C-LTMRs Regulate Thermosensation and Gate the Transition from Acute to Chronic Pain

C-LTMRs Regulate Thermosensation and Gate the Transition from Acute to Chronic Pain | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article C-LTMRs Regulate Thermosensation and Gate the Transition from Acute to Chronic Pain Aziz Moqrich, Guillaume Robert, Karine Magalon, Aude Charron, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7198392/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted You are reading this latest preprint version Abstract C-low threshold mechanoreceptors (C-LTMRs) are traditionally associated with affective touch, yet emerging evidence suggests broader roles in sensory processing and pain modulation. We developed an intersectional genetic approach to selectively ablate C-LTMRs in adult mice by combining Nav1.8 IRES-FLPo and TH CreER drivers with a conditional DTR reporter. This approach yields robust, tissue-specific deletion of C-LTMRs without off-target effects in non-sensory tissues. C-LTMR-ablated mice exhibit altered thermotaxis behavior, including a sharpened and spatially restricted preference for warmth, while maintaining largely intact responses to touch. Remarkably, following surgical or chemotherapeutic injury, these mice display persistent mechanical and cold hypersensitivity, implicating C-LTMRs in the resolution of pain. Transcriptomic profiling of dorsal root ganglia (DRG) and dorsal horn of the spinal cord (DHSC) revealed widespread transcriptional dysregulation in pathways related to extracellular matrix remodeling, vascular function and gliogenesis in naive mice. In C-LTMR-ablated mice, paclitaxel failed to induce pro-recovery transcriptional programs and instead promoted persistent neuroinflammatory signatures. These findings establish C-LTMRs as key modulators of pain recovery, acting through tissue-specific transcriptional programs that suppress inflammation and support sensory homeostasis. Biological sciences/Neuroscience/Somatosensory system/Pain/Chronic pain Biological sciences/Neuroscience/Molecular neuroscience Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 INTRODUCTION Mechanical allodynia (pain elicited by normally innocuous mechanical stimuli) is a hallmark of several chronic pain conditions and remains a particularly challenging symptom to treat. A classical explanation for this phenomenon is provided by the gate control theory (GCT) of pain, first proposed by Melzack and Wall in 1965 1 . This model posits that tissue injury disrupts the inhibitory spinal "gate" circuits, allowing input from Aβ low-threshold mechanoreceptors to engage the pain pathway, thereby converting touch into pain. While this framework has guided decades of research, it may not fully capture the complexity of sensory modulation in chronic pain. Emerging evidence suggests that C-low-threshold mechanoreceptors (C-LTMRs), a class of unmyelinated sensory afferents traditionally associated with affective touch, may also play an active role in pathological pain states, potentially contributing to aberrant gating processes 2 . C-LTMRs are specialized sensory neurons that respond preferentially to gentle stroking and innocuous cooling. Found in humans and other mammals, including cats and primates 3 , 4 , their human counterparts, C-tactile afferents, are tuned to slow velocities (~ 3 cm/s) and skin temperature (~ 32°C), aligning with the perception of pleasant touch 5 , 6 . These afferents terminate around hair follicles and project to lamina II of the dorsal horn, a key site for nociceptive and non-nociceptive integration 7 . At the molecular level, C-LTMRs are marked by the expression of VGLUT3, tyrosine hydroxylase (TH), and TAFA4 8–15 , and are known to influence autonomic processes such as heart rate and to exert central effects through after-discharges and neuromodulation 16 . Importantly, C-LTMRs appear to have dual roles in pain modulation. Human studies show that their activation can produce both anti-nociceptive effects, such as reduced thermal or chemical pain 17 , 18 , and pro-nociceptive responses, such as mechanical or cold allodynia in muscle pain and delayed-onset muscle soreness 19 – 22 . Alterations in C-tactile function have also been observed in chronic pain conditions like migraine and fibromyalgia, suggesting a broader role in central sensitization 23 , 24 . Rodent studies have further explored the involvement of C-LTMRs in pain, but they suffer from important methodological limitations that complicate interpretation. For example, initial findings using VGLUT3-KO mice suggested that C-LTMRs contribute to mechanical hypersensitivity 13 , but follow-up work showed this phenotype was due to transient VGLUT3 expression in spinal neurons, not in C-LTMRs themselves 25 . Similarly, conditional inactivation of Cav3.2 in Nav1.8-lineage neurons, intended to target Cav3.2 function in C-LTMRs, reduced pain responses 26 , but the broader expression of this marker in other C-fiber subsets undermines the specificity of these conclusions. Optogenetic studies also face similar challenges. Noble et al. (2022) showed that activation of TH-lineage neurons in injured mice induced aversive behaviors, implicating a pronociceptive role for C-LTMRs 27 . However, TH is also expressed in sympathetic fibers, leaving open the possibility that the observed effects were not specific to C-LTMRs. In the context of chemotherapy-induced pain, optogenetic stimulation of VGLUT3-lineage cells produced nocifensive behaviors in oxaliplatin-treated mice 28 , but again, lineage tracing does not guarantee functional specificity to C-LTMRs. On the other hand, several studies using TAFA4 and Bhlha9 KO mice as well as GINIP-DTR mice have proposed anti-nociceptive roles for C-LTMRs 8 , 29 – 31 , suggesting these neurons may also contribute to the resolution of pain. Yet, these findings rely on global gene deletions, dual ablation of C-LTMRs and MRGPRD + mechanonociceptors or exogenous protein application, all of which fail to isolate the endogenous and cell-specific contributions of C-LTMRs. Taken together, while experimental data from both human and animal studies suggest that C-LTMRs may exert bidirectional effects on pain, current approaches, including global and conditional knock-out models, lack the cellular and temporal specificity necessary to definitively link C-LTMRs to specific pain phenotypes. These limitations highlight the need for more precise, lineage-restricted, and temporally controlled strategies to clarify the true functional role of C-LTMRs in pain modulation. In this study, we developed a novel, inducible genetic model to selectively ablate C-LTMRs in adult mice. By crossing Nav1.8 IRES - FLPo ; TH CreER mice with a dual-recombinase reporter line expressing diphtheria toxin receptor (DTR), we achieved robust, tissue-specific ablation of C-LTMRs. This inducible genetic strategy circumvents the off-target effects and developmental compensations commonly associated with traditional knockout models. Using this approach, we demonstrate that partial ablation of C-LTMRs in adult mice does not substantially impair touch behaviors but markedly alters thermotaxis preferences and significantly promotes the transition from acute to chronic pain following both surgical and chemotherapeutic injury. Transcriptomic analyses of DRG and spinal cord tissues confirmed the selective loss of C-LTMRs-specific markers and revealed broad dysregulation of genes involved in synaptic transmission, thermogenesis, immune signaling, and detoxification pathways. Systemic TAFA4 treatment prevented chronic pain in C-LTMRs-DTR mice and reestablished transcriptional homeostasis by suppressing maladaptive vascular, structural, and excitability pathways while boosting metabolic and neuroprotective programs in both the DRG and spinal cord. These findings establish C-LTMRs as key modulators of thermal preference and critical contributors to the recovery processes after injury. RESULTS Tissue specific and inducible ablation of C-LTMRs Previous studies from our laboratory have suggested that, beyond their well-established role in mediating pleasant touch, C-LTMRs may also modulate pain following tissue injury 8 , 30 . To directly test this hypothesis, we developed a genetic strategy enabling the selective and inducible ablation of C-LTMRs in adult mice. We crossed Na v 1.8 Ires − FLPo ;TH CreER mice with a reporter line expressing the simian diphtheria toxin receptor (DTR) under the control of a pan-neuronal Tau promoter flanked by loxP and FRT stop cassettes (Tau loxP−STOP−loxP−FRT−STOP−FRT−DTR ) (Fig. 1A). This breeding strategy yielded two genotypes: experimental Na v 1.8 Ires − FLPo ;TH CreER ;Tau DTR (hereafter referred to as C-LTMRs-DTR mice) and control Na v 1.8 Ires − FLPo ;Tau DTR (hereafter referred to as control mice). To induce targeted neuronal ablation, we administered tamoxifen (oral gavage, once daily for five consecutive days) to 3-week-old mice, followed one week later by two intraperitoneal injections of diphtheria toxin (DT) spaced two days apart. All subsequent analyses were conducted at 11 weeks of age (Fig. 1A). To assess the efficacy and specificity of C-LTMRs ablation, we quantified the number of tyrosine hydroxylase-positive (TH + ) neurons in lumbar (L3) dorsal root ganglia (DRG) (Figs. 1B and C). Compared to controls, C-LTMRs-DTR mice exhibited an approximately 50% reduction in TH + neuron counts (Fig. 1C) (control: 625,5 ± 62,38; C-LTMRs-DTR : 315 ± 25.88; n = 4). Consistently, expression of C-LTMRs-enriched markers such as TAFA4 and Ceacam10 (Delfini et al., 2013; Reynders et al., 2015) was markedly reduced in C-LTMRs-DTR mice (Figs. 1D and E). In contrast, markers excluded from C-LTMRs, including CGRP, P2X3, IB4, TrkC, and NF200 remained unchanged (Figs. S1A and B), supporting the selectivity of our ablation approach. At the spinal cord level, C-LTMRs-DTR mice showed a pronounced decrease of VGLUT3 immunoreactivity specifically in lamina II inner of the dorsal horn (Fig. 1F). This was corroborated by electron microscopy (EM), which revealed a dramatic reduction in VGLUT3 + glomeruli in C-LTMRs-DTR mice compared to controls (Fig. 1G). This is consistent with the large decrease of the number of non-labelled glomeruli observed in C-LTMRs-DTR mice (Fig. S1 D). Even though a mild but significant decrease in IB4 + glomeruli could be observed using EM (Fig S1 E), we could not see significant difference in the central projections of CGRP + and IB4 + afferents (Fig. S1 C), which is consistent with the specificity of C-LTMRs targeting. Additionally, the analysis revealed the presence of some VGLUT3 + glomeruli with atypical morphology, referred to as “strange” glomeruli, which exhibited a markedly reduced density of synaptic vesicles compared to typical (“normal”) glomeruli (Fig. 1H). These “strange” glomeruli were only observed in C-LTMRs-DTR mice (Fig. 1H) suggesting a functional deficit in some of the 50% remaining VGLUT3 + glomeruli. To rule out off-target effects in non-sensory tissues, we crossed Nav1.8 Ires − FLPo mice with the RC::FL-hM3Dq reporter line 32 , allowing visualization of Nav1.8 -lineage via EGFP expression (Fig. S2A). EGFP signal was absent from known TH + regions such as Substantia Nigra pars compacta (SNpc) in the brain (Fig. S2B), jugular/nodose ganglion (JNG) in which a faint colocalization signal is occasionally detectable (Fig. S2C), and celiac ganglia (Fig. S2D). These data confirm that Nav1.8 -driven FLPo activity, and thus C-LTMRs ablation, is restricted to primary sensory neurons. Together, these results demonstrate that our genetic model enables robust, inducible, and tissue-specific ablation of C-LTMRs in adult mice. This approach provides a powerful tool for dissecting the functional contributions of C-LTMRs to somatosensation and pain modulation. Partial ablation of C-LTMRs alters thermotaxis behavior without significantly affecting touch responses We first sought to assess the impact of partial ablation of C-LTMRs on general behavior. C-LTMRs-DTR mice appeared normal in terms of open field (Figure S3A), and rotarod (Figure S3B) profiles, indicating that a 50% reduction in C-LTMRs does not result in detectable alterations in motor activity or anxiety-like behavior. While C-LTMRs are classically associated with affective touch, several studies have suggested they may also play a role in temperature perception 7 , 26 , 29 . To directly investigate their contribution to thermosensation, we assessed thermotaxis behavior of C-LTMRs-DTR mice using a temperature gradient paradigm. Over a 90-minute session, C-LTMRs-DTR mice of both sexes exhibited a significantly sharper and more spatially restricted preference for warmer temperatures compared to their control littermates (Figs. 2A and 2B). When we analyzed behavior in the first 30-minute interval, all groups explored the arena in a similar manner, indicating normal exploratory drive (Figs. 2C and D). By the second interval, both control and C-LTMRs-DTR males began favoring warmer zones, but this preference was significantly more pronounced in ablated mice and further intensified during the last 30 minutes (Fig. 2C). A similar, yet more striking, effect was observed in females: while control females continued to explore a broader range of temperatures, C-LTMRs-DTR females rapidly developed and maintained a strong preference for warmer areas, closely mirroring the male ablation phenotype (Fig. 2D). To ensure this thermotaxis phenotype was not confounded by motor deficits, we quantified total distance travelled across each phase. All groups covered comparable distances during the first 30 minutes (control males: 8041 ± 412,1 cm, C-LTMRs-DTR males: 8039 ± 318,3cm, control females: 6984 ± 343cm, C-LTMRs-DTR females: 7443 ± 403,1cm), confirming intact locomotor function (Fig. 2E). During the second and third intervals, movement decreased in all groups as temperature preferences consolidated (Fig. 2E). Notably, C-LTMRs-DTR males travelled significantly less than controls in the final phase (1325 ± 258.6 cm vs. 2774 ± 354,3cm), consistent with significantly higher sharp and net preference for the warm zone of the arena (Fig. 2E). No significant difference was observed between female groups, likely due to broader zone occupancy across genotypes (Fig. 2E). Next, we sought to evaluate whether the partial ablation of C-LTMRs also affects touch responses. To do so, we assessed behavioral outcomes using the tape removal 33 and the oil drop assay 34 . In both paradigms, C-LTMRs-DTR mice performed similarly (in terms of number of wet dog shakes) to controls, indicating that basic touch perception remains largely intact under our C-LTMRs’ ablation conditions (Figs. 2F and G). However, in the tape test, we observed a mild but consistent delay in the onset of the characteristic “wet-dog shake” response in C-LTMRs-DTR mice (Fig. 2F), a behavior recently linked to C-LTMRs-mediated activation of the spinoparabrachial pathway 34 . Together, these findings demonstrate a novel role for C-LTMRs in shaping thermotaxis behavior and spatial temperature discrimination, while suggesting that the baseline detection of touch may either require the full complement of C-LTMRs or depend on subpopulations that remain intact in our ablation set up. Partial ablation of C-LTMRs facilitates the transition to chronic pain following injury In earlier work, we identified GINIP (Gα-inhibitory interacting protein) as a marker of two distinct populations of dorsal root ganglion (DRG) neurons: MRGPRD-expressing mechanonociceptors and TAFA4-expressing C-LTMRs 35 . Using a genetic ablation approach targeting both populations simultaneously, we later showed that GINIP-DTR mice displayed normal onset and resolution of mechanical hypersensitivity in both the Complete Freund’s Adjuvant (CFA) inflammatory model and the chronic constriction injury (CCI) model of neuropathic pain 30 . We hypothesized that this lack of phenotype could be due to compensatory effects between the two ablated populations: specifically, that ablation of MRGPRD + neurons alone would be analgesic 36 , while ablation of C-LTMRs alone would exaggerate injury-induced pain. Thus, the concurrent deletion of both populations may have masked the individual contributions of each. To directly test the specific role of C-LTMRs in injury-induced pain, we examined C-LTMRs-DTR and control mice in two complementary models: the paw incision surgery as a model of acute post-operative pain 37 and paclitaxel-induced chemotherapy-induced peripheral neuropathy (CIPN), a model of chronic neuropathic pain 38 . Mechanical sensitivity was assessed at baseline and multiple time points post-injury using the Von Frey up-and-down method. At baseline, both male and female C-LTMRs-DTR mice exhibited a modest but significant reduction in mechanical thresholds compared to controls (Figs. 3A; n = 43 and 44, respectively and S4A). To account for this difference, all subsequent data were normalized to individual baselines and expressed as percentage changes. In the paw incision model, both C-LTMRs-DTR and control mice developed robust mechanical hypersensitivity in the ipsilateral hindpaw by day 1 post-surgery (Fig. 3B; n = 24 per group). While hypersensitivity gradually resolved in control animals, C-LTMRs-DTR mice displayed a persistent pain phenotype that lasted up to 43 days, indicating impaired recovery (Fig. 3B). Moreover, repetitive stimulation of the contralateral (uninjured) paw revealed a significant reduction in mechanical threshold in C-LTMRs-DTR mice, but not in controls (Fig. 3C), suggesting an enhanced wind-up phenomenon or a generalized sensitization phenotype. No statistical differences were observed between males and females of both genotypes neither for the ipsilateral side nor the contralateral one. (Figs. S4B and C). To determine whether this effect extended to neuropathic pain, we employed the paclitaxel CIPN model (Fig. 3D). In both groups, paclitaxel administration induced mechanical hypersensitivity (Fig. 3E). However, C-LTMRs-DTR mice developed a significantly earlier onset and more severe mechanical hypersensitivity than controls, which persisted well beyond the treatment window, showing no signs of resolution (Fig. 3E). No statistical differences were observed between males and females of both genotypes (Fig. S4D). Given that paclitaxel is also known to induce cold allodynia, we assessed cold sensitivity using the dry ice test 39 . First at baseline level, no differences were observed between both genotypes and nor between sexes in each genotype (Fig. S4E). Repetitive paclitaxel injections led to a significant increase in cold sensitivity in C-LTMRs-DTR mice compared to controls starting at day 17 post-treatment (Figs. 3F and G). Taken together, these findings reveal a previously unappreciated role for C-LTMRs in the resolution of injury-induced pain. Their partial ablation delays recovery and promotes the transition from acute to chronic pain, suggesting that C-LTMRs act as modulators of protective sensory signaling during the recovery process. C-LTMRs ablation induces a primed, maladaptive transcriptional state To determine how selective C-LTMRs ablation perturbs somatosensory circuit homeostasis and predisposes mice to paclitaxel-induced chronic pain, we performed bulk RNA-seq on adult L3–L5 DRG and lumbar dorsal horn of the spinal cord (DHSC) from control and C-LTMRs-DTR mice at baseline (D0) and day 35 after paclitaxel (D35). At baseline, C-LTMRs loss triggered a strong transcriptional response in the DRG (177 DEGs; 65 up, 112 down; FDR 5%, |log₂FC| ≥ 0.3; Figs. 4A and S5B). Differential gene expression analysis confirmed effective C-LTMRs ablation, with marked downregulation of canonical C-LTMRs markers Th , Fam19a4 (TAFA4), Slc17a8 (VGLUT3), Cacna1i , Cd34 , Ceacam10 and many others (Figs. 4B and S5A). Downregulated genes were enriched for developmental processes, including vascular homeostasis, and metabolic and oxidative stress defenses, indicating DRG stress and altered neuronal integrity (Fig. 4C). Upregulated genes were associated with the regulation of circadian rhythmic processes, regulation of metal ion transport, notably processes involved in calcium homeostasis, including release of calcium sequestrated calcium into cytosol and immune or stress-response pathways, reflecting a hyperexcitable and pro-nociceptive state (Fig. 4C). These data are consistent with the results shown in Fig. 3C in which we show that repetitive stimulation of C-LTMRs-DTR mice caused a significant mechanical hypersensitivity in the uninjured paw. In the DHSC, C-LTMRs ablation produced an even broader transcriptional shift, with 694 DEGs (497 down, 197 up; FDR 5%, |log₂FC| ≥ 0.3; Figs. 4D and S5C). Downregulated genes corresponded to genes encoding extracellular matrix (ECM) and basement membrane components, vascular and endothelial markers, and glial or myelin-associated transcripts (Fig. 4E), which is consistent with our ultrastructural results highlighting a drastically weakened VGLUT3-positive glomeruli (Fig. 1H). Upregulated genes were enriched for glutamine transport and energy homeostasis modules, motor proteins assembly/disassembly, rhythmic processes, including circadian regulation of gene expression, nucleosome disassembly related to epigenetic regulation of gene expression as well as processes involved in the positive regulation of cold-induced thermogenesis (Fig. 4E). Together, C-LTMRs ablation establishes DRG and spinal environments marked by weakened structural and glial support, disrupted neurovascular stability, and heightened excitability and neuroimmune signaling, conditions that sensitize the system to chronic pain following injury or paclitaxel exposure. Surprisingly, at D35 after paclitaxel, differential gene expression was greatly reduced in both tissues, with only 16 DEGs in the DRG and 64 in the DHSC (FDR 5%, |log₂FC| ≥ 03, Figs. 4F and G), indicating that paclitaxel treatment dampened the extensive differential expression caused by C-LTMRs ablation in naïve DRG and DHSC. Among the 16 DEGs in the DRG, all were downregulated and consisted largely of C-LTMRs markers or highly enriched transcripts from this population (Figs. S6A and B). In the DHSC, 29 DEGs were downregulated and 35 upregulated (Figs. 4G and S6C). Metascape analysis failed to identify pathway enrichment among the downregulated genes. However, the vast majority of the upregulated genes were mainly involved in axogenesis and synapse organization, neutrophil response, including response to xenobiotic stimulus, suggesting that the DHSC is locked in a state of persistent low-grade inflammation and maladaptive synaptic reorganization, consistent with a spinal environment rewired toward heightened nociceptive transmission (Fig. 4H). TAFA4 rescues paclitaxel-induced chronic pain and restores transcriptional homeostasis Our previous studies demonstrated strong analgesic properties of TAFA4 8,31,40 . To test whether TAFA4 mitigates paclitaxel-induced chronic pain in C-LTMRs-DTR mice, we administered TAFA4 or vehicle twice daily for 7 days, while all mice received paclitaxel every two days over the same period (Fig. 5A). TAFA4-treated mice showed a slight delay in the onset of mechanical hypersensitivity and, importantly, exhibited significant pain relief at day 35, whereas, as expected, vehicle-treated mice developed persistent mechanical pain (Fig. 5B). To identify the mechanisms underlying this rescue, we performed bulk RNA-seq on DRG and DHSC from TAFA4- and vehicle-treated C-LTMRs-DTR mice at D35. TAFA4 treatment produced 39 DEGs in the DRG (22 up, 17 down) and 80 in the DHSC (35 up, 45 down; FDR 5%, |log₂FC| ≥ 0.3; Figs. 5C and D, S7A-B). In the DRG, Metascape failed to identify pathway enrichment in the up-regulated genes. In contrast, following TAFA4 administration, the downregulated genes were mainly involved in cell surface receptor protein tyrosine kinase signaling pathways, including protein phosphorylation (Fig. 5E). In the DHSC, transcripts related to metabolic regulation, including glucose homeostasis, amino acid metabolism and mitochondrial aerobic respiration and regulation of cold-induced thermogenesis were upregulated, while genes linked to structural remodeling, vascular and endothelial signaling, inflammatory immune response and to the response to mechanical stimuli were downregulated as a consequence of TAFA4 treatment (Fig. 5F). These coordinated transcriptional changes in both DRG and DHSC indicate restored vascular stability and metabolic resilience as well as the control of paclitaxel-induced inflammation, effectively re-establishing somatosensory circuit homeostasis and preventing chronic pain development. DISCUSSION In this study, we used an inducible dual-recombinase strategy to selectively ablate C-LTMRs in adult mice and uncovered an essential role for this sensory neuron population in maintaining somatosensory homeostasis. Although historically linked to pleasant touch, accumulating evidence suggests that C-LTMRs also contribute to innocuous thermal perception. Prior in vitro and ex vivo work has shown that C-LTMRs respond to gradual temperature changes, particularly across broad cooling and warming ranges, without signaling discrete thresholds 7 , 26 . Our behavioral findings support this thermosensory function in vivo . In a thermal gradient assay, mice with partial C-LTMRs ablation exhibited a significantly sharper and more spatially restricted preference for warmer temperatures compared to controls. This phenotype was consistent across sexes, emerged gradually, and was not attributable to deficits in locomotion or broad sensory impairment, as exploratory behavior and responses to noxious temperatures were preserved. These findings suggest that C-LTMRs contribute to the detection of relative temperature changes and help guide adaptive thermotaxis behavior. Unlike classical thermoreceptors, which rely on TRP channel-mediated detection of absolute thermal thresholds, C-LTMRs may provide a continuous, graded input that enhances subtle temperature discrimination. In humans, the pleasantness of touch is known to peak at skin temperature (~ 32°C), where CT afferents (the human equivalents of C-LTMRs) exhibit maximal firing 5 . This convergence of tactile and thermal tuning suggests that C-LTMRs encode not just mechanical features of touch, but also its thermal context. Despite this clear thermosensory phenotype, baseline tactile responses in C-LTMRs-DTR mice were largely preserved. In assays such as the tape removal test and oil drop assay, ablated animals performed comparably to controls. A minor but consistent delay in the wet-dog shake reflex was observed, a behavior recently linked to C-LTMRs-mediated engagement of the spinoparabrachial pathway 34 . These findings suggest that partial ablation either spares a sufficient number of C-LTMRs to support basic tactile perception or that redundant pathways involving other low-threshold mechanoreceptors compensate for the loss. Supporting the former hypothesis, single-cell RNA sequencing has identified two subsets of C-LTMRs distinguished by differing levels of tyrosine hydroxylase (TH) expression 9 . Given that the Th locus drives Cre recombinase expression in this model, it is plausible that the spared population contributing to residual tactile behaviors, including tape removal and the wet-dog shake, is the subset expressing lower levels of TH, and thus the subset that is spared in our experimental setting. A more striking phenotype emerged under conditions of repeated mechanical stimulation. C-LTMRs-DTR mice exhibited increased mechanical hypersensitivity in both acute and chronic pain models, including exaggerated responses to repetitive stimulation of uninjured tissue; a pattern resembling wind-up 41 . These data suggest that C-LTMRs are involved in suppressing this amplification process under normal conditions. This interpretation is supported by human psychophysical studies demonstrating that CT-targeted touch reduces wind-up pain and modulates cortical responses associated with central sensitization. For instance, Fidanza et al. (2021) showed that gentle stroking of CT-innervated skin inhibits wind-up, while similar stimuli to glabrous skin do not 42 . Wakui et al. (2025) further demonstrated that CT activation uniquely shapes cortical responses to repetitive mechanical input 43 . Similarly, Taneja et al. (2021) found that continuous CT-optimal stimulation alleviates hyperalgesia on remote body regions, but only when delivered with CT-specific parameters 44 . Together, these findings support a conserved role for C-LTMRs in damping excitatory spinal signaling and modulating central pain states. The most profound effect of C-LTMRs ablation was observed following injury. In both paw incision and paclitaxel-induced neuropathy models, C-LTMRs-DTR mice failed to recover from mechanical hypersensitivity and instead developed persistent pain. This occurred despite intact Aβ fibers and other low-threshold mechanoreceptors, underscoring a protective role for C-LTMRs in pain resolution and strongly implicating this enigmatic population in the gate control theory of pain 1 . While this theory has long provided a foundational framework in pain research, the specific afferent subtypes mediating gating mechanisms have remained elusive. Our findings provide direct evidence that C-LTMRs contribute to this gating function by modulating pain resolution after injury. Rather than broadly inhibiting nociceptive input, C-LTMRs appear to selectively constrain maladaptive plasticity during the transition from acute to chronic pain. Their loss unmasks latent sensitization, thereby promoting the development of prolonged pain states. How, mechanistically speaking, C-LTMRs contribute to the development of prolonged pain states? Transcriptomic profiling revealed that C-LTMRs loss fundamentally destabilizes somatosensory circuit homeostasis. Even in the absence of injury, ablation triggered broad transcriptional reprogramming in both DRG and DHSC, marked by reduced vascular and extracellular matrix support and heightened excitability, metabolic stress, and neuroimmune signaling. These changes define a primed molecular state that favors sensitization and provides a mechanistic basis for the exaggerated and persistent mechanical hypersensitivity observed behaviorally. Intriguingly, the DHSC showed the most extensive disruption, with downregulation of structural and glial programs and upregulation of pathways governing RNA processing, translational control, and intracellular signaling, which are key events for central sensitization. These central alterations align with the structural defects in VGLUT3 + glomeruli and suggest that C-LTMRs contribute critically to maintaining synaptic architecture and inhibitory balance within lamina IIi. Unexpectedly, paclitaxel treatment greatly attenuated the large transcriptional differences observed at baseline, with DEGs largely restricted to the remaining C-LTMRs-enriched transcripts. This normalization paradox may reflect a floor effect following the already profound transcriptional collapse triggered by C-LTMRs loss, or a convergence of transcriptional states as paclitaxel drives global somatosensory reprogramming in both genotypes 38 , 45 , 46 . Behaviorally, however, paclitaxel unmasked the functional vulnerability created by C-LTMRs ablation, producing exaggerated and persistent hypersensitivity. TAFA4 treatment reversed this vulnerability at both the behavioral and transcriptomic levels. In the DRG, TAFA4 downregulated genes associated with vascular stress, aberrant excitability, and synaptic destabilization while upregulating those supporting metabolic resilience and neuroprotection. In the DHSC, TAFA4 suppressed ECM and endothelial stress markers and restored programs involved in metabolic regulation and synaptic stability. These coordinated changes indicate that TAFA4 reestablishes the structural, vascular, and transcriptional homeostasis that C-LTMRs loss disrupts, thereby preventing the transition to chronic pain after paclitaxel. Together, our results define C-LTMRs as essential regulators of the molecular environment of both peripheral and central somatosensory circuits. Their loss destabilizes structural, vascular and metabolic support systems and elevates excitability and stress-response programs, creating a primed state highly susceptible to pathological sensitization. Conversely, TAFA4 restores homeostatic transcriptional programs across both DRG and DHSC, highlighting its therapeutic potential in chronic pain associated with sensory circuit destabilization. EXPERIMENTAL PROCEDURES Mice Mice were maintained under standard housing conditions (22°C, 40% humidity, 12 hr light cycles, and free access to food and water). Mice at 8 to 12 weeks of age and of both sexes were used for experiments. Particular efforts were made to minimize the number of mice used in this study, as well as the stress and suffering to which they were subjected. All experiments were conducted in line with the European guidelines for the care and use of laboratory animals (Council Directive 86/609/EEC). All experimental procedures were approved by an independent ethics committee for animal experimentation (APAFIS), as required by the French law and in accordance with the relevant institutional regulations of French legislation on animal experimentation, under license number APAFIS #34501. All experiments were performed in accordance with the ARRIVE guidelines. Generation of mouse lines Na v 1.8 Ires−FLPo mice 45 were crossed with TH 2ACreERT2 mice 46 and Tau ds-DTR (gift of Dr Martyn Goulding) to generate Na v 1.8 Ires−FLPo/+ ::TH 2ACreERT2/+ ::Tau ds-DTR/+ named C-LTMRs-DTR mice. Na v 1.8 Ires−FLPo/+ ::Tau ds-DTR/+ were used as control. Na v 1.8 Ires−FLPo mice 45 were crossed with RC::FL-hM3Dq mice 31 to generate Nav1.8 Ires-FLPo ::RC::FL-hM3Dq (related to Fig. S2). Tamoxifen treatmeant Tamoxifen (Sigma #T5648) was freshly prepared and dissolved in corn oil (Sigma #C8267) to a concentration of 20 mg/mL. Tamoxifen solution was administered by using oral gavage (Instech Laboratories™ Feeding tube, rodent oral gavage, stainless steel, 22ga x 25mm, straight, sterile_Brand: Instech Laboratories™ FTSS-22S-25), once daily for five consecutive days, to 3-week-old mice. Both C-LTMRs-DTR and control mice were treated. Diphteria toxin treatmeant Diphtheria Toxin (Sigma #322326-1MG) was dissolved in water then aliquoted and stored at -80°C. Diphteria Toxin solution was freshly prepared and administrated by using I.P (50µg/kg) on 2 days; separated by 48 h. Behavioral tests were performed 7 to 10 weeks after the initial DT injection. Both C-LTMRs-DTR and control mice were treated. Tissue processing for immunofluorescence (IF) and in situ hybridization (ISH) Mice of both sexes were used for all experiments. Mice were deeply anesthetized with 100 mg/kg ketamine plus 10 mg/kg xylazine, and were intracardially perfused with an ice-cold solution of phosphate-buffered saline (PBS) followed by 30 ml ice-cold 4% paraformaldehyde in PBS. Their tissues were dissected and post-fixed by overnight incubation in the same fixative at 4°C. DRG, JNG, celiac ganglion, and brain tissues were transferred to 30% (w/v) sucrose in PBS for cryoprotection and incubated at 4°C until they sank. They were then frozen in OCT medium and stored at −80 °C. Samples with a thickness of 12 μm (DRG, JNG) or 20µm (celiac), were cut with a standard cryostat (Leica). All these tissue sections were mounted on Superfrost slides and kept at −80°C until their use for IF experiments. Brain and the lumbar segment of the spinal cord were mounted in a small 3% agarose block. Sections with a thickness of 80 μm were cut with a Leica VT1200S vibratome, collected in a six-well plate filled with PBS and stored at 4°C until their use for IF experiments. Immunofluorescence For immunostaining, sections were incubated for 1 h at room temperature in PBS-10% (vol/vol) donkey serum (Sigma), 3% (weight/vol) bovine albumin (Sigma), 0.4% Triton X-100 and then overnight at 4°C with primary antibodies diluted in the same blocking solution. The primary antibodies used in this study were chicken anti-GFP (1:1000, Thermo Fisher Scientific, A10262); rabbit anti-P2X3 (1:1000 Neuromics Cat# RA10109, RRID:AB_2157931); rabbit anti-CGRP (1:1000, Cabiochem, PC205L, for DRG staining); rabbit anti-neurofilament M (145 kDa) (1:1000, Sigma-Aldrich AB1987) ; rabbit anti-TH (1:500, Sigma-Aldrich AB152); rat anti-TAFA4 (1:2000, a gift from Sophie Ugolini (CIML)); goat anti-TRKC (1:500, R and D Systems Cat# AF1404, RRID:AB_2155412); guinea pig anti-VGLUT3 (1:1000, Synaptic Systems, 135204). After three washes for 5 minutes each in 1xPBS, sections were incubated for 1 h at room temperature with secondary antibodies diluted in the blocking solution described above. The corresponding donkey anti-chicken, anti-rat, anti-rabbit, anti-goat or anti-guineapig Alexa 488-, 555-, or 647-conjugated secondary antibodies (1:500, Thermo Fisher Scientific) was used for the detection of primary antibody binding. Isolectin B4 conjugates with AlexaFluorR 647 dye were used at a dilution of 1:200 (Thermo Fisher Scientific I32450). Tissues were washed (3 times in 1xPBS) and mounted in ImmuMount Reagent. Images were acquired with an AxioImager M2 (Zeiss) fluorescence microscope with a 20x/0,8 objective and contrast was adjusted with Fiji software. Cell count The entire L3 DRG was sectioned at 12 µm thickness using step serial sectioning and distributed across seven slides, ensuring that each slide contained a representative cross-section of the entire ganglion. Quantification of TH-, CGRP-, or P2X3-positive neurons was performed on all DRG sections present on a single slide from the L3 level. To estimate the total number of TH + , CGRP + , or P2X3 + neurons in a whole L3 DRG, the count obtained from that single slide was multiplied by seven. All analyses were conducted blind to the genotype of the animals. In situ hybridization RNA probes were synthesized with gene-specific PCR primers and cDNA templates from mouse DRG. In situ hybridization was performed with digoxigenin-labeled probes (Roche, cat# 11277073910). Probes were incubated with the slides overnight at 55°C and the slides were then incubated with the horseradish peroxidase-conjugated anti-digoxigenin antibody 1:500 (Roche, Cat#11207733910; RRID:AB_514500). Final detection was achieved with TSA-Cy3 at a dilution of 1:50 (Perkin Elmer Life Sciences, FP1170). The following oligonucleotides were used for the nested PCRs for probe synthesis: Ceacam10 F1 gactactgctcacagcctcact Ceacam10 R1 cctactgctttttagcgtgaac Ceacam10 F2 tggtacaagggaaacagtgg Ceacam10 R2 TAATACGACTCACTATAGGGggcattagggtatgatcgaagt Electron Microscopy (EM) Tissue preparation for ultrastructural morphology Mice of both sexes were used for all experiments. Mice were deeply anesthetized with 100 mg/kg ketamine plus 10 mg/kg xylazine and perfused with Ringer solution followed by 1% PAF + 2% glutaraldehyde in 0.1 M phosphate buffer, pH 7.4. Lumbar spinal cord segments were dissected out and postfixed for 2 h in the same aldehyde mixture. Coronal sections were cut on a vibratome (Leica VT1000S) at a thickness of 100 μm. EM embedding Spinal cord sections were post-fixed in osmium ferrocyanide for 1 h at 4°C, dehydrated in graded acetone, incubated in acetone/Spurr resin (1:1; 30 min), acetone/Spurr resin (1:2; 30 min) and Spurr resin overnight at room temperature. Finally, sections were flat-embedded in Spurr resin in capped 00 BEEM capsules (Electron Microscopy Sciences) (24 h, at 70°C). Ultrathin sections were cut with an ultramicrotome (EM UC6, Leica) and collected on uncoated nickel grids (200 mesh). EM post-embedding immunostaining Ultrathin sections were doubled immunostained following a conventional post-embedding protocol 14 . Sections were treated for 3 min with a sodium borohydride solution (Sigma), rinsed in 1% Triton X-100 in Tris buffered saline (TBS) 0.5 M, and incubated for 1 h in 10% normal serum and/or bovine serum albumin. Grids were then incubated overnight on drops of a mixture of rabbit anti-VGLUT3 primary antibody (1:20, Synaptic System, Cat# 135203) and Lectin from Bandeiraea simplicifolia ( Griffonia simplicifolia ) biotin conjugated (IB4; 1:20; Sigma, Cat# L2140). After rinsing in TBS, sections were incubated in a mixture of anti-rabbit 20 nm-gold conjugated secondary antibody (1:15; BBI Solutions, Cardiff, United Kingdom) and Streptavidin 10 nm-gold conjugated (1:15, Sigma) for 1 h at 37°C. They were then transferred into drops of 2.5% glutaraldehyde in cacodylate buffer 0.05 M pH 7.4 for 10 min, and finally washed in distilled water. Sections were further counterstained for 30’’ with Uranyl Less EM Stain and for 30’’ with Lead citrate (Electron Microscopy Sciences, Hatfield, PA, USA). Grids were observed with a JEM-1400 Flash transmission electron microscope (Jeol, Tokyo, Japan). The Jeol Matataki Flash camera's automated montage system was employed to obtain electron micrographs. EM Quantification of Glomeruli We counted the number of glomeruli in lamina II to assess whether there was a loss after DT-selective ablation of C-LTMRs. We focused our analysis on counting non-peptidergic glomeruli of the type Ia (GIa) from control vs C-LTMRs-DTR animals in (i) plain ultrathin sections; and (ii) sections immunolabeled for IB4 and VGLUT3. Five sections/animal for control and C-LTMRs-DTR mice were examined in studies that were carried out by an operator unaware of the experimental group. More precisely, the experimenter directly counted the number of glomeruli within all the 90 × 90 µm squares of 200 mesh EM grids that were occupied by relevant tissue. Quantitative analysis was performed using the ImageJ software (NIH, Bethesda, USA) and Graph Pad Prism 6 (GraphPad Software, San Diego, CA, USA). Pain models Paw incision Paw incision surgery was performed as described by Brennan 36 . Mice were anesthetized with ketamine (40 mg/kg IP) and xylazine (5 mg/kg IP) and a longitudinal incision was made through the skin and fascia of the right hind paw. Forceps were used to elevate the flexor digitorum brevis muscle longitudinally and an incision was made through the muscle with a scalpel, to cut it into two halves. The wound was closed with sutures, and the animals were allowed to recover and returned to their cages. Paclitaxel treatment Paclitaxel (Sigma 580555-5MG) was dissolved in a mixture of 1:1 [1 volume ethanol/1 volume Kolliphor-620 (Kolliphor-EL Sigma C5135). Paclitaxel solution was extemporaly prepared at a concentration of 0.4 mg/mL by diluting the 5 mg/ml stock solution with 0.9% NaCl. The mice received an intraperitoneal injection of paclitaxel (4 mg/kg) every two days for a total of four injections. The last injection was administered 72 hours after the third injection. Both C-LTMRs-DTR and control mice were treated. Behavior All behavioral assays were conducted on 11 - to 14-week-old mice of both sexes. Animals were acclimated to their testing environment for 45-60 minutes before each experiment, and all experiments were performed at room temperature (~22°C). Experimenters were blind to the treatments used. Open-field test The open-field apparatus consists of an empty square arena (40x40x35 cm), surrounded by walls to prevent animal from escaping. Light inside the arena was uniform and kept at approximately 100 lux throughout the tests. Control and cre positive mice were individually placed in the center of the arena and their behavior was recorded using the EthoVision XT16 video-tracking system (Noldus) over a 10-minute period. The time spent grooming and rearing, the total distance traveled, and the total amount of time spent in the peripheral borders and in the center were recorded. Rotarod test A rotarod apparatus (LSI Letica Scientific Instruments) was used to explore coordinated locomotor and balance function in mice. Mice were placed on a rod that slowly accelerated from 4 rpm to 44 rpm over 5 minutes and the latency to fall off during this period was recorded. The test was conducted over 3 consecutive days. Each day, the animals were tested 3 times separated by at least a 5-minute resting period. Thermal gradient test Response to temperature Gradient assay were performed as described in 47 but using Bioseb apparatus. Tape test Mice were allowed to acclimate in a circular plexiglass container for 5 minutes. A 3 cm piece of common lab tape was then applied gently to the back of the mouse such that it sticks to the mouse. Mice are then observed for 5 minutes. The latency before the first response is recorded and the total number of responses to the tape were counted. A response was scored when the mouse stopped moving and bites or scratched the piece of tape or showed a visible “wet dog shake” motion in an attempt to remove the foreign object on its back. Oil droplet test This test was performed as described in 48 . Briefly, oil droplet stimuli, 16-18 µl of sunflower seed oil (Sigma #S5007) were applied to the neck of the mice using a glass Pasteur pipette. A response was scored when the mouse showed a visible “wet dog shake” motion in an attempt to remove the oil on its neck. Von Frey’s test Mice were placed in plastic chambers on a wire mesh grid and stimulated with von Frey filaments (Bioseb) by the up-down method 49 starting with a 1g filament, and using 0.07 and 2g filaments as the cutoffs. Dry ice test The mice were acclimated on a glass plate (8 mm thick float borosilicate Pyrex) in transparent plastic enclosures separated by opaque black partitions for 30 minutes to one hour. Resting mice, but not sleeping mice, were tested by placing a dry ice pellet under the hindpaw on the glass plate. The dry ice should be placed in the center of the hind paw, being careful to avoid the distal joints and ensuring good contact between the paw and the glass. Withdrawal latency was measured with a stopwatch and defined as any action aimed at moving the paw away from the cold glass, either vertically or horizontally. There was an interval of at least 15 minutes between tests on the same paw. These intervals were chosen empirically to allow sufficient time for the mouse to return to a resting state after stimulation. Each paw was measured at least three times. The maximum time allowed for withdrawal is 20 seconds to avoid potential tissue damage. Trials in which the animal does not withdraw within 20 seconds are repeated. During the second test, if there was no withdrawal within the threshold, the value was recorded as 20 seconds. High-throughput RNA sequencing and analyses Control and C-LTMRs-DTR DRG or DHSC RNAs from naive and 40 days post paclitaxel mice (only males), were extracted in experimental quadruplate from individual mice. High quality RNA (RIN > 8) was used for sequencing. RNA quality was measured using Agilent RNA 6000 Pico Kit. RNA-seq libraries were prepared using Watchmaker mRNA Library Prep Kit (Watchmaker Genomics) in order to produce paired end reads of 100 pb. All libraries were validated for concentration and fragment size using Agilent DNA1000 chips. Sequencing was performed on a NovaSeqX (Illumina) and quality control performed using FastQC (https://www.bioinformatics.bbsrc.ac.uk/projects/fastqc). Sequences were uniquely mapped to the mm39 genome using STAR 50 (version 2.7.11b) using default values and paired-end mode. Reads mapping to gene exons (GRCm39 GCF_000001635.27 NCBI RefSeq assembly) were counted using featureCounts 51 (C version 1.4.6-p2). Differential gene expression was performed using exon counts from biological replicates using the EdgeR BioConductor R package 52 (version 4.2.2), using a 5 % false discovery rate (FDR) cutoff. Heat-maps were generated using Heatmapper on-line software (https://heatmapper.ca). Venny diagrams were generated using Venny on-line software (https://bioinfogp.cnb.csic.es/tools/venny/). Functional analysis was performed using Metascape software 53 . Software Some figures elements were generated using BioRender on-line software (https://www.biorender.com/) Quantification and statistical analysis Results were expressed as mean +/- SEM. Quantitative and statistical analyses were performed by using the GraphPad Prism 7 (GraphPad Software, La Jolla, CA) and were indicated in each figure. The Shapiro–Wilk test was used to assess the normality of the data. Statistical significance was set to *P , 0.05, **P , 0.01,***P , 0.001, and ****P , 0.0001. Declarations G.R characterized the mouse model, managed the mouse colony and generated most of the data presented in the manuscript. He also generated all the figures and managed the writing of the materials and methods section, K.M set up the CIPN model and generated the related data, contributed to the immunostaining and RNA-seq data. A.C. generated the data on paw incision and behavioral experiment related to TAFA4. P.M generated the Nav1.8-FLP mouse model. C.S performed the electron microscopy experiments and generated data that will be published elsewhere. A.S analysed the raw RNA-seq data, A.R managed the progression of the project, contributed to the generation and analysis of the RNA-seq data. A.M designed the project and wrote the manuscript. All authors contributed to editing the manuscript. ACKNOWLEGMENTS We are grateful to the members of the Moqrich lab at IBDM for the scientific discussions. The IBDM imaging and animal facilities for assistance. This work was funded by the ANR Sensorimmune and by institutional funding from the CNRS and Aix-Marseille-Université to IBDM. References Melzack R, Wall PD (1965) Pain mechanisms: a new theory. Science 150:971–979. 10.1126/science.150.3699.971 Larsson M, Nagi SS (2022) Role of C-tactile fibers in pain modulation: animal and human perspectives. Curr Opin Behav Sci 43:1–7. 10.1016/j.cobeha.2021.09.005 Zotterman Y (1939) Touch, pain and tickling: an electro-physiological investigation on cutaneous sensory nerves. J Physiol 95:1–28. 10.1113/jphysiol.1939.sp003707 Bessou P, Burgess PR, Perl ER, Taylor CB (1971) Dynamic properties of mechanoreceptors with unmyelinated (C) fibers. J Neurophysiol 34:116–131. 10.1152/jn.1971.34.1.116 Ackerley R, Saar K, McGlone F, Wasling B, H (2014) Quantifying the sensory and emotional perception of touch: differences between glabrous and hairy skin. Front Behav Neurosci 8:34. 10.3389/fnbeh.2014.00034 Liljencrantz J, Olausson H (2014) Tactile C fibers and their contributions to pleasant sensations and to tactile allodynia. Front Behav Neurosci 8:37. 10.3389/fnbeh.2014.00037 Li L, Rutlin M, Abraira VE, Cassidy C, Kus L, Gong S, Jankowski MP, Luo W, Heintz N, Koerber HR et al (2011) The functional organization of cutaneous low-threshold mechanosensory neurons. Cell 147:1615–1627. 10.1016/j.cell.2011.11.027 Delfini MC, Mantilleri A, Gaillard S, Hao J, Reynders A, Malapert P, Alonso S, Francois A, Barrere C, Seal R et al (2013) TAFA4, a chemokine-like protein, modulates injury-induced mechanical and chemical pain hypersensitivity in mice. Cell Rep 5:378–388. 10.1016/j.celrep.2013.09.013 Renthal W, Tochitsky I, Yang L, Cheng YC, Li E, Kawaguchi R, Geschwind DH, Woolf CJ (2020) Transcriptional Reprogramming of Distinct Peripheral Sensory Neuron Subtypes after Axonal Injury. Neuron 108:128–144e129. 10.1016/j.neuron.2020.07.026 Reynders A, Anissa Jhumka Z, Gaillard S, Mantilleri A, Malapert P, Magalon K, Etzerodt A, Salio C, Ugolini S, Castets F et al (2024) Gut microbiota promotes pain chronicity in Myosin1A deficient male mice. Brain Behav Immun 119:750–766. 10.1016/j.bbi.2024.05.010 Reynders A, Mantilleri A, Malapert P, Rialle S, Nidelet S, Laffray S, Beurrier C, Bourinet E, Moqrich A (2015) Transcriptional Profiling of Cutaneous MRGPRD Free Nerve Endings and C-LTMRs. Cell Rep 10:1007–1019. 10.1016/j.celrep.2015.01.022 Reynders A, Moqrich A (2015) Analysis of cutaneous MRGPRD free nerve endings and C-LTMRs transcriptomes by RNA-sequencing. Genom Data 5:132–135. 10.1016/j.gdata.2015.05.022 Seal RP, Wang X, Guan Y, Raja SN, Woodbury CJ, Basbaum AI, Edwards RH (2009) Injury-induced mechanical hypersensitivity requires C-low threshold mechanoreceptors. Nature 462:651–655. 10.1038/nature08505 Usoskin D, Furlan A, Islam S, Abdo H, Lonnerberg P, Lou D, Hjerling-Leffler J, Haeggstrom J, Kharchenko O, Kharchenko PV et al (2015) Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat Neurosci 18:145–153. 10.1038/nn.3881 Salio C, Aimar P, Malapert P, Moqrich A, Merighi A (2021) Neurochemical and Ultrastructural Characterization of Unmyelinated Non-peptidergic C-Nociceptors and C-Low Threshold Mechanoreceptors Projecting to Lamina II of the Mouse Spinal Cord. Cell Mol Neurobiol 41:247–262. 10.1007/s10571-020-00847-w Nordin M (1990) Low-threshold mechanoreceptive and nociceptive units with unmyelinated (C) fibres in the human supraorbital nerve. J Physiol 426:229–240. 10.1113/jphysiol.1990.sp018135 Habig K, Schanzer A, Schirner W, Lautenschlager G, Dassinger B, Olausson H, Birklein F, Gizewski ER, Kramer HH (2017) Low threshold unmyelinated mechanoafferents can modulate pain. BMC Neurol 17:184. 10.1186/s12883-017-0963-6 Shaikh M, Ostor AJ (2015) Evaluating the patient with low back pain. Practitioner 259:21–24 Samour MS, Nagi SS, Mahns DA (2015) Cav3.2-expressing low-threshold C fibres in human hairy skin contribute to cold allodynia–a non-TRPV1- and non-TRPM8-dependent phenomenon. Pain 156:1566–1575. 10.1097/j.pain.0000000000000202 Nagi SS, Rubin TK, Chelvanayagam DK, Macefield VG, Mahns DA (2011) Allodynia mediated by C-tactile afferents in human hairy skin. J Physiol 589:4065–4075. 10.1113/jphysiol.2011.211326 Nagi SS, Marshall AG, Makdani A, Jarocka E, Liljencrantz J, Ridderstrom M, Shaikh S, O'Neill F, Saade D, Donkervoort S et al (2019) An ultrafast system for signaling mechanical pain in human skin. Sci Adv 5:eaaw1297. 10.1126/sciadv.aaw1297 Nagi SS, Mahns DA (2013) C-tactile fibers contribute to cutaneous allodynia after eccentric exercise. J Pain 14:538–548. 10.1016/j.jpain.2013.01.009 Bruti G, Foggetti P (2024) Insecure Attachment, Oxytocinergic System and C-Tactile Fibers: An Integrative and Translational Pathophysiological Model of Fibromyalgia and Central Sensitivity Syndromes. Biomedicines 12 . 10.3390/biomedicines12081744 Lapp HS, Sabatowski R, Weidner K, Croy I, Gossrau G (2020) C-tactile touch perception in migraineurs - a case-control study. Cephalalgia 40:478–492. 10.1177/0333102419889349 Peirs C, Williams SP, Zhao X, Walsh CE, Gedeon JY, Cagle NE, Goldring AC, Hioki H, Liu Z, Marell PS, Seal RP (2015) Dorsal Horn Circuits for Persistent Mechanical Pain. Neuron 87 , 797–812. 10.1016/j.neuron.2015.07.029 Francois A, Schuetter N, Laffray S, Sanguesa J, Pizzoccaro A, Dubel S, Mantilleri A, Nargeot J, Noel J, Wood JN et al (2015) The Low-Threshold Calcium Channel Cav3.2 Determines Low-Threshold Mechanoreceptor Function. Cell Rep 10:370–382. 10.1016/j.celrep.2014.12.042 Noble DJ, Dongmo R, Parvin S, Martin KK, Garraway SM (2022) C-low threshold mechanoreceptor activation becomes sufficient to trigger affective pain in spinal cord-injured mice in association with increased respiratory rates. Front Integr Neurosci 16:1081172. 10.3389/fnint.2022.1081172 Draxler P, Honsek SD, Forsthuber L, Hadschieff V, Sandkuhler J (2014) VGluT3(+) primary afferents play distinct roles in mechanical and cold hypersensitivity depending on pain etiology. J Neurosci 34:12015–12028. 10.1523/JNEUROSCI.2157-14.2014 Bohic M, Marics I, Santos C, Malapert P, Ben-Arie N, Salio C, Reynders A, Le Feuvre Y, Saurin AJ, Moqrich A (2020) Loss of bhlha9 Impairs Thermotaxis and Formalin-Evoked Pain in a Sexually Dimorphic Manner. Cell Rep 30:602–610e606. 10.1016/j.celrep.2019.12.041 Urien L, Gaillard S, Lo Re L, Malapert P, Bohic M, Reynders A, Moqrich A (2017) Genetic ablation of GINIP-expressing primary sensory neurons strongly impairs Formalin-evoked pain. Sci Rep 7:43493. 10.1038/srep43493 Yoo S, Santos C, Reynders A, Marics I, Malapert P, Gaillard S, Charron A, Ugolini S, Rossignol R, Khallouqi E, A., et al (2021) TAFA4 relieves injury-induced mechanical hypersensitivity through LDL receptors and modulation of spinal A-type K(+) current. Cell Rep 37:109884. 10.1016/j.celrep.2021.109884 Sciolino NR, Plummer NW, Chen YW, Alexander GM, Robertson SD, Dudek SM, McElligott ZA, Jensen P (2016) Recombinase-Dependent Mouse Lines for Chemogenetic Activation of Genetically Defined Cell Types. Cell Rep 15:2563–2573. 10.1016/j.celrep.2016.05.034 Ranade SS, Woo SH, Dubin AE, Moshourab RA, Wetzel C, Petrus M, Mathur J, Begay V, Coste B, Mainquist J et al (2014) Piezo2 is the major transducer of mechanical forces for touch sensation in mice. Nature 516:121–125. 10.1038/nature13980 Zhang D, Turecek J, Choi S, Delisle M, Pamplona CL, Meltzer S, Ginty DD (2024) C-LTMRs mediate wet dog shakes via the spinoparabrachial pathway. bioRxiv. 10.1101/2024.06.10.597395 Gaillard S, Lo Re L, Mantilleri A, Hepp R, Urien L, Malapert P, Alonso S, Deage M, Kambrun C, Landry M et al (2014) GINIP, a Galphai-interacting protein, functions as a key modulator of peripheral GABAB receptor-mediated analgesia. Neuron 84:123–136. 10.1016/j.neuron.2014.08.056 Cavanaugh DJ, Lee H, Lo L, Shields SD, Zylka MJ, Basbaum AI, Anderson DJ (2009) Distinct subsets of unmyelinated primary sensory fibers mediate behavioral responses to noxious thermal and mechanical stimuli. Proc Natl Acad Sci U S A 106:9075–9080. 10.1073/pnas.0901507106 Brennan TJ (1999) Postoperative Models of Nociception. ILAR J 40:129–136. 10.1093/ilar.40.3.129 Sun W, Yang S, Wu S, Ba X, Xiong D, Xiao L, Hao Y (2023) Transcriptome analysis reveals dysregulation of inflammatory and neuronal function in dorsal root ganglion of paclitaxel-induced peripheral neuropathy rats. Mol Pain 19:17448069221106167. 10.1177/17448069221106167 Brenner DS, Golden JP, Gereau RWt (2012) A novel behavioral assay for measuring cold sensation in mice. PLoS ONE 7:e39765. 10.1371/journal.pone.0039765 Kambrun C, Roca-Lapirot O, Salio C, Landry M, Moqrich A, Le Feuvre Y (2018) TAFA4 Reverses Mechanical Allodynia through Activation of GABAergic Transmission and Microglial Process Retraction. Cell Rep 22:2886–2897. 10.1016/j.celrep.2018.02.068 Mendell LM (1966) Physiological properties of unmyelinated fiber projection to the spinal cord. Exp Neurol 16:316–332. 10.1016/0014-4886(66)90068-9 Fidanza F, Polimeni E, Pierangeli V, Martini M (2021) A Better Touch: C-tactile Fibers Related Activity is Associated to Pain Reduction During Temporal Summation of Second Pain. J Pain 22:567–576. 10.1016/j.jpain.2021.01.001 Wakui E, Fidanza F, Martini M (2025) Neural response associated with the modulation of temporal summation of second pain by affective touch. J Pain 29:105349. 10.1016/j.jpain.2025.105349 Taneja P, Baad-Hansen L, Shaikh S, Svensson P, Olausson H (2021) Robotic Stroking on the Face and Forearm: Touch Satiety and Effects on Mechanical Pain. Front Pain Res (Lausanne) 2:693987. 10.3389/fpain.2021.693987 Cirrincione AM, Reimonn CA, Harrison BJ, Rieger S (2022) Longitudinal RNA Sequencing of Skin and DRG Neurons in Mice with Paclitaxel-Induced Peripheral Neuropathy. Data (Basel) 7 . 10.3390/data7060072 Li Y, Yin C, Liu B, Nie H, Wang J, Zeng D, Chen R, He X, Fang J, Du J et al (2021) Transcriptome profiling of long noncoding RNAs and mRNAs in spinal cord of a rat model of paclitaxel-induced peripheral neuropathy identifies potential mechanisms mediating neuroinflammation and pain. J Neuroinflammation 18. 10.1186/s12974-021-02098-y Malapert P, Robert G, Brunet E, Chemin J, Bourinet E, Moqrich A (2024) A novel Na(v)1.8-FLPo driver mouse for intersectional genetics to uncover the functional significance of primary sensory neuron diversity. iScience 27 , 109396. 10.1016/j.isci.2024.109396 Abraira VE, Kuehn ED, Chirila AM, Springel MW, Toliver AA, Zimmerman AL, Orefice LL, Boyle KA, Bai L, Song BJ et al (2017) The Cellular and Synaptic Architecture of the Mechanosensory Dorsal Horn. Cell 168 , 295–310 e219. 10.1016/j.cell.2016.12.010 Moqrich A, Hwang SW, Earley TJ, Petrus MJ, Murray AN, Spencer KS, Andahazy M, Story GM, Patapoutian A (2005) Impaired thermosensation in mice lacking TRPV3, a heat and camphor sensor in the skin. Science 307:1468–1472. 10.1126/science.1108609 Zhang D, Turecek J, Choi S, Delisle M, Pamplona CL, Meltzer S, Ginty DD (2024) C-LTMRs evoke wet dog shakes via the spinoparabrachial pathway. Science 386:686–692. 10.1126/science.adq8834 Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL (1994) Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods 53:55–63. 10.1016/0165–0270(94)90144-9 Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR (2013) STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29:15–21. 10.1093/bioinformatics/bts635 Liao Y, Smyth GK, Shi W (2014) featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30:923–930. 10.1093/bioinformatics/btt656 Robinson MD, McCarthy DJ, Smyth GK (2010) edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26:139–140. 10.1093/bioinformatics/btp616 Zhou Y, Zhou B, Pache L, Chang M, Khodabakhshi AH, Tanaseichuk O, Benner C, Chanda SK (2019) Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat Commun 10:1523. 10.1038/s41467-019-09234-6 Additional Declarations There is NO Competing Interest. Supplementary Files RobertetalExtendedfiguresandlegendssmall.pdf Supplementary figures and legends Cite Share Download PDF Status: Under Review Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7198392","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":499116072,"identity":"e26f2ab3-fc6d-40e2-8e39-64e8aaf96bd4","order_by":0,"name":"Aziz Moqrich","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9UlEQVRIiWNgGAWjYFACxgYIzczAxvCBgYEHKixHnBbGGQgtxkTZx8bMg+Dg1sLff7j5A2OOjez2duZnj23b7sgYHGB+upmHwSAflxaJAwcbDBi3pRnPOcxmbpzb9ozH4ACb2W2gFssGXHoONjYkMG47nDiDmYdNOrftMI/k/AcgLX8McOmQP8zYcACuxRKkpYH9G8gWnFoMjjE2NsC1MAK18DPwmOHVYniGsZkhEeiXGcxsZpI958Baym7OMcCtRe788ccfPm6zkZ3Bf/iZxI+yw/ZsDOzbbrypwK0FDBIQEQp3MF4NYICuZRSMglEwCkYBAgAAYBlMfwJQ+wQAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-1937-1675","institution":"Institut de Biologie du Développement de Marseille","correspondingAuthor":true,"prefix":"","firstName":"Aziz","middleName":"","lastName":"Moqrich","suffix":""},{"id":499116073,"identity":"9b0cefc4-e39b-4c15-aecb-b57cf431e3b6","order_by":1,"name":"Guillaume Robert","email":"","orcid":"","institution":"Institut de Biologie du Développement de Marseille","correspondingAuthor":false,"prefix":"","firstName":"Guillaume","middleName":"","lastName":"Robert","suffix":""},{"id":499116074,"identity":"22d41fb7-042a-42d0-94c0-a414ef4f1856","order_by":2,"name":"Karine Magalon","email":"","orcid":"","institution":"Aix-Marseille University, CNRS, IBDM","correspondingAuthor":false,"prefix":"","firstName":"Karine","middleName":"","lastName":"Magalon","suffix":""},{"id":499116075,"identity":"eabab226-9193-4876-9c12-9e25731fd835","order_by":3,"name":"Aude Charron","email":"","orcid":"","institution":"Tafalgie Therapeutics","correspondingAuthor":false,"prefix":"","firstName":"Aude","middleName":"","lastName":"Charron","suffix":""},{"id":499116076,"identity":"73eb8a81-1233-42a6-9dd0-e277ba2194eb","order_by":4,"name":"Pascale Malapert","email":"","orcid":"","institution":"Marseille","correspondingAuthor":false,"prefix":"","firstName":"Pascale","middleName":"","lastName":"Malapert","suffix":""},{"id":499116077,"identity":"d2f7973e-0f28-4e7c-8574-38defeca070a","order_by":5,"name":"Chiara Salio","email":"","orcid":"https://orcid.org/0000-0002-4956-3563","institution":"University of Turin","correspondingAuthor":false,"prefix":"","firstName":"Chiara","middleName":"","lastName":"Salio","suffix":""},{"id":499116078,"identity":"102edc95-6e92-45fb-8bcc-44801ccd3002","order_by":6,"name":"Andrew Saurin","email":"","orcid":"https://orcid.org/0000-0001-5162-003X","institution":"CNRS","correspondingAuthor":false,"prefix":"","firstName":"Andrew","middleName":"","lastName":"Saurin","suffix":""},{"id":499116079,"identity":"4fe43108-d665-4056-bb83-8e9c63fd83ea","order_by":7,"name":"Ana Reynders","email":"","orcid":"","institution":"Institut de Biologie du Développement de Marseille","correspondingAuthor":false,"prefix":"","firstName":"Ana","middleName":"","lastName":"Reynders","suffix":""}],"badges":[],"createdAt":"2025-07-23 16:20:52","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7198392/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7198392/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":99194176,"identity":"c460bafc-3dd8-4091-9838-8ffa0dccd063","added_by":"auto","created_at":"2025-12-30 01:30:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":46409360,"visible":true,"origin":"","legend":"","description":"","filename":"RobertetalFiguresandlegends.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7198392/v1/34b8ae7ac9338dea48e91b27.pdf"},{"id":99194170,"identity":"5ab0866a-640d-4185-93da-cbefa1abffcc","added_by":"auto","created_at":"2025-12-30 01:30:44","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":124217,"visible":true,"origin":"","legend":"","description":"","filename":"RobertetalManuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7198392/v1/5c8ddf48fd7db261bbbd39e5.docx"},{"id":99317448,"identity":"d9268b92-66f6-431c-a61a-b4951d4f0e59","added_by":"auto","created_at":"2025-12-31 16:30:14","extension":"json","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8776,"visible":true,"origin":"","legend":"","description":"","filename":"NCOMMS2557416.json","url":"https://assets-eu.researchsquare.com/files/rs-7198392/v1/4590be46092fb1d27d8cc071.json"},{"id":99194175,"identity":"e5947b5c-920a-489a-974f-54fc123f57ce","added_by":"auto","created_at":"2025-12-30 01:30:44","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5622492,"visible":true,"origin":"","legend":"","description":"","filename":"RobertetalExtendedfiguresandlegendssmall.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7198392/v1/5cce5a7b169073a2767ccd09.pdf"},{"id":99194177,"identity":"0b36bc16-cb20-45cb-bc0d-330cea5c42e4","added_by":"auto","created_at":"2025-12-30 01:30:44","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":46409360,"visible":true,"origin":"","legend":"","description":"","filename":"RobertetalFiguresandlegends.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7198392/v1/1efbd6f9eb7550b6b2740874.pdf"},{"id":99317579,"identity":"1d2254f8-9499-4bdd-b4e5-c9a853df4fd0","added_by":"auto","created_at":"2025-12-31 16:30:24","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":161470,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSelective and inducible ablation of C-LTMRs in adult mice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A)\u0026nbsp;\u0026nbsp;\u0026nbsp; Schematic of the intersectional genetic strategy used to selectively ablate C-LTMRs. \u003cem\u003eNav1.8\u003c/em\u003e\u003csup\u003e\u003cem\u003eIRES-FLPo\u003c/em\u003e\u003c/sup\u003e drives expression of FLPo in sensory neurons; \u003csup\u003e\u003cem\u003eTHCreER\u003c/em\u003e\u003c/sup\u003e enables tamoxifen-inducible Cre expression in TH\u003csup\u003e+\u003c/sup\u003e neurons. The \u003cem\u003eTau-\u003c/em\u003e\u003csup\u003e\u003cem\u003eloxP-STOP-loxP-FRT-STOP-FRT-DTR\u003c/em\u003e\u003c/sup\u003e allele allows\u003c/p\u003e\n\u003cp\u003eDTR expression only in neurons where both Cre and FLPo are active, permitting C-LTMR-specific ablation upon diphtheria toxin (DT) administration.\u003c/p\u003e\n\u003cp\u003e(B)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Representative images of lumbar (L3) DRG sections stained for TH in control and \u003cem\u003eC-LTMRs-DTR \u003c/em\u003emice. Scale bar: 100 μm.\u003c/p\u003e\n\u003cp\u003e(C)\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Quantification of the total number of lumbar (L3) TH\u003csup\u003e+\u003c/sup\u003e DRG neurons in control (grey) and \u003cem\u003eC-LTMRs-DTR (red) \u003c/em\u003emice (\u003cem\u003en \u003c/em\u003e= 4 per group). C-LTMR ablation results in a ~50% reduction in TH\u003csup\u003e+\u003c/sup\u003e neurons. Data are presented as the mean ± SEM (unpaired t-test \u003cem\u003e**P \u0026lt; 0.01). \u003c/em\u003eDots represent individual animals.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D-E) \u003c/strong\u003eExpression levels of C-LTMRs-enriched markers (TAFA4 and \u003cem\u003eCeacam10\u003c/em\u003e) are significantly decreased in \u003cem\u003eC-LTMRs-DTR \u003c/em\u003emice compared to control mice. Scale bar: 100 μm.\u003c/p\u003e\n\u003cp\u003e(F)\u0026nbsp;\u0026nbsp;\u0026nbsp; Immunostaining for VGLUT3 in the spinal cord dorsal horn. \u003cem\u003eC-LTMRs-DTR \u003c/em\u003emice show a dramatic loss of VGLUT3 signal in lamina II inner compared to controls. Scale bar: 100 μm.\u003c/p\u003e\n\u003cp\u003e(G)\u0026nbsp;\u0026nbsp; Quantification of VGLUT3\u003csup\u003e+\u003c/sup\u003e glomeruli in the DHSC, in control (gray, n=5) and \u003cem\u003eC-LTMRs-DTR \u003c/em\u003emice (red, n=6). Data are presented as the mean ± SEM (unpaired t-test \u003cem\u003e****P \u0026lt;0.0001). \u003c/em\u003eDots represent individual animals.\u003c/p\u003e\n\u003cp\u003e(H)\u0026nbsp;\u0026nbsp; Ultrastructure of C-LTMRs terminals immuno-gold labelled for VGLUT3. “Strange” terminals, only observed in \u003cem\u003eC-LTMRs-DTR \u003c/em\u003emice, exhibit a drastic decrease in the number of synaptic vesicles compared to normal ones. Scale bar: 500 nm.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7198392/v1/81a4c4506fdd036618ba1e9e.png"},{"id":99194165,"identity":"01ec118d-03fd-40fb-af35-91a12ecc0f40","added_by":"auto","created_at":"2025-12-30 01:30:43","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":109232,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePartial ablation of C-LTMRs sharpens thermotactic behavior without major disruption of gentle touch responses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A-B) \u003c/strong\u003eGraphical representations of the time spent by (A) males and (B) females control (gray line) and \u003cem\u003eC-LTMRs-DTR \u003c/em\u003emice (red line) across a 90-minute temperature gradient assay. Ablated mice of both sexes (n=16 for males and n=13 for females) show a markedly narrower preference for the warm zone compared to controls (n=18 for males and n=16 for females). Data are presented as mean ± SEM (two-way repeated measures ANOVA followed by Bonferroni test).\u003c/p\u003e\n\u003cp\u003e(C) Temporal analysis across three 30-minute intervals shows that both male groups initially explore the full arena, but \u003cem\u003eC-LTMRs-DTR \u003c/em\u003emales progressively restrict their movements to the warmer zone, showing a significantly stronger thermal preference than controls by the final phase. Data are presented as mean ± SEM (two-way repeated measures ANOVA followed by Bonferroni test).\u003c/p\u003e\n\u003cp\u003e(D) Female \u003cem\u003eC-LTMRs-DTR \u003c/em\u003emice show an even earlier and more pronounced spatial restriction to the warm zone compared to control females, who maintain broader temperature exploration. Data are presented as mean ± SEM (two-way repeated measures ANOVA followed by Bonferroni test).\u003c/p\u003e\n\u003cp\u003e(E) Total distance traveled in each phase reveals no difference between genotypes during initial exploration. By the final 30 minutes, \u003cem\u003eC-LTMRs-DTR \u003c/em\u003emales travel significantly less than controls, consistent with increased spatial fixation. No significant differences were observed in females. Data are presented as mean ± SEM (unpaired Mann-Whitney test or t-test, ns, ** P \u0026lt; 0.01).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F-G) \u003c/strong\u003eBehavioral responses to gentle touch are evaluated using the tape removal test and the oil drop assay. No significant differences are observed between groups in the number of wet dog shakes response. However, \u003cem\u003eC-LTMRs-DTR \u003c/em\u003emice exhibit a slight but consistent delay in the onset of the “wet-dog shake” response in the tape test, suggesting altered C-LTMR signaling dynamics (Zhang et al., \u003cem\u003eScience\u003c/em\u003e, 2024). Data are presented as mean ± SEM (unpaired Mann-Whitney test or t-test, ns, * P \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7198392/v1/08c7a4cf2ae507e5dd13513d.png"},{"id":99194169,"identity":"5fdd49ff-442e-4741-bff9-ca335e666e9a","added_by":"auto","created_at":"2025-12-30 01:30:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":100462,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePartial ablation of C-LTMRs prolongs injury-induced mechanical hypersensitivity and promote cold allodynia\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Baseline mechanical thresholds measured by Von Frey testing show a modest but significant reduction in \u003cem\u003eC-LTMRs-DTR \u003c/em\u003emice compared to controls (\u003cem\u003en \u003c/em\u003e= 43 and 44, respectively) (unpaired t-test ** P \u0026lt; 0.01).\u003c/p\u003e\n\u003cp\u003e(B) In the paw incision model, both groups develop acute mechanical hypersensitivity at day 1 post-surgery. However, \u003cem\u003eC-LTMRs-DTR \u003c/em\u003emice fail to recover and display persistent hypersensitivity lasting up to 43 days (\u003cem\u003en \u003c/em\u003e= 24 per group) (two-way repeated measures ANOVA followed by Bonferroni test).\u003c/p\u003e\n\u003cp\u003e(C) Repetitive mechanical stimulation of the contralateral paw reveals a significant reduction in threshold in \u003cem\u003eC-LTMRs-DTR \u003c/em\u003ebut not control mice, indicating generalized sensitization (two-way repeated measures ANOVA followed by Bonferroni test).\u003c/p\u003e\n\u003cp\u003e(D) Schematic of the paclitaxel-induced CIPN model.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e(E)\u003c/em\u003e \u003cem\u003eC-LTMRs-DTR \u003c/em\u003emice show an earlier and more severe mechanical hypersensitivity that persists beyond the treatment period (control: \u003cem\u003en \u003c/em\u003e= 20, C\u003cem\u003e-LTMRs-DTR: 21\u003c/em\u003e) (two-way repeated measures ANOVA followed by Bonferroni test).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F-G) \u003c/strong\u003eCold allodynia develops selectively in \u003cem\u003eC-LTMRs-DTR \u003c/em\u003emice after paclitaxel administration, with significant threshold reduction starting around day 17 for males, and day 24 for females.\u003c/p\u003e\n\u003cp\u003eAll data are presented as mean ± SEM, *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001 ***P \u0026lt; 0.0001, the same for $ indicating statistical differences in \u003cem\u003eC-LTMRs-DTR \u003c/em\u003emice (or control mice only Fig. 3G) between D0 and the corresponding time point.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7198392/v1/89d2287bbe60cc2a616ba350.png"},{"id":99194172,"identity":"98bc8e0e-c60e-4a54-a121-920349c75509","added_by":"auto","created_at":"2025-12-30 01:30:44","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":200233,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePartial ablation of C-LTMRs modifies gene expression in the lumbar DRGs in naive mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Heatmap representing the expression of indicated C-LTMRs-specific or enriched genes in control and \u003cem\u003eC-LTMRs-DTR \u003c/em\u003enaïve mice.\u003c/p\u003e\n\u003cp\u003e(B) Counts Per Million (CPM) obtained after RNA-Seq for the same sets of C-LTMR-specific or enriched genes.\u003c/p\u003e\n\u003cp\u003e(C) Volcano plot representing up- and down-regulated DEG in the L3-L5 DRG of naive \u003cem\u003eC-LTMRs-DTR \u003c/em\u003ecompared to control mice (FDR5, n=4 samples per genotype). For a matter of representation, \u003cem\u003eTh \u003c/em\u003ewas excluded from the plot.\u003c/p\u003e\n\u003cp\u003e(D) Heatmap representing the expression of identified DEG in control and \u003cem\u003eC-LTMRs-DTR \u003c/em\u003emice (n=4 each).\u003c/p\u003e\n\u003cp\u003e(E) Up (red) and down (blue)-regulated biological processes and pathways in \u003cem\u003eC-LTMRs-DTR \u003c/em\u003elumbar DRGs determined with Metascape software. Non-exhaustive examples of corresponding transcripts are illustrated for each indicated processes.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7198392/v1/0c531cb4db5c0810b4c2c897.png"},{"id":99194171,"identity":"883d5945-df42-4b04-a73f-d479b4e914a4","added_by":"auto","created_at":"2025-12-30 01:30:44","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":187727,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePartial ablation of C-LTMRs modifies gene expression in the lumbar DHSC in naive mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Volacno plot representing up- and down-regulated DEG in the lumbar DHSC of naive \u003cem\u003eC-LTMRS-DTR \u003c/em\u003emice compared to controls (FDR5, Log2FoldChange \u0026gt; 0.3, n=4 samples per genotype).\u003c/p\u003e\n\u003cp\u003e(B) Heatmap representing the expression of identified DEG in naïve control and \u003cem\u003eC-LTMRS-DTR \u003c/em\u003emice (n=4 each). E) Up (red) and down (blue)-regulated biological processes and pathways in \u003cem\u003eC-LTMRS-DTR \u003c/em\u003elumbar DHSC determined with Metascape software. Non-exhaustive examples of corresponding transcripts are illustrated for each indicated processes.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7198392/v1/2c753e098926926e8ae4c8f3.png"},{"id":99316904,"identity":"4e59e80a-07c2-40be-940b-17ae55117047","added_by":"auto","created_at":"2025-12-31 16:29:25","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":98837,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePartial ablation of C-LTMRs disrupts DHSC transcriptional response to paclitaxel\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Down- (light blue, upper panel) and up- (light red, middle panel) regulated biological processes and pathways in \u003cem\u003eC-LTMRs-DTR \u003c/em\u003elumbar DHSC at day 40 (D40) after paclitaxel as compared to untreated \u003cem\u003eC-LTMRs-DTR \u003c/em\u003eDHSC (D0). Down-regulated (dark turquoise, lower panel) biological processes and pathways in control lumbar DHSC at D40 after paclitaxel as compared to untreated control DHSC (D0).\u003c/p\u003e\n\u003cp\u003e(B) Heatmap representing the expression levels of genes involved in \u003cem\u003eNeutrophil degranulation\u003c/em\u003e, \u003cem\u003eRNA-Splicing and gene expression\u003c/em\u003e, \u003cem\u003eCalcium import in the cytosol \u003c/em\u003ein control and \u003cem\u003eC-LTMRs-DTR \u003c/em\u003euntreated (D0) and at D40 after paclitaxel administration (D40). These genes are part of transcriptional changes occurring specifically in \u003cem\u003eC-LTMRs-DTR \u003c/em\u003eDHSC in response to paclitaxel (see Fig.S8).\u003c/p\u003e\n\u003cp\u003e(C) Heatmap representing the expression levels of genes involved in Extracellular matrix organization and vasculature development in control and \u003cem\u003eC-LTMRs-DTR \u003c/em\u003euntreated (D0) and at D40 after paclitaxel administration (D40). These genes are part of the transcriptional response to paclitaxel implemented in controls but not in \u003cem\u003eC-LTMRs-DTR \u003c/em\u003eDHSC (see Fig.S9).\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7198392/v1/aeb29d09e166a366ca70406e.png"},{"id":99788328,"identity":"477ae6ae-9b4a-41c3-ab81-9e31c518e3aa","added_by":"auto","created_at":"2026-01-08 12:46:19","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1554612,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7198392/v1/f23c5c05-a248-421b-b336-75625933c741.pdf"},{"id":99194174,"identity":"19c42112-26d6-4cdc-a0d1-ef1ab3f8285d","added_by":"auto","created_at":"2025-12-30 01:30:44","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":5622492,"visible":true,"origin":"","legend":"Supplementary figures and legends","description":"","filename":"RobertetalExtendedfiguresandlegendssmall.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7198392/v1/4ab1d6c4cc9103b290daecb9.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eC-LTMRs Regulate Thermosensation and Gate the Transition from Acute to Chronic Pain\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eMechanical allodynia (pain elicited by normally innocuous mechanical stimuli) is a hallmark of several chronic pain conditions and remains a particularly challenging symptom to treat. A classical explanation for this phenomenon is provided by the gate control theory (GCT) of pain, first proposed by Melzack and Wall in 1965 \u003csup\u003e1\u003c/sup\u003e. This model posits that tissue injury disrupts the inhibitory spinal \"gate\" circuits, allowing input from Aβ low-threshold mechanoreceptors to engage the pain pathway, thereby converting touch into pain. While this framework has guided decades of research, it may not fully capture the complexity of sensory modulation in chronic pain. Emerging evidence suggests that C-low-threshold mechanoreceptors (C-LTMRs), a class of unmyelinated sensory afferents traditionally associated with affective touch, may also play an active role in pathological pain states, potentially contributing to aberrant gating processes\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eC-LTMRs are specialized sensory neurons that respond preferentially to gentle stroking and innocuous cooling. Found in humans and other mammals, including cats and primates \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e, their human counterparts, C-tactile afferents, are tuned to slow velocities (~\u0026thinsp;3 cm/s) and skin temperature (~\u0026thinsp;32\u0026deg;C), aligning with the perception of pleasant touch\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. These afferents terminate around hair follicles and project to lamina II of the dorsal horn, a key site for nociceptive and non-nociceptive integration \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. At the molecular level, C-LTMRs are marked by the expression of VGLUT3, tyrosine hydroxylase (TH), and TAFA4\u003csup\u003e8\u0026ndash;15\u003c/sup\u003e, and are known to influence autonomic processes such as heart rate and to exert central effects through after-discharges and neuromodulation\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eImportantly, C-LTMRs appear to have dual roles in pain modulation. Human studies show that their activation can produce both anti-nociceptive effects, such as reduced thermal or chemical pain\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e, and pro-nociceptive responses, such as mechanical or cold allodynia in muscle pain and delayed-onset muscle soreness\u003csup\u003e\u003cspan additionalcitationids=\"CR20 CR21\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Alterations in C-tactile function have also been observed in chronic pain conditions like migraine and fibromyalgia, suggesting a broader role in central sensitization\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e,\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eRodent studies have further explored the involvement of C-LTMRs in pain, but they suffer from important methodological limitations that complicate interpretation. For example, initial findings using VGLUT3-KO mice suggested that C-LTMRs contribute to mechanical hypersensitivity \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e, but follow-up work showed this phenotype was due to transient VGLUT3 expression in spinal neurons, not in C-LTMRs themselves \u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Similarly, conditional inactivation of Cav3.2 in Nav1.8-lineage neurons, intended to target Cav3.2 function in C-LTMRs, reduced pain responses\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e, but the broader expression of this marker in other C-fiber subsets undermines the specificity of these conclusions. Optogenetic studies also face similar challenges. Noble et al. (2022) showed that activation of TH-lineage neurons in injured mice induced aversive behaviors, implicating a pronociceptive role for C-LTMRs\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. However, TH is also expressed in sympathetic fibers, leaving open the possibility that the observed effects were not specific to C-LTMRs. In the context of chemotherapy-induced pain, optogenetic stimulation of VGLUT3-lineage cells produced nocifensive behaviors in oxaliplatin-treated mice\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e, but again, lineage tracing does not guarantee functional specificity to C-LTMRs.\u003c/p\u003e \u003cp\u003eOn the other hand, several studies using TAFA4 and Bhlha9 KO mice as well as GINIP-DTR mice have proposed anti-nociceptive roles for C-LTMRs\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan additionalcitationids=\"CR30\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e, suggesting these neurons may also contribute to the resolution of pain. Yet, these findings rely on global gene deletions, dual ablation of C-LTMRs and MRGPRD\u003csup\u003e+\u003c/sup\u003e mechanonociceptors or exogenous protein application, all of which fail to isolate the endogenous and cell-specific contributions of C-LTMRs.\u003c/p\u003e \u003cp\u003eTaken together, while experimental data from both human and animal studies suggest that C-LTMRs may exert bidirectional effects on pain, current approaches, including global and conditional knock-out models, lack the cellular and temporal specificity necessary to definitively link C-LTMRs to specific pain phenotypes. These limitations highlight the need for more precise, lineage-restricted, and temporally controlled strategies to clarify the true functional role of C-LTMRs in pain modulation. In this study, we developed a novel, inducible genetic model to selectively ablate C-LTMRs in adult mice. By crossing \u003cem\u003eNav1.8\u003c/em\u003e\u003csup\u003e\u003cem\u003eIRES\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e-\u003c/em\u003e\u003csup\u003e\u003cem\u003eFLPo\u003c/em\u003e\u003c/sup\u003e;\u003cem\u003eTH\u003c/em\u003e\u003csup\u003e\u003cem\u003eCreER\u003c/em\u003e\u003c/sup\u003e mice with a dual-recombinase reporter line expressing diphtheria toxin receptor (DTR), we achieved robust, tissue-specific ablation of C-LTMRs. This inducible genetic strategy circumvents the off-target effects and developmental compensations commonly associated with traditional knockout models. Using this approach, we demonstrate that partial ablation of C-LTMRs in adult mice does not substantially impair touch behaviors but markedly alters thermotaxis preferences and significantly promotes the transition from acute to chronic pain following both surgical and chemotherapeutic injury. Transcriptomic analyses of DRG and spinal cord tissues confirmed the selective loss of C-LTMRs-specific markers and revealed broad dysregulation of genes involved in synaptic transmission, thermogenesis, immune signaling, and detoxification pathways. Systemic TAFA4 treatment prevented chronic pain in \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice and reestablished transcriptional homeostasis by suppressing maladaptive vascular, structural, and excitability pathways while boosting metabolic and neuroprotective programs in both the DRG and spinal cord. These findings establish C-LTMRs as key modulators of thermal preference and critical contributors to the recovery processes after injury.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eTissue specific and inducible ablation of C-LTMRs\u003c/h2\u003e \u003cp\u003ePrevious studies from our laboratory have suggested that, beyond their well-established role in mediating pleasant touch, C-LTMRs may also modulate pain following tissue injury \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. To directly test this hypothesis, we developed a genetic strategy enabling the selective and inducible ablation of C-LTMRs in adult mice. We crossed Na\u003csub\u003ev\u003c/sub\u003e1.8\u003csup\u003eIres\u0026thinsp;\u0026minus;\u0026thinsp;FLPo\u003c/sup\u003e;TH\u003csup\u003eCreER\u003c/sup\u003e mice with a reporter line expressing the simian diphtheria toxin receptor (DTR) under the control of a pan-neuronal \u003cem\u003eTau\u003c/em\u003e promoter flanked by loxP and FRT stop cassettes (Tau\u003csup\u003eloxP\u0026minus;STOP\u0026minus;loxP\u0026minus;FRT\u0026minus;STOP\u0026minus;FRT\u0026minus;DTR\u003c/sup\u003e) (Fig.\u0026nbsp;1A). This breeding strategy yielded two genotypes: experimental Na\u003csub\u003ev\u003c/sub\u003e1.8\u003csup\u003eIres\u0026thinsp;\u0026minus;\u0026thinsp;FLPo\u003c/sup\u003e;TH\u003csup\u003eCreER\u003c/sup\u003e;Tau\u003csup\u003eDTR\u003c/sup\u003e (hereafter referred to as \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice) and control Na\u003csub\u003ev\u003c/sub\u003e1.8\u003csup\u003eIres\u0026thinsp;\u0026minus;\u0026thinsp;FLPo\u003c/sup\u003e;Tau\u003csup\u003eDTR\u003c/sup\u003e (hereafter referred to as control mice).\u003c/p\u003e \u003cp\u003eTo induce targeted neuronal ablation, we administered tamoxifen (oral gavage, once daily for five consecutive days) to 3-week-old mice, followed one week later by two intraperitoneal injections of diphtheria toxin (DT) spaced two days apart. All subsequent analyses were conducted at 11 weeks of age (Fig.\u0026nbsp;1A).\u003c/p\u003e \u003cp\u003eTo assess the efficacy and specificity of C-LTMRs ablation, we quantified the number of tyrosine hydroxylase-positive (TH\u003csup\u003e+\u003c/sup\u003e) neurons in lumbar (L3) dorsal root ganglia (DRG) (Figs.\u0026nbsp;1B and C). Compared to controls, \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice exhibited an approximately 50% reduction in TH\u0026thinsp;+\u0026thinsp;neuron counts (Fig.\u0026nbsp;1C) (control: 625,5\u0026thinsp;\u0026plusmn;\u0026thinsp;62,38; \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e: 315\u0026thinsp;\u0026plusmn;\u0026thinsp;25.88; \u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;4). Consistently, expression of C-LTMRs-enriched markers such as TAFA4 and \u003cem\u003eCeacam10\u003c/em\u003e (Delfini et al., 2013; Reynders et al., 2015) was markedly reduced in \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice (Figs.\u0026nbsp;1D and E). In contrast, markers excluded from C-LTMRs, including CGRP, P2X3, IB4, TrkC, and NF200 remained unchanged (Figs. S1A and B), supporting the selectivity of our ablation approach.\u003c/p\u003e \u003cp\u003eAt the spinal cord level, \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice showed a pronounced decrease of VGLUT3 immunoreactivity specifically in lamina II inner of the dorsal horn (Fig.\u0026nbsp;1F). This was corroborated by electron microscopy (EM), which revealed a dramatic reduction in VGLUT3\u003csup\u003e+\u003c/sup\u003e glomeruli in \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice compared to controls (Fig.\u0026nbsp;1G). This is consistent with the large decrease of the number of non-labelled glomeruli observed in \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eD). Even though a mild but significant decrease in IB4\u003csup\u003e+\u003c/sup\u003e glomeruli could be observed using EM (Fig \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eE), we could not see significant difference in the central projections of CGRP\u003csup\u003e+\u003c/sup\u003e and IB4\u003csup\u003e+\u003c/sup\u003e afferents (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC), which is consistent with the specificity of C-LTMRs targeting. Additionally, the analysis revealed the presence of some VGLUT3\u003csup\u003e+\u003c/sup\u003e glomeruli with atypical morphology, referred to as \u0026ldquo;strange\u0026rdquo; glomeruli, which exhibited a markedly reduced density of synaptic vesicles compared to typical (\u0026ldquo;normal\u0026rdquo;) glomeruli (Fig.\u0026nbsp;1H). These \u0026ldquo;strange\u0026rdquo; glomeruli were only observed in \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice (Fig.\u0026nbsp;1H) suggesting a functional deficit in some of the 50% remaining VGLUT3\u003csup\u003e+\u003c/sup\u003e glomeruli.\u003c/p\u003e \u003cp\u003eTo rule out off-target effects in non-sensory tissues, we crossed \u003cem\u003eNav1.8\u003c/em\u003e\u003csup\u003e\u003cem\u003eIres\u0026thinsp;\u0026minus;\u0026thinsp;FLPo\u003c/em\u003e\u003c/sup\u003e mice with the \u003cem\u003eRC::FL-hM3Dq\u003c/em\u003e reporter line \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e, allowing visualization of \u003cem\u003eNav1.8\u003c/em\u003e-lineage via EGFP expression (Fig. S2A). EGFP signal was absent from known TH\u003csup\u003e+\u003c/sup\u003e regions such as Substantia Nigra pars compacta (SNpc) in the brain (Fig. S2B), jugular/nodose ganglion (JNG) in which a faint colocalization signal is occasionally detectable (Fig. S2C), and celiac ganglia (Fig. S2D). These data confirm that \u003cem\u003eNav1.8\u003c/em\u003e-driven FLPo activity, and thus C-LTMRs ablation, is restricted to primary sensory neurons. Together, these results demonstrate that our genetic model enables robust, inducible, and tissue-specific ablation of C-LTMRs in adult mice. This approach provides a powerful tool for dissecting the functional contributions of C-LTMRs to somatosensation and pain modulation.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePartial ablation of C-LTMRs alters thermotaxis behavior without significantly affecting touch responses\u003c/h3\u003e\n\u003cp\u003eWe first sought to assess the impact of partial ablation of C-LTMRs on general behavior. \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice appeared normal in terms of open field (Figure S3A), and rotarod (Figure S3B) profiles, indicating that a 50% reduction in C-LTMRs does not result in detectable alterations in motor activity or anxiety-like behavior.\u003c/p\u003e \u003cp\u003eWhile C-LTMRs are classically associated with affective touch, several studies have suggested they may also play a role in temperature perception\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e,\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. To directly investigate their contribution to thermosensation, we assessed thermotaxis behavior of \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice using a temperature gradient paradigm.\u003c/p\u003e \u003cp\u003eOver a 90-minute session, \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice of both sexes exhibited a significantly sharper and more spatially restricted preference for warmer temperatures compared to their control littermates (Figs.\u0026nbsp;2A and 2B). When we analyzed behavior in the first 30-minute interval, all groups explored the arena in a similar manner, indicating normal exploratory drive (Figs.\u0026nbsp;2C and D). By the second interval, both control and \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e males began favoring warmer zones, but this preference was significantly more pronounced in ablated mice and further intensified during the last 30 minutes (Fig.\u0026nbsp;2C). A similar, yet more striking, effect was observed in females: while control females continued to explore a broader range of temperatures, \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e females rapidly developed and maintained a strong preference for warmer areas, closely mirroring the male ablation phenotype (Fig.\u0026nbsp;2D).\u003c/p\u003e \u003cp\u003eTo ensure this thermotaxis phenotype was not confounded by motor deficits, we quantified total distance travelled across each phase. All groups covered comparable distances during the first 30 minutes (control males: 8041\u0026thinsp;\u0026plusmn;\u0026thinsp;412,1 cm, \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e males: 8039\u0026thinsp;\u0026plusmn;\u0026thinsp;318,3cm, control females: 6984\u0026thinsp;\u0026plusmn;\u0026thinsp;343cm, \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e females: 7443\u0026thinsp;\u0026plusmn;\u0026thinsp;403,1cm), confirming intact locomotor function (Fig.\u0026nbsp;2E). During the second and third intervals, movement decreased in all groups as temperature preferences consolidated (Fig.\u0026nbsp;2E). Notably, \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e males travelled significantly less than controls in the final phase (1325\u0026thinsp;\u0026plusmn;\u0026thinsp;258.6 cm vs. 2774\u0026thinsp;\u0026plusmn;\u0026thinsp;354,3cm), consistent with significantly higher sharp and net preference for the warm zone of the arena (Fig.\u0026nbsp;2E). No significant difference was observed between female groups, likely due to broader zone occupancy across genotypes (Fig.\u0026nbsp;2E).\u003c/p\u003e \u003cp\u003eNext, we sought to evaluate whether the partial ablation of C-LTMRs also affects touch responses. To do so, we assessed behavioral outcomes using the tape removal \u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003eand the oil drop assay \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. In both paradigms, \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice performed similarly (in terms of number of wet dog shakes) to controls, indicating that basic touch perception remains largely intact under our C-LTMRs\u0026rsquo; ablation conditions (Figs.\u0026nbsp;2F and G). However, in the tape test, we observed a mild but consistent delay in the onset of the characteristic \u0026ldquo;wet-dog shake\u0026rdquo; response in \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice (Fig.\u0026nbsp;2F), a behavior recently linked to C-LTMRs-mediated activation of the spinoparabrachial pathway\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eTogether, these findings demonstrate a novel role for C-LTMRs in shaping thermotaxis behavior and spatial temperature discrimination, while suggesting that the baseline detection of touch may either require the full complement of C-LTMRs or depend on subpopulations that remain intact in our ablation set up.\u003c/p\u003e\n\u003ch3\u003ePartial ablation of C-LTMRs facilitates the transition to chronic pain following injury\u003c/h3\u003e\n\u003cp\u003eIn earlier work, we identified GINIP (Gα-inhibitory interacting protein) as a marker of two distinct populations of dorsal root ganglion (DRG) neurons: MRGPRD-expressing mechanonociceptors and TAFA4-expressing C-LTMRs\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Using a genetic ablation approach targeting both populations simultaneously, we later showed that \u003cem\u003eGINIP-DTR\u003c/em\u003e mice displayed normal onset and resolution of mechanical hypersensitivity in both the Complete Freund\u0026rsquo;s Adjuvant (CFA) inflammatory model and the chronic constriction injury (CCI) model of neuropathic pain \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. We hypothesized that this lack of phenotype could be due to compensatory effects between the two ablated populations: specifically, that ablation of MRGPRD\u0026thinsp;+\u0026thinsp;neurons alone would be analgesic\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e, while ablation of C-LTMRs alone would exaggerate injury-induced pain. Thus, the concurrent deletion of both populations may have masked the individual contributions of each.\u003c/p\u003e \u003cp\u003eTo directly test the specific role of C-LTMRs in injury-induced pain, we examined \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e and control mice in two complementary models: the paw incision surgery as a model of acute post-operative pain\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e and paclitaxel-induced chemotherapy-induced peripheral neuropathy (CIPN), a model of chronic neuropathic pain\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. Mechanical sensitivity was assessed at baseline and multiple time points post-injury using the Von Frey up-and-down method.\u003c/p\u003e \u003cp\u003eAt baseline, both male and female \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice exhibited a modest but significant reduction in mechanical thresholds compared to controls (Figs.\u0026nbsp;3A; \u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;43 and 44, respectively and S4A). To account for this difference, all subsequent data were normalized to individual baselines and expressed as percentage changes.\u003c/p\u003e \u003cp\u003eIn the paw incision model, both \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e and control mice developed robust mechanical hypersensitivity in the ipsilateral hindpaw by day 1 post-surgery (Fig.\u0026nbsp;3B; \u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;24 per group). While hypersensitivity gradually resolved in control animals, \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice displayed a persistent pain phenotype that lasted up to 43 days, indicating impaired recovery (Fig.\u0026nbsp;3B). Moreover, repetitive stimulation of the contralateral (uninjured) paw revealed a significant reduction in mechanical threshold in \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice, but not in controls (Fig.\u0026nbsp;3C), suggesting an enhanced wind-up phenomenon or a generalized sensitization phenotype. No statistical differences were observed between males and females of both genotypes neither for the ipsilateral side nor the contralateral one. (Figs. S4B and C).\u003c/p\u003e \u003cp\u003eTo determine whether this effect extended to neuropathic pain, we employed the paclitaxel CIPN model (Fig.\u0026nbsp;3D). In both groups, paclitaxel administration induced mechanical hypersensitivity (Fig.\u0026nbsp;3E). However, \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice developed a significantly earlier onset and more severe mechanical hypersensitivity than controls, which persisted well beyond the treatment window, showing no signs of resolution (Fig.\u0026nbsp;3E). No statistical differences were observed between males and females of both genotypes (Fig. S4D).\u003c/p\u003e \u003cp\u003eGiven that paclitaxel is also known to induce cold allodynia, we assessed cold sensitivity using the dry ice test \u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. First at baseline level, no differences were observed between both genotypes and nor between sexes in each genotype (Fig. S4E). Repetitive paclitaxel injections led to a significant increase in cold sensitivity in \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice compared to controls starting at day 17 post-treatment (Figs.\u0026nbsp;3F and G).\u003c/p\u003e \u003cp\u003eTaken together, these findings reveal a previously unappreciated role for C-LTMRs in the resolution of injury-induced pain. Their partial ablation delays recovery and promotes the transition from acute to chronic pain, suggesting that C-LTMRs act as modulators of protective sensory signaling during the recovery process.\u003c/p\u003e\n\u003ch3\u003eC-LTMRs ablation induces a primed, maladaptive transcriptional state\u003c/h3\u003e\n\u003cp\u003eTo determine how selective C-LTMRs ablation perturbs somatosensory circuit homeostasis and predisposes mice to paclitaxel-induced chronic pain, we performed bulk RNA-seq on adult L3\u0026ndash;L5 DRG and lumbar dorsal horn of the spinal cord (DHSC) from control and \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice at baseline (D0) and day 35 after paclitaxel (D35).\u003c/p\u003e \u003cp\u003eAt baseline, C-LTMRs loss triggered a strong transcriptional response in the DRG (177 DEGs; 65 up, 112 down; FDR 5%, |log₂FC| \u0026ge; 0.3; Figs.\u0026nbsp;4A and S5B). Differential gene expression analysis confirmed effective C-LTMRs ablation, with marked downregulation of canonical C-LTMRs markers \u003cem\u003eTh\u003c/em\u003e, \u003cem\u003eFam19a4\u003c/em\u003e (TAFA4), \u003cem\u003eSlc17a8\u003c/em\u003e (VGLUT3), \u003cem\u003eCacna1i\u003c/em\u003e, \u003cem\u003eCd34\u003c/em\u003e, \u003cem\u003eCeacam10\u003c/em\u003e and many others (Figs.\u0026nbsp;4B and S5A). Downregulated genes were enriched for developmental processes, including vascular homeostasis, and metabolic and oxidative stress defenses, indicating DRG stress and altered neuronal integrity (Fig.\u0026nbsp;4C). Upregulated genes were associated with the regulation of circadian rhythmic processes, regulation of metal ion transport, notably processes involved in calcium homeostasis, including release of calcium sequestrated calcium into cytosol and immune or stress-response pathways, reflecting a hyperexcitable and pro-nociceptive state (Fig.\u0026nbsp;4C). These data are consistent with the results shown in Fig.\u0026nbsp;3C in which we show that repetitive stimulation of \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice caused a significant mechanical hypersensitivity in the uninjured paw.\u003c/p\u003e \u003cp\u003eIn the DHSC, C-LTMRs ablation produced an even broader transcriptional shift, with 694 DEGs (497 down, 197 up; FDR 5%, |log₂FC| \u0026ge; 0.3; Figs.\u0026nbsp;4D and S5C). Downregulated genes corresponded to genes encoding extracellular matrix (ECM) and basement membrane components, vascular and endothelial markers, and glial or myelin-associated transcripts (Fig.\u0026nbsp;4E), which is consistent with our ultrastructural results highlighting a drastically weakened VGLUT3-positive glomeruli (Fig.\u0026nbsp;1H). Upregulated genes were enriched for glutamine transport and energy homeostasis modules, motor proteins assembly/disassembly, rhythmic processes, including circadian regulation of gene expression, nucleosome disassembly related to epigenetic regulation of gene expression as well as processes involved in the positive regulation of cold-induced thermogenesis (Fig.\u0026nbsp;4E). Together, C-LTMRs ablation establishes DRG and spinal environments marked by weakened structural and glial support, disrupted neurovascular stability, and heightened excitability and neuroimmune signaling, conditions that sensitize the system to chronic pain following injury or paclitaxel exposure.\u003c/p\u003e \u003cp\u003eSurprisingly, at D35 after paclitaxel, differential gene expression was greatly reduced in both tissues, with only 16 DEGs in the DRG and 64 in the DHSC (FDR 5%, |log₂FC| \u0026ge; 03, Figs.\u0026nbsp;4F and G), indicating that paclitaxel treatment dampened the extensive differential expression caused by C-LTMRs ablation in na\u0026iuml;ve DRG and DHSC. Among the 16 DEGs in the DRG, all were downregulated and consisted largely of C-LTMRs markers or highly enriched transcripts from this population (Figs. S6A and B). In the DHSC, 29 DEGs were downregulated and 35 upregulated (Figs.\u0026nbsp;4G and S6C). Metascape analysis failed to identify pathway enrichment among the downregulated genes. However, the vast majority of the upregulated genes were mainly involved in axogenesis and synapse organization, neutrophil response, including response to xenobiotic stimulus, suggesting that the DHSC is locked in a state of persistent low-grade inflammation and maladaptive synaptic reorganization, consistent with a spinal environment rewired toward heightened nociceptive transmission (Fig.\u0026nbsp;4H).\u003c/p\u003e\n\u003ch3\u003eTAFA4 rescues paclitaxel-induced chronic pain and restores transcriptional homeostasis\u003c/h3\u003e\n\u003cp\u003eOur previous studies demonstrated strong analgesic properties of TAFA4\u003csup\u003e8,31,40\u003c/sup\u003e. To test whether TAFA4 mitigates paclitaxel-induced chronic pain in \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice, we administered TAFA4 or vehicle twice daily for 7 days, while all mice received paclitaxel every two days over the same period (Fig.\u0026nbsp;5A). TAFA4-treated mice showed a slight delay in the onset of mechanical hypersensitivity and, importantly, exhibited significant pain relief at day 35, whereas, as expected, vehicle-treated mice developed persistent mechanical pain (Fig.\u0026nbsp;5B).\u003c/p\u003e \u003cp\u003eTo identify the mechanisms underlying this rescue, we performed bulk RNA-seq on DRG and DHSC from TAFA4- and vehicle-treated \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice at D35. TAFA4 treatment produced 39 DEGs in the DRG (22 up, 17 down) and 80 in the DHSC (35 up, 45 down; FDR 5%, |log₂FC| \u0026ge; 0.3; Figs.\u0026nbsp;5C and D, S7A-B). In the DRG, Metascape failed to identify pathway enrichment in the up-regulated genes. In contrast, following TAFA4 administration, the downregulated genes were mainly involved in cell surface receptor protein tyrosine kinase signaling pathways, including protein phosphorylation (Fig.\u0026nbsp;5E). In the DHSC, transcripts related to metabolic regulation, including glucose homeostasis, amino acid metabolism and mitochondrial aerobic respiration and regulation of cold-induced thermogenesis were upregulated, while genes linked to structural remodeling, vascular and endothelial signaling, inflammatory immune response and to the response to mechanical stimuli were downregulated as a consequence of TAFA4 treatment (Fig.\u0026nbsp;5F).\u003c/p\u003e \u003cp\u003eThese coordinated transcriptional changes in both DRG and DHSC indicate restored vascular stability and metabolic resilience as well as the control of paclitaxel-induced inflammation, effectively re-establishing somatosensory circuit homeostasis and preventing chronic pain development.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eIn this study, we used an inducible dual-recombinase strategy to selectively ablate C-LTMRs in adult mice and uncovered an essential role for this sensory neuron population in maintaining somatosensory homeostasis.\u003c/p\u003e \u003cp\u003eAlthough historically linked to pleasant touch, accumulating evidence suggests that C-LTMRs also contribute to innocuous thermal perception. Prior \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003eex vivo\u003c/em\u003e work has shown that C-LTMRs respond to gradual temperature changes, particularly across broad cooling and warming ranges, without signaling discrete thresholds \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Our behavioral findings support this thermosensory function \u003cem\u003ein vivo\u003c/em\u003e. In a thermal gradient assay, mice with partial C-LTMRs ablation exhibited a significantly sharper and more spatially restricted preference for warmer temperatures compared to controls. This phenotype was consistent across sexes, emerged gradually, and was not attributable to deficits in locomotion or broad sensory impairment, as exploratory behavior and responses to noxious temperatures were preserved. These findings suggest that C-LTMRs contribute to the detection of relative temperature changes and help guide adaptive thermotaxis behavior. Unlike classical thermoreceptors, which rely on TRP channel-mediated detection of absolute thermal thresholds, C-LTMRs may provide a continuous, graded input that enhances subtle temperature discrimination. In humans, the pleasantness of touch is known to peak at skin temperature (~\u0026thinsp;32\u0026deg;C), where CT afferents (the human equivalents of C-LTMRs) exhibit maximal firing \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. This convergence of tactile and thermal tuning suggests that C-LTMRs encode not just mechanical features of touch, but also its thermal context.\u003c/p\u003e \u003cp\u003eDespite this clear thermosensory phenotype, baseline tactile responses in \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice were largely preserved. In assays such as the tape removal test and oil drop assay, ablated animals performed comparably to controls. A minor but consistent delay in the wet-dog shake reflex was observed, a behavior recently linked to C-LTMRs-mediated engagement of the spinoparabrachial pathway \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. These findings suggest that partial ablation either spares a sufficient number of C-LTMRs to support basic tactile perception or that redundant pathways involving other low-threshold mechanoreceptors compensate for the loss. Supporting the former hypothesis, single-cell RNA sequencing has identified two subsets of C-LTMRs distinguished by differing levels of tyrosine hydroxylase (TH) expression \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Given that the \u003cem\u003eTh\u003c/em\u003e locus drives Cre recombinase expression in this model, it is plausible that the spared population contributing to residual tactile behaviors, including tape removal and the wet-dog shake, is the subset expressing lower levels of TH, and thus the subset that is spared in our experimental setting.\u003c/p\u003e \u003cp\u003eA more striking phenotype emerged under conditions of repeated mechanical stimulation. \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice exhibited increased mechanical hypersensitivity in both acute and chronic pain models, including exaggerated responses to repetitive stimulation of uninjured tissue; a pattern resembling wind-up \u003csup\u003e41\u003c/sup\u003e. These data suggest that C-LTMRs are involved in suppressing this amplification process under normal conditions. This interpretation is supported by human psychophysical studies demonstrating that CT-targeted touch reduces wind-up pain and modulates cortical responses associated with central sensitization. For instance, Fidanza et al. (2021) showed that gentle stroking of CT-innervated skin inhibits wind-up, while similar stimuli to glabrous skin do not \u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Wakui et al. (2025) further demonstrated that CT activation uniquely shapes cortical responses to repetitive mechanical input \u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Similarly, Taneja et al. (2021) found that continuous CT-optimal stimulation alleviates hyperalgesia on remote body regions, but only when delivered with CT-specific parameters \u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. Together, these findings support a conserved role for C-LTMRs in damping excitatory spinal signaling and modulating central pain states.\u003c/p\u003e \u003cp\u003eThe most profound effect of C-LTMRs ablation was observed following injury. In both paw incision and paclitaxel-induced neuropathy models, \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice failed to recover from mechanical hypersensitivity and instead developed persistent pain. This occurred despite intact Aβ fibers and other low-threshold mechanoreceptors, underscoring a protective role for C-LTMRs in pain resolution and strongly implicating this enigmatic population in the gate control theory of pain \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. While this theory has long provided a foundational framework in pain research, the specific afferent subtypes mediating gating mechanisms have remained elusive. Our findings provide direct evidence that C-LTMRs contribute to this gating function by modulating pain resolution after injury. Rather than broadly inhibiting nociceptive input, C-LTMRs appear to selectively constrain maladaptive plasticity during the transition from acute to chronic pain. Their loss unmasks latent sensitization, thereby promoting the development of prolonged pain states.\u003c/p\u003e \u003cp\u003eHow, mechanistically speaking, C-LTMRs contribute to the development of prolonged pain states? Transcriptomic profiling revealed that C-LTMRs loss fundamentally destabilizes somatosensory circuit homeostasis. Even in the absence of injury, ablation triggered broad transcriptional reprogramming in both DRG and DHSC, marked by reduced vascular and extracellular matrix support and heightened excitability, metabolic stress, and neuroimmune signaling. These changes define a primed molecular state that favors sensitization and provides a mechanistic basis for the exaggerated and persistent mechanical hypersensitivity observed behaviorally.\u003c/p\u003e \u003cp\u003eIntriguingly, the DHSC showed the most extensive disruption, with downregulation of structural and glial programs and upregulation of pathways governing RNA processing, translational control, and intracellular signaling, which are key events for central sensitization. These central alterations align with the structural defects in VGLUT3\u003csup\u003e+\u003c/sup\u003e glomeruli and suggest that C-LTMRs contribute critically to maintaining synaptic architecture and inhibitory balance within lamina IIi.\u003c/p\u003e \u003cp\u003eUnexpectedly, paclitaxel treatment greatly attenuated the large transcriptional differences observed at baseline, with DEGs largely restricted to the remaining C-LTMRs-enriched transcripts. This normalization paradox may reflect a floor effect following the already profound transcriptional collapse triggered by C-LTMRs loss, or a convergence of transcriptional states as paclitaxel drives global somatosensory reprogramming in both genotypes\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e,\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. Behaviorally, however, paclitaxel unmasked the functional vulnerability created by C-LTMRs ablation, producing exaggerated and persistent hypersensitivity.\u003c/p\u003e \u003cp\u003eTAFA4 treatment reversed this vulnerability at both the behavioral and transcriptomic levels. In the DRG, TAFA4 downregulated genes associated with vascular stress, aberrant excitability, and synaptic destabilization while upregulating those supporting metabolic resilience and neuroprotection. In the DHSC, TAFA4 suppressed ECM and endothelial stress markers and restored programs involved in metabolic regulation and synaptic stability. These coordinated changes indicate that TAFA4 reestablishes the structural, vascular, and transcriptional homeostasis that C-LTMRs loss disrupts, thereby preventing the transition to chronic pain after paclitaxel.\u003c/p\u003e \u003cp\u003eTogether, our results define C-LTMRs as essential regulators of the molecular environment of both peripheral and central somatosensory circuits. Their loss destabilizes structural, vascular and metabolic support systems and elevates excitability and stress-response programs, creating a primed state highly susceptible to pathological sensitization. Conversely, TAFA4 restores homeostatic transcriptional programs across both DRG and DHSC, highlighting its therapeutic potential in chronic pain associated with sensory circuit destabilization.\u003c/p\u003e"},{"header":"EXPERIMENTAL PROCEDURES","content":"\u003cp\u003e\u003cu\u003eMice\u0026nbsp;\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eMice were maintained under standard housing conditions (22\u0026deg;C, 40% humidity, 12 hr light cycles, and free access to food and water). Mice at 8 to 12 weeks of age and of both sexes were used for experiments. Particular efforts were made to minimize the number of mice used in this study, as well as the stress and suffering to which they were subjected. All experiments were conducted in line with the European guidelines for the care and use of laboratory animals (Council Directive 86/609/EEC). All experimental procedures were approved by an independent ethics committee for animal experimentation (APAFIS), as required by the French law and in accordance with the relevant institutional regulations of French legislation on animal experimentation, under license number APAFIS #34501. All experiments were performed in accordance with the ARRIVE guidelines.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eGeneration of mouse lines\u0026nbsp;\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eNa\u003csub\u003ev\u003c/sub\u003e1.8\u003csup\u003eIres\u0026minus;FLPo\u003c/sup\u003e mice \u003csup\u003e45\u003c/sup\u003e were crossed with TH\u003csup\u003e2ACreERT2\u003c/sup\u003e mice \u003csup\u003e46\u003c/sup\u003e and Tau\u003csup\u003eds-DTR\u003c/sup\u003e (gift of Dr Martyn Goulding) to generate Na\u003csub\u003ev\u003c/sub\u003e1.8\u003csup\u003eIres\u0026minus;FLPo/+\u003c/sup\u003e::TH\u003csup\u003e2ACreERT2/+\u003c/sup\u003e::Tau\u003csup\u003eds-DTR/+\u003c/sup\u003e named\u0026nbsp;\u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice.\u003cbr\u003eNa\u003csub\u003ev\u003c/sub\u003e1.8\u003csup\u003eIres\u0026minus;FLPo/+\u003c/sup\u003e::Tau\u003csup\u003eds-DTR/+\u003c/sup\u003e were used as control.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNa\u003csub\u003ev\u003c/sub\u003e1.8\u003csup\u003eIres\u0026minus;FLPo\u003c/sup\u003e mice \u003csup\u003e45\u003c/sup\u003e were crossed with RC::FL-hM3Dq mice \u003csup\u003e31\u003c/sup\u003e to generate Nav1.8\u003csup\u003eIres-FLPo\u003c/sup\u003e::RC::FL-hM3Dq (related to Fig. S2).\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eTamoxifen treatmeant\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eTamoxifen (Sigma #T5648) was freshly prepared and dissolved in corn oil (Sigma #C8267) to a concentration of 20 mg/mL. Tamoxifen solution was administered by using oral gavage (Instech Laboratories\u0026trade; Feeding tube, rodent oral gavage, stainless steel, 22ga x 25mm, straight, sterile_Brand: Instech Laboratories\u0026trade; FTSS-22S-25), once daily for five consecutive days, to 3-week-old mice. Both \u003cem\u003eC-LTMRs-DTR\u0026nbsp;\u003c/em\u003eand control mice were treated.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eDiphteria toxin treatmeant\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eDiphtheria Toxin (Sigma #322326-1MG) was dissolved in water then aliquoted and stored at -80\u0026deg;C. Diphteria Toxin solution was freshly prepared and administrated by using I.P (50\u0026micro;g/kg) on 2 days; separated by 48\u0026thinsp;h. Behavioral tests were performed 7 to 10 weeks after the initial DT injection. Both \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e and control mice were treated. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eTissue processing for immunofluorescence (IF) and \u003cem\u003ein situ\u003c/em\u003e hybridization (ISH)\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eMice of both sexes were used for all experiments. Mice were deeply anesthetized with 100\u0026nbsp;mg/kg ketamine plus 10\u0026nbsp;mg/kg xylazine, and were intracardially perfused with an ice-cold solution of phosphate-buffered saline (PBS) followed by 30\u0026nbsp;ml ice-cold 4% paraformaldehyde in PBS. Their tissues were dissected and post-fixed by overnight incubation in the same fixative at 4\u0026deg;C.\u003c/p\u003e\n\u003cp\u003eDRG, JNG, celiac ganglion, and brain tissues were transferred to 30% (w/v) sucrose in PBS for cryoprotection and incubated at 4\u0026deg;C until they sank. They were then frozen in OCT medium and stored at \u0026minus;80 \u0026deg;C. Samples with a thickness of 12\u0026thinsp;\u0026mu;m (DRG, JNG) or 20\u0026micro;m (celiac), were cut with a standard cryostat (Leica). All these tissue sections were mounted on Superfrost slides and kept at \u0026minus;80\u0026deg;C until their use for IF experiments.\u003c/p\u003e\n\u003cp\u003eBrain and the lumbar segment of the spinal cord were mounted in a small 3% agarose block. Sections with a thickness of 80 \u0026mu;m were cut with a Leica VT1200S vibratome, collected in a six-well plate filled with PBS and stored at 4\u0026deg;C until their use for IF experiments.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eImmunofluorescence\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eFor immunostaining, sections were incubated for 1 h at room temperature in PBS-10% (vol/vol) donkey serum (Sigma), 3% (weight/vol) bovine albumin (Sigma), 0.4% Triton X-100 and then overnight at 4\u0026deg;C with primary antibodies diluted in the same blocking solution. The primary antibodies used in this study were chicken anti-GFP (1:1000, Thermo Fisher Scientific, A10262); rabbit anti-P2X3 (1:1000 Neuromics Cat# RA10109, RRID:AB_2157931); rabbit anti-CGRP (1:1000, Cabiochem, PC205L, for DRG staining); rabbit anti-neurofilament M (145 kDa) (1:1000, Sigma-Aldrich AB1987) ; rabbit anti-TH (1:500, Sigma-Aldrich AB152); rat anti-TAFA4 (1:2000, a gift from Sophie Ugolini (CIML)); goat anti-TRKC (1:500, R and D Systems Cat# AF1404, RRID:AB_2155412); guinea pig anti-VGLUT3 (1:1000, Synaptic Systems, 135204). After three washes for 5 minutes each in 1xPBS, sections were incubated for 1 h at room temperature with secondary antibodies diluted in the blocking solution described above. The corresponding donkey anti-chicken, anti-rat, anti-rabbit, anti-goat or anti-guineapig Alexa 488-, 555-, or 647-conjugated secondary antibodies (1:500, Thermo Fisher Scientific) was used for the detection of primary antibody binding. Isolectin B4 conjugates with AlexaFluorR 647 dye were used at a dilution of 1:200 (Thermo Fisher Scientific I32450). Tissues were washed (3 times in 1xPBS) and mounted in ImmuMount Reagent. Images were acquired with an AxioImager M2 (Zeiss) fluorescence microscope with a 20x/0,8 objective and contrast was adjusted with Fiji software.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCell count\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe entire L3 DRG was sectioned at 12 \u0026micro;m thickness using step serial sectioning and distributed across seven slides, ensuring that each slide contained a representative cross-section of the entire ganglion. Quantification of TH-, CGRP-, or P2X3-positive neurons was performed on all DRG sections present on a single slide from the L3 level. To estimate the total number of TH\u003csup\u003e+\u003c/sup\u003e , CGRP\u003csup\u003e+\u003c/sup\u003e , or P2X3\u003csup\u003e+\u003c/sup\u003e neurons in a whole L3 DRG, the count obtained from that single slide was multiplied by seven. All analyses were conducted blind to the genotype of the animals.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cu\u003eIn situ\u003c/u\u003e\u003c/em\u003e\u003cu\u003e\u0026nbsp;hybridization\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eRNA probes were synthesized with gene-specific PCR primers and cDNA templates from mouse DRG. \u003cem\u003eIn situ\u003c/em\u003e hybridization was performed with digoxigenin-labeled probes (Roche, cat# 11277073910). Probes were incubated with the slides overnight at 55\u0026deg;C and the slides were then incubated with the horseradish peroxidase-conjugated anti-digoxigenin antibody 1:500 (Roche, Cat#11207733910; RRID:AB_514500). Final detection was achieved with TSA-Cy3 at a dilution of 1:50 (Perkin Elmer Life Sciences, FP1170). The following oligonucleotides were used for the nested PCRs for probe synthesis:\u003c/p\u003e\n\u003cp\u003eCeacam10 F1\u0026nbsp;\u0026nbsp;gactactgctcacagcctcact\u003c/p\u003e\n\u003cp\u003eCeacam10 R1\u0026nbsp;\u0026nbsp;cctactgctttttagcgtgaac\u003c/p\u003e\n\u003cp\u003eCeacam10 F2\u0026nbsp;\u0026nbsp;tggtacaagggaaacagtgg\u003c/p\u003e\n\u003cp\u003eCeacam10 R2\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;TAATACGACTCACTATAGGGggcattagggtatgatcgaagt\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eElectron Microscopy (EM)\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTissue preparation for ultrastructural morphology\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eMice of both sexes were used for all experiments. Mice were deeply anesthetized with 100\u0026nbsp;mg/kg ketamine plus 10\u0026nbsp;mg/kg xylazine and perfused with Ringer solution followed by 1% PAF\u0026nbsp;+ 2% glutaraldehyde in 0.1\u0026nbsp;M phosphate buffer, pH 7.4. Lumbar spinal cord segments were dissected out and postfixed for 2\u0026nbsp;h in the same aldehyde mixture. Coronal sections were cut on a vibratome (Leica VT1000S) at a thickness of 100\u0026nbsp;\u0026mu;m.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eEM embedding\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eSpinal cord sections were post-fixed in osmium ferrocyanide for 1\u0026nbsp;h at 4\u0026deg;C, dehydrated in graded acetone, incubated in acetone/Spurr resin (1:1; 30\u0026nbsp;min), acetone/Spurr resin (1:2; 30\u0026nbsp;min) and Spurr resin overnight at room temperature. Finally, sections were flat-embedded in Spurr resin in capped 00 BEEM capsules (Electron Microscopy Sciences) (24 h, at 70\u0026deg;C). Ultrathin sections were cut with an ultramicrotome (EM UC6, Leica) and collected on uncoated nickel grids (200 mesh).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eEM post-embedding immunostaining\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eUltrathin sections were doubled immunostained following a conventional post-embedding protocol \u003csup\u003e14\u003c/sup\u003e. Sections were treated for 3\u0026nbsp;min with a sodium borohydride solution (Sigma), rinsed in 1% Triton X-100 in Tris buffered saline (TBS) 0.5 M, and incubated for 1\u0026nbsp;h in 10% normal serum and/or bovine serum albumin. Grids were then incubated overnight on drops of a mixture of rabbit anti-VGLUT3 primary antibody (1:20, Synaptic System, Cat# 135203) and Lectin from Bandeiraea simplicifolia (\u003cem\u003eGriffonia simplicifolia\u003c/em\u003e) biotin conjugated (IB4; 1:20; Sigma, Cat# L2140). After rinsing in TBS, sections were incubated in a mixture of anti-rabbit 20 nm-gold conjugated secondary antibody (1:15; BBI Solutions, Cardiff, United Kingdom) and Streptavidin 10 nm-gold conjugated (1:15, Sigma) for 1 h at 37\u0026deg;C. They were then transferred into drops of 2.5% glutaraldehyde in cacodylate buffer 0.05\u0026nbsp;M pH 7.4 for 10\u0026nbsp;min, and finally washed in distilled water. Sections were further counterstained for 30\u0026rsquo;\u0026rsquo; with Uranyl Less EM Stain and for 30\u0026rsquo;\u0026rsquo; with Lead citrate (Electron Microscopy Sciences, Hatfield, PA, USA).\u003c/p\u003e\n\u003cp\u003eGrids were observed with a JEM-1400 Flash transmission electron microscope (Jeol, Tokyo, Japan). The Jeol Matataki Flash camera\u0026apos;s automated montage system was employed to obtain electron micrographs.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eEM Quantification of Glomeruli\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eWe counted the number of glomeruli in lamina II to assess whether there was a loss after DT-selective ablation of C-LTMRs. We focused our analysis on counting non-peptidergic glomeruli of the type Ia (GIa) from control vs \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e animals in (i) plain ultrathin sections; and (ii) sections immunolabeled for IB4 and VGLUT3. Five sections/animal for control and \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e mice were examined in studies that were carried out by an operator unaware of the experimental group. More precisely, the experimenter directly counted the number of glomeruli within all the 90\u0026thinsp;\u0026times;\u0026thinsp;90 \u0026micro;m squares of 200 mesh EM grids that were occupied by relevant tissue. Quantitative analysis was performed using the ImageJ software (NIH, Bethesda, USA) and Graph Pad Prism 6 (GraphPad Software, San Diego, CA, USA).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cu\u003ePain models\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePaw incision\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003ePaw incision surgery was performed as described by Brennan \u003csup\u003e36\u003c/sup\u003e. Mice were anesthetized with ketamine (40 mg/kg IP) and xylazine (5 mg/kg IP) and a longitudinal incision was made through the skin and fascia of the right hind paw. Forceps were used to elevate the flexor digitorum brevis muscle longitudinally and an incision was made through the muscle with a scalpel, to cut it into two halves. The wound was closed with sutures, and the animals were allowed to recover and returned to their cages.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePaclitaxel treatment\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003ePaclitaxel (Sigma 580555-5MG) was dissolved in a mixture of 1:1 [1 volume ethanol/1 volume Kolliphor-620 (Kolliphor-EL Sigma C5135). Paclitaxel solution was extemporaly prepared at a concentration of 0.4 mg/mL by diluting the 5 mg/ml stock solution with 0.9% NaCl. The mice received an intraperitoneal injection of paclitaxel (4 mg/kg) every two days for a total of four injections. The last injection was administered 72 hours after the third injection. Both \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e and control mice were treated.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eBehavior\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eAll behavioral assays were conducted on 11 - to 14-week-old mice of both sexes. Animals were acclimated to their testing environment for 45-60 minutes before each experiment, and all experiments were performed at room temperature (~22\u0026deg;C). Experimenters were blind to the treatments used.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eOpen-field test\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe open-field apparatus consists of an empty square arena (40x40x35 cm), surrounded by walls to prevent animal from escaping. Light inside the arena was uniform and kept at approximately 100 lux throughout the tests. Control and cre positive mice were individually placed in the center of the arena and their behavior was recorded using the EthoVision XT16 video-tracking system (Noldus) over a 10-minute period. The time spent grooming and rearing, the total distance traveled, and the total amount of time spent in the peripheral borders and in the center were recorded.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eRotarod test\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eA rotarod apparatus (LSI Letica Scientific Instruments) was used to explore coordinated locomotor and balance function in mice. Mice were placed on a rod that slowly accelerated from 4 rpm to 44 rpm over 5 minutes and the latency to fall off during this period was recorded. The test was conducted over 3 consecutive days. Each day, the animals were tested 3 times separated by at least a 5-minute resting period.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eThermal gradient test\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eResponse to temperature Gradient assay were performed as described in \u003csup\u003e47\u003c/sup\u003e but using Bioseb apparatus.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTape test\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eMice were allowed to acclimate in a circular plexiglass container for 5 minutes. A 3 cm piece of common lab tape was then applied gently to the back of the mouse such that it sticks to the mouse. Mice are then observed for 5 minutes. The latency before the first response is recorded and the total number of responses to the tape were counted. A response was scored when the mouse stopped moving and bites or scratched the piece of tape or showed a visible \u0026ldquo;wet dog shake\u0026rdquo; motion in an attempt to remove the foreign object on its back.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eOil droplet test\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThis test was performed as described in \u003csup\u003e48\u003c/sup\u003e. Briefly, oil droplet stimuli, 16-18 \u0026micro;l of sunflower seed oil (Sigma #S5007) were applied to the neck of the mice using a glass Pasteur pipette. A response was scored when the mouse showed a visible \u0026ldquo;wet dog shake\u0026rdquo; motion in an attempt to remove the oil on its neck.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eVon Frey\u0026rsquo;s test\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eMice were placed in plastic chambers on a wire mesh grid and stimulated with von Frey filaments (Bioseb) by the up-down method \u003csup\u003e49\u003c/sup\u003e starting with a 1g filament, and using 0.07 and 2g filaments as the cutoffs.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eDry ice test\u003c/u\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe mice were acclimated on a glass plate (8 mm thick float borosilicate Pyrex) in transparent plastic enclosures separated by opaque black partitions for 30 minutes to one hour. Resting mice, but not sleeping mice, were tested by placing a dry ice pellet under the hindpaw on the glass plate. The dry ice should be placed in the center of the hind paw, being careful to avoid the distal joints and ensuring good contact between the paw and the glass. Withdrawal latency was measured with a stopwatch and defined as any action aimed at moving the paw away from the cold glass, either vertically or horizontally. There was an interval of at least 15 minutes between tests on the same paw. These intervals were chosen empirically to allow sufficient time for the mouse to return to a resting state after stimulation. Each paw was measured at least three times. The maximum time allowed for withdrawal is 20 seconds to avoid potential tissue damage. Trials in which the animal does not withdraw within 20 seconds are repeated. During the second test, if there was no withdrawal within the threshold, the value was recorded as 20 seconds.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eHigh-throughput RNA sequencing and analyses\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eControl and \u003cem\u003eC-LTMRs-DTR\u003c/em\u003e DRG or DHSC RNAs from naive and 40 days post paclitaxel mice (only males), were extracted in experimental quadruplate from individual mice. High quality RNA (RIN \u0026gt; 8) was used for sequencing. RNA quality was measured using Agilent RNA 6000 Pico Kit. RNA-seq libraries were prepared using Watchmaker mRNA Library Prep Kit (Watchmaker Genomics) in order to produce paired end reads of 100 pb. All libraries were validated for concentration and fragment size using Agilent DNA1000 chips. Sequencing was performed on a NovaSeqX (Illumina) and quality control performed using FastQC (https://www.bioinformatics.bbsrc.ac.uk/projects/fastqc). Sequences were uniquely mapped to the mm39 genome using STAR \u003csup\u003e50\u003c/sup\u003e (version 2.7.11b) using default values and paired-end mode. Reads mapping to gene exons (GRCm39 GCF_000001635.27 NCBI RefSeq assembly) were counted using featureCounts \u003csup\u003e51\u003c/sup\u003e (C version 1.4.6-p2). Differential gene expression was performed using exon counts from biological replicates using the EdgeR BioConductor R package \u003csup\u003e52\u003c/sup\u003e (version 4.2.2), using a 5 % false discovery rate (FDR) cutoff. Heat-maps were generated using Heatmapper on-line software (https://heatmapper.ca). Venny diagrams were generated using Venny on-line software (https://bioinfogp.cnb.csic.es/tools/venny/). Functional analysis was performed using Metascape software \u003csup\u003e53\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eSoftware\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eSome figures elements were generated using BioRender on-line software (https://www.biorender.com/)\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eQuantification and statistical analysis\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eResults were expressed as mean +/- SEM. Quantitative and statistical analyses were performed by using the GraphPad Prism 7 (GraphPad Software, La Jolla, CA) and were indicated in each figure. The Shapiro\u0026ndash;Wilk test was used to assess the normality of the data. Statistical significance was set to *P , 0.05, **P , 0.01,***P , 0.001, and ****P , 0.0001.\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eG.R characterized the mouse model, managed the mouse colony and generated most of the data presented in the manuscript. He also generated all the figures and managed the writing of the materials and methods section, K.M set up the CIPN model and generated the related data, contributed to the immunostaining and RNA-seq data. A.C. generated the data on paw incision and behavioral experiment related to TAFA4. P.M generated the Nav1.8-FLP mouse model. C.S performed the electron microscopy experiments and generated data that will be published elsewhere. A.S analysed the raw RNA-seq data, A.R managed the progression of the project, contributed to the generation and analysis of the RNA-seq data. A.M designed the project and wrote the manuscript. All authors contributed to editing the manuscript.\u003c/p\u003e \u003cdiv id=\"Sec37\" class=\"Section2\"\u003e \u003ch2\u003eACKNOWLEGMENTS\u003c/h2\u003e \u003cp\u003eWe are grateful to the members of the Moqrich lab at IBDM for the scientific discussions. The IBDM imaging and animal facilities for assistance. This work was funded by the ANR Sensorimmune and by institutional funding from the CNRS and Aix-Marseille-Universit\u0026eacute; to IBDM.\u003c/p\u003e \u003c/div\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMelzack R, Wall PD (1965) Pain mechanisms: a new theory. Science 150:971\u0026ndash;979. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.150.3699.971\u003c/span\u003e\u003cspan address=\"10.1126/science.150.3699.971\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLarsson M, Nagi SS (2022) Role of C-tactile fibers in pain modulation: animal and human perspectives. Curr Opin Behav Sci 43:1\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cobeha.2021.09.005\u003c/span\u003e\u003cspan address=\"10.1016/j.cobeha.2021.09.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZotterman Y (1939) Touch, pain and tickling: an electro-physiological investigation on cutaneous sensory nerves. J Physiol 95:1\u0026ndash;28. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1113/jphysiol.1939.sp003707\u003c/span\u003e\u003cspan address=\"10.1113/jphysiol.1939.sp003707\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBessou P, Burgess PR, Perl ER, Taylor CB (1971) Dynamic properties of mechanoreceptors with unmyelinated (C) fibers. J Neurophysiol 34:116\u0026ndash;131. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1152/jn.1971.34.1.116\u003c/span\u003e\u003cspan address=\"10.1152/jn.1971.34.1.116\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAckerley R, Saar K, McGlone F, Wasling B, H (2014) Quantifying the sensory and emotional perception of touch: differences between glabrous and hairy skin. Front Behav Neurosci 8:34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fnbeh.2014.00034\u003c/span\u003e\u003cspan address=\"10.3389/fnbeh.2014.00034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiljencrantz J, Olausson H (2014) Tactile C fibers and their contributions to pleasant sensations and to tactile allodynia. Front Behav Neurosci 8:37. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fnbeh.2014.00037\u003c/span\u003e\u003cspan address=\"10.3389/fnbeh.2014.00037\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi L, Rutlin M, Abraira VE, Cassidy C, Kus L, Gong S, Jankowski MP, Luo W, Heintz N, Koerber HR et al (2011) The functional organization of cutaneous low-threshold mechanosensory neurons. Cell 147:1615\u0026ndash;1627. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2011.11.027\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2011.11.027\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDelfini MC, Mantilleri A, Gaillard S, Hao J, Reynders A, Malapert P, Alonso S, Francois A, Barrere C, Seal R et al (2013) TAFA4, a chemokine-like protein, modulates injury-induced mechanical and chemical pain hypersensitivity in mice. Cell Rep 5:378\u0026ndash;388. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2013.09.013\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2013.09.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRenthal W, Tochitsky I, Yang L, Cheng YC, Li E, Kawaguchi R, Geschwind DH, Woolf CJ (2020) Transcriptional Reprogramming of Distinct Peripheral Sensory Neuron Subtypes after Axonal Injury. Neuron 108:128\u0026ndash;144e129. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.neuron.2020.07.026\u003c/span\u003e\u003cspan address=\"10.1016/j.neuron.2020.07.026\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReynders A, Anissa Jhumka Z, Gaillard S, Mantilleri A, Malapert P, Magalon K, Etzerodt A, Salio C, Ugolini S, Castets F et al (2024) Gut microbiota promotes pain chronicity in Myosin1A deficient male mice. Brain Behav Immun 119:750\u0026ndash;766. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbi.2024.05.010\u003c/span\u003e\u003cspan address=\"10.1016/j.bbi.2024.05.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReynders A, Mantilleri A, Malapert P, Rialle S, Nidelet S, Laffray S, Beurrier C, Bourinet E, Moqrich A (2015) Transcriptional Profiling of Cutaneous MRGPRD Free Nerve Endings and C-LTMRs. Cell Rep 10:1007\u0026ndash;1019. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2015.01.022\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2015.01.022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReynders A, Moqrich A (2015) Analysis of cutaneous MRGPRD free nerve endings and C-LTMRs transcriptomes by RNA-sequencing. Genom Data 5:132\u0026ndash;135. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.gdata.2015.05.022\u003c/span\u003e\u003cspan address=\"10.1016/j.gdata.2015.05.022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeal RP, Wang X, Guan Y, Raja SN, Woodbury CJ, Basbaum AI, Edwards RH (2009) Injury-induced mechanical hypersensitivity requires C-low threshold mechanoreceptors. Nature 462:651\u0026ndash;655. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nature08505\u003c/span\u003e\u003cspan address=\"10.1038/nature08505\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUsoskin D, Furlan A, Islam S, Abdo H, Lonnerberg P, Lou D, Hjerling-Leffler J, Haeggstrom J, Kharchenko O, Kharchenko PV et al (2015) Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat Neurosci 18:145\u0026ndash;153. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nn.3881\u003c/span\u003e\u003cspan address=\"10.1038/nn.3881\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalio C, Aimar P, Malapert P, Moqrich A, Merighi A (2021) Neurochemical and Ultrastructural Characterization of Unmyelinated Non-peptidergic C-Nociceptors and C-Low Threshold Mechanoreceptors Projecting to Lamina II of the Mouse Spinal Cord. Cell Mol Neurobiol 41:247\u0026ndash;262. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10571-020-00847-w\u003c/span\u003e\u003cspan address=\"10.1007/s10571-020-00847-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNordin M (1990) Low-threshold mechanoreceptive and nociceptive units with unmyelinated (C) fibres in the human supraorbital nerve. J Physiol 426:229\u0026ndash;240. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1113/jphysiol.1990.sp018135\u003c/span\u003e\u003cspan address=\"10.1113/jphysiol.1990.sp018135\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHabig K, Schanzer A, Schirner W, Lautenschlager G, Dassinger B, Olausson H, Birklein F, Gizewski ER, Kramer HH (2017) Low threshold unmyelinated mechanoafferents can modulate pain. BMC Neurol 17:184. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12883-017-0963-6\u003c/span\u003e\u003cspan address=\"10.1186/s12883-017-0963-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShaikh M, Ostor AJ (2015) Evaluating the patient with low back pain. Practitioner 259:21\u0026ndash;24\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSamour MS, Nagi SS, Mahns DA (2015) Cav3.2-expressing low-threshold C fibres in human hairy skin contribute to cold allodynia\u0026ndash;a non-TRPV1- and non-TRPM8-dependent phenomenon. Pain 156:1566\u0026ndash;1575. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/j.pain.0000000000000202\u003c/span\u003e\u003cspan address=\"10.1097/j.pain.0000000000000202\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagi SS, Rubin TK, Chelvanayagam DK, Macefield VG, Mahns DA (2011) Allodynia mediated by C-tactile afferents in human hairy skin. J Physiol 589:4065\u0026ndash;4075. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1113/jphysiol.2011.211326\u003c/span\u003e\u003cspan address=\"10.1113/jphysiol.2011.211326\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagi SS, Marshall AG, Makdani A, Jarocka E, Liljencrantz J, Ridderstrom M, Shaikh S, O'Neill F, Saade D, Donkervoort S et al (2019) An ultrafast system for signaling mechanical pain in human skin. Sci Adv 5:eaaw1297. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/sciadv.aaw1297\u003c/span\u003e\u003cspan address=\"10.1126/sciadv.aaw1297\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagi SS, Mahns DA (2013) C-tactile fibers contribute to cutaneous allodynia after eccentric exercise. J Pain 14:538\u0026ndash;548. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jpain.2013.01.009\u003c/span\u003e\u003cspan address=\"10.1016/j.jpain.2013.01.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBruti G, Foggetti P (2024) Insecure Attachment, Oxytocinergic System and C-Tactile Fibers: An Integrative and Translational Pathophysiological Model of Fibromyalgia and Central Sensitivity Syndromes. Biomedicines \u003cem\u003e12\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/biomedicines12081744\u003c/span\u003e\u003cspan address=\"10.3390/biomedicines12081744\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLapp HS, Sabatowski R, Weidner K, Croy I, Gossrau G (2020) C-tactile touch perception in migraineurs - a case-control study. Cephalalgia 40:478\u0026ndash;492. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1177/0333102419889349\u003c/span\u003e\u003cspan address=\"10.1177/0333102419889349\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeirs C, Williams SP, Zhao X, Walsh CE, Gedeon JY, Cagle NE, Goldring AC, Hioki H, Liu Z, Marell PS, Seal RP (2015) Dorsal Horn Circuits for Persistent Mechanical Pain. Neuron \u003cem\u003e87\u003c/em\u003e, 797\u0026ndash;812. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.neuron.2015.07.029\u003c/span\u003e\u003cspan address=\"10.1016/j.neuron.2015.07.029\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrancois A, Schuetter N, Laffray S, Sanguesa J, Pizzoccaro A, Dubel S, Mantilleri A, Nargeot J, Noel J, Wood JN et al (2015) The Low-Threshold Calcium Channel Cav3.2 Determines Low-Threshold Mechanoreceptor Function. Cell Rep 10:370\u0026ndash;382. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2014.12.042\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2014.12.042\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoble DJ, Dongmo R, Parvin S, Martin KK, Garraway SM (2022) C-low threshold mechanoreceptor activation becomes sufficient to trigger affective pain in spinal cord-injured mice in association with increased respiratory rates. Front Integr Neurosci 16:1081172. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fnint.2022.1081172\u003c/span\u003e\u003cspan address=\"10.3389/fnint.2022.1081172\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDraxler P, Honsek SD, Forsthuber L, Hadschieff V, Sandkuhler J (2014) VGluT3(+) primary afferents play distinct roles in mechanical and cold hypersensitivity depending on pain etiology. J Neurosci 34:12015\u0026ndash;12028. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1523/JNEUROSCI.2157-14.2014\u003c/span\u003e\u003cspan address=\"10.1523/JNEUROSCI.2157-14.2014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBohic M, Marics I, Santos C, Malapert P, Ben-Arie N, Salio C, Reynders A, Le Feuvre Y, Saurin AJ, Moqrich A (2020) Loss of bhlha9 Impairs Thermotaxis and Formalin-Evoked Pain in a Sexually Dimorphic Manner. Cell Rep 30:602\u0026ndash;610e606. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2019.12.041\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2019.12.041\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUrien L, Gaillard S, Lo Re L, Malapert P, Bohic M, Reynders A, Moqrich A (2017) Genetic ablation of GINIP-expressing primary sensory neurons strongly impairs Formalin-evoked pain. Sci Rep 7:43493. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/srep43493\u003c/span\u003e\u003cspan address=\"10.1038/srep43493\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoo S, Santos C, Reynders A, Marics I, Malapert P, Gaillard S, Charron A, Ugolini S, Rossignol R, Khallouqi E, A., et al (2021) TAFA4 relieves injury-induced mechanical hypersensitivity through LDL receptors and modulation of spinal A-type K(+) current. Cell Rep 37:109884. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2021.109884\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2021.109884\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSciolino NR, Plummer NW, Chen YW, Alexander GM, Robertson SD, Dudek SM, McElligott ZA, Jensen P (2016) Recombinase-Dependent Mouse Lines for Chemogenetic Activation of Genetically Defined Cell Types. Cell Rep 15:2563\u0026ndash;2573. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2016.05.034\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2016.05.034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRanade SS, Woo SH, Dubin AE, Moshourab RA, Wetzel C, Petrus M, Mathur J, Begay V, Coste B, Mainquist J et al (2014) Piezo2 is the major transducer of mechanical forces for touch sensation in mice. Nature 516:121\u0026ndash;125. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nature13980\u003c/span\u003e\u003cspan address=\"10.1038/nature13980\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang D, Turecek J, Choi S, Delisle M, Pamplona CL, Meltzer S, Ginty DD (2024) C-LTMRs mediate wet dog shakes via the spinoparabrachial pathway. bioRxiv. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/2024.06.10.597395\u003c/span\u003e\u003cspan address=\"10.1101/2024.06.10.597395\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGaillard S, Lo Re L, Mantilleri A, Hepp R, Urien L, Malapert P, Alonso S, Deage M, Kambrun C, Landry M et al (2014) GINIP, a Galphai-interacting protein, functions as a key modulator of peripheral GABAB receptor-mediated analgesia. Neuron 84:123\u0026ndash;136. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.neuron.2014.08.056\u003c/span\u003e\u003cspan address=\"10.1016/j.neuron.2014.08.056\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCavanaugh DJ, Lee H, Lo L, Shields SD, Zylka MJ, Basbaum AI, Anderson DJ (2009) Distinct subsets of unmyelinated primary sensory fibers mediate behavioral responses to noxious thermal and mechanical stimuli. Proc Natl Acad Sci U S A 106:9075\u0026ndash;9080. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.0901507106\u003c/span\u003e\u003cspan address=\"10.1073/pnas.0901507106\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrennan TJ (1999) Postoperative Models of Nociception. ILAR J 40:129\u0026ndash;136. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/ilar.40.3.129\u003c/span\u003e\u003cspan address=\"10.1093/ilar.40.3.129\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun W, Yang S, Wu S, Ba X, Xiong D, Xiao L, Hao Y (2023) Transcriptome analysis reveals dysregulation of inflammatory and neuronal function in dorsal root ganglion of paclitaxel-induced peripheral neuropathy rats. Mol Pain 19:17448069221106167. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1177/17448069221106167\u003c/span\u003e\u003cspan address=\"10.1177/17448069221106167\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrenner DS, Golden JP, Gereau RWt (2012) A novel behavioral assay for measuring cold sensation in mice. PLoS ONE 7:e39765. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0039765\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0039765\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKambrun C, Roca-Lapirot O, Salio C, Landry M, Moqrich A, Le Feuvre Y (2018) TAFA4 Reverses Mechanical Allodynia through Activation of GABAergic Transmission and Microglial Process Retraction. Cell Rep 22:2886\u0026ndash;2897. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2018.02.068\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2018.02.068\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMendell LM (1966) Physiological properties of unmyelinated fiber projection to the spinal cord. Exp Neurol 16:316\u0026ndash;332. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0014-4886(66)90068-9\u003c/span\u003e\u003cspan address=\"10.1016/0014-4886(66)90068-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFidanza F, Polimeni E, Pierangeli V, Martini M (2021) A Better Touch: C-tactile Fibers Related Activity is Associated to Pain Reduction During Temporal Summation of Second Pain. J Pain 22:567\u0026ndash;576. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jpain.2021.01.001\u003c/span\u003e\u003cspan address=\"10.1016/j.jpain.2021.01.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWakui E, Fidanza F, Martini M (2025) Neural response associated with the modulation of temporal summation of second pain by affective touch. J Pain 29:105349. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jpain.2025.105349\u003c/span\u003e\u003cspan address=\"10.1016/j.jpain.2025.105349\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaneja P, Baad-Hansen L, Shaikh S, Svensson P, Olausson H (2021) Robotic Stroking on the Face and Forearm: Touch Satiety and Effects on Mechanical Pain. Front Pain Res (Lausanne) 2:693987. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fpain.2021.693987\u003c/span\u003e\u003cspan address=\"10.3389/fpain.2021.693987\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCirrincione AM, Reimonn CA, Harrison BJ, Rieger S (2022) Longitudinal RNA Sequencing of Skin and DRG Neurons in Mice with Paclitaxel-Induced Peripheral Neuropathy. Data (Basel) \u003cem\u003e7\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/data7060072\u003c/span\u003e\u003cspan address=\"10.3390/data7060072\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Yin C, Liu B, Nie H, Wang J, Zeng D, Chen R, He X, Fang J, Du J et al (2021) Transcriptome profiling of long noncoding RNAs and mRNAs in spinal cord of a rat model of paclitaxel-induced peripheral neuropathy identifies potential mechanisms mediating neuroinflammation and pain. J Neuroinflammation 18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12974-021-02098-y\u003c/span\u003e\u003cspan address=\"10.1186/s12974-021-02098-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMalapert P, Robert G, Brunet E, Chemin J, Bourinet E, Moqrich A (2024) A novel Na(v)1.8-FLPo driver mouse for intersectional genetics to uncover the functional significance of primary sensory neuron diversity. iScience \u003cem\u003e27\u003c/em\u003e, 109396. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.isci.2024.109396\u003c/span\u003e\u003cspan address=\"10.1016/j.isci.2024.109396\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbraira VE, Kuehn ED, Chirila AM, Springel MW, Toliver AA, Zimmerman AL, Orefice LL, Boyle KA, Bai L, Song BJ et al (2017) The Cellular and Synaptic Architecture of the Mechanosensory Dorsal Horn. Cell \u003cem\u003e168\u003c/em\u003e, 295\u0026ndash;310 e219. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2016.12.010\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2016.12.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoqrich A, Hwang SW, Earley TJ, Petrus MJ, Murray AN, Spencer KS, Andahazy M, Story GM, Patapoutian A (2005) Impaired thermosensation in mice lacking TRPV3, a heat and camphor sensor in the skin. Science 307:1468\u0026ndash;1472. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.1108609\u003c/span\u003e\u003cspan address=\"10.1126/science.1108609\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang D, Turecek J, Choi S, Delisle M, Pamplona CL, Meltzer S, Ginty DD (2024) C-LTMRs evoke wet dog shakes via the spinoparabrachial pathway. Science 386:686\u0026ndash;692. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.adq8834\u003c/span\u003e\u003cspan address=\"10.1126/science.adq8834\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL (1994) Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods 53:55\u0026ndash;63. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0165\u0026ndash;0270(94)90144-9\u003c/span\u003e\u003cspan address=\"10.1016/0165\u0026ndash;0270(94)90144-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR (2013) STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29:15\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/bioinformatics/bts635\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/bts635\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao Y, Smyth GK, Shi W (2014) featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30:923\u0026ndash;930. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/bioinformatics/btt656\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btt656\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRobinson MD, McCarthy DJ, Smyth GK (2010) edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26:139\u0026ndash;140. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/bioinformatics/btp616\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btp616\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou Y, Zhou B, Pache L, Chang M, Khodabakhshi AH, Tanaseichuk O, Benner C, Chanda SK (2019) Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat Commun 10:1523. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-019-09234-6\u003c/span\u003e\u003cspan address=\"10.1038/s41467-019-09234-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7198392/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7198392/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eC-low threshold mechanoreceptors (C-LTMRs) are traditionally associated with affective touch, yet emerging evidence suggests broader roles in sensory processing and pain modulation. We developed an intersectional genetic approach to selectively ablate C-LTMRs in adult mice by combining Nav1.8\u003csup\u003eIRES-FLPo \u003c/sup\u003eand TH\u003csup\u003eCreER\u003c/sup\u003e drivers with a conditional DTR reporter. This approach yields robust, tissue-specific deletion of C-LTMRs without off-target effects in non-sensory tissues. C-LTMR-ablated mice exhibit altered thermotaxis behavior, including a sharpened and spatially restricted preference for warmth, while maintaining largely intact responses to touch. Remarkably, following surgical or chemotherapeutic injury, these mice display persistent mechanical and cold hypersensitivity, implicating C-LTMRs in the resolution of pain. Transcriptomic profiling of dorsal root ganglia (DRG) and dorsal horn of the spinal cord (DHSC) revealed widespread transcriptional dysregulation in pathways related to extracellular matrix remodeling, vascular function and gliogenesis in naive mice. In C-LTMR-ablated mice, paclitaxel failed to induce pro-recovery transcriptional programs and instead promoted persistent neuroinflammatory signatures. These findings establish C-LTMRs as key modulators of pain recovery, acting through tissue-specific transcriptional programs that suppress inflammation and support sensory homeostasis.\u003c/p\u003e","manuscriptTitle":"C-LTMRs Regulate Thermosensation and Gate the Transition from Acute to Chronic Pain","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-30 01:30:39","doi":"10.21203/rs.3.rs-7198392/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"nature-communications","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"NCOMMS","sideBox":"Learn more about [Nature Communications](http://www.nature.com/ncomms/)","snPcode":"","submissionUrl":"https://mts-ncomms.nature.com/","title":"Nature Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature Communications","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"65a59af5-0679-43f3-aef6-2d7ec30ca36e","owner":[],"postedDate":"December 30th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":60182050,"name":"Biological sciences/Neuroscience/Somatosensory system/Pain/Chronic pain"},{"id":60182051,"name":"Biological sciences/Neuroscience/Molecular neuroscience"}],"tags":[],"updatedAt":"2025-12-30T01:30:39+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-30 01:30:39","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7198392","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7198392","identity":"rs-7198392","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}