Cellular mechanism of gain-of-function mutation I173M in sheep MC4R gene identified in year-round and seasonal estrus breeds through whole-genome resequencing

Cellular mechanism of gain-of-function mutation I173M in sheep MC4R gene identified in year-round and seasonal estrus breeds through whole-genome resequencing | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Cellular mechanism of gain-of-function mutation I173M in sheep MC4R gene identified in year-round and seasonal estrus breeds through whole-genome resequencing Xianyong Lan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4513754/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Investigating the key genes and mutations regulating year-round estrus can enhance the reproductive performance of sheep, thereby boosting sheep industry efficiency. In this study, we employed genomic research methods to analyze whole-genome resequencing data from 392 sheep, including six year-round estrus breeds and ten seasonal estrus breeds. Here we show the Melanocortin 4 receptor (MC4R) gene as a significant player in the regulation of year-round estrus in sheep. Specifically, I173M (g.59480440G > C, P.Ile173Met), demonstrating potential relevance to sheep estrus, was identified in MC4R. The mutation frequency of this variant was higher in year-round estrus breeds than in seasonal estrus breeds, suggesting it could be a crucial functional mutation affecting sheep estrus. Transcriptome sequencing analysis indicated that genes differentially expressed after transfection with the M173 receptor were enriched in pathways related to reproduction such as GnRH signaling pathway and Ovarian steroidogenesis. Subsequent functional exploration revealed that the I173M mutation enhanced cAMP and MAPK/ERK signal transduction activation, increased receptor constitutive activity, and significantly improved receptor function. Consequently, we posit that MC4R is involved in regulating year-round estrus and the I173M mutation in the MC4R gene identified as a pivotal functional mutation influencing year-round estrus in sheep. Biological sciences/Genetics/Animal breeding Biological sciences/Genetics/Gene expression Year-round Estrus MC4R Functional mutation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Mammals typically exhibit a seasonal reproductive pattern, leading to a pronounced imbalance in the supply of animal products throughout the year 1 , 2 . Seasonal estrus in sheep serves as a classic example of this phenomenon. Mammalian estrus can be classified into short-day breeders and long-day breeders, with sheep categorized as short-day breeders, primarily displaying estrus during the autumn and winter seasons 3 . While this seasonal estrus ensures favorable environmental conditions for offspring survival, it also results in an extended anestrous period, challenging successful mating and diminishing reproductive efficiency 4 . Reproductive efficiency stands as a critical factor in the economic viability of sheep farming, yet the seasonality of estrus remains a pivotal constraint to the industry's progress. The estrous cycle is a crucial factor influencing the reproductive efficiency of sheep. Year-round estrus, characterized by the absence of seasonal constraints, represents a substantial enhancement in production efficiency. Consequently, the exploration of key genes associated with seasonal estrus and the investigation of the molecular mechanisms underpinning seasonal estrus in sheep are of paramount importance for augmenting their reproductive capabilities. Sheep reproduction is primarily regulated by the Pineal-Hypothalamus-Pituitary-Ovary (PHPO) axis, with its secreted reproductive hormones exhibiting seasonal fluctuations, influenced by photoperiodic changes (seasonal variations) 5 – 8 . In sheep, light signals received by the retina trigger changes in melatonin secretion within the pineal gland, initiating a regulatory process involving melatonin receptors and influencing the regulation of the Thyroid-Stimulating Hormone (TSH)-Dio and KISS1 - GPR54 receptor (kisspeptin- GPR54 ) systems 3 . This regulatory process, achieved through the modulation of hormone secretion, ultimately governs reproductive activities. Due to the seasonality of estrus, there is research suggesting that circadian rhythm genes may influence the seasonal reproduction of sheep 9 . This includes genes such as Clock , BMAL1 , Per1 , Per2 , Cry1 and Cry2 , which are believed to potentially affect seasonal estrus 10 , 11 . Transcriptomic sequencing has been employed to analyze tissues, for instance, the hypothalamus, pituitary, and ovary tissues of seasonal and non-seasonal reproductive sheep 12 – 14 , revealing candidate genes such as MTNR1A 15 , GNAQ 16 and SEMA7A 13 linked to sheep estrus. These genes may play crucial roles in regulating the seasonal reproductive processes in sheep, offering valuable clues for unraveling the mechanisms behind seasonal reproduction. However, due to the complexity of estrus as a trait, the physiological processes involved are influenced by genetics, external factors, and the environment, making it challenging to perform functional validation of candidate genes. The manifestation of year-round estrus in certain sheep breeds is a consequence of rigorous human selection, possibly driven by the selection for specific major-effect genes and critical mutations. In sheep, breeds such as Hu sheep, Large Tail Han sheep, and Cele black exhibit year-round reproductive behaviors 17 – 19 . In contrast, Tibetan sheep and Tan sheep develop their gonads at specific times of the year and demonstrate seasonal reproductive behaviors 5 , 15 . Therefore, using both year-round and seasonal estrus sheep breeds as models can facilitate a more comprehensive investigation into the molecular mechanisms underlying seasonal reproduction in sheep. Genomic research offers a new approach by establishing a direct link between phenotypes and genetics, providing a fresh perspective on the study of complex traits. This study conducted genomic analysis using GWAS data from a total of 392 sheep, including 6 breeds exhibiting year-round estrus and 10 breeds displaying seasonal estrus to identify candidate genes associated with year-round estrus in sheep and to perform functional validation of single nucleotide polymorphism (SNP) sites. This research holds significant importance in overcoming limitations associated with controlling the seasonality of sheep estrus through selective breeding, ultimately contributing to the improvement of the reproductive performance of sheep. Results The screening of candidate genes for year-round estrus in sheep To identify selection signals associated with year-round estrus in sheep at the whole-genome level, this study utilized whole-genome resequencing data from 6 year-round estrus breeds and 10 seasonal estrus breeds, encompassing a total of 392 sheep. The PCA results revealed a well-defined clustering of individuals within each breed, indicating the suitability of these data for subsequent analysis (Fig. S1A). FST analysis and GWAS analysis were conducted between the year-round estrus and seasonal estrus breeds. Gene annotation of the top 1‰ significant loci revealed genes associated with lambing ( BMPR1B ), horn type ( RXFP2 ), tail type ( PDGFD ), immunity ( ADAR ), tail length ( TBXT ), coat color ( KIT ), and year-round/seasonal estrus (Melanocortin 4 receptor, MC4R ) (Fig. 1 A and Fig. 1 B). Notably, this study discovered a highly selected region in the MC4R gene region on chromosome 23, with the strongest selection signal. Through gene annotation, a missense mutation I173M (g.59480440G > C, P.Ile173Met) in the MC4R region on chromosome 23 was identified as the strongest selected site, showing significant frequency differences between year-round estrus and seasonal estrus breeds, with a higher frequency of the mutant type in year-round estrus breeds(Fig. 1 C and Fig. 1 D). This mutation might influence the year-round estrus trait in sheep. The expression of the MC4R gene in various tissues of sheep was comparatively analyzed using the Animal Genetics and Genomics Database ( http://animal.omics.pro ). The results revealed that MC4R is expressed in reproductive-related tissues, such as the epididymis, oviduct, vas deferens, uterus, cervix, and thyroid (Fig. 1 E). Additionally, we scanned single nucleotide polymorphisms (SNPs) in the MC4R gene across the 16 sheep breeds (Table S1), and the frequencies of these mutations in these breeds are shown in Fig. S1B. Conservation and mutation site analysis of the candidate gene MC4R associated with year-round estrus in sheep The results of the conservative analysis of the MC4R protein in 13 vertebrate species indicate that MC4R is highly conserved across different species, with conservation levels exceeding 90% in animals such as goats, sheep, and pigs. Additionally, the similarity between sheep MC4R protein and human MC4R protein is 92.77% (Fig. 2 A). The analysis of the conservation of the Ile amino acid at position 173 in the sheep MC4R across different species showed that this site was highly conserved, indicated that mutation at this position may have an impact on protein function (Fig. 2 B). Subsequently, we employed PCR primers for MC4R amplification (F: TCAGTCAGTCCAGAGGGGAC, R: TGTGTTTAGCATCGCGTTTG) to validate the sequenced site. The sequencing results for the mutation site are shown in the Fig. 2 C. The PyMol v7.0.1 software was used for protein three-dimensional structure prediction of the missense mutation. Introducing the M173 amino acid revealed a change in the three-dimensional structure of the MC4R protein (Fig. 2 D). This suggests that the mutation may impact the function of the MC4R protein. Further prediction through the online tool ( http://wlab.ethz.ch/protter/start/ ) indicated that the missense mutation g.59480440G > C is located in the fourth transmembrane domain (TM4) of the MC4R protein (Fig. 2 E). Previous studies have demonstrated the crucial importance of the third and fourth transmembrane domains of MC4R for its binding 20 . Hence, it is inferred that this mutation may potentially impact the functionality of receptor. The I173M mutation in sheep does not impact the localization and expression of MC4R To investigate whether the I173M mutation alters the expression of MC4R on the cell membrane, we transfected HEK293T cells with WT and M173 recombinant vectors and assessed the protein expression level of MC4R. The electrophoresis results demonstrated that the I173M mutation does not affect the expression level of MC4R protein (Fig. 3 A). To further evaluate the impact of the mutation on MC4R expression, we used flow cytometry to detect the surface expression of WT and M173 proteins in HEK293T cells. There was no significant difference in the expression levels of WT and M173 receptors on the cell membrane ( P > 0.05, Fig. 3 B). Previous studies have shown that MC4R is localized on the cell membrane and undergoes continuous endocytosis and recycling 21 . Immunostaining of HEK293T cells expressing the two recombinant plasmids revealed that both WT and M173 MC4R s are normally expressed on the cell membrane without permeabilization. After permeabilization, both receptors were successfully transported to the intracellular membrane, indicating that the mutation does not affect receptor localization and trafficking on the cell membrane (Fig. 3 C). These results suggest that the I173M mutation does not significantly alter the expression or localization of MC4R on the cell membrane. The transcriptional regulation of sheep MC4R I173M mutant Subsequently, WT and M173 MC4R plasmids were transfected into HEK293T cells, followed by sample collection for transcriptome sequencing to investigate differentially expressed genes (DEGs) and their associated pathways. After filtering the transcriptome sequencing results, 53 DEGs were identified, with 26 significantly upregulated and 27 significantly downregulated genes (Fig. 4 A). Among them, genes such as NR4A2 , IL5RA , and CAMK2A showed upregulation in cells transfected with the M173 plasmid (Fig. 4 B). GO analysis results indicated that DEGs were enriched in biological processes such as aminomuconate-semialdehyde dehydrogenase activity, interleukin-5 receptor activity, follicle-stimulating hormone secretion, signaling receptor ligand activity and receptor activator activity (Fig. 4 C). Using the KEGG database for pathway enrichment analysis of DEGs, the most significantly enriched pathways included the GnRH signaling pathway, Aldosterone synthesis and secretion, Necroptosis, Ovarian steroidogenesis, Wnt signaling pathway (Fig. 4 D). It is worth noting that the cAMP signaling pathway and MAPK signaling pathway of MC4R are also significantly enriched (Fig. 4 D). Certainly, follow-up studies can be undertaken to delve deeper into the implications of these DEGs and pathways. Here, we mainly focus on the regulation of cAMP signaling pathway and MAPK signaling pathway by the M173 MC4R receptor. The I173M mutation amplifies the constitutive activity and activates cAMP signaling in the MC4R receptor MC4R mainly couples to the G-protein G S and it is well-established that binding of Pro-opiomelanocortin (POMC)-derived peptides (α-/β-MSH [melanocyte-stimulating hormone]) to membrane-bound MC4R activates G proteins (Gαs) and stimulates the production of cyclic AMP (cAMP) 21 , 22 . Wild-type MC4R exhibits basal (constitutive) activity, and naturally occurring mutations have been identified that result in either increased or decreased basal activities 23 . The transfection of HEK293T cells with pGL4.29, pEGFP-N1, and WT/M173 MC4R , followed by the evaluation of constitutive activity (cAMP basal level) using a dual luciferase reporter gene assay in the absence of agonist stimulation (Fig. 5 A), revealed a significant increase in cAMP basal level by the WT MC4R receptor compared to pcDNA3.1 ( P < 0.05, Fig. 5 B). Moreover, the M173 mutant receptor exhibited significantly increased basal activity compared to the WT receptor ( P < 0.05). Subsequent evaluation of the signal transduction capacity of the receptors before and after mutation involved stimulating cells expressing recombinant WT and M173 MC4R vectors with six concentrations of α-MSH /β-MSH (ranging from 10 − 5 to 10 − 10 ) and assessing receptor signal transduction ability using a dual luciferase reporter gene assay (Fig. 5 A). The data obtained from concentration-response experiments (all concentration-response curves for two receptors and the two ligands are presented in Fig. 5 C and Fig. 5 F) were subjected to fitting non-linear regression models to calculate the response value of each ligand at the receptor mutation (Rmax) and the potency of the ligand at the receptor mutation (EC 50 ). The cAMP activity of the M173 MC4R increased fourfold compared to that of WT MC4R upon stimulation with the α-MSH ligand (Fig. 5 D), and the Rmax of M173 receptor to cAMP increased significantly (P < 0.01, Fig. 5 E, Table 2 ). After using β-MSH stimulation, the results were found to be consistent with those of α-MSH stimulation (Fig. 5 G and Fig. 5 H). Specifically, the EC 50 value of β-MSH in activating cAMP activity of the I173M MC4R (0.05 ± 0.02µM) was significantly lower than that of the WT MC4R (0.46 ± 0.07µM) (Table 2 ). It turns out that M173 MC4R increased ligand-induced cAMP signaling activation. The I173M mutation in MC4R mediates enhanced MAPK/ERK signal activation MC4R is known to activate the p44/42 mitogen-activated protein kinases (MAPK), also referred to as extracellular signal-regulated kinases 1 and 2 (ERK1/2). The activation of the ERK1/2 pathway is considered a potential cellular mechanism involved in regulating MC4R 24 – 26 . To evaluate the activation of MAPK/ERK by both the WT and I173M mutant forms of MC4R , we employed a dual-luciferase reporter gene experiment using the ERK pathway reporter gene vector pSRE-luc. HEK293T cells were transfected with pGL4.33, pEGFP-N1, and either WT or M173 MC4R , followed by stimulation with six concentrations of α-MSH/β-MSH (Fig. 5 A). Both receptors exhibited dose-dependent responses to varying concentrations of α-MSH/β-MSH (Fig. 5 I and 5 L). Analysis of EC 50 values revealed that the M173 MC4R enhanced ligand-induced MAPK/ERK signaling activation. Specifically, the EC 50 value of α-MSH in activating the M173 MC4R (0.26 ± 0.03µM) was significantly lower than that of the WT MC4R (0.98 ± 0.03µM) ( P < 0.05, Fig. 5 J). This indicated a fourfold increase in activation efficiency, while the Rmax value did not show significant change (Fig. 5 K). There was no significant difference in EC 50 values upon stimulation with β-MSH in terms of MAPK/ERK (Fig. 5 M). However, Rmax value of the M173 MC4R showed a substantial increase ( P < 0.05, Fig. 5 N). Specific EC 50 and Rmax values was shown in Table 2 . Together, these data suggest that the sheep MC4R I173M mutation enhances cAMP signal transduction activation, increases receptor basal activity, and promotes the activation of MAPK/ERK signaling. The I173M mutation significantly enhances the functionality of the mutated receptor, establishing it as an important functional variant in the regulation of estrus in sheep. Discussion Seasonal estrus poses a significant constraint on the reproductive capacity of sheep. Investigating the regulatory mechanisms of year-round estrus in sheep is crucial for enhancing their reproductive efficiency. Through a genomic approach, utilizing comprehensive sheep whole-genome resequencing data and estrus information, and employing methodologies like selective signal detection and association analysis, we provide strong evidence that MC4R is a novel candidate gene for year-round estrus in sheep, particularly through the I173M mutation site which may potentially influence the traits associated with year-round estrus in sheep. The C allele of rs571312 and the G allele of rs12970134 in the MC4R gene have been found to be linked with precocious puberty among girls suffering from obesity 27 . Previous studies have revealed disruptions in follicular dynamics and a reduction in corpus luteum count in MC4R knockout mice. The regularity of the estrous cycle in mice is significantly influenced by genetic factors, as evidenced by the pronounced impact of MC4R knockout on the rhythmicity of the mouse estrous cycle 28 . Similarly, in rats, MC4R has been shown to impact the secretion of luteinizing hormone (LH), potentially influencing the estrous cycle 29 . Quantitative analysis of MC4R expression in the hypothalamus of female rats at different estrous stages indicates elevated expression during the pre-estrus phase, followed by downregulation during estrus, post-estrus, and diestrus 30 . These results suggest that the upregulation of MC4R expression may be associated with the pre-ovulatory surge in gonadotropin-releasing hormone (GnRH) and LH, further substantiating the involvement of MC4R in the regulation of the female's estrous cycle. In sheep, existing studies have linked MC4R to growth traits, meat quality characteristics, and feed intake 31 – 33 , but till now, no reported research explored it the association with estrus in sheep. The KISS1 - GPR54 / TSHR - DIO2 / DIO3 signaling pathway has been linked to year-round estrus in sheep 3 , and the co-location of MC4R and the long-day reproductive gene kisspeptin in the arcuate nucleus (ARC) of sheep suggests a potential role for MC4R in promoting year-round estrus 34 . Previous studies have shown that MC4R expressed in HEK293T cells can be stimulated to activate transcription by melanocortin analogues at different concentrations, allowing exploration of its regulation of downstream signaling pathways 35 . Given the high degree of conservation between sheep MC4R and human MC4R protein, we conducted further research on the regulatory effects of sheep MC4R I173M in HEK293T cells. The analysis shows that the variant does not affect total protein expression and receptor internalization. Transcriptome sequencing results revealed that the biological processes of signaling receptor ligand activity and receptor activator activity were enriched, and cAMP signaling pathway and MAPK signaling pathway were significantly enriched after transfected with M173 MC4R plasmid. In consistency with these results, our study identified MC4R gene I173M mutation as a functionally acquired mutation, enhancing the basal activity of the mutated receptor and upregulating the cAMP and MAPK/ERK signaling pathways. Additionally, reproduction-related pathways, such as GnRH signaling pathway and Ovarian steroidogenesis pathways, were significantly enriched, suggesting an influence on the hypothalamic-pituitary-ovarian axis and influencing hormone secretion in animals. Furthermore, previous research has suggested that obesity can affect various aspects of female reproductive capability, including oocyte growth and development, ovulation, endometrial growth, embryo development, and embryo implantation, ultimately influencing estrus 36 – 38 . Previous studies have shown that the MC4R gene I173M mutation can significantly increase gene transcriptional activity 39 . The I173M mutation has been associated with the adult height of Hu sheep and has effects on gene transcriptional activity, with the homozygous wild type linked to higher body weight 39 . Functional gain-of-function mutations in MC4R can prevent obesity and exhibit favorable metabolic characteristics, potentially serving as crucial factors influencing sheep estrus. Therefore, the I173M mutation may impact hormone secretion and energy metabolism, affecting sheep estrus. This study leverages sequencing data from both year-round and seasonal estrus sheep, establishing a significant association between the novel candidate gene MC4R and its I173M mutation with estrus traits in sheep. Significantly, it marks the first exploration of the cellular mechanisms underlying the I173M mutation in the sheep MC4R gene. Mechanistically, this mutation induced an augment basal activity of the MC4R receptor, enhancing the efficiency of binding between the mutated receptor and agonists (α-MSH, β-MSH) is enhanced. This indicates a functionally acquired mutation that may strengthen the regulatory role of the MC4R receptor in estrus (Fig. 6 . Graphical summary). While recognizing the pivotal role of the MC4R gene in year-round estrus in sheep, it is crucial to acknowledge that it is not the sole determination of this reproductive trait. Other contributing elements such as other genes 16 , hormone levels 40 , and nutritional status 41 collectively impact estrus traits in sheep. Given the complexity of estrus traits, our current study lacks direct evidence of MC4R regulating sheep estrus. Further research and functional validation of MC4R are essential to gain additional insights. Potential ways could include experiments to detect hormone levels after activating MC4R receptors in vivo, overexpressing the MC4R gene in sheep ovarian granulosa cell lines to explore its function, and conducting transcriptomic and metabolomic sequencing analyses on tissues from sheep with different genotypes of the I173M mutation. After supplementing these experiments, the regulatory role of the MC4R gene and its I173M mutation in the year-round estrus of sheep will become more concrete. In summary, our research results confirm the previously unrecognized role of the MC4R gene in year-round estrus in sheep. We found that the I173M mutation in this gene is associated with estrus traits in year-round estrus breeds. This discovery contributes to a deeper understanding of the functionality of MC4R and holds significant implications for enhancing the reproductive performance of seasonally estrous sheep. Materials and Methods In accordance with animal welfare requirements, all the animal experiments in this study were consistent with relevant national legal and ethical principles. Our study was approved by the Institutional Animal Care and Use Committee of Northwest A&F University (IACUC-NWAFU). Animal and Sample Collection The whole-genome sequencing data were collected from both year-round estrus and seasonally estrus sheep. A total of 160 year-round estrus individuals from 6 breeds and 232 seasonally estrus individuals from 10 breeds were downloaded from NCBI SRA database ( https://www.ncbi.nlm.nih.gov/sra/ ) for further research. Detailed information is provided in Table 1 . Reads mapping and SNPs calling The raw FASTQ files underwent quality filtering using the fastp (v0.20.0) 42 . BWA-MEM software (v0.7.17) was employed to align the genome data to the sheep reference genome (ARS-UI_Ramb_v2.0) 43 . SAMTOOLS software (v1.7) was used to convert SAM files to BAM files 44 . The variants calling were performed using GATK (version 4.1.7.0). VCFTOOLS (version 0.1.16) was used to filter SNPs data, and only biallelic SNPs were retained. SNPs with minimum allele frequency greater than 0.05 and missing ratio less than 0.1 were selected for subsequent analysis. FST Analysis VCFTOOLS (version 0.1.16) was used to detect the genome-wide selection signatures using SNPs loci. The table_annovar.pl module of ANNOVAR was used for functional annotation for each SNP 45 . GWAS Analysis In this study, perennial estrus and seasonal estrus characteristics were treated as binary variables (0 or 1). The EMMA software was used for GWAS analysis on perennially estrous and seasonally estrous sheep 46 . PLINK (v1.90b7) was used for preliminary data processing and principal component analysis (PCA) calculation. The first three principal components (PC1, PC2, PC3) from PCA, explaining 13.639%, 7.322%, and 5.418% of the effect values, were used as corrected fixed effects. The emmax-kin module of EMMA was used to calculate the relationship as a covariance. Personal python scripts were employed for result visualization. In vitro mutagenesis of MC4R The coding regions of wild-type (WT) and mutant sheep MC4R were sub-cloned into the pcDNA3.1 (+) vector from Invitrogen (Carlsbad, CA, USA). The WT and M173 3×Myc-tagged MC4R vectors were synthesized by Nanjing GenScript Corporation. Plasmids for transfection were prepared using the Endofree Plasmid Maxi Kit from TianGen Biotech. DNA sequencing was conducted to verify the correctness of the full coding region. Cell culture and luciferase reporter assay This study utilized the luciferase reporter system to investigate the activation of downstream signals through MC4R by two ligands. The luciferase reporter vectors employed were pGL4.29 from Promega (Madison, WI, USA), containing cAMP response element (CRE) in the promoter regions for monitoring cAMP activation, and pGL4.33 plasmid with serum response element (SRE) sequences for detecting MAPK/ERK signaling pathway activation 47 , 48 . Human embryonic kidney (HEK) 293T cells were grown at 5% CO 2 in DMEM supplemented with 10% fetal bovine serum, and 100 units/ml of penicillin and 100 µg/ml streptomycin. The brief operating procedure was as follows: the HEK293T cells were passaged to a 6-well plate 24 h before transfection. Then, a mixture containing 1000ng luciferase reporter vector, 500ng WT or mutant sheep MC4R expression plasmid (or empty pcDNA3.1 plasmid), 300ng pEGFP-N1 (as the internal control for transfection normalization), and 4 µL PEI transfection reagent (Fusheng Biotechnology, Shanghai, China) was used to transfect these cells. The transfected cells continued to grow in the original medium for 24 h, then they were pipetted down and transferred to a 48-well plate to grow for another 24 h to reach a density of 2 × 10 5 cells per well. The agonists α-MSH and β-MSH were obtained from GenScript Biotechnology (Nanjing, China). The α-MSH and β-MSH were diluted to working concentration in serum-free medium, and then added to the 48-well plate to treat cells for 6 h. After processing, the cells were lysed with 1 × passive lysis buffer (YEASEN, Shanghai, China), and the luciferase substrate was added for reaction. For each assay, two additional 48-well plates (n = 3) were used as technical replicates and data were shown as Mean ± SEM. Western blot After transfecting HEK293T cells with WT or M173 MC4R plasmids (or empty pcDNA3.1 plasmid) for 24 hours, cells were stimulated with 10 − 5 M α-MSH for 15 minutes. The control group was treated with serum-free medium for 15 minutes. The cultured cells were lysed in RIPA buffer containing 1% PMSF and 2% phosphatase inhibitors. After centrifugation, the supernatant was collected, mixed with protein loading buffer at a 3:1 ratio, and subjected to protein denaturation at 100℃ in a constant temperature metal bath for 10 minutes. Following SDS-PAGE gel electrophoresis separation of 20ng protein samples, the proteins were wet-transferred onto a PVDF membrane. The membrane was then blocked at room temperature for 2 hours using a 5% skim milk solution. Primary antibodies, Myc (1:2000) and β-actin (1:5000), were incubated overnight at 4℃. After washing with TBST for 3 hours, each wash lasting 5 minutes, the membrane was incubated with secondary antibodies (1:10000) for 2 hours on a shaker. Subsequent to another 3 washes with TBST, chemiluminescent ECL reagent was applied, and the membrane was scanned using a chemiluminescence imager. ImageJ software was used for grayscale analysis of bands, with relative expression levels of the target bands calculated by comparing grayscale values with β-actin protein bands. Immunofluorescence HEK293T cells were seeded onto glass coverslips in 12-well plates and transfected with 500 ng of WT or M173 MC4R plasmids. After 24 hours of transfection, the cells were fixed with 4% formaldehyde in PBS for 10 minutes at room temperature. They were then washed three times for 5 minutes each with phosphate-buffered saline (PBS). Next, the cells were permeabilized with 0.1% Triton X-100 in PBS for 5 minutes. Following permeabilization, a blocking step was performed by incubating the cells with 5% bovine serum albumin (BSA) for 1 hour. After blocking, the cells were incubated overnight at 4°C with Myc-Tag (19C2) Mouse mAb antibody (Abmart) at a dilution of 1:200 in BondTM primary antibody diluent. The next day, the cells were washed with PBS to remove unbound primary antibodies. Then, they were incubated with a fluorescently labeled secondary antibody, iFluor 488 (HA1125), at a dilution of 1:500. This incubation was performed in a dark environment for 2 hours. After the secondary antibody incubation, the cells were washed to remove unbound secondary antibodies. Finally, Hoechst 33342 dye was added for nuclear staining, and the cells were incubated with the dye for 20 minutes. Slides were imaged using a confocal microscope and images processed using FIJI. Results are from three independent experiments. Flow cytometry assay The flow cytometry assay to quantitate the expression levels of MC4R involved the following steps: Cells were plated into a six-well plate and prepared by washing with PBS. The cells were then fixed with 4% paraformaldehyde and incubated with a blocking solution (5% BSA). After blocking, the cells were incubated with Myc-Tag (19C2) Mouse mAb antibody (dilution 1:200) for 1 hour. Subsequently, the cells were washed and incubated with a fluorescently labeled secondary antibody, iFluor 488 (dilution 1:500) for 2 hours. Flow cytometry analysis was performed using a C6 flow cytometer to measure the fluorescence emitted by the cells. The expression levels of the MC4R variants were calculated as a percentile of WT expression using a specific formula 49 . The entire assay was conducted at room temperature. RNA-sequencing and bioinformatic analyses HEK293T cells were seeded onto glass coverslips in plates and transfected with WT and M173 MC4R constructs for transcriptome sequencing, total RNA was extracted from by TRIzol (Invitrogen) following the standard protocol. The transcriptome sequencing was performed by Guangzhou GENE DENOVO Biotechnology Co., Ltd, and the NOISeq method was used to identify differentially expressed genes (DEGs) between the two groups with Fold change R2 and diverge probability R0.8, as described by Tarazona et al 50 Gene Ontology (GO) and pathway annotation and enrichment analyses were conducted using the Gene Ontology Database ( http://www.geneontology.org/ ) and the KEGG pathway database ( http://www.genome.jp/kegg/ ), respectively. Statistical analysis EC 50 values were calculated using Prism software version 4 (GraphPad Software). Statistical calculations were performed by SPSS software ver. 23.0. For comparisons on EC 50 , an unpaired T-test was used. Declarations Acknowledgments This study was supported by the sub-project of the National Key Research and Development Program during the 14th Five-Year Plan (Grant No. 2022YFF1000100). Author Contributions Yuta Yang: Contributed to formal analysis, software implementation, investigation, and original draft writing, Engaged in reviewing and editing the manuscript; Yuxin Kang: Participated in formal analysis, software development, and investigative efforts; Chunna Cao: Oversaw project administration and took part in its conceptualization; Peiyao Liu: Participated in formal analysis, software development, and investigative efforts; Yang Li: Participated in formal analysis, software development; Ran Li : Participated in formal analysis, software development; Qingfeng Zhang: participated in reviewing and editing the manuscript; Chuanying Pan and Xianyong Lan: Exercised supervision over the project, engaging in conceptualization, validation, funding acquisition, project administration, and participated in reviewing and editing the manuscript. Declaration of competing interest The authors declare no conflict of interest. Data availability The datasets supporting the conclusions of this article are included within the article and its additional file. References de Carvalho NA, Soares JG, Baruselli PS. Strategies to overcome seasonal anestrus in water buffalo. Theriogenology . 86 ,200-206(2016). Chemineau P. et al. Seasonality of reproduction in mammals: intimate regulatory mechanisms and practical implications. Reprod Domest Anim. 2008;43 Suppl 2:40-47. Xia Q. et al. [The molecular mechanism of sheep seasonal breeding and artificial regulatory techniques for estrus and mating in anestrus]. Yi. Chuan. 40 ,369-377(2018). Li X. et al. Analysis of pituitary transcriptomics indicates that lncRNAs are involved in the regulation of sheep estrus. Funct. Integr. Genomics . 20 ,563-573(2020). Wei S. et al. Analysis of reproduction-related transcriptomes on pineal-hypothalamic-pituitary-ovarian tissues during estrus and anestrus in Tan sheep. Front. Vet. Sci . 9 ,1068882(2022). He X. et al. Transcriptomic Changes of Photoperiodic Response in the Hypothalamus Were Identified in Ovariectomized and Estradiol-Treated Sheep. Front. Mol. Biosci. 9 ,848144(2022). Kopycińska K, Wojtulewicz K, Herman AP, Tomaszewska-Zaremba D. The Effect of Photoperiodic Conditions on GnRH/LH Secretion in Ewes. Animals (Basel) . 12 ,283(2022). Dardente H. et al. Photoperiod, but not progesterone, has a strong impact upon the transcriptome of the medio-basal hypothalamus in female goats and ewes. Mol. Cell. Endocrinol. 588 ,112216(2024). Lincoln G, Messager S, Andersson H, Hazlerigg D. Temporal expression of seven clock genes in the suprachiasmatic nucleus and the pars tuberalis of the sheep: evidence for an internal coincidence timer. Proc. Natl. Acad. Sci. U S A . 99 ,13890-13895(2002). Matthews CD, Guerin MV, Deed JR. Melatonin and photoperiodic time measurement: seasonal breeding in the sheep. J. Pineal. Res . 14 ,105-116(1993). Han Q, He X, Di R, Chu M. Comparison of expression patterns of six canonical clock genes of follicular phase and luteal phase in Small-tailed Han sheep. Arch. Anim. Breed. 64 ,457-466(2021). Zhong Y, Di R, Yang Y, Liu Q, Chu M. Transcriptome Analysis of Neuroendocrine Regulation of Ovine Hypothalamus-Pituitary-Ovary Axis during Ovine Anestrus and the Breeding Season. Genes (Basel) . 12 ,18 61(2021). Du X. et al. Comparative Transcriptomics Reveals the Key lncRNA and mRNA of Sunite Sheep Adrenal Gland Affecting Seasonal Reproduction. Front. Vet. Sci. 9 ,816241(2022). Di R. et al. Characterization and comparative profiling of ovarian microRNAs during ovine anestrus and the breeding season. BMC. Genomics . 15 ,899(2014). Yang D. et al. Expression and role of melatonin membrane receptors in the hypothalamic-pituitary-testicular axis of Tibetan sheep in a plateau pastoral area. PLoS. One . 18 , e0290775(2023). Zhu M. et al. Targeting GNAQ in hypothalamic nerve cells to regulate seasonal estrus in sheep. Theriogenology . 181 ,79-88(2022). Yuan Z. et al. Association of Polymorphisms in Candidate Genes with the Litter Size in Two Sheep Breeds. Animals (Basel) . 9 ,958(2019). Li C. et al. Comparative proteomics of ovaries elucidated the potential targets related to ovine prolificacy. Front. Vet. Sci. 10 ,1096762(2023). Tao YX. Constitutive activity in melanocortin-4 receptor: biased signaling of inverse agonists. Adv. Pharmacol. 70 ,135-154(2014). Wang J. et al. Comprehensive Analysis of Differentially Expressed CircRNAs in the Ovaries of Low- and High-Fertility Sheep. Animals (Basel) . 13 ,236(2023). Yang Y. et al. Molecular determination of agouti-related protein binding to human melanocortin-4 receptor. Mol. Pharmacol . 64 , 94-103(2003). Cooney KA, Molden BM, Kowalczyk NS, Russell S, Baldini G. Lipid stress inhibits endocytosis of melanocortin-4 receptor from modified clathrin-enriched sites and impairs receptor desensitization. J. Biol. Chem. 292 ,17731-17745(2017). Mo XL, Tao YX. Activation of MAPK by inverse agonists in six naturally occurring constitutively active mutant human melanocortin-4 receptors. Biochim. Biophys. Acta. 1832 ,1939-1948(2013). Schwartz MW, Woods SC, Porte D Jr, Seeley RJ, Baskin DG. Central nervous system control of food intake. Nature . 404 ,661-671(2000). Daniels D, Patten CS, Roth JD, Yee DK, Fluharty SJ. Melanocortin receptor signaling through mitogen-activated protein kinase in vitro and in rat hypothalamus. Brain. Res. 986 ,1-11(2003). Chen X. et al. Deficient melanocortin-4 receptor causes abnormal reproductive neuroendocrine profile in female mice. Reproduction . 153 ,267-276(2017). Vongs A, Lynn NM, Rosenblum CI. Activation of MAP kinase by MC4-R through PI3 kinase. Regul. Pept. 120 ,113-118(2004). Chai B, Li JY, Zhang W, Newman E, Ammori J, Mulholland MW. Melanocortin-4 receptor-mediated inhibition of apoptosis in immortalized hypothalamic neurons via mitogen-activated protein kinase. Peptides . 27 ,2846-2857(2006). Zandi MR. et al. Hypothalamic Expression of Melanocortin-4 Receptor and Agouti-related Peptide mRNAs During the Estrous Cycle of Rats. Int. J. Mol. Cell. Med. 3 ,183-189(2014). Xue P. et al. Association of obesity and menarche SNPs and interaction with environmental factors on precocious puberty. Pediatr. Res. 10.1038/s41390-024-03168-6(2024). Sandrock M. et al. Reduction in corpora lutea number in obese melanocortin-4-receptor-deficient mice. Reprod. Biol. Endocrinol. 7 ,24(2009). Sartin JL, Daniel JA, Whitlock BK, Wilborn RR. Selected hormonal and neurotransmitter mechanisms regulating feed intake in sheep. Animal . 4 ,1781-1789(2010). Hernández-Herrera DY, Carrillo-González DF, Rincón-Flórez JC. Association of the MC4R gene with growth traits and meat quality in Colombian hair sheep. J. Adv. Vet. Anim. Res. 10 ,449-457(2023). Shishay G. et al. Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep. Int. J. Mol. Sci. 20 ,240(2019). Merkley CM, Shuping SL, Sommer JR, Nestor CC. Evidence That Agouti-Related Peptide May Directly Regulate Kisspeptin Neurons in Male Sheep. Metabolites . 11 ,138(2021). Kim CS. et al. Identification of domains directing specificity of coupling to G-proteins for the melanocortin MC3 and MC4 receptors. J. Biol. Chem . 277, 31310-31317(2002). Frisch RE, Hegsted DM, Yoshinaga K. Body weight and food intake at early estrus of rats on a high-fat diet. Proc. Natl. Acad. Sci. U S A. 72 ,4172-4176(1975). Broughton DE, Moley KH. Obesity and female infertility: potential mediators of obesity's impact. Fertil. Steril. 107 ,840-847(2017). Armstrong A, Berger M, Al-Safi Z. Obesity and reproduction. Curr. Opin. Obstet. Gynecol. 34 ,184-189(2022). Shan HL. et al. Association of the melanocortin 4 receptor (MC4R) gene polymorphism with growth traits of Hu sheep. Small. Ruminant. Research. 192 . 10.1016/j.smallrumres.2020.106206(2020). Soto R, Terrazas A, Poindron P, González-Mariscal G. Regulation of maternal behavior, social isolation responses, and postpartum estrus by steroid hormones and vaginocervical stimulation in sheep. Horm. Behav. 136 ,105061(2021). Schillo KK. Effects of dietary energy on control of luteinizing hormone secretion in cattle and sheep. J. Anim. Sci. 70 ,1271-1282(1992). Chen S, Zhou Y, Chen Y, Gu J. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics . 34 , i884-i890(2018). Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics . 25 ,1754-1760(2009). Li H. et al.1000 Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools. Bioinformatics . 25 , 2078-2079(2009). Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic. Acids. Res . 38 , e164(2010). Kang HM. et al. Variance component model to account for sample structure in genome-wide association studies. Nat. Genet. 42 ,348-354(2010). Glas E, Mückter H, Gudermann T, Breit A. Exchange factors directly activated by cAMP mediate melanocortin 4 receptor-induced gene expression. Sci. Rep . 6 ,32776(2016). You L, Kruse FE, Bacher S, Schmitz ML. Lipoteichoic acid selectively induces the ERK signaling pathway in the cornea. Invest. Ophthalmol. Vis. Sci . 43 ,2272-2277(2002). Yan Y. et al. The c.612A>G mutation of MC4R affects constitutive activity and signaling in domestic goats. Anim. Genet. 53 , 665-675(2022). Tarazona S, García-Alcalde F, Dopazo J, Ferrer A, Conesa A. Differential expression in RNA-seq: a matter of depth. Genome. Res . 21 ,2213-2223(2011). Tables Table 1. Sample information Breeds Abbreviations Estrus type Number Cele black sheep CLB year-round estrus 40 Hu sheep HUS year-round estrus 50 Large Tail Han sheep LTH year-round estrus 12 Sishui fur sheep SSS year-round estrus 11 Small Tail Han sheep STH year-round estrus 29 Wadi sheep WDS year-round estrus 18 Bayinbuluke sheep BYK seasonal estrus 31 Diqing sheep DQS seasonal estrus 13 Chaka sheep CKS seasonal estrus 10 Tan sheep TAN seasonal estrus 38 Tengchong sheep TCS seasonal estrus 9 Tibetan sheep TIB seasonal estrus 50 Waggir Sheep WGS seasonal estrus 10 Oula sheep OLS seasonal estrus 16 Wuzhumuqin sheep WZM seasonal estrus 10 Yunnan sheep YNS seasonal estrus 45 Table 2. The signaling properties of WT and mutant MC4R s in response to ligand stimulation. Ligand cAMP Response MAPK/ERK Response EC 50 (µM) Rmax(%WT) EC 50 (µM) Rmax(%WT) α-MSH WT 0.13±0.02 100.0±7.1 0.98±0.03 100.0±3.2 M173 0.03±0.01 122.4±2.1 0.26 ±0.03 116.2±2.1 P value 0.009 0.0001 0.004 0.227 β-MSH WT 0.46±0.07 100.1±1.2 5.61 ±2.16 100.0±5.2 M173 0.05±0.02 104.5±1.0 3.59±1.21 138.7±2.4 P value 0.0003 0.067 0.547 0.001 Additional Declarations There is NO Competing Interest. Supplementary Files TableS20231226.xlsx Dataset1 Figs1.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4513754","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":315427443,"identity":"7d176b30-ff09-414f-abcf-65be60a95713","order_by":0,"name":"Xianyong Lan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8klEQVRIiWNgGAWjYBACPhCRAGGz//hQISHHT0gLG5IWBskZZyyMJRuI0QID0rxtFYkbCGphP3tM4kHNncR+6fYLxrzzJBg3MDA/fHQDnxaevGSDhGPPEmfOOVOQOHebBLM5A5uxcQ5eh+UYPkhgO5y44UZOwoG32yTYLBt42KTxauF/Y3Ag4R9YS2ID7xwJHoMDhLRIAG1JbANpST/MyNsgIUGEljfGBol9h41nzshhY5xxTMJAspmAX/j5c8wkf3w7LNsvkf6M4UNNXX0/e/PDx/i0wIBjAwOPAYTJTIRyELAHppcHRKodBaNgFIyCkQYAB8tNGaV1RV4AAAAASUVORK5CYII=","orcid":"","institution":"College of Animal Science and Technology, Northwest A\u0026F University, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Yangling, Shaanxi 712100, P. R. China","correspondingAuthor":true,"prefix":"","firstName":"Xianyong","middleName":"","lastName":"Lan","suffix":""}],"badges":[],"createdAt":"2024-06-01 13:10:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4513754/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4513754/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":59551586,"identity":"2ba959f5-23b3-448b-bad5-d2b46b08f81e","added_by":"auto","created_at":"2024-07-03 06:28:00","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":198736,"visible":true,"origin":"","legend":"\u003cp\u003eI173M (g.59480440G\u0026gt;C, P.Ile173Met) locus of \u003cem\u003eMC4R\u003c/em\u003e gene was selected as a candidate locus for sheep year-round estrus.\u003c/p\u003e\n\u003cp\u003e(A) Manhattan plots of selective signatures with FST and GWAS.\u003c/p\u003e\n\u003cp\u003e(B) PI and Tajima’s D at chromosome 23 around \u003cem\u003eMC4R\u003c/em\u003e gene of seasonal estrus breeds (green) as compared to year-round breeds (blue).\u003c/p\u003e\n\u003cp\u003e(C) The FST result of the region (chr23:59,300-59,600Kb) showed that I173M (g.59480440G\u0026gt;C, P.Ile173Met) locus was the peak site.\u003c/p\u003e\n\u003cp\u003e(D) Frequency distribution of I173M (g.59480440G\u0026gt;C, P.Ile173Met) locus in seasonal and year-round estrus sheep breeds.\u003c/p\u003e\n\u003cp\u003e(E) Expression of \u003cem\u003eMC4R\u003c/em\u003e gene in sheep different tissues. Data source: http://animal.omics.pro/code/index.php/RGD.\u003c/p\u003e","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4513754/v1/5dcd918f3b0cc7f0b02fb116.png"},{"id":59550927,"identity":"b4a9e200-0e1e-4ba8-8f89-46a1a373c27d","added_by":"auto","created_at":"2024-07-03 06:20:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":835261,"visible":true,"origin":"","legend":"\u003cp\u003eSequence chromatograms of the missense mutation loci and the transmembrane structure of sheep \u003cem\u003eMC4R\u003c/em\u003e protein.\u003c/p\u003e\n\u003cp\u003e(A) The conservation analysis of the \u003cem\u003eMC4R\u003c/em\u003e protein.\u003c/p\u003e\n\u003cp\u003e(B) Sequence alignment of the amino acid at position 173 in 13 species.\u003c/p\u003e\n\u003cp\u003e(C) DNA-sequencing electropherograms of the I173M (g.59480440G\u0026gt;C, P.Ile173Met) mutation.\u003c/p\u003e\n\u003cp\u003e(D) Three-dimensional protein structure changes of I173M before and after mutation introduction.\u003c/p\u003e\n\u003cp\u003e(E) \u003cem\u003eMC4R\u003c/em\u003e protein highlighting amino acids affected by I173M variant. （\u003ca href=\"http://wlab.ethz.ch/protter/start/\"\u003ehttp://wlab.ethz.ch/protter/start/\u003c/a\u003e）.\u003c/p\u003e","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4513754/v1/06a918c843b2dd5985d76b32.png"},{"id":59552392,"identity":"128d6892-8d82-466e-9063-ab305d116b1a","added_by":"auto","created_at":"2024-07-03 06:36:00","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":678817,"visible":true,"origin":"","legend":"\u003cp\u003eThe impact of the I173M mutation in \u003cem\u003eMC4R\u003c/em\u003eon receptor membrane localization, transport, and constitutive activity.\u003c/p\u003e\n\u003cp\u003e(A) Western bloting results of WT and M173 MC4R before (-) and after (+) stimulation by α-MSH.\u003c/p\u003e\n\u003cp\u003e(B) Flow cytometry results of the expression of WT and M173 receptors.\u003c/p\u003e\n\u003cp\u003e(C) Membrane localization of WT and M173 \u003cem\u003eMC4R\u003c/em\u003e, localization of \u003cem\u003eMC4R\u003c/em\u003e protein before and after cell permeability, staining with anti-Myc labeled antibody, confocal laser imaging using 100× oil mirror (scale: 10μm), blue for nucleus, (+) for triton permeability.\u003c/p\u003e","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4513754/v1/7bcdd6eeefdc6afae3c80115.png"},{"id":59550934,"identity":"36ab13f2-927e-46ad-9e5a-dcb073745bd0","added_by":"auto","created_at":"2024-07-03 06:20:00","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":767626,"visible":true,"origin":"","legend":"\u003cp\u003eRNA sequencing to analyze the regulation of I173M mutation on downstream signaling pathways.\u003c/p\u003e\n\u003cp\u003e(A) Volcano plots: differentially expressed genes (DEGs) of WT and M173 \u003cem\u003eMC4R\u003c/em\u003es.\u003c/p\u003e\n\u003cp\u003e(B) Heat map: differentially expressed genes (DEGs)\u003c/p\u003e\n\u003cp\u003e(C) GO analysis of differentially DEGs.\u003c/p\u003e\n\u003cp\u003e(D) KEGG pathway analysis.\u003c/p\u003e","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-4513754/v1/08d8fe5ab62adb05b5e72de9.png"},{"id":59551587,"identity":"67f37e91-d792-4cf1-b84c-69afbdb72873","added_by":"auto","created_at":"2024-07-03 06:28:00","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":419419,"visible":true,"origin":"","legend":"\u003cp\u003eThe I173M mutation affects the constitutive activity of the \u003cem\u003eMC4R\u003c/em\u003e receptor and the activation of the cAMP and MAPK/ERK signaling pathways.\u003c/p\u003e\n\u003cp\u003e(A) Experimental protocol.\u003c/p\u003e\n\u003cp\u003e(B) Basal cAMP (%WT) mediated by WT and M173 \u003cem\u003eMC4R\u003c/em\u003es.\u003c/p\u003e\n\u003cp\u003e(C) Activation of cAMP signaling mediated by WT and M173 \u003cem\u003eMC4R\u003c/em\u003es stimulated using α-MSH.\u003c/p\u003e\n\u003cp\u003e(D) The α-MSH stimulated cAMP response EC\u003csub\u003e50\u003c/sub\u003e (M) of WT and M173 \u003cem\u003eMC4R\u003c/em\u003es.\u003c/p\u003e\n\u003cp\u003e(E) The α-MSH stimulated cAMP response Rmax value of WT and M173 \u003cem\u003eMC4R\u003c/em\u003es.\u003c/p\u003e\n\u003cp\u003e(F) Activation of cAMP signaling mediated by WT and M173 \u003cem\u003eMC4R\u003c/em\u003es stimulated using β-MSH.\u003c/p\u003e\n\u003cp\u003e(G) The β-MSH stimulated cAMP response EC\u003csub\u003e50\u003c/sub\u003e (M) of WT and M173 \u003cem\u003eMC4R\u003c/em\u003es.\u003c/p\u003e\n\u003cp\u003e(H) The β-MSH stimulated cAMP response Rmax value of WT and M173 \u003cem\u003eMC4R\u003c/em\u003es.\u003c/p\u003e\n\u003cp\u003e(I) Activation of MAPK/ERK signaling mediated by WT and M173 \u003cem\u003eMC4R\u003c/em\u003es stimulated using α-MSH.\u003c/p\u003e\n\u003cp\u003e(J) The α-MSH stimulated MAPK/ERK response EC\u003csub\u003e50\u003c/sub\u003e (M) of WT and M173 \u003cem\u003eMC4R\u003c/em\u003es.\u003c/p\u003e\n\u003cp\u003e(K) The α-MSH stimulated MAPK/ERK response Rmax value of WT and M173 \u003cem\u003eMC4R\u003c/em\u003es.\u003c/p\u003e\n\u003cp\u003e(L) Activation of MAPK/ERK signaling mediated by WT and M173 \u003cem\u003eMC4R\u003c/em\u003es stimulated using β-MSH.\u003c/p\u003e\n\u003cp\u003e(M) The β-MSH stimulated MAPK/ERK response EC\u003csub\u003e50\u003c/sub\u003e (M) of WT and M173 \u003cem\u003eMC4R\u003c/em\u003es.\u003c/p\u003e\n\u003cp\u003e(N) The β-MSH stimulated MAPK/ERK response Rmax value of WT and M173 \u003cem\u003eMC4R\u003c/em\u003es.\u003c/p\u003e\n\u003cp\u003e*P\u0026lt;0.05, **P\u0026lt;0.01. All data are shown as Mean±SEM.\u003c/p\u003e","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4513754/v1/b4676300acb947c571b71cd1.png"},{"id":59550931,"identity":"e85d748b-64f7-4f47-ba0d-7074e42330b7","added_by":"auto","created_at":"2024-07-03 06:20:00","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":680649,"visible":true,"origin":"","legend":"\u003cp\u003eGraphical summary.\u003c/p\u003e","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-4513754/v1/17bd1ac9303d0701fd65fdc6.png"},{"id":63646594,"identity":"af21d989-7f69-43e8-afa6-b1dcc4f6e549","added_by":"auto","created_at":"2024-08-30 14:03:48","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4444737,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4513754/v1/0c15b314-0c03-415b-8c01-34af575dca06.pdf"},{"id":59550929,"identity":"242714bd-cbab-4968-9f9b-ccb3bcf8905a","added_by":"auto","created_at":"2024-07-03 06:20:00","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":307953,"visible":true,"origin":"","legend":"Dataset1","description":"","filename":"TableS20231226.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4513754/v1/611eaf85eb298a01eab4a1fa.xlsx"},{"id":59551589,"identity":"7ee2fc18-74a7-4a40-be2e-c96af24f4118","added_by":"auto","created_at":"2024-07-03 06:28:00","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1802876,"visible":true,"origin":"","legend":"","description":"","filename":"Figs1.docx","url":"https://assets-eu.researchsquare.com/files/rs-4513754/v1/6def97bab73e5ae309eba456.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Cellular mechanism of gain-of-function mutation I173M in sheep MC4R gene identified in year-round and seasonal estrus breeds through whole-genome resequencing","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMammals typically exhibit a seasonal reproductive pattern, leading to a pronounced imbalance in the supply of animal products throughout the year\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Seasonal estrus in sheep serves as a classic example of this phenomenon. Mammalian estrus can be classified into short-day breeders and long-day breeders, with sheep categorized as short-day breeders, primarily displaying estrus during the autumn and winter seasons\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. While this seasonal estrus ensures favorable environmental conditions for offspring survival, it also results in an extended anestrous period, challenging successful mating and diminishing reproductive efficiency\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Reproductive efficiency stands as a critical factor in the economic viability of sheep farming, yet the seasonality of estrus remains a pivotal constraint to the industry's progress. The estrous cycle is a crucial factor influencing the reproductive efficiency of sheep. Year-round estrus, characterized by the absence of seasonal constraints, represents a substantial enhancement in production efficiency. Consequently, the exploration of key genes associated with seasonal estrus and the investigation of the molecular mechanisms underpinning seasonal estrus in sheep are of paramount importance for augmenting their reproductive capabilities.\u003c/p\u003e \u003cp\u003eSheep reproduction is primarily regulated by the Pineal-Hypothalamus-Pituitary-Ovary (PHPO) axis, with its secreted reproductive hormones exhibiting seasonal fluctuations, influenced by photoperiodic changes (seasonal variations)\u003csup\u003e\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. In sheep, light signals received by the retina trigger changes in melatonin secretion within the pineal gland, initiating a regulatory process involving melatonin receptors and influencing the regulation of the Thyroid-Stimulating Hormone (TSH)-Dio and \u003cem\u003eKISS1\u003c/em\u003e-\u003cem\u003eGPR54\u003c/em\u003e receptor (kisspeptin-\u003cem\u003eGPR54\u003c/em\u003e) systems\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. This regulatory process, achieved through the modulation of hormone secretion, ultimately governs reproductive activities. Due to the seasonality of estrus, there is research suggesting that circadian rhythm genes may influence the seasonal reproduction of sheep\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. This includes genes such as \u003cem\u003eClock\u003c/em\u003e, \u003cem\u003eBMAL1\u003c/em\u003e, \u003cem\u003ePer1\u003c/em\u003e, \u003cem\u003ePer2\u003c/em\u003e, \u003cem\u003eCry1\u003c/em\u003e and \u003cem\u003eCry2\u003c/em\u003e, which are believed to potentially affect seasonal estrus\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Transcriptomic sequencing has been employed to analyze tissues, for instance, the hypothalamus, pituitary, and ovary tissues of seasonal and non-seasonal reproductive sheep\u003csup\u003e\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e, revealing candidate genes such as \u003cem\u003eMTNR1A\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003eGNAQ\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003eSEMA7A\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/em\u003e\u003c/sup\u003e linked to sheep estrus. These genes may play crucial roles in regulating the seasonal reproductive processes in sheep, offering valuable clues for unraveling the mechanisms behind seasonal reproduction. However, due to the complexity of estrus as a trait, the physiological processes involved are influenced by genetics, external factors, and the environment, making it challenging to perform functional validation of candidate genes. The manifestation of year-round estrus in certain sheep breeds is a consequence of rigorous human selection, possibly driven by the selection for specific major-effect genes and critical mutations. In sheep, breeds such as Hu sheep, Large Tail Han sheep, and Cele black exhibit year-round reproductive behaviors\u003csup\u003e\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. In contrast, Tibetan sheep and Tan sheep develop their gonads at specific times of the year and demonstrate seasonal reproductive behaviors\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Therefore, using both year-round and seasonal estrus sheep breeds as models can facilitate a more comprehensive investigation into the molecular mechanisms underlying seasonal reproduction in sheep. Genomic research offers a new approach by establishing a direct link between phenotypes and genetics, providing a fresh perspective on the study of complex traits.\u003c/p\u003e \u003cp\u003eThis study conducted genomic analysis using GWAS data from a total of 392 sheep, including 6 breeds exhibiting year-round estrus and 10 breeds displaying seasonal estrus to identify candidate genes associated with year-round estrus in sheep and to perform functional validation of single nucleotide polymorphism (SNP) sites. This research holds significant importance in overcoming limitations associated with controlling the seasonality of sheep estrus through selective breeding, ultimately contributing to the improvement of the reproductive performance of sheep.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eThe screening of candidate genes for year-round estrus in sheep\u003c/h2\u003e \u003cp\u003eTo identify selection signals associated with year-round estrus in sheep at the whole-genome level, this study utilized whole-genome resequencing data from 6 year-round estrus breeds and 10 seasonal estrus breeds, encompassing a total of 392 sheep. The PCA results revealed a well-defined clustering of individuals within each breed, indicating the suitability of these data for subsequent analysis (Fig. S1A). FST analysis and GWAS analysis were conducted between the year-round estrus and seasonal estrus breeds. Gene annotation of the top 1\u0026permil; significant loci revealed genes associated with lambing (\u003cem\u003eBMPR1B\u003c/em\u003e), horn type (\u003cem\u003eRXFP2\u003c/em\u003e), tail type (\u003cem\u003ePDGFD\u003c/em\u003e), immunity (\u003cem\u003eADAR\u003c/em\u003e), tail length (\u003cem\u003eTBXT\u003c/em\u003e), coat color (\u003cem\u003eKIT\u003c/em\u003e), and year-round/seasonal estrus (Melanocortin 4 receptor, \u003cem\u003eMC4R\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Notably, this study discovered a highly selected region in the \u003cem\u003eMC4R\u003c/em\u003e gene region on chromosome 23, with the strongest selection signal. Through gene annotation, a missense mutation I173M (g.59480440G\u0026thinsp;\u0026gt;\u0026thinsp;C, P.Ile173Met) in the \u003cem\u003eMC4R\u003c/em\u003e region on chromosome 23 was identified as the strongest selected site, showing significant frequency differences between year-round estrus and seasonal estrus breeds, with a higher frequency of the mutant type in year-round estrus breeds(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). This mutation might influence the year-round estrus trait in sheep. The expression of the \u003cem\u003eMC4R\u003c/em\u003e gene in various tissues of sheep was comparatively analyzed using the Animal Genetics and Genomics Database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://animal.omics.pro\u003c/span\u003e\u003cspan address=\"http://animal.omics.pro\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The results revealed that \u003cem\u003eMC4R\u003c/em\u003e is expressed in reproductive-related tissues, such as the epididymis, oviduct, vas deferens, uterus, cervix, and thyroid (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). Additionally, we scanned single nucleotide polymorphisms (SNPs) in the \u003cem\u003eMC4R\u003c/em\u003e gene across the 16 sheep breeds (Table S1), and the frequencies of these mutations in these breeds are shown in Fig. S1B.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eConservation and mutation site analysis of the candidate gene\u003c/b\u003e \u003cb\u003eMC4R\u003c/b\u003e \u003cb\u003eassociated with year-round estrus in sheep\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe results of the conservative analysis of the MC4R protein in 13 vertebrate species indicate that MC4R is highly conserved across different species, with conservation levels exceeding 90% in animals such as goats, sheep, and pigs. Additionally, the similarity between sheep MC4R protein and human MC4R protein is 92.77% (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The analysis of the conservation of the Ile amino acid at position 173 in the sheep MC4R across different species showed that this site was highly conserved, indicated that mutation at this position may have an impact on protein function (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Subsequently, we employed PCR primers for \u003cem\u003eMC4R\u003c/em\u003e amplification (F: TCAGTCAGTCCAGAGGGGAC, R: TGTGTTTAGCATCGCGTTTG) to validate the sequenced site. The sequencing results for the mutation site are shown in the Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eC. The PyMol v7.0.1 software was used for protein three-dimensional structure prediction of the missense mutation. Introducing the M173 amino acid revealed a change in the three-dimensional structure of the MC4R protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). This suggests that the mutation may impact the function of the MC4R protein. Further prediction through the online tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://wlab.ethz.ch/protter/start/\u003c/span\u003e\u003cspan address=\"http://wlab.ethz.ch/protter/start/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) indicated that the missense mutation g.59480440G\u0026thinsp;\u0026gt;\u0026thinsp;C is located in the fourth transmembrane domain (TM4) of the MC4R protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Previous studies have demonstrated the crucial importance of the third and fourth transmembrane domains of \u003cem\u003eMC4R\u003c/em\u003e for its binding\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Hence, it is inferred that this mutation may potentially impact the functionality of receptor.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eThe I173M mutation in sheep does not impact the localization and expression of MC4R\u003c/h2\u003e \u003cp\u003eTo investigate whether the I173M mutation alters the expression of MC4R on the cell membrane, we transfected HEK293T cells with WT and M173 recombinant vectors and assessed the protein expression level of MC4R. The electrophoresis results demonstrated that the I173M mutation does not affect the expression level of MC4R protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). To further evaluate the impact of the mutation on MC4R expression, we used flow cytometry to detect the surface expression of WT and M173 proteins in HEK293T cells. There was no significant difference in the expression levels of WT and M173 receptors on the cell membrane (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Previous studies have shown that MC4R is localized on the cell membrane and undergoes continuous endocytosis and recycling\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Immunostaining of HEK293T cells expressing the two recombinant plasmids revealed that both WT and M173 \u003cem\u003eMC4R\u003c/em\u003es are normally expressed on the cell membrane without permeabilization. After permeabilization, both receptors were successfully transported to the intracellular membrane, indicating that the mutation does not affect receptor localization and trafficking on the cell membrane (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). These results suggest that the I173M mutation does not significantly alter the expression or localization of \u003cem\u003eMC4R\u003c/em\u003e on the cell membrane.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eThe transcriptional regulation of sheep MC4R I173M mutant\u003c/h2\u003e \u003cp\u003eSubsequently, WT and M173 \u003cem\u003eMC4R\u003c/em\u003e plasmids were transfected into HEK293T cells, followed by sample collection for transcriptome sequencing to investigate differentially expressed genes (DEGs) and their associated pathways. After filtering the transcriptome sequencing results, 53 DEGs were identified, with 26 significantly upregulated and 27 significantly downregulated genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Among them, genes such as \u003cem\u003eNR4A2\u003c/em\u003e, \u003cem\u003eIL5RA\u003c/em\u003e, and \u003cem\u003eCAMK2A\u003c/em\u003e showed upregulation in cells transfected with the M173 plasmid (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). GO analysis results indicated that DEGs were enriched in biological processes such as aminomuconate-semialdehyde dehydrogenase activity, interleukin-5 receptor activity, follicle-stimulating hormone secretion, signaling receptor ligand activity and receptor activator activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Using the KEGG database for pathway enrichment analysis of DEGs, the most significantly enriched pathways included the GnRH signaling pathway, Aldosterone synthesis and secretion, Necroptosis, Ovarian steroidogenesis, Wnt signaling pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). It is worth noting that the cAMP signaling pathway and MAPK signaling pathway of \u003cem\u003eMC4R\u003c/em\u003e are also significantly enriched (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Certainly, follow-up studies can be undertaken to delve deeper into the implications of these DEGs and pathways. Here, we mainly focus on the regulation of cAMP signaling pathway and MAPK signaling pathway by the M173 \u003cem\u003eMC4R\u003c/em\u003e receptor.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eThe I173M mutation amplifies the constitutive activity and activates cAMP signaling in the MC4R receptor\u003c/h2\u003e \u003cp\u003e \u003cem\u003eMC4R\u003c/em\u003e mainly couples to the G-protein G\u003csub\u003eS\u003c/sub\u003e and it is well-established that binding of Pro-opiomelanocortin (POMC)-derived peptides (α-/β-MSH [melanocyte-stimulating hormone]) to membrane-bound \u003cem\u003eMC4R\u003c/em\u003e activates G proteins (Gαs) and stimulates the production of cyclic AMP (cAMP)\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eWild-type \u003cem\u003eMC4R\u003c/em\u003e exhibits basal (constitutive) activity, and naturally occurring mutations have been identified that result in either increased or decreased basal activities\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. The transfection of HEK293T cells with pGL4.29, pEGFP-N1, and WT/M173 \u003cem\u003eMC4R\u003c/em\u003e, followed by the evaluation of constitutive activity (cAMP basal level) using a dual luciferase reporter gene assay in the absence of agonist stimulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), revealed a significant increase in cAMP basal level by the WT MC4R receptor compared to pcDNA3.1 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Moreover, the M173 mutant receptor exhibited significantly increased basal activity compared to the WT receptor (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Subsequent evaluation of the signal transduction capacity of the receptors before and after mutation involved stimulating cells expressing recombinant WT and M173 \u003cem\u003eMC4R\u003c/em\u003e vectors with six concentrations of α-MSH /β-MSH (ranging from 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e to 10\u003csup\u003e\u0026minus;\u0026thinsp;10\u003c/sup\u003e) and assessing receptor signal transduction ability using a dual luciferase reporter gene assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). The data obtained from concentration-response experiments (all concentration-response curves for two receptors and the two ligands are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eC and Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eF) were subjected to fitting non-linear regression models to calculate the response value of each ligand at the receptor mutation (Rmax) and the potency of the ligand at the receptor mutation (EC\u003csub\u003e50\u003c/sub\u003e). The cAMP activity of the M173 \u003cem\u003eMC4R\u003c/em\u003e increased fourfold compared to that of WT \u003cem\u003eMC4R\u003c/em\u003e upon stimulation with the α-MSH ligand (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eD), and the Rmax of M173 receptor to cAMP increased significantly (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eE, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e2\u003c/span\u003e). After using β-MSH stimulation, the results were found to be consistent with those of α-MSH stimulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eG and Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eH). Specifically, the EC\u003csub\u003e50\u003c/sub\u003e value of β-MSH in activating cAMP activity of the I173M \u003cem\u003eMC4R\u003c/em\u003e (0.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u0026micro;M) was significantly lower than that of the WT \u003cem\u003eMC4R\u003c/em\u003e (0.46\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u0026micro;M) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e2\u003c/span\u003e). It turns out that M173 \u003cem\u003eMC4R\u003c/em\u003e increased ligand-induced cAMP signaling activation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eThe I173M mutation in MC4R mediates enhanced MAPK/ERK signal activation\u003c/h2\u003e \u003cp\u003e \u003cem\u003eMC4R\u003c/em\u003e is known to activate the p44/42 mitogen-activated protein kinases (MAPK), also referred to as extracellular signal-regulated kinases 1 and 2 (ERK1/2). The activation of the ERK1/2 pathway is considered a potential cellular mechanism involved in regulating \u003cem\u003eMC4R\u003c/em\u003e\u003csup\u003e\u003cspan additionalcitationids=\"CR25\" citationid=\"CR25\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eTo evaluate the activation of MAPK/ERK by both the WT and I173M mutant forms of \u003cem\u003eMC4R\u003c/em\u003e, we employed a dual-luciferase reporter gene experiment using the ERK pathway reporter gene vector pSRE-luc. HEK293T cells were transfected with pGL4.33, pEGFP-N1, and either WT or M173 \u003cem\u003eMC4R\u003c/em\u003e, followed by stimulation with six concentrations of α-MSH/β-MSH (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Both receptors exhibited dose-dependent responses to varying concentrations of α-MSH/β-MSH (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eI and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eL). Analysis of EC\u003csub\u003e50\u003c/sub\u003e values revealed that the M173 \u003cem\u003eMC4R\u003c/em\u003e enhanced ligand-induced MAPK/ERK signaling activation. Specifically, the EC\u003csub\u003e50\u003c/sub\u003e value of α-MSH in activating the M173 \u003cem\u003eMC4R\u003c/em\u003e (0.26\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u0026micro;M) was significantly lower than that of the WT \u003cem\u003eMC4R\u003c/em\u003e (0.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u0026micro;M) (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ). This indicated a fourfold increase in activation efficiency, while the Rmax value did not show significant change (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eK). There was no significant difference in EC\u003csub\u003e50\u003c/sub\u003e values upon stimulation with β-MSH in terms of MAPK/ERK (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eM). However, Rmax value of the M173 \u003cem\u003eMC4R\u003c/em\u003e showed a substantial increase (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eN). Specific EC\u003csub\u003e50\u003c/sub\u003e and Rmax values was shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003eTogether, these data suggest that the sheep \u003cem\u003eMC4R\u003c/em\u003e I173M mutation enhances cAMP signal transduction activation, increases receptor basal activity, and promotes the activation of MAPK/ERK signaling. The I173M mutation significantly enhances the functionality of the mutated receptor, establishing it as an important functional variant in the regulation of estrus in sheep.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eSeasonal estrus poses a significant constraint on the reproductive capacity of sheep. Investigating the regulatory mechanisms of year-round estrus in sheep is crucial for enhancing their reproductive efficiency. Through a genomic approach, utilizing comprehensive sheep whole-genome resequencing data and estrus information, and employing methodologies like selective signal detection and association analysis, we provide strong evidence that \u003cem\u003eMC4R\u003c/em\u003e is a novel candidate gene for year-round estrus in sheep, particularly through the I173M mutation site which may potentially influence the traits associated with year-round estrus in sheep.\u003c/p\u003e \u003cp\u003eThe C allele of rs571312 and the G allele of rs12970134 in the \u003cem\u003eMC4R\u003c/em\u003e gene have been found to be linked with precocious puberty among girls suffering from obesity\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Previous studies have revealed disruptions in follicular dynamics and a reduction in corpus luteum count in \u003cem\u003eMC4R\u003c/em\u003e knockout mice. The regularity of the estrous cycle in mice is significantly influenced by genetic factors, as evidenced by the pronounced impact of \u003cem\u003eMC4R\u003c/em\u003e knockout on the rhythmicity of the mouse estrous cycle\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Similarly, in rats, \u003cem\u003eMC4R\u003c/em\u003e has been shown to impact the secretion of luteinizing hormone (LH), potentially influencing the estrous cycle\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Quantitative analysis of \u003cem\u003eMC4R\u003c/em\u003e expression in the hypothalamus of female rats at different estrous stages indicates elevated expression during the pre-estrus phase, followed by downregulation during estrus, post-estrus, and diestrus\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. These results suggest that the upregulation of \u003cem\u003eMC4R\u003c/em\u003e expression may be associated with the pre-ovulatory surge in gonadotropin-releasing hormone (GnRH) and LH, further substantiating the involvement of \u003cem\u003eMC4R\u003c/em\u003e in the regulation of the female's estrous cycle. In sheep, existing studies have linked \u003cem\u003eMC4R\u003c/em\u003e to growth traits, meat quality characteristics, and feed intake\u003csup\u003e\u003cspan additionalcitationids=\"CR32\" citationid=\"CR32\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e, but till now, no reported research explored it the association with estrus in sheep. The \u003cem\u003eKISS1\u003c/em\u003e-\u003cem\u003eGPR54\u003c/em\u003e/\u003cem\u003eTSHR\u003c/em\u003e-\u003cem\u003eDIO2\u003c/em\u003e/\u003cem\u003eDIO3\u003c/em\u003e signaling pathway has been linked to year-round estrus in sheep\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e, and the co-location of \u003cem\u003eMC4R\u003c/em\u003e and the long-day reproductive gene kisspeptin in the arcuate nucleus (ARC) of sheep suggests a potential role for \u003cem\u003eMC4R\u003c/em\u003e in promoting year-round estrus\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePrevious studies have shown that MC4R expressed in HEK293T cells can be stimulated to activate transcription by melanocortin analogues at different concentrations, allowing exploration of its regulation of downstream signaling pathways\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Given the high degree of conservation between sheep MC4R and human MC4R protein, we conducted further research on the regulatory effects of sheep \u003cem\u003eMC4R\u003c/em\u003e I173M in HEK293T cells. The analysis shows that the variant does not affect total protein expression and receptor internalization. Transcriptome sequencing results revealed that the biological processes of signaling receptor ligand activity and receptor activator activity were enriched, and cAMP signaling pathway and MAPK signaling pathway were significantly enriched after transfected with M173 \u003cem\u003eMC4R\u003c/em\u003e plasmid. In consistency with these results, our study identified \u003cem\u003eMC4R\u003c/em\u003e gene I173M mutation as a functionally acquired mutation, enhancing the basal activity of the mutated receptor and upregulating the cAMP and MAPK/ERK signaling pathways. Additionally, reproduction-related pathways, such as GnRH signaling pathway and Ovarian steroidogenesis pathways, were significantly enriched, suggesting an influence on the hypothalamic-pituitary-ovarian axis and influencing hormone secretion in animals. Furthermore, previous research has suggested that obesity can affect various aspects of female reproductive capability, including oocyte growth and development, ovulation, endometrial growth, embryo development, and embryo implantation, ultimately influencing estrus\u003csup\u003e\u003cspan additionalcitationids=\"CR37\" citationid=\"CR37\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. Previous studies have shown that the \u003cem\u003eMC4R\u003c/em\u003e gene I173M mutation can significantly increase gene transcriptional activity\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. The I173M mutation has been associated with the adult height of Hu sheep and has effects on gene transcriptional activity, with the homozygous wild type linked to higher body weight\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Functional gain-of-function mutations in \u003cem\u003eMC4R\u003c/em\u003e can prevent obesity and exhibit favorable metabolic characteristics, potentially serving as crucial factors influencing sheep estrus. Therefore, the I173M mutation may impact hormone secretion and energy metabolism, affecting sheep estrus.\u003c/p\u003e \u003cp\u003eThis study leverages sequencing data from both year-round and seasonal estrus sheep, establishing a significant association between the novel candidate gene \u003cem\u003eMC4R\u003c/em\u003e and its I173M mutation with estrus traits in sheep. Significantly, it marks the first exploration of the cellular mechanisms underlying the I173M mutation in the sheep \u003cem\u003eMC4R\u003c/em\u003e gene. Mechanistically, this mutation induced an augment basal activity of the \u003cem\u003eMC4R\u003c/em\u003e receptor, enhancing the efficiency of binding between the mutated receptor and agonists (α-MSH, β-MSH) is enhanced. This indicates a functionally acquired mutation that may strengthen the regulatory role of the \u003cem\u003eMC4R\u003c/em\u003e receptor in estrus (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003e. Graphical summary). While recognizing the pivotal role of the \u003cem\u003eMC4R\u003c/em\u003e gene in year-round estrus in sheep, it is crucial to acknowledge that it is not the sole determination of this reproductive trait. Other contributing elements such as other genes\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e, hormone levels\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e, and nutritional status\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e collectively impact estrus traits in sheep. Given the complexity of estrus traits, our current study lacks direct evidence of \u003cem\u003eMC4R\u003c/em\u003e regulating sheep estrus. Further research and functional validation of \u003cem\u003eMC4R\u003c/em\u003e are essential to gain additional insights. Potential ways could include experiments to detect hormone levels after activating MC4R receptors in vivo, overexpressing the \u003cem\u003eMC4R\u003c/em\u003e gene in sheep ovarian granulosa cell lines to explore its function, and conducting transcriptomic and metabolomic sequencing analyses on tissues from sheep with different genotypes of the I173M mutation. After supplementing these experiments, the regulatory role of the \u003cem\u003eMC4R\u003c/em\u003e gene and its \u003cem\u003eI173M\u003c/em\u003e mutation in the year-round estrus of sheep will become more concrete.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn summary, our research results confirm the previously unrecognized role of the \u003cem\u003eMC4R\u003c/em\u003e gene in year-round estrus in sheep. We found that the I173M mutation in this gene is associated with estrus traits in year-round estrus breeds. This discovery contributes to a deeper understanding of the functionality of \u003cem\u003eMC4R\u003c/em\u003e and holds significant implications for enhancing the reproductive performance of seasonally estrous sheep.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e In accordance with animal welfare requirements, all the animal experiments in this study were consistent with relevant national legal and ethical principles. Our study was approved by the Institutional Animal Care and Use Committee of Northwest A\u0026amp;F University (IACUC-NWAFU).\u003c/p\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eAnimal and Sample Collection\u003c/h2\u003e \u003cp\u003eThe whole-genome sequencing data were collected from both year-round estrus and seasonally estrus sheep. A total of 160 year-round estrus individuals from 6 breeds and 232 seasonally estrus individuals from 10 breeds were downloaded from NCBI SRA database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/sra/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/sra/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) for further research. Detailed information is provided in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eReads mapping and SNPs calling\u003c/h2\u003e \u003cp\u003eThe raw FASTQ files underwent quality filtering using the fastp (v0.20.0)\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. BWA-MEM software (v0.7.17) was employed to align the genome data to the sheep reference genome (ARS-UI_Ramb_v2.0)\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. SAMTOOLS software (v1.7) was used to convert SAM files to BAM files\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. The variants calling were performed using GATK (version 4.1.7.0). VCFTOOLS (version 0.1.16) was used to filter SNPs data, and only biallelic SNPs were retained. SNPs with minimum allele frequency greater than 0.05 and missing ratio less than 0.1 were selected for subsequent analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eFST Analysis\u003c/h2\u003e \u003cp\u003eVCFTOOLS (version 0.1.16) was used to detect the genome-wide selection signatures using SNPs loci. The table_annovar.pl module of ANNOVAR was used for functional annotation for each SNP \u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eGWAS Analysis\u003c/h2\u003e \u003cp\u003eIn this study, perennial estrus and seasonal estrus characteristics were treated as binary variables (0 or 1). The EMMA software was used for GWAS analysis on perennially estrous and seasonally estrous sheep\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. PLINK (v1.90b7) was used for preliminary data processing and principal component analysis (PCA) calculation. The first three principal components (PC1, PC2, PC3) from PCA, explaining 13.639%, 7.322%, and 5.418% of the effect values, were used as corrected fixed effects. The emmax-kin module of EMMA was used to calculate the relationship as a covariance. Personal python scripts were employed for result visualization.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vitro mutagenesis of\u003c/b\u003e \u003cb\u003eMC4R\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe coding regions of wild-type (WT) and mutant sheep \u003cem\u003eMC4R\u003c/em\u003e were sub-cloned into the pcDNA3.1 (+) vector from Invitrogen (Carlsbad, CA, USA). The WT and M173 3\u0026times;Myc-tagged \u003cem\u003eMC4R\u003c/em\u003e vectors were synthesized by Nanjing GenScript Corporation. Plasmids for transfection were prepared using the Endofree Plasmid Maxi Kit from TianGen Biotech. DNA sequencing was conducted to verify the correctness of the full coding region.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and luciferase reporter assay\u003c/h2\u003e \u003cp\u003eThis study utilized the luciferase reporter system to investigate the activation of downstream signals through \u003cem\u003eMC4R\u003c/em\u003e by two ligands. The luciferase reporter vectors employed were pGL4.29 from Promega (Madison, WI, USA), containing cAMP response element (CRE) in the promoter regions for monitoring cAMP activation, and pGL4.33 plasmid with serum response element (SRE) sequences for detecting MAPK/ERK signaling pathway activation\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e47\u003c/span\u003e,\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. Human embryonic kidney (HEK) 293T cells were grown at 5% CO\u003csub\u003e2\u003c/sub\u003e in DMEM supplemented with 10% fetal bovine serum, and 100 units/ml of penicillin and 100 \u0026micro;g/ml streptomycin. The brief operating procedure was as follows: the HEK293T cells were passaged to a 6-well plate 24 h before transfection. Then, a mixture containing 1000ng luciferase reporter vector, 500ng WT or mutant sheep \u003cem\u003eMC4R\u003c/em\u003e expression plasmid (or empty pcDNA3.1 plasmid), 300ng pEGFP-N1 (as the internal control for transfection normalization), and 4 \u0026micro;L PEI transfection reagent (Fusheng Biotechnology, Shanghai, China) was used to transfect these cells. The transfected cells continued to grow in the original medium for 24 h, then they were pipetted down and transferred to a 48-well plate to grow for another 24 h to reach a density of 2 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells per well. The agonists α-MSH and β-MSH were obtained from GenScript Biotechnology (Nanjing, China). The α-MSH and β-MSH were diluted to working concentration in serum-free medium, and then added to the 48-well plate to treat cells for 6 h. After processing, the cells were lysed with 1 \u0026times; passive lysis buffer (YEASEN, Shanghai, China), and the luciferase substrate was added for reaction. For each assay, two additional 48-well plates (n\u0026thinsp;=\u0026thinsp;3) were used as technical replicates and data were shown as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003eAfter transfecting HEK293T cells with WT or M173 \u003cem\u003eMC4R\u003c/em\u003e plasmids (or empty pcDNA3.1 plasmid) for 24 hours, cells were stimulated with 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003eM α-MSH for 15 minutes. The control group was treated with serum-free medium for 15 minutes. The cultured cells were lysed in RIPA buffer containing 1% PMSF and 2% phosphatase inhibitors. After centrifugation, the supernatant was collected, mixed with protein loading buffer at a 3:1 ratio, and subjected to protein denaturation at 100℃ in a constant temperature metal bath for 10 minutes. Following SDS-PAGE gel electrophoresis separation of 20ng protein samples, the proteins were wet-transferred onto a PVDF membrane. The membrane was then blocked at room temperature for 2 hours using a 5% skim milk solution. Primary antibodies, Myc (1:2000) and β-actin (1:5000), were incubated overnight at 4℃. After washing with TBST for 3 hours, each wash lasting 5 minutes, the membrane was incubated with secondary antibodies (1:10000) for 2 hours on a shaker. Subsequent to another 3 washes with TBST, chemiluminescent ECL reagent was applied, and the membrane was scanned using a chemiluminescence imager. ImageJ software was used for grayscale analysis of bands, with relative expression levels of the target bands calculated by comparing grayscale values with β-actin protein bands.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence\u003c/h2\u003e \u003cp\u003eHEK293T cells were seeded onto glass coverslips in 12-well plates and transfected with 500 ng of WT or M173 \u003cem\u003eMC4R\u003c/em\u003e plasmids. After 24 hours of transfection, the cells were fixed with 4% formaldehyde in PBS for 10 minutes at room temperature. They were then washed three times for 5 minutes each with phosphate-buffered saline (PBS). Next, the cells were permeabilized with 0.1% Triton X-100 in PBS for 5 minutes. Following permeabilization, a blocking step was performed by incubating the cells with 5% bovine serum albumin (BSA) for 1 hour. After blocking, the cells were incubated overnight at 4\u0026deg;C with Myc-Tag (19C2) Mouse mAb antibody (Abmart) at a dilution of 1:200 in BondTM primary antibody diluent. The next day, the cells were washed with PBS to remove unbound primary antibodies. Then, they were incubated with a fluorescently labeled secondary antibody, iFluor 488 (HA1125), at a dilution of 1:500. This incubation was performed in a dark environment for 2 hours. After the secondary antibody incubation, the cells were washed to remove unbound secondary antibodies. Finally, Hoechst 33342 dye was added for nuclear staining, and the cells were incubated with the dye for 20 minutes. Slides were imaged using a confocal microscope and images processed using FIJI. Results are from three independent experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry assay\u003c/h2\u003e \u003cp\u003eThe flow cytometry assay to quantitate the expression levels of \u003cem\u003eMC4R\u003c/em\u003e involved the following steps: Cells were plated into a six-well plate and prepared by washing with PBS. The cells were then fixed with 4% paraformaldehyde and incubated with a blocking solution (5% BSA). After blocking, the cells were incubated with Myc-Tag (19C2) Mouse mAb antibody (dilution 1:200) for 1 hour. Subsequently, the cells were washed and incubated with a fluorescently labeled secondary antibody, iFluor 488 (dilution 1:500) for 2 hours. Flow cytometry analysis was performed using a C6 flow cytometer to measure the fluorescence emitted by the cells. The expression levels of the \u003cem\u003eMC4R\u003c/em\u003e variants were calculated as a percentile of WT expression using a specific formula\u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. The entire assay was conducted at room temperature.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eRNA-sequencing and bioinformatic analyses\u003c/h2\u003e \u003cp\u003eHEK293T cells were seeded onto glass coverslips in plates and transfected with WT and M173 \u003cem\u003eMC4R\u003c/em\u003e constructs for transcriptome sequencing, total RNA was extracted from by TRIzol (Invitrogen) following the standard protocol. The transcriptome sequencing was performed by Guangzhou GENE DENOVO Biotechnology Co., Ltd, and the NOISeq method was used to identify differentially expressed genes (DEGs) between the two groups with Fold change R2 and diverge probability R0.8, as described by Tarazona et al\u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e Gene Ontology (GO) and pathway annotation and enrichment analyses were conducted using the Gene Ontology Database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.geneontology.org/\u003c/span\u003e\u003cspan address=\"http://www.geneontology.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and the KEGG pathway database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.genome.jp/kegg/\u003c/span\u003e\u003cspan address=\"http://www.genome.jp/kegg/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eEC\u003csub\u003e50\u003c/sub\u003e values were calculated using Prism software version 4 (GraphPad Software). Statistical calculations were performed by SPSS software ver. 23.0. For comparisons on EC\u003csub\u003e50\u003c/sub\u003e, an unpaired T-test was used.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the sub-project of the National Key Research and Development Program during the 14th Five-Year Plan (Grant No. 2022YFF1000100).\u003cstrong\u003e\u0026nbsp;Author Contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYuta Yang: Contributed to formal analysis, software implementation, investigation, and original draft writing, Engaged in reviewing and editing the manuscript;\u0026nbsp;Yuxin Kang: Participated in formal analysis, software development, and investigative efforts;\u0026nbsp;Chunna Cao: Oversaw project administration and took part in its conceptualization;\u0026nbsp;Peiyao Liu: Participated in formal analysis, software development, and investigative efforts;\u0026nbsp;Yang Li:\u0026nbsp;Participated in formal analysis, software development; \u0026nbsp;Ran Li :\u0026nbsp;Participated in formal analysis, software development; Qingfeng Zhang:\u0026nbsp;participated in reviewing and editing the manuscript;\u0026nbsp;Chuanying Pan\u0026nbsp;and\u0026nbsp;Xianyong Lan: Exercised supervision over the project, engaging in conceptualization, validation, funding acquisition, project administration, and participated in reviewing and editing the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets supporting the conclusions of this article are included within the article and its additional file.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003ede Carvalho NA, Soares JG, Baruselli PS. Strategies to overcome seasonal anestrus in water buffalo. \u003cem\u003eTheriogenology\u003c/em\u003e. \u003cstrong\u003e86\u003c/strong\u003e,200-206(2016).\u003c/li\u003e\n\u003cli\u003eChemineau P. et al. Seasonality of reproduction in mammals: intimate regulatory mechanisms and practical implications. Reprod Domest Anim. 2008;43 Suppl 2:40-47.\u003c/li\u003e\n\u003cli\u003eXia Q. et al. [The molecular mechanism of sheep seasonal breeding and artificial regulatory techniques for estrus and mating in anestrus]. \u003cem\u003eYi. Chuan.\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e,369-377(2018). \u003c/li\u003e\n\u003cli\u003eLi X. et al. Analysis of pituitary transcriptomics indicates that lncRNAs are involved in the regulation of sheep estrus.\u003cem\u003e Funct. Integr. Genomics\u003c/em\u003e.\u003cstrong\u003e 20\u003c/strong\u003e,563-573(2020).\u003c/li\u003e\n\u003cli\u003eWei S. et al. Analysis of reproduction-related transcriptomes on pineal-hypothalamic-pituitary-ovarian tissues during estrus and anestrus in Tan sheep. \u003cem\u003eFront. Vet. Sci\u003c/em\u003e. \u003cstrong\u003e9\u003c/strong\u003e,1068882(2022).\u003c/li\u003e\n\u003cli\u003eHe X. et al. Transcriptomic Changes of Photoperiodic Response in the Hypothalamus Were Identified in Ovariectomized and Estradiol-Treated Sheep. \u003cem\u003eFront. Mol. Biosci.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e,848144(2022).\u003c/li\u003e\n\u003cli\u003eKopycińska K, Wojtulewicz K, Herman AP, Tomaszewska-Zaremba D. The Effect of Photoperiodic Conditions on GnRH/LH Secretion in Ewes. \u003cem\u003eAnimals (Basel)\u003c/em\u003e. \u003cstrong\u003e12\u003c/strong\u003e,283(2022).\u003c/li\u003e\n\u003cli\u003eDardente H. et al. Photoperiod, but not progesterone, has a strong impact upon the transcriptome of the medio-basal hypothalamus in female goats and ewes. \u003cem\u003eMol. Cell. Endocrinol. 588\u003c/em\u003e,112216(2024).\u003c/li\u003e\n\u003cli\u003eLincoln G, Messager S, Andersson H, Hazlerigg D. Temporal expression of seven clock genes in the suprachiasmatic nucleus and the pars tuberalis of the sheep: evidence for an internal coincidence timer.\u003cem\u003e Proc. Natl. Acad. Sci.\u003c/em\u003e \u003cem\u003eU S A\u003c/em\u003e. \u003cstrong\u003e99\u003c/strong\u003e,13890-13895(2002).\u003c/li\u003e\n\u003cli\u003eMatthews CD, Guerin MV, Deed JR. Melatonin and photoperiodic time measurement: seasonal breeding in the sheep. \u003cem\u003eJ. Pineal. Res\u003c/em\u003e. \u003cstrong\u003e14\u003c/strong\u003e,105-116(1993).\u003c/li\u003e\n\u003cli\u003eHan Q, He X, Di R, Chu M. Comparison of expression patterns of six canonical clock genes of follicular phase and luteal phase in Small-tailed Han sheep. \u003cem\u003eArch. Anim. Breed.\u003c/em\u003e \u003cstrong\u003e64\u003c/strong\u003e,457-466(2021).\u003c/li\u003e\n\u003cli\u003eZhong Y, Di R, Yang Y, Liu Q, Chu M. Transcriptome Analysis of Neuroendocrine Regulation of Ovine Hypothalamus-Pituitary-Ovary Axis during Ovine Anestrus and the Breeding Season. \u003cem\u003eGenes (Basel)\u003c/em\u003e. \u003cstrong\u003e12\u003c/strong\u003e,18 61(2021).\u003c/li\u003e\n\u003cli\u003eDu X. et al. Comparative Transcriptomics Reveals the Key lncRNA and mRNA of Sunite Sheep Adrenal Gland Affecting Seasonal Reproduction. \u003cem\u003eFront. Vet. Sci.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e,816241(2022).\u003c/li\u003e\n\u003cli\u003eDi R. et al. Characterization and comparative profiling of ovarian microRNAs during ovine anestrus and the breeding season. \u003cem\u003eBMC. Genomics\u003c/em\u003e. \u003cstrong\u003e15\u003c/strong\u003e,899(2014).\u003c/li\u003e\n\u003cli\u003eYang D. et al. Expression and role of melatonin membrane receptors in the hypothalamic-pituitary-testicular axis of Tibetan sheep in a plateau pastoral area. \u003cem\u003ePLoS. One\u003c/em\u003e. \u003cstrong\u003e18\u003c/strong\u003e, e0290775(2023).\u003c/li\u003e\n\u003cli\u003eZhu M. et al. Targeting GNAQ in hypothalamic nerve cells to regulate seasonal estrus in sheep. \u003cem\u003eTheriogenology\u003c/em\u003e. \u003cstrong\u003e181\u003c/strong\u003e,79-88(2022).\u003c/li\u003e\n\u003cli\u003eYuan Z. et al. Association of Polymorphisms in Candidate Genes with the Litter Size in Two Sheep Breeds.\u003cem\u003e Animals (Basel)\u003c/em\u003e. \u003cstrong\u003e9\u003c/strong\u003e,958(2019).\u003c/li\u003e\n\u003cli\u003eLi C. et al. Comparative proteomics of ovaries elucidated the potential targets related to ovine prolificacy. \u003cem\u003eFront. Vet. Sci.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e,1096762(2023).\u003c/li\u003e\n\u003cli\u003eTao YX. Constitutive activity in melanocortin-4 receptor: biased signaling of inverse agonists. \u003cem\u003eAdv. Pharmacol.\u003c/em\u003e \u003cstrong\u003e70\u003c/strong\u003e,135-154(2014).\u003c/li\u003e\n\u003cli\u003eWang J. et al. Comprehensive Analysis of Differentially Expressed CircRNAs in the Ovaries of Low- and High-Fertility Sheep. \u003cem\u003eAnimals (Basel)\u003c/em\u003e. \u003cstrong\u003e13\u003c/strong\u003e,236(2023).\u003c/li\u003e\n\u003cli\u003eYang Y. et al. Molecular determination of agouti-related protein binding to human melanocortin-4 receptor. \u003cem\u003eMol. Pharmacol\u003c/em\u003e. \u003cstrong\u003e64\u003c/strong\u003e, 94-103(2003).\u003c/li\u003e\n\u003cli\u003eCooney KA, Molden BM, Kowalczyk NS, Russell S, Baldini G. Lipid stress inhibits endocytosis of melanocortin-4 receptor from modified clathrin-enriched sites and impairs receptor desensitization. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cstrong\u003e292\u003c/strong\u003e,17731-17745(2017).\u003c/li\u003e\n\u003cli\u003eMo XL, Tao YX. Activation of MAPK by inverse agonists in six naturally occurring constitutively active mutant human melanocortin-4 receptors. \u003cem\u003eBiochim. Biophys. Acta.\u003c/em\u003e \u003cstrong\u003e1832\u003c/strong\u003e,1939-1948(2013).\u003c/li\u003e\n\u003cli\u003eSchwartz MW, Woods SC, Porte D Jr, Seeley RJ, Baskin DG. Central nervous system control of food intake. \u003cem\u003eNature\u003c/em\u003e.\u003cstrong\u003e404\u003c/strong\u003e,661-671(2000).\u003c/li\u003e\n\u003cli\u003eDaniels D, Patten CS, Roth JD, Yee DK, Fluharty SJ. Melanocortin receptor signaling through mitogen-activated protein kinase in vitro and in rat hypothalamus. \u003cem\u003eBrain. Res. \u003c/em\u003e\u003cstrong\u003e986\u003c/strong\u003e,1-11(2003).\u003c/li\u003e\n\u003cli\u003eChen X. et al. Deficient melanocortin-4 receptor causes abnormal reproductive neuroendocrine profile in female mice. \u003cem\u003eReproduction\u003c/em\u003e. \u003cstrong\u003e153\u003c/strong\u003e,267-276(2017).\u003c/li\u003e\n\u003cli\u003eVongs A, Lynn NM, Rosenblum CI. Activation of MAP kinase by MC4-R through PI3 kinase. \u003cem\u003eRegul. Pept.\u003c/em\u003e \u003cstrong\u003e120\u003c/strong\u003e,113-118(2004).\u003c/li\u003e\n\u003cli\u003eChai B, Li JY, Zhang W, Newman E, Ammori J, Mulholland MW. Melanocortin-4 receptor-mediated inhibition of apoptosis in immortalized hypothalamic neurons via mitogen-activated protein kinase. \u003cem\u003ePeptides\u003c/em\u003e. \u003cstrong\u003e27\u003c/strong\u003e,2846-2857(2006).\u003c/li\u003e\n\u003cli\u003eZandi MR. et al. Hypothalamic Expression of Melanocortin-4 Receptor and Agouti-related Peptide mRNAs During the Estrous Cycle of Rats. \u003cem\u003eInt. J. Mol. Cell. Med.\u003c/em\u003e\u003cstrong\u003e3\u003c/strong\u003e,183-189(2014).\u003c/li\u003e\n\u003cli\u003eXue P. et al. Association of obesity and menarche SNPs and interaction with environmental factors on precocious puberty. \u003cem\u003ePediatr. Res.\u003c/em\u003e 10.1038/s41390-024-03168-6(2024).\u003c/li\u003e\n\u003cli\u003eSandrock M. et al. Reduction in corpora lutea number in obese melanocortin-4-receptor-deficient mice. \u003cem\u003eReprod. Biol. Endocrinol.\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e,24(2009).\u003c/li\u003e\n\u003cli\u003eSartin JL, Daniel JA, Whitlock BK, Wilborn RR. Selected hormonal and neurotransmitter mechanisms regulating feed intake in sheep. \u003cem\u003eAnimal\u003c/em\u003e. \u003cstrong\u003e4\u003c/strong\u003e,1781-1789(2010).\u003c/li\u003e\n\u003cli\u003eHern\u0026aacute;ndez-Herrera DY, Carrillo-Gonz\u0026aacute;lez DF, Rinc\u0026oacute;n-Fl\u0026oacute;rez JC. Association of the MC4R gene with growth traits and meat quality in Colombian hair sheep. \u003cem\u003eJ. Adv. Vet. Anim. Res.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e,449-457(2023).\u003c/li\u003e\n\u003cli\u003eShishay G. et al. Variation in the Promoter Region of the MC4R Gene Elucidates the Association of Body Measurement Traits in Hu Sheep. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e,240(2019).\u003c/li\u003e\n\u003cli\u003eMerkley CM, Shuping SL, Sommer JR, Nestor CC. Evidence That Agouti-Related Peptide May Directly Regulate Kisspeptin Neurons in Male Sheep. \u003cem\u003eMetabolites\u003c/em\u003e. \u003cstrong\u003e11\u003c/strong\u003e,138(2021).\u003c/li\u003e\n\u003cli\u003eKim CS. et al. Identification of domains directing specificity of coupling to G-proteins for the melanocortin MC3 and MC4 receptors. \u003cem\u003eJ. Biol. Chem\u003c/em\u003e. 277, 31310-31317(2002).\u003c/li\u003e\n\u003cli\u003eFrisch RE, Hegsted DM, Yoshinaga K. Body weight and food intake at early estrus of rats on a high-fat diet. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e U S A. \u003cstrong\u003e72\u003c/strong\u003e,4172-4176(1975).\u003c/li\u003e\n\u003cli\u003eBroughton DE, Moley KH. Obesity and female infertility: potential mediators of obesity\u0026apos;s impact. \u003cem\u003eFertil. Steril.\u003c/em\u003e \u003cstrong\u003e107\u003c/strong\u003e,840-847(2017).\u003c/li\u003e\n\u003cli\u003eArmstrong A, Berger M, Al-Safi Z. Obesity and reproduction. \u003cem\u003eCurr. Opin. Obstet. Gynecol.\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e,184-189(2022).\u003c/li\u003e\n\u003cli\u003eShan HL. et al. Association of the melanocortin 4 receptor (MC4R) gene polymorphism with growth traits of Hu sheep. \u003cem\u003eSmall. Ruminant. Research.\u003c/em\u003e \u003cstrong\u003e192\u003c/strong\u003e. 10.1016/j.smallrumres.2020.106206(2020).\u003c/li\u003e\n\u003cli\u003eSoto R, Terrazas A, Poindron P, Gonz\u0026aacute;lez-Mariscal G. Regulation of maternal behavior, social isolation responses, and postpartum estrus by steroid hormones and vaginocervical stimulation in sheep. \u003cem\u003eHorm. Behav.\u003c/em\u003e \u003cstrong\u003e136\u003c/strong\u003e,105061(2021).\u003c/li\u003e\n\u003cli\u003eSchillo KK. Effects of dietary energy on control of luteinizing hormone secretion in cattle and sheep. \u003cem\u003eJ. Anim. Sci. \u003c/em\u003e\u003cstrong\u003e70\u003c/strong\u003e,1271-1282(1992).\u003c/li\u003e\n\u003cli\u003eChen S, Zhou Y, Chen Y, Gu J. fastp: an ultra-fast all-in-one FASTQ preprocessor. \u003cem\u003eBioinformatics\u003c/em\u003e. \u003cstrong\u003e34\u003c/strong\u003e, i884-i890(2018).\u003c/li\u003e\n\u003cli\u003eLi H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. \u003cem\u003eBioinformatics\u003c/em\u003e. \u003cstrong\u003e25\u003c/strong\u003e,1754-1760(2009).\u003c/li\u003e\n\u003cli\u003eLi H. et al.1000 Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools.\u003cem\u003e Bioinformatics\u003c/em\u003e.\u003cstrong\u003e25\u003c/strong\u003e, 2078-2079(2009).\u003c/li\u003e\n\u003cli\u003eWang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. \u003cem\u003eNucleic. Acids. Res\u003c/em\u003e. \u003cstrong\u003e38\u003c/strong\u003e, e164(2010).\u003c/li\u003e\n\u003cli\u003eKang HM. et al. Variance component model to account for sample structure in genome-wide association studies. \u003cem\u003eNat. Genet. \u003c/em\u003e\u003cstrong\u003e42\u003c/strong\u003e,348-354(2010).\u003c/li\u003e\n\u003cli\u003eGlas E, M\u0026uuml;ckter H, Gudermann T, Breit A. Exchange factors directly activated by cAMP mediate melanocortin 4 receptor-induced gene expression. \u003cem\u003eSci. Rep\u003c/em\u003e. \u003cstrong\u003e6\u003c/strong\u003e,32776(2016).\u003c/li\u003e\n\u003cli\u003eYou L, Kruse FE, Bacher S, Schmitz ML. Lipoteichoic acid selectively induces the ERK signaling pathway in the cornea. \u003cem\u003eInvest. Ophthalmol. Vis. Sci\u003c/em\u003e. \u003cstrong\u003e43\u003c/strong\u003e,2272-2277(2002).\u003c/li\u003e\n\u003cli\u003eYan Y. et al. The c.612A\u0026gt;G mutation of MC4R affects constitutive activity and signaling in domestic goats. \u003cem\u003eAnim. Genet.\u003c/em\u003e\u003cstrong\u003e53\u003c/strong\u003e, 665-675(2022).\u003c/li\u003e\n\u003cli\u003eTarazona S, Garc\u0026iacute;a-Alcalde F, Dopazo J, Ferrer A, Conesa A. Differential expression in RNA-seq: a matter of depth. \u003cem\u003eGenome. Res\u003c/em\u003e. \u003cstrong\u003e21\u003c/strong\u003e,2213-2223(2011).\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1. Sample information\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"512\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eBreeds\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\" valign=\"top\"\u003e\n \u003cp\u003eAbbreviations\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\" valign=\"top\"\u003e\n \u003cp\u003eEstrus type\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003eNumber\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eCele black sheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\"\u003e\n \u003cp\u003eCLB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\" valign=\"top\"\u003e\n \u003cp\u003eyear-round estrus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eHu sheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\"\u003e\n \u003cp\u003eHUS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\" valign=\"top\"\u003e\n \u003cp\u003eyear-round estrus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eLarge Tail Han sheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\"\u003e\n \u003cp\u003eLTH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\" valign=\"top\"\u003e\n \u003cp\u003eyear-round estrus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eSishui fur sheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\"\u003e\n \u003cp\u003eSSS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\" valign=\"top\"\u003e\n \u003cp\u003eyear-round estrus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eSmall Tail Han sheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\"\u003e\n \u003cp\u003eSTH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\" valign=\"top\"\u003e\n \u003cp\u003eyear-round estrus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003e29\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eWadi sheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\"\u003e\n \u003cp\u003eWDS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\" valign=\"top\"\u003e\n \u003cp\u003eyear-round estrus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eBayinbuluke sheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\"\u003e\n \u003cp\u003eBYK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\" valign=\"top\"\u003e\n \u003cp\u003eseasonal estrus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003e31\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eDiqing sheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\"\u003e\n \u003cp\u003eDQS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\" valign=\"top\"\u003e\n \u003cp\u003eseasonal estrus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eChaka sheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\"\u003e\n \u003cp\u003eCKS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\" valign=\"top\"\u003e\n \u003cp\u003eseasonal estrus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eTan sheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\"\u003e\n \u003cp\u003eTAN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\" valign=\"top\"\u003e\n \u003cp\u003eseasonal estrus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003e38\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eTengchong sheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\"\u003e\n \u003cp\u003eTCS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\" valign=\"top\"\u003e\n \u003cp\u003eseasonal estrus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eTibetan sheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\"\u003e\n \u003cp\u003eTIB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\" valign=\"top\"\u003e\n \u003cp\u003eseasonal estrus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eWaggir Sheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\"\u003e\n \u003cp\u003eWGS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\"\u003e\n \u003cp\u003eseasonal estrus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eOula sheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\"\u003e\n \u003cp\u003eOLS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\"\u003e\n \u003cp\u003eseasonal estrus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eWuzhumuqin sheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\"\u003e\n \u003cp\u003eWZM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\" valign=\"top\"\u003e\n \u003cp\u003eseasonal estrus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.07240704500978%\"\u003e\n \u003cp\u003eYunnan sheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.59099804305284%\"\u003e\n \u003cp\u003eYNS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.59491193737769%\" valign=\"top\"\u003e\n \u003cp\u003eseasonal estrus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.741682974559687%\"\u003e\n \u003cp\u003e45\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 2.\u0026nbsp;The signaling properties of WT and mutant \u003cem\u003eMC4R\u003c/em\u003es in response to ligand stimulation.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"558\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.387791741472173%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eLigand\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.310592459605028%\" rowspan=\"2\" valign=\"top\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd width=\"40.754039497307005%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003ecAMP Response\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.5475763016158%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eMAPK/ERK Response\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"29.342723004694836%\" valign=\"top\"\u003e\n \u003cp\u003eEC\u003csub\u003e50\u003c/sub\u003e (\u0026micro;M)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.943661971830984%\" valign=\"top\"\u003e\n \u003cp\u003eRmax(%WT)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.300469483568076%\" valign=\"top\"\u003e\n \u003cp\u003eEC\u003csub\u003e50\u003c/sub\u003e (\u0026micro;M)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.413145539906104%\" valign=\"top\"\u003e\n \u003cp\u003eRmax(%WT)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.365591397849462%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026alpha;-MSH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.290322580645162%\" valign=\"top\"\u003e\n \u003cp\u003eWT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.40143369175627%\" valign=\"top\"\u003e\n \u003cp\u003e0.13\u0026plusmn;0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.27956989247312%\" valign=\"top\"\u003e\n \u003cp\u003e100.0\u0026plusmn;7.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.025089605734767%\" valign=\"top\"\u003e\n \u003cp\u003e0.98\u0026plusmn;0.03\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.63799283154122%\" valign=\"top\"\u003e\n \u003cp\u003e100.0\u0026plusmn;3.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.883435582822086%\" valign=\"top\"\u003e\n \u003cp\u003eM173\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.562372188139058%\" valign=\"top\"\u003e\n \u003cp\u003e0.03\u0026plusmn;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.858895705521473%\" valign=\"top\"\u003e\n \u003cp\u003e122.4\u0026plusmn;2.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.427402862985684%\" valign=\"top\"\u003e\n \u003cp\u003e0.26\u0026nbsp;\u0026plusmn;0.03\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.267893660531698%\" valign=\"top\"\u003e\n \u003cp\u003e116.2\u0026plusmn;2.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.883435582822086%\" valign=\"top\"\u003e\n \u003cp\u003eP value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.562372188139058%\" valign=\"top\"\u003e\n \u003cp\u003e0.009\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.858895705521473%\" valign=\"top\"\u003e\n \u003cp\u003e0.0001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.427402862985684%\" valign=\"top\"\u003e\n \u003cp\u003e0.004\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.267893660531698%\" valign=\"top\"\u003e\n \u003cp\u003e0.227\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.365591397849462%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026beta;-MSH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.290322580645162%\" valign=\"top\"\u003e\n \u003cp\u003eWT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.40143369175627%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;0.46\u0026plusmn;0.07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.27956989247312%\" valign=\"top\"\u003e\n \u003cp\u003e100.1\u0026plusmn;1.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.025089605734767%\" valign=\"top\"\u003e\n \u003cp\u003e5.61\u0026nbsp;\u0026plusmn;2.16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.63799283154122%\" valign=\"top\"\u003e\n \u003cp\u003e100.0\u0026plusmn;5.2\u003csup\u003e\u0026nbsp;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.883435582822086%\" valign=\"top\"\u003e\n \u003cp\u003eM173\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.562372188139058%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;0.05\u0026plusmn;0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.858895705521473%\" valign=\"top\"\u003e\n \u003cp\u003e104.5\u0026plusmn;1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.427402862985684%\" valign=\"top\"\u003e\n \u003cp\u003e3.59\u0026plusmn;1.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.267893660531698%\" valign=\"top\"\u003e\n \u003cp\u003e138.7\u0026plusmn;2.4\u003csup\u003e\u0026nbsp;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"12.883435582822086%\" valign=\"top\"\u003e\n \u003cp\u003eP value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.562372188139058%\" valign=\"top\"\u003e\n \u003cp\u003e0.0003\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.858895705521473%\" valign=\"top\"\u003e\n \u003cp\u003e0.067\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.427402862985684%\" valign=\"top\"\u003e\n \u003cp\u003e0.547\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.267893660531698%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp; 0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Year-round Estrus, MC4R, Functional mutation","lastPublishedDoi":"10.21203/rs.3.rs-4513754/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4513754/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eInvestigating the key genes and mutations regulating year-round estrus can enhance the reproductive performance of sheep, thereby boosting sheep industry efficiency. In this study, we employed genomic research methods to analyze whole-genome resequencing data from 392 sheep, including six year-round estrus breeds and ten seasonal estrus breeds. Here we show the Melanocortin 4 receptor (MC4R) gene as a significant player in the regulation of year-round estrus in sheep. Specifically, I173M (g.59480440G\u0026thinsp;\u0026gt;\u0026thinsp;C, P.Ile173Met), demonstrating potential relevance to sheep estrus, was identified in MC4R. The mutation frequency of this variant was higher in year-round estrus breeds than in seasonal estrus breeds, suggesting it could be a crucial functional mutation affecting sheep estrus. Transcriptome sequencing analysis indicated that genes differentially expressed after transfection with the M173 receptor were enriched in pathways related to reproduction such as GnRH signaling pathway and Ovarian steroidogenesis. Subsequent functional exploration revealed that the I173M mutation enhanced cAMP and MAPK/ERK signal transduction activation, increased receptor constitutive activity, and significantly improved receptor function. Consequently, we posit that MC4R is involved in regulating year-round estrus and the I173M mutation in the MC4R gene identified as a pivotal functional mutation influencing year-round estrus in sheep.\u003c/p\u003e","manuscriptTitle":"Cellular mechanism of gain-of-function mutation I173M in sheep MC4R gene identified in year-round and seasonal estrus breeds through whole-genome resequencing","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-03 06:19:55","doi":"10.21203/rs.3.rs-4513754/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c9fe37ef-32a7-4e02-9fb5-3336afa93e20","owner":[],"postedDate":"July 3rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":33354553,"name":"Biological sciences/Genetics/Animal breeding"},{"id":33354554,"name":"Biological sciences/Genetics/Gene expression"}],"tags":[],"updatedAt":"2024-08-30T13:55:32+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-03 06:19:55","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4513754","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4513754","identity":"rs-4513754","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}