Elektra-Qki and Alien-Wt1 lncRNA-protein interaction controls myocardial ion channel expression and epicardial EMT during heart development

Elektra-Qki and Alien-Wt1 lncRNA-protein interaction controls myocardial ion channel expression and epicardial EMT during heart development | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Elektra-Qki and Alien-Wt1 lncRNA-protein interaction controls myocardial ion channel expression and epicardial EMT during heart development Sheila Caño-Carrillo, Estefanía Lozano-Velasco, Diego Franco This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8097679/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 4 You are reading this latest preprint version Abstract Background The heart is the first organ to develop during embryogenesis, reflecting its vital role maintaining oxygen and nutrient delivery to the developing embryo. Initially, the heart forms as a linear tube composed of two distinct layers: the myocardium and the endocardium. A third layer, the embryonic epicardium (EE), originates soon thereafter from a transient structure called the proepicardium (PE). PE cells migrate over the myocardial surface to generate the EE, and, in subsequent stages, a subset of these epicardial cells undergoes an epithelial-to-mesenchymal transition (EMT), invades the subepicardial space and leads to epicardial-derived cells (EPDCs) colonizing the embryonic myocardium and differentiating into multiple cardiac lineages. In recent years, long non-coding RNAs (lncRNAs) have emerged as key regulators of cardiac development. Previous data from our laboratory identified two murine lncRNAs, Elektra and Alien , with differential expression between the PE and the EE. Methods In this study, we performed a comprehensive characterization of both lncRNAs, analyzing their expression in embryonic and adult tissues with a focus on the three main cardiac cell types. We evaluated their transcriptional regulation by cardiogenic transcription factors and identified lncRNA-binding proteins via RNA pull-down (PD) and mass spectrometry (MS) assays, followed by validation using RNA immunoprecipitation (RIP). Functional analyses through loss-of-function experiments, qPCR, cell migration and EMT assays revealed distinct roles for each lncRNA. Results Elektra regulated the expression of ion channel genes in the myocardium through interaction with Qki protein, while Alien modulates the epicardial EMT process by interacting with Wt1 and controlling EMT-related genes, including Snai1 , Snai2 , Cdh1 and Cdh2 . Conclusion Altogether, our findings reveal that Elektra and Alien exert important roles in cardiac development by regulating myocardial ion channel expression and epicardial EMT, respectively, supporting new insights into lncRNA-mediated regulation of heart morphogenesis. lncRNAs myocardium epicardium ion channels EMT Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 BACKGROUND The formation of the heart is a complex developmental process that initiates soon after gastrulation with the configuration of the bilateral precardiac precursors that will subsequently fuse in the embryonic midline forming a cardiac straight tube [ 1 , 2 ]. The linear cardiac tube, initially composed of myocardium and endocardium, begins to grow and elongate due to cardiomyocyte proliferation. This structure undergoes a rightward looping, which is the first evidence of asymmetry in heart development [ 3 , 4 ]. Then, the third and final cellular layer of the heart, the embryonic epicardium (EE) originates from the proepicardium (PE), a transient cauliflower-structure located near the venous pole [ 5 , 6 ]. This transient structure exhibits high cellular heterogeneity, as evidenced by the differential expression of several gene markers, suggesting the presence of distinct cell populations within the PE [ 7 ]. After PE formation, proepicardial cells delaminate and generate vesicles that float in the pericardial cavity until they reach the myocardium, where they adhere and begin to cover the myocardial surface [ 8 ]. Epicardial development is essential for correct cardiac morphogenesis, since once established, a cellular subset undergoes an epithelial-mesenchymal transition (EMT), giving rise to epicardial-derived cells (EPDCs) that invade the myocardium. These EPDCs can differentiate into various cell types, including smooth muscle cells, fibroblasts and endothelial cells [ 9 – 11 ]. Due to its importance in cardiac development, epicardial EMT is a highly regulated process, involving several signaling pathways and transcription factors, such as Wt1 , Snai1 or Snai2 [ 12 , 13 ]. Once the embryonic heart has developed three distinct cardiac layers, each chamber is subsequently divided into right and left parts as development proceeds, resulting in the configuration of the fully formed four-chambered heart with distinct inlet and outlet connections [ 14 ]. The heart is the first organ that is functional during embryonic development [ 15 , 16 ]. As soon as the cardiac straight tube is formed, a peristaltic contraction is initiated and blood is directionally pumped [ 17 ]. As development proceeds, the synchronous chamber contraction initiates and the configuration of the atrial and ventricular cardiac action potentials takes place, involving distinct sodium, calcium and potassium ion channels [ 18 ]. For efficient pumping of blood throughout the body, it is essential that the heart precisely coordinates its structural changes and functional responses. Alterations in the heart contractile capacity can lead to cardiovascular diseases such as cardiomyopathies or arrhythmias, including atrial fibrillation (AF), which can potentially result, eventually, in heart failure (HF) [ 19 – 21 ]. In particular, AF is the most common arrhythmias and its prevalence has significantly increased in recent years [ 22 ]. Mutations in sarcomeric genes can induce structural alterations in the atria and affect the expression of ion channels and other proteins involved in electrical conduction, resulting in arrhythmia development [ 23 , 24 ]. In addition to sarcomeric genes such as Myh7 [ 25 ] or Myl4 [ 26 ], the transcription factor Pitx2c has been shown to play a key role in establishing AF. Pitx2c mutations have been associated with alterations in cardiac electrophysiology, including disruptions in calcium homeostasis, which can trigger arrhythmogenesis [ 27 , 28 ]. In recent years, the mechanisms of transcriptional and post-transcriptional regulation have become more complex due to the discovery of non-coding RNAs (ncRNAs), which are involved in regulating multiple biological processes [ 29 ]. ncRNAs can be classified according to various criteria, including their biological function. In this context, the term “housekeeping RNAs” is used to describe a group that includes ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs) and small nucleolar RNAs (snoRNAs) [ 30 , 31 ]. On the other hand, regulatory ncRNAs can be divided into two large groups according to their length [ 32 , 33 ]. Small non-coding RNAs, which are less than 200 nucleotides, include microRNAs (miRNAs) [ 34 ]. These molecules, which consist of 19–25 nucleotides, exert a pivotal role in post-transcriptional control by binding to the 3’ UTR regions of messenger RNAs (mRNAs), thereby inducing their degradation and reducing their expression [ 35 ]. However, additional functions have recently been described at both nuclear and cytoplasmic levels, including transcriptional and translational regulation [ 36 , 37 ]. In contrast, another group of regulatory ncRNAs are long non-coding RNAs (lncRNAs), which exceed 200 nucleotides and share several structural features with mRNAs [ 38 ]. Functionally, lncRNAs can act in both the nucleus and the cytoplasm, regulating processes such as transcription, alternative splicing, translation and/or protein distribution [ 39 – 42 ]. In the heart, several lncRNAs play a role in cardiac development by regulating key cellular mechanisms [ 29 ]. These include Braveheart , CARMEN or Fendrr lncRNAs, which are primarily involved in cardiac differentiation during the early stages of development [ 43 – 45 ]. Another relevant lncRNA is ALIEN , which is associated with the specification of cardiac mesoderm [ 46 ]. However, its function at later stages of development remains unclear. In addition to their role in differentiation, lncRNAs also regulate aspects of cardiac morphogenesis, including epicardial cell migration, formation of the cardiac chambers, trabeculation, or establishment of the conduction system and electrophysiology [ 47 – 49 ]. Dysregulation of these processes has been associated with multiple cardiac pathologies, including cardiomyopathies and electrical conduction disorders [ 50 – 52 ]. Using RNA-seq analysis, we recently identified two lncRNAs, Elektra (also known as Gm35533 ) and Alien (also known as DEANR1 , Falcor or 9030622O22Rik ), which are differentially expressed between the PE and the EE [ 53 ]. In this study, we characterized these lncRNAs in the different cardiac cell types by analyzing their expression, subcellular distribution, and transcriptional regulation. Additionally, we identified key proteins that directly interact with these lncRNAs and are essential for epicardial development and cardiac electrophysiology regulation. Our results reveal that Elektra and Alien directly interact with Qki and Wt1, respectively, thereby regulating genes associated with voltage-gated ion channels in the myocardium, and also key genes involved in the epithelial-to-mesenchymal transition in epicardial cells. These findings suggest a potential regulatory role for these lncRNAs in essential cardiac processes such as myocardial contractility and epicardial development. METHODS Mouse embryonic tissues CD1 mice were bred and embryos were collected at different embryonic stages (E10.5, E13.5, E16.5, E19.5) as well as postnatal (P2, P7 and P21) and adult stages. Pregnant females were euthanized by cervical dislocation to obtain the embryos while neonatal mice were decapitated. For each embryonic and postnatal stage, the heart was carefully isolated, dissected and stored at -80°C until further used. To obtain epicardial cells, ventricles from E10.5 mouse embryos were isolated and cultured in 24-well plates for 48 h to allow the migration and expansion of epicardial cells. Additionally, tissues from the lung, stomach and liver were collected from embryonic (E13.5) and adult stages and stored following the same procedure. Approved consent of the Andalusian Ethic Committee was obtained prior to the initiation of the study (#09/07/2024/096 corresponding to the ALURES platform code NTS-ES-001583). siRNA and ASO transfections HL1 cardiomyocytes (SCC065, Sigma Aldrich), MEVEC endocardial cells [54], MEC1 (SCC187, Sigma Aldrich) and EPIC epicardial cells [55] were cultured on 24-well plates (6 x 10 4 cells per well) and transfected with Pitx2c -siRNA, Mef2c -siRNA, Srf -siRNA, Nkx2.5 -siRNA, Elektra -siRNA, Qki -siRNA, Wt1 -siRNA (Sigma, Aldrich, Munich, Germany), respectively. Antisense oligonucleotides (ASOs) were designed according to the method described by Le et al . [56] with a backbone of 10-12 DNA bases flanked by 5 modified 2’ O-Methyl RNA bases in both 5’ and 3’-arms. The sequences of siRNAs and ASOs are provided in Supplementary Table 1 . Transfections were carried out using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) and Opti-MEM I (1X) (Gibco™, 31985070) following the manufacturer’s guidelines. siRNAs and ASOs concentration used ranged from 20nM to 80nM and validation of the inhibition was carried out by RT-qPCR assays. Plasmid transfections Elektra lncRNA was cloned into the pcDNA3.1 vector to achieve gain-of-function expression. To clone the ∼700 bp Elektra insert in sense orientation under the SP6 promoter, primers were designed with EcoRI and HindIII restriction sites at the 5’ ends of the forward and reverse primers, respectively. These enzymes do not cut within the insert, preserving its sequence integrity. The primer sequences used for cloning are detailed in Supplementary Table 1 . HL1 cardiomyocytes were transfected with 300 ng of the plasmid using Lipofectamine 2000, as described above. Overexpression was validated by RT-qPCR assays. RNA isolation and cDNA synthesis Total RNA isolation was carried out using ReliaPrep™ RNA Miniprep Systems (Promega, Z6011) according to the manufacturer's instructions. For RNA extraction from both tissue and cells, pooled samples were collected and stored at -80°C. First-strand cDNA synthesis for real-time RT-PCR (qPCR) was performed using PrimeScript™ RT Master Mix (Perfect Real Time) (Takara, RR036A) following the manufacturer's guidelines. For the analysis of lncRNAs and mRNA expression, a range of 100-500 ng total RNA was used for retrotranscription. Subsequently, the cDNA was diluted to a ratio of 1/40 for use in qPCR. To avoid genomic DNA contamination, a negative control reaction was set up without reverse transcriptase enzyme, which produced no amplification signal during qPCR. Nucleus /cytoplasm subcellular isolation Nuclear and cytoplasmic RNA fractions were isolated from MEC1 and EPIC epicardial cells, MEVEC endocardial cells and HL1 cardiomyocytes using Cytoplasmic & Nuclear RNA Purification Kit (Norgen, Belmont, CA. USA, Cat. 21000) according to the manufacturer’s instructions. Separation of RNA fractions from proteins or genomic DNA was achieved by column chromatography with Norgen resin. To verify the successful separation of nuclear and cytoplasmic RNA, the expression levels of nuclear-enriched mRNA ( Xist2 ) and cytoplasmic-enriched mRNA ( Gapdh ) were analyzed by qPCR in each fraction. qPCR analyses (mRNA and lncRNA) Real-time PCR was performed using 2µL of cDNA (prepared as described above), 5 µL of GoTaq® qPCR Master Mix (Promega), and 1µL of specific primer (2.5nM). The reactions were conducted on a CFX384 TM thermocycler (Bio-Rad) following the manufacturer's recommendations. The expression levels of the different mRNAs and lncRNAs were analyzed according to the ∆∆CT method described by Livak & Schmittgen [57] using Gapdh as an internal normalization control. Each reaction was prepared in triplicate using three biological samples. Negative control reactions, prepared without cDNA, showed no amplification signal. The sequences of all primers used are provided in Supplementary Table 1 . Primer design was performed using Primer3Plus software (https://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) and they were synthesized by IDT (Integrated DNA Technologies). SCRINSHOT in situ hybridization SCRINSHOT (Single-Cell Resolution IN Situ Hybridization On Tissues) assay was performed as described by Sountoulidis et al . [58]. Hearts were collected at different embryonic (E10.5, E13.5, E16.5, E19.5) and postnatal stages (P2, P7, P21). All samples were washed in PBS 1X (pH=7.4), frozen in OCT (FSC22 Clear, Leica), and stored at -80°C until used. Heart tissues were sectioned at a thickness of 5 µm using a cryostat (Leica CM3050S) and mounted onto Superfrost Plus slides. Padlock probes and detection oligos were designed using the IDT PrimerQuest™ Tool and RStudio. Padlock probes (ordered from IDT), were used at a concentration of 0.04 µM, while detection oligos (ordered from Eurofins), were employed at concentrations ranging from 0.02 µM to 0.01 µM. The sequences for both padlock probes and fluorophore-labeled detection oligos are provided in Supplementary Table 1 . Images were captured using a Leica TCS SP5 II confocal scanning laser microscope. Subsequent image processing and analysis were performed with FIJI (v2.9.0), CellProfiler (v4.2.5), RStudio (v2024.04.2), and TissUUmaps (v3.0.10.1). LncRNA pull down assays Biotinylated RNA pull-down was perfomed described by Panda et al. [59]. For the in vitro transcription of Elektra and Alien , primers were designed using Primer3plus adding the T7 RNA polymerase promoter sequence (T7) [5’AGTAATACGACTCACTATAGGG] upstream of the forward primer sequences. All primer sequences to obtain the DNA fragments are described in Supplementary Table 1 . A biotinylated RNA negative control ( Gapdh ) was designed to validate the specificity of interaction between the RNA-binding proteins (RBPs) and the mRNA of interest. Two fragments were obtained for the Elektra sequence, seven fragments for Alien and one fragment for Gapdh. DNA fragments obtained by PCR were transcribed in vitro into RNA using MaxiScript T7 kit (Thermo Fisher Scientific, Invitrogen) and biotinylated with Biotin-14-CTP (Thermo Fisher Scientific, Invitrogen). Whole cells lysates (500µg) from MEC1 epicardial cells, MEVEC endocardial cells and HL1 myocardial cells were incubated with 1 µg of biotinylated RNA fragments and streptavidin-coupled dynabeads for 2h at room temperature. A negative control sample (input), incubated without RNA fragments, was prepared to ensure specificity. All samples were processed in triplicate and analyzed by mass spectrometry (MS). Proteins uniquely associated with Elektra and Alien were selected and analyzed using the DAVID database (v2023q4). RIP assay Ribonucleoprotein immunoprecipitation (RIP) assays for Qki and Wt1 proteins were respectively performed as previously described [60]. Whole-cell lysates from HL1 cardiomyocytes and MEC1 epicardial cells were prepared using PEB buffer (100 mM KCl, 5 mM MgCl2, 10 mM HEPES pH 7.0, 0.5% Nonidet P-40). Cells were lysed on ice for 10 min and centrifuged at 10 000 x g during 15 min at 4°C. For Qki RIP, the supernatant was incubated with protein A Sepharose beads (Abcam, ab193256) and antibodies recognizing Qki (ThermoFisher, 1D1N6) and IgG (Abcam, ab7085) proteins. For Wt1 RIP protein G Sepharose beads (Abcam, ab193259) and antibodies recognizing Wt1 (ThermoFisher, 6F-H2) and IgG (Santa Cruz, sc-52256) were used. Antibody-bead complexes were diluted in NT2 buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1mM MgCl2, 0.05% Nonidet P-40). The samples were incubated during 1-2 h at 4°C and washed with NT2 buffer. To eliminate contaminating DNA and proteins, samples were treated sequentially with Ambion™ DNase I (Invitrogen, AM2222) and Proteinase K (20 mg/mL; Invitrogen, 17916). Purified RNA was analyzed by RT-qPCR. Cell migration assay Cell migration was evaluated using a scratch wound assay, following the protocol established by Ascione et al . [61]. MEC1 epicardial cells were seeded in 24-well plates at a density of 6 × 10⁵ cells per well and cultured until reaching 90–100% confluence. A uniform scratch was then made across the cell monolayer using a P200 pipette tip. After scratching, the cells were rinsed with PBS to remove debris, and the medium was replaced with serum-free culture medium. For the experimental condition, lipid vesicles loaded with antisense oligonucleotides (ASOs) were added, while control cells received empty lipid vesicles. Images were captured at 6h, 12h and 24h after treatment to assess wound closure. Collagen Gel Assay for EMT Analysis To assess the ability of MEC1 epicardial cells and E10.5 ventricular explants to undergo EMT, cells were cultured on collagen gels in 24-well plates. Collagen gels were prepared using Corning™ Collagen I (rat tail, Fisher Scientific), 199 Medium, 1 M NaOH, and penicillin/streptomycin (P/S). The mixture was allowed to solidify by incubating the plates for 30 minutes at 37 °C. After polymerization, gels were washed three times with EMT medium consisting of high-glucose DMEM supplemented with GlutaMAX (ThermoFisher), Insulin-Transferrin-Selenium (1×) (Gibco), and P/S (1×). Following the specific treatments, gels were fixed and stained with DAPI (1:1000) for nuclear labeling and Phalloidin-iFluor 488 (1:1000) (Abcam, ab176753) to visualize F-actin filaments. Imaging was performed using a Leica TCS SP5 II confocal scanning laser microscope. Immunohistochemical analyses HL1 cardiomyocytes were fixed with 4% paraformaldehyde (PFA) for 10 min at room temperature. After fixation, samples were washed twice with PBS for 5 min and incubated with permeation solution (50 nM NH 4 Cl, 0.2% Triton X-100, PBS 1X) during 10 min. Samples were washed twice with PBS 5 min each. Blocking was performed using 0.2% gelatin (Sigma-Aldrich, G1393) dissolved in PBS applied twice during 10 min. The primary antibody for Qki was diluted in blocking solution (1:200) and incubated at 4°C overnight. Following primary antibody incubation, samples were washed three times with PBS and incubated with Alexa-Fluor 488-conjugated secondary antibody (Invitrogen) for 30 min at room temperature. Finally, cells were washed with PBS, incubated with DAPI (1:1000) for nuclei labelling and stored in PBS until imaging using a Leica TCS SP5 II confocal scanning laser microscope. Negative controls were carried out without incubation of the corresponding specific primary antibody, and no signal was obtained in any of them after incubation with the secondary antibody. Statistical analyses For statistical analyses of datasets, unpaired Student’s t-tests were used with an 95% confidence interval. Significance levels of p-values are stated in each corresponding figure legend: * p-value < 0.05; ** p-value < 0.005; *** p-value < 0.001; **** p-value <0.0001. GraphPad Prims software (v8.0.2) was used for statistical analysis and graphical representation. RESULTS Elektra and Alien are developmentally expressed in multiple tissues displaying different cardiac expression profiles in adulthood To gain insight into the molecular changes associated with the transition from PE (E9.5) to EE (E10.5), we performed a comparative RNA-seq analysis of embryonic samples at these stages [53]. This analysis revealed a set of lncRNAs differentially expressed between the two conditions. Among them, we focused our attention on two particularly relevant lncRNAs, Alien , which was downregulated in EE, and Elektra , which was upregulated in EE at E10.5, as they were among the most significantly altered transcripts identified in this dataset (Figure 1A) . Based on these findings, we further characterize their expression patterns at two distinct developmental time points (E13.5 and adult) across various tissues and organs in mice. At E13.5, Elektra is highly expressed in the kidney, moderately expressed in the heart, lung and stomach and barely detectable in the head (Figure 1B) . Curiously, in adulthood, expression was exclusively confined to the heart, displaying similar expression levels in the ventricles and left atrium while it was significantly decreased in the right atrium (Figure 1C) . For Alien, high expression levels were observed in the embryonic lung, stomach and liver, with moderate levels in the head and intestine and lower levels in the heart and kidney (Figure 1B) . This expression pattern was largely maintained in adulthood, with elevated Alien levels persisting in the lung, stomach, intestine and liver. In contrast, its expression remained low in the kidney, skeletal muscle and the heart, where similar levels were found in the atria and the ventricle (Figure 1C) . Although Elektra and Alien are not among the most highly expressed lncRNAs in cardiac tissue, we selected them for further analysis due to their potential involvement in heart development. To investigate their possible regulatory roles, we subsequently performed SCRINSHOT analyses to dissect their cellular distribution along cardiac development (Figure 1D, E) . Globally, Elektra expression is more abundant at early developmental stages (E10.5 and E13.5; corresponding to ∼ 5% of the total number of cells), decreasing as development proceeds (E16.5 and E19.5; corresponding to ∼ 2% of the total number of cells). Surprisingly a transient increase was observed at P2 (corresponding to ∼ 5% of the total number of cells), while becoming barely detectable at later postnatal stages (P7 and P21) corresponding to ∼ 1% of the total cells (Figure 1D) . Notably, at P30, the proportion of Elektra -positive cells slightly increased again to ∼ 2% of the total cell population. Overall these data illustrate that Elektra expression decreases during cardiac maturation, with transient increases at P2 and P30, suggesting dynamic postnatal regulation. We subsequently performed colocalization analyses with epicardial ( Col1a2 ), endothelial ( Pecam ) and myocardial ( Tnnt2 ) at different developmental stages (Supplementary Figure 1A) . Our data demonstrated that Elektra is expressed in all three distinct cell types, with comparable abundance on each of them at all developmental stages analyzed. Alien expression levels were substantially higher than those of Elektra , but displayed a similar embryonic expression pattern (Figure 1E) . The highest expression levels were detected at E10.5, E13.5 and E16.5, with up to 93% of positive cells at E13.5. This was followed by a marked decrease in expression at E19.5 and early postnatal stages (P2 and P7), reaching ∼ 7% of total cells. Interestingly, at later postnatal stages (P21 and P30), expression increased again, obtaining ∼ 68% of positive cells at P30, comparable to the levels detected during embryogenesis. Furthermore, in line with the colocalization percentages, these data suggest that this lncRNA is expressed in the three cardiac cell types (Supplementary Figure 1B) . These results indicate that Alien expression decreases progressively during cardiac development, reaching a minimum in early postnatal stages, but reactivates at late postnatal stages. Subcellular distribution and transcriptional regulation of Elektra and Alien To further characterize Elektra and Alien , we subsequently analyzed their relative expression in different cardiac cell types, as well as their subcellular distribution. We examined the expression of both lncRNAs in HL1 atrial cardiomyocytes, MEC1 and EPIC epicardial cells and MEVEC endocardial cells, demonstrating that Elektra displayed the highest expression levels in endocardial cells, followed by epicardial cells, with the lowest levels observed in the myocardial cells (Figure 2A) . In contrast, Alien was most highly expressed in epicardial cells, followed by endocardial cells, and, similarly to Elektra , showed the lowest expression in cardiomyocytes (Figure 2A) . We further analyzed their subcellular distribution, after validating the correct nucleus-cytoplasm isolation (Supplementary Figure 2A) , and found that Elektra was equally distributed in the nucleus and cytoplasm in myocardial cells, prominently distributed in the cytoplasm in epicardial cells (both EPIC and MEC1) and almost exclusively cytoplasmic in endocardial cells (MEVEC) (Figure 2B) . These findings indicate that Elektra has a specific subcellular localization on each cardiac cell type, which supports the notion that this lncRNA can exert distinct functional roles in a cell-specific manner in the cardiac context. In contrast, Alien was mainly located in the nucleus in all three cardiac cells type (Figure 2B) , suggesting a conserved nuclear function across these cell types. LncRNAs are transcriptionally regulated by RNA polymerase II in conjunction with distinct transcription factors, as previously reported [62,63]. To investigate whether cardiac-enriched transcription factors modulate the expression of Elektra and Alien , we performed gain- and loss-of-function for different transcriptional factors, such as Pitx2c , Mef2c , Srf and Nkx2.5 (Supplementary Figure 2B) , in distinct cardiovascular cell lines, such as HL1 atrial cardiomyocytes, MEC1 and EPIC epicardial cells and MEVEC endocardial cells. Focusing in Elektra , Pitx2c overexpression leads to downregulation in MEVEC endocardial, MEC1 and EPIC epicardial cells, while induces upregulation in HL1 cardiomyocytes (Figure 2C) . On the other hand, Pitx2c inhibition resulted in Elektra upregulation in EPIC epicardial cells and downregulation in all the other cell types (Figure 2D) . Mef2c overexpression leads to Elektra downregulation in EPIC and MEC1 epicardial cells as well as in MEVEC endocardial cells, whereas it is upregulated in HL1 cardiomyocytes (Figure 2C) . In contrast, Mef2c silencing resulted in Elektra upregulation in EPIC epicardial cells while it was downregulated in MEVEC endocardial cells. In HL1 cardiomyocytes and MEC1 epicardial cells, no significant differences were identified (Figure 2D) . Similarly, Srf overexpression downregulated Elektra in both EPIC and MEC1 epicardial cells while no significant differences were detected in HL1 and MEVEC cells (Figure 2C) , whereas Srf silencing caused upregulation in EPIC epicardial cells, downregulation in MEVEC endocardial cells and no significant effect in HL1 and MEC1 cells (Figure 2D) . Finally, Nkx2.5 overexpression downregulated Elektra in EPIC and MEC1 epicardial cells and MEVEC endocardial cells while no significant differences were observed in HL1 cardiomyocytes (Figure 2C) , whereas Nkx2.5 inhibition leads to Elektra upregulation in EPIC epicardial, downregulation in MEC1 epicardial cells and no significant changes in HL1 cardiomyocytes (Figure 2D) . Collectively, these data demonstrate that Elektra is regulated by distinct cardiac-enriched transcription factors, displaying a cell type specific regulation, with all tested transcriptional factors playing a pivotal regulation role in EPIC epicardial cells, and Pitx2c particularly in HL1 cardiomyocytes. Regarding the transcriptional regulation of Alien , Pitx2c overexpression reduced its expression levels in MEVEC endocardial cells and both EPIC and MEC1 epicardial cells, while no changes are observed in HL1 cardiomyocytes (Figure 2C) . Conversely, loss of Pitx2c function resulted in increased Alien expression in HL1 cardiomyocytes and EPIC epicardial cells, decreased expression in MEC1 epicardial cells, and no changes in MEVEC endocardial cells (Figure 2D) . Mef2c overexpression reduced Alien levels in MEVEC endocardial and MEC1 epicardial cells, but upregulated it in HL1 cardiomyocytes, with no effect in EPIC epicardial cells (Figure 2C) . In contrast, Mef2c inhibition upregulated Alien expression in HL1 cardiomyocytes and MEC1 epicardial cells, while downregulation in MEVEC endocardial and EPIC epicardial cells was observed (Figure 2D) . In addition, overexpression of Srf reduced Alien levels in MEC1 epicardial cells, upregulated it in HL1 cardiomyocytes and MEVEC endocardial cells, and did not affect its expression in EPIC epicardial cells (Figure 2C) . Conversely, Srf loss-of-function only increased Alien expression in MEC1 and EPIC epicardial cells, with no differences in the other cell types (Figure 2D) . Notably, Nkx2.5 overexpression reduced Alien expression in MEC1 epicardial cells and increased it in HL1 cardiomyocytes, while there were no significant differences in EPIC epicardial and MEVEC endocardial cells (Figure 2C) . On the other hand, Nkx2.5 inhibition upregulated Alien in HL1 cardiomyocytes, MEVEC endocardial and EPIC epicardial cells, while downregulated it in MEC1 epicardial cells (Figure 2D) . Therefore, Alien is also regulated by cardiac transcription factors in a cell-type-specific manner, with Pitx2c exerting a significant influence in EPIC cells, while Mef2c and Srf predominantly regulate its expression in MEC1 cells. In summary, the differential responses observed across various cardiac cell types underscore the complexity of transcriptional regulation governing lncRNAs, i.e. Elektra and Alien in the cardiovascular context. Proteomic analysis reveals cell-type-specific interactions of Elektra and Alien lncRNAs LncRNAs can exert multiple functions interacting with different types of molecules, including other RNAs species and protein [64]. Therefore, dissecting lncRNA-protein interactions can provide hints of their putative transcriptional and/or post-transcriptional functional role [39,65]. In order to get further insights into the molecular mechanisms driven by Elektra and Alien lncRNAs in the cardiac context, we performed RNA pull-down (PD) assays followed by mass spectrometry (MS) to identify associated proteins with both lncRNAs, respectively (Figure 3A) . Since both lncRNAs showed cell type-dependent expression and specific transcriptional regulation, PD experiments were performed in different cardiac cell lines (HL1 cardiomyocytes, MEVEC endocardial cells and MEC1 epicardial cells for Elektra ; and MEC1 epicardial cells for Alien ) to identify proteins potentially associated with each lncRNA in different cellular contexts. In epicardial cells, a total of 71 unique proteins that interact directly with Elektra were identified in MEC1 epicardial cells, as compared with Gapdh and Input pull-down control (Supplementary Figure 3A) . Approximately 32% of these proteins were exclusively nuclear, ∼ 22% were uniquely cytoplasmic and ∼ 32% were detected in both compartments (Supplementary Figure 3B, Supplementary Table 2) . Gene Ontology (GO) analysis of these proteins revealed an enrichment of biological processes (BPs) and molecular functions (MFs) associated with chromatin organization, nucleosome assembly, protein heterodimerization, and cytoplasmic translation (Supplementary Figure 3C) . These results indicate a variety of protein interactions involving Elektra in MEC1 epicardial cells. Supporting this, GO analyses of cellular components (CCs) identified the nucleus, nucleoplasm, cytosol and ribosomes as associated compartments (Supplementary Figure 3C) , suggesting a dual localization of Elektra within both nuclear and cytoplasmic regions. A total of 29 unique Elektra -associated proteins were identified in MEVEC endocardial cells (Supplementary Figure 3D) , the majority of which were exclusively cytoplasmic (∼ 38%), located only in the nucleus (∼ 21%), or found in both compartments (∼ 21%) (Supplementary Figure 3E, Supplementary Table 3) . These percentages are in line with the GO analysis of cellular components (CCs), where the most representative compartment were the cytosol, ribosomes and cytoplasm, and with a lower proportion, the nucleus (Supplementary Figure 3F) . The major biological processes (BPs) and associated molecular functions (MFs) included cytoplasmic translation, rRNA processing, transcriptional regulation by RNA polymerases I and III, and protein binding (Supplementary Figure 3F) . These results suggest a more significant presence and potential function for Elektra in the cytoplasm, due to the high number of associated proteins found in this compartment. In the myocardial context, a total of 175 proteins were uniquely identified in the Elektra PD assays, as compared to Input and Gapdh PD controls in HL1 cardiomyocytes (Figure 3B, Supplementary Table 4 ). Approximately 11% were exclusively nuclear, ∼ 50% were exclusively cytoplasmic and ∼ 20% were present in both compartments ( Figure 3C ). Gene ontology (GO) analyses of uniquely identified proteins in Elektra PD were primarily involved in biological processes (BPs) such as cell surface receptor protein tyrosine kinase pathway, secondary palate development, protein import into nucleus, regulation of RNA splicing membrane fission and animal organ morphogenesis among the most significant pathways ( Figure 3D ). These results suggest the prominent role of Elektra in association with cytoplasmic biological processes, in line with its predominant cytoplasmic localization, although distinct nuclear and cytoplasmic biological functions are also identified. GO analyses of cellular components (CCs) revealed that the plasma membrane, cytoplasm, lysosomal membrane, spliceosomal complex and nucleus are the most representative compartments ( Figure 3D ). Finally, GO molecular function (MF) analysis identified RNA binding, protein binding, ubiquitin-protein transferase activity and protein homodimerization activity as the most represented functions ( Figure 3D ). Thus, all GO analyses support a dual nuclear and cytoplasmic role for Elektra in myocardial cells. Comparative analyses of PD and MS data from MEC1, MEVEC and HL1 cells were performed to determine whether Elektra binds to similar proteins in different cardiac cell types. Curiously, we did not identify any proteins in common (Supplementary Figure 3G) , supporting the idea that lncRNA-protein interactions and their functions are cell-type-specific. Furthermore, despite the lower expression of Elektra in HL1 cardiomyocytes compared to the other cell types, the highest number of Elektra -associated proteins was detected in these cells, suggesting a higher functional relevance of the interaction in HL1 cardiomyocytes. Therefore, further functional analyses were performed in the myocardial context. We subsequently focused our attention on those cellular compartments and molecular and biological functions with a higher number of uniquely identified proteins in Elektra PD in HL1 cardiomyocytes, i.e. plasma membrane, cytoplasm, RNA binding, protein binding, protein import to the nucleus and regulation of RNA splicing (Figure 3D) . Among these categories, several families of proteins are highly represented, such distinct ion channels (e.g. Cacnb4, Kcnn3, KCa2.3), canonical Wnt signaling (Wnt8, Wnt11) and splicing mRNA stability (Qki, Snrnp70, Snrpd2). These findings suggest therefore that Elektra might be involved in RNA binding and regulation of RNA splicing, plausible playing a role in ion channel expression and/or remodeling. For Alien lncRNA, a total of 903 proteins that specifically interact with this lncRNA were identified in MEC1 epicardial cells, after comparison with the Input and Gapdh PD controls (Figure 3E, Supplementary Table 5) . Approximately 12% of the total enriched proteins were classified as exclusively nuclear, ∼ 39% as exclusively cytoplasmic and ∼ 20% as localized in both nuclear and cytoplasmic compartments (Figure 3F) . Gene Ontology (GO) analyses revealed that the most prevalent biological processes (BPs) include protein modification, mRNA processing, mitochondrial translation, and most notably, epithelial-mesenchymal transition (EMT) (Figure 3G) . In terms of molecular functions (MFs), Alien -associated proteins are mainly related to nucleic acid binding, ion binding, and RNA binding. Furthermore, the most representative cellular components include cell projections, the cytoplasm and the nucleus. Taken together, these results suggest that Alien may exert a functional role at both nuclear and cytoplasmic levels in MEC1 epicardial cells, possibly predominating in the cytoplasm due to the higher representation of cytoplasmic proteins. In addition, among the biological processes identified, the presence of key proteins involved in the maintenance and remodeling of the cytoskeleton ( e.g. Krt39, Krt33a, Pacsin3, Pkp4), as well as the regulation of EMT (including factors such as Wt1, Tgfb1, Tgfb1r and Wnt11), is noteworthy. These findings may indicate a possible direct involvement of Alien in these cellular processes in epicardial cells. Elektra modulates the gene expression of the cardiac action potential determinants by interacting with Qki and Pitx2 > Wnt signaling Since Elektra is dually expressed in both nuclear and cytoplasmic subcellular compartments in cardiomyocytes, we designed siRNAs and ASO against this lncRNA to distinctly target its cytoplasmic (siRNA) and nuclear (ASO) molecular function. Additionally, we cloned Elektra into an expression vector, providing therefore a mean to overexpress this lncRNA. We subsequently tested the molecular function of Elektra loss-of-function and gain-of-function in the most significantly signaling pathways identified by MS/GO analyses, i.e. splicing/mRNA stability, cardiac ion channel and Wnt signaling. First, we validated the direct interaction between Elektra and the Qki protein, which is involved in splicing and mRNA stability, by RIP. We observed a significant enrichment of Elektra upon immunoprecipitation with Qki-specific antibody compared to the IgG control (Figure 4A) . Then, we validated gain- and loss-of-function of Elektra (Figure 4B) and fluorescent immunohistochemistry assays revealed that Elektra inhibition results in Qki upregulation, whereas lncRNA overexpression did not significantly alter Qki protein levels (Figure 4C) . However, at the mRNA level changes were observed in both conditions: loss of Elektra function led to increased Qki expression while gain of Elektra function reduced Qki levels (Figure 4D) . In addition, inhibition of Elektra by siRNA lead to upregulation of genes coding for calcium handling proteins such as Ryr2 , Atp2a2 and Ncx1 , downregulation of Cacnb3 and Casq2 , while no significant differences were observed for Cacna1c and Cacnb4 (Figure 4D) . On the other hand, overexpression of Elektra lead to downregulation of Atp2a2 and Casq2 , upregulation of Cacnb3 , while no significant differences were observed for Ryr2 , Cacna1c , Cacnb2 , Cacnb4 and Ncx1 . Curiously, both inhibition and overexpression of Elektra leads to upregulation of the potassium channel Kcnn3 , while for the sodium channel Scn5a , the silencing of Elektra does not alter its expression and the overexpression significantly decreases Scn5a expression (Figure 4D) . These results suggest that the effects observed upon siRNA-mediated silencing of Elektra are predominantly linked to the loss of its cytoplasmic function. Since Elektra is expressed in the nucleus and cytoplasm of HL1 cardiomyocytes, the loss of function of this lncRNA was performed using an antisense oligo (ASO) to explore the functional analysis of Elektra in both compartments. ASO-mediated silencing of Elektra was evaluated at two time points: 6h post-transfection, when the lncRNA was efficiently inhibited, and 24h, when its expression was not significantly suppressed (Supplementary Figure 4A-B) . Thus, Elektra inhibition resulted in the upregulation of calcium channels genes such as Cacnb3 , Casq2 and Ncx1; sodium channel Scn5a , and potassium channels Kcnn3 and Kcnk3 . In contrast, Ryr2 and Cacnb4 expression was downregulated, while the levels of Cacna1c , Cacnb2 and Atp2a2 were no modified (Supplementary Figure 4A) . Furthermore, 24h after ASO transfection, when Elektra expression was not modified, reduced levels of Qki , Ryr2 , Cacn1c , Cacnb2 , Cacnb4 , Atp2a2 , Ncx1 , Scn5a as well as an upregulation of Cacnb3 were identified. However, no changes in the expression levels of Casq2 , Kcnn3 and Kcnk3 were observed (Supplementary Figure 4B) . Both inhibition methods of Elektra , siRNA and ASO, affect the expression of genes related to ion channels, showing both similarities and differences that suggest specific functions in different cellular compartments. Notably, Ncx1 is upregulated after lncRNA inhibition by both approaches. siRNA, which primarily acts in the cytoplasm, causes a Cacnb3 and Casq2 downregulation, along with Ryr2 and Atp2a2 upregulation. In contrast, ASO inhibition, which affects both the nucleus and cytoplasm, induces upregulation of Cacnb3 , Casq2 , Kcnn3 , Kcnk3 , and Scn5a . These differences suggest that Elektra may have distinct functions in the nucleus and cytoplasm, modulating gene expression in a compartment-specific manner but, curiously, affecting in both cases the expression of ion channel genes. Additionally, we tested whether Qki silencing could modulate Elektra and its downstream partners. Qki inhibition (Figure 4E) leads to downregulation of Elektra (Figure 4F) as well as reduced levels of Ryr2 , Atp2a2 , Casq2 , Scn5a , Cacna1c, Cancb3 , Canb4 and Kcnn3 , while Cacnb2 and Ncx1 are upregulated (Figure 4G) . These data suggest the existence of a feedback mechanism between Elektra and Qki, which supports the hypothesis that Elektra regulates Qki expression. Therefore, our results propose that Elektra may act as an indirect regulator of ion channel gene expression by exerting post-transcriptional control through Qki. Given that pull-down and mass spectrometry analyses identified Wnt pathway proteins, such as Wnt8a , Wnt8b , and Wnt11 , as potential interactors of Elektra , we investigated whether this lncRNA could influence Wnt signaling. In this context, it is important to highlight that we have previously reported the Pitx2 > Wnt signaling is essential for maintaining cardiac action potential homeostasis. For this reason, we subsequently analyzed the regulatory role of Elektra on Pitx2c and the Wnt signaling pathway. In this context, silencing Elektra led to upregulation of Pitx2c and Wnt11 , whereas overexpression of Elektra resulted in reduced Pitx2c and Wnt11 levels, with no significant differences in Wnt8a expression (Figure 5A) . Taken together, these data demonstrate that the lncRNA Elektra can distinctly modulate the expression of Qki , Wnt signaling, and cardiac ion channels. Therefore, we explored the interlinks between these signaling pathways and Elektra . For that purpose, we analyzed Elektra and Qki expression after gain-of-function assays of Pitx2c and Wnt signaling, demonstrating that Pitx2c overexpression upregulated Elektra and downregulated Qki (Figure 5B) . Similarly, canonical Wnt8a overexpression resulted in Elektra upregulation and Qki downregulation (Figure 5C) , whereas non-canonical Wnt11 does not alter Elektra expression (Figure 5D) . In addition, Qki knockdown led to a decrease in Pitx2c expression levels (Figure 5E) , suggesting a regulatory feedback loop involving Qki , Pitx2c and Elektra . Since Elektra play a regulatory role in modulating cardiac ion channel expression and key signaling pathways such as Qki and Pitx2c > Wnt , both essential for proper electrical activity, we explored how this lncRNA could also modulate the contractile apparatus of cardiomyocytes. We therefore investigated myosin heavy chain protein expression after Elektra inhibition, which resulted in decreased MF20 immunoreactivity compared to controls (Figure 5F) , in the absence of differences in cell proliferation (Figure 5F) . Furthermore, qPCR analyses demonstrated that both sarcomeric myosin Mhy6 and Mhy7 transcripts were significantly downregulated after Elektra inhibition (Figure 5G) , in the absence of modulation of cardiac troponin T, Tnnt2 (Figure 5H) . These results suggest that the inhibition of Elektra modulates the sarcomere function by regulating the expression of sarcomeric myosins, such as Myh6 and Myh7 . Therefore, Elektra may play also a significant role in regulating cardiac contraction in cardiomyocytes. Overall, these data demonstrate that Elektra can modulate Pitx2c > Wnt signaling as well as Qki pathway impacting the expression of multiple genes coding for ion channels that are essential for the cardiac action potential configuration and, additionally, contributes to cardiomyocyte contractile function by controlling sarcomeric myosin expression. Alien modulates in vitro expression of EMT-related genes and epicardial cell migration Given that Alien displays differential expression between PE and EE, with predominant expression in MEC1 epicardial cells and primary nuclear localization, we performed loss-of-function assays using antisense oligonucleotides (ASOs) to investigate its potential role in epicardial development. ASOs were tested at two different concentrations (20 nM and 80 nM) and two post-transfection time points were analyzed (6h and 24h). Previous PD and MS data identified several Alien -associated proteins involved in EMT, suggesting that this lncRNA may exert a regulatory role in this biological process. Among the proteins related to the EMT process, Wt1 stands out, and it has been identified as one of the proteins that directly interacts with Alien in MS assays (Supplementary Table 5) . This interaction was validated using RNA immunoprecipitation (RIP), which revealed a significant enrichment of Alien in the Wt1-immunoprecipitated fraction compared to the IgG control (Figure 6A) . Furthermore, to analyze the functional relevance of this interaction, Wt1 loss-of-function assays were performed using siRNA, in which the inhibition of Wt1 at 48h (Figure 6B) and 72h (Figure 6C) upregulated Alien expression (Figure 6B-C) . These results suggest that Wt1 may act as a negative regulator of Alien , controlling its expression through direct interaction. To investigate the possible epicardial role of Alien through its interaction with Wt1, we also analyzed its impact on the migratory capacity of epicardial cells. To achieve this, we used two ASO molecules to generate different lncRNA expression profiles over time. Specifically, one of the ASOs (ASO1) treatment did not alter Alien expression at 6h, but led to a significant upregulation at 24h. The second ASO (ASO2) caused a transient lncRNA knockdown at 6h, followed by gain-of-function at 24h (Figure 6D) . Scratch migration assays revealed a significant decrease in migratory capacity in ASO1-treated cells, whereas cells treated with ASO2 showed no relevant differences compared to controls (Figure 6E) . Overall, these results suggest that Alien overexpression could limit epicardial cell migration, while transient inhibition would not be sufficient to induce a significant functional change. In addition, we analyzed the expression of several genes involved in the EMT process, such as Snai1 , Snai2 and different cadherins. We conducted loss-of-function assays of Alien using ASO2 at two concentrations (20 nM and 80 nM), evaluating their impact after 6 and 24h. A consistent pattern was observed: transient inhibition of Alien at 6h, followed by lncRNA overexpression at 24h (Figure 6F) . Due to these results, the functional effects at both times were analyzed. While the levels of inhibition and overexpression were comparable at both concentrations, the response of EMT-associated genes differed. After 6h, the inhibition of Alien at 20 nM increased the expression of Cdh1 and Cdh5 while reducing the expression of Wt1 and Cdh2 , without affecting the levels of Snai1 and Snai2 (Figure 6G) . In contrast, Alien overexpression at 24h significantly upregulated Snai1 , Snai2 , Cdh1 and Cdh5 , without affecting Wt1 and Cdh2 (Figure 6G) . These data suggest that overexpression of lncRNA could partially activates the EMT process without fully suppressing epithelial identity, as evidenced by the elevated increase in Cdh1 . Overall, these results suggest that Alien may enhanced EMT-genes which promote an intermediate state of epithelial-to-mesenchymal transition in MEC1 epicardial cells. On the other hand, inhibiting Alien for 6h with an ASO2 at 80 nM increased the expression of Wt1 , reduced the expression of Snai1 , Snai2 , Cdh2 and Cdh5 , without significantly altering Cdh1 levels (Figure 6H) . However, after 24h, when Alien overexpression was detected, Wt1 , Snai1 , Snai2 , Cdh1 and Cdh5 levels remained elevated, with reduced levels observed in Cdh2 (Figure 6H) . These findings suggest that Alien overexpression induces a mixed transcriptional profile that could correspond to an intermediate epithelial-to-mesenchymal state. Overall, these data support the notion that Alien exerts a modulatory role in EMT, whose expression levels regulate the balance between epithelial and mesenchymal phenotypes. Alien modulates ex vivo EMT-associated gene expression and promotes epicardial cell EMT Given the potential regulatory role of Alien on genes involved in the EMT and the epicardial cell migration, we also performed loss-of-function assays in ex vivo experiments using epicardial cells isolated from ventricular explants of E10.5 mouse embryos. Consistent with the in vitro results obtained in MEC1 epicardial cells, ex vivo treatment with 80 nM ASO2 led to a transient downregulation of Alien at 6h, followed by a significant overexpression at 24h (Figure 7A) . In contrast, treatment with a lower concentration (20 nM) did not alter Alien expression at 6h but induced its overexpression at 24h (Figure 7A) . Based on these expression dynamics, we assessed the mRNA levels of EMT-related genes (Figures 7B-C) . Following 20 nM ASO2 treatment, a significant increase in Snai2 , Cdh2 and Cdh5 mRNA levels was observed at 6h, while no changes were detected in Wt1 , Snai1 or Cdh1 expression (Figure 7B) . At 24h, the overexpression of Alien resulted in downregulation of Cdh1 and Cdh5 , along with upregulation of Wt1 , Snai1 , Snai2 and Cdh2 (Figure 7B) . Altogether, these results indicate that the overexpression of Alien promotes the upregulation of several genes associated with the EMT program, including Wt1 , Snai1 , Snai2 and Cdh2 , while reducing epithelial markers such as Cdh1 . These findings suggest that this lncRNA may play a role in promoting a mesenchymal transcriptional profile in epicardial cells. In contrast, an initial knockdown of Alien using a higher ASO2 concentration (80 nM) did not produce the same effect in epicardial cells. The loss-of-function of the lncRNA at 6h led to an increase in the expression of Wt1 , Snai1 , Snai2 , Cdh2 and Cdh5 , without affecting Cdh1 levels (Figure 7C) . However, at 24h, when a significant Alien overexpression was observed, only Snai2 , Cdh2 and Cdh1 were upregulated, with Cdh1 showing the most consistent increase. On the other hand, no significant changes were detected in the expression of Wt1 , Snai1 or Cdh5 . This pattern suggests that Alien knockdown may partially promote the expression of EMT-related genes, although with a more limited effect. Altogether, these findings suggest that Alien plays a regulatory role in EMT, with prolonged expression promoting the upregulation of EMT-related genes, including Wt1 , Snai1 and Snai2 , and the downregulation of Cdh1 . In order to confirm the transcriptional EMT modulation by Alien , we performed ex vivo functional EMT assays using collagen gels. Although epicardial cells isolated from explants did not spontaneously initiate the EMT process, we confirmed their capacity to undergo EMT upon treatment with TGF-β, a key inducer of epithelial-to-mesenchymal transition. This EMT-inducing ability was also observed in epicardial cells treated with 20 nM ASO2, whereas no significant changes were detected using the higher concentration (80 nM) (Figure 7D) . These data support the mRNA results, suggesting that sustained overexpression of Alien promotes the EMT in epicardial cells. DISCUSSION Long non-coding RNAs are increasingly recognized as important regulators of gene expression in different biological processes [39,66]. However, their functional roles during embryonic development remain largely uncharacterized. In previous studies, we identified two lncRNAs, Elektra and Alien , with differential expression between the PE and EE [53]. These lncRNAs may play crucial roles in epicardial development since their expression in embryonic and adult tissues suggests diverse functions depending on the developmental stage or tissue context [67,68]. Although both lncRNAs are expressed at low levels in the heart, we focused on this organ due to its developmental relevance. qPCR and SCRINSHOT assays demonstrated their presence in cardiomyocytes, endocardial and epicardial cells, with Elektra enriched in MEVEC endocardial cells and Alien in MEC1 epicardial cells. Elektra shows cell-type-specific subcellular distribution, since it was mainly cytoplasmic in MEVEC, but nuclear and cytoplasmic in the other cell types. These data suggest that Elektra may regulate transcriptional processes in the nucleus, while it acts as a post-transcriptional modulator in the cytoplasm, similar to other lncRNAs such as HBL1 or H19 [69,70]. In the cytoplasm HBL1 sponges miR-1 , regulating cardiogenic differentiation, while H19 modulates cardiomyocyte apoptosis via miR-675 [69,70]. However, in the nucleus, both lncRNAs participate in epigenetic regulation through the PRC2 complex [52,71,72]. In contrast, our data show that Alien displays a predominantly nuclear localization in the cardiac cell types analyzed, indicating its nuclear function. Interestingly, previous studies reported that this lncRNA exhibits nuclear, perinuclear and cytoplasmic localization in vascular progenitors, while in liver cells its expression is mainly nuclear [73], indicating that its subcellular distribution and function may depend on the developmental stage or the cell type context [46]. Several studies highlight the importance of transcription factors in modulating lncRNA expression [47,63,74]. We investigated the regulatory effects of cardiogenic transcriptional factors, such as Pitx2c [75,76], Mef2c [77,78], Srf [79,80] and Nkx2.5 [81,82], on Elektra and Alien expression through loss- and gain-of-function experiments. Our data indicate cell-type-specific transcriptional regulation, since all transcription factors modulate Elektra expression in epicardial cells, whereas Pitx2c predominantly controls Elektra in myocardial cells. Similarly, Pitx2c regulates Alien in EPIC epicardial cells, while Srf and Mef2c exert stronger control in MEC1 epicardial cells. These findings demonstrate the context-dependent regulation of lncRNAs by transcriptional factors within cardiac cell types [33,83,84]. To explore the biological function of Elektra and Alien , we performed PD assay followed by MS to identify specific proteins directly interacting with each lncRNA. For Elektra , assays were conducted in the three cardiac cell types, and, surprisingly, no common shared interacting proteins were found among them, highlighting the functional specificity of this lncRNA in different cellular contexts. In MEC1 epicardial cells and MEVEC endocardial cells, Elektra interacted with proteins from both nuclear and cytoplasmic compartments, consistent with its localization. These findings support a dual role for Elektra in both transcriptional and post-transcriptional regulation, as previously reported for other cardiac lncRNAs such as MALAT1 , which regulates gene expression in the nucleus by controlling nuclear speckle localization and splicing factors, while acts in the cytoplasm as a miRNA sponge for miR-155 and miR-125 , modulating different cardiac processes [85–88]. In HL1 myocardial cells, most interacting proteins were cytoplasmic, indicating a more relevant post-transcriptional role of Elektra in this context, in line with other lncRNAs, such as ZFAS1 , that acts in the cytoplasm by binding to Atp2a2 to regulate its expression and therefore modulate cardiomyocyte calcium homeostasis [89,90]. Gene Ontology (GO) analysis of the Elektra interactome in cardiomyocytes revealed enrichment in cytoplasmic processes such as RNA splicing regulation. Notably, one of the interacting proteins was the KH-domain RNA-binding protein Qki, a well-established regulator of alternative splicing in cardiomyocytes [91]. Functional assays showed that Elektra negatively regulates Qki , with its knockdown increasing Qki levels and altering ion channel gene expression. These effects were mainly associated with the cytoplasmic fraction of Elektra , suggesting a post-transcriptional regulation. In contrast, nuclear Elektra showed a distinct regulatory pattern, with only Ncx1 consistently affected in both compartments, emphasizing the importance of subcellular localization in lncRNA function [92,93]. Previous studies have shown that Qki regulates the splicing of genes related to cardiac contraction and electrophysiology, including Ryr2 and Cacnb1 [91,94]. Our findings suggest that Elektra modulates these pathways by regulating Qki levels, without affecting the Qki-driven alternative splicing of these ion channels (data not shown). Moreover, Qki inhibition reduced Elektra expression, in addition to altering the levels of several calcium, sodium and potassium channel genes, in line with previous data [91,94]. These results suggest a regulatory feedback for maintaining proper splicing and ion channel expression in cardiomyocytes. Additionally, Elektra interacts with proteins of the Wnt signaling pathway such as Wnt8a , Wnt8b and Wnt11 , a pathway involved in cardiac electrophysiology and regulated by Pitx2c [28,95,96]. While Pitx2c upregulates Elektra , this lncRNA inhibits Pitx2c and Wnt11 , indicating a feedback loop modulating Pitx2c > Wn t signaling. Interestingly, other lncRNAs previously investigated in our laboratory, such as Walrad , Walras , and Walce , also participate in this pathway, suggesting a complex lncRNA network [60]. Furthermore, we found a cross-talk between Qki and Pitx2c > Wnt pathway, with reciprocal regulation. Lastly, Elektra also modulates sarcomeric gene expression essential for cardiac structure and contractile function and liked to atrial fibrillation (AF) [97–99]. Therefore, Elektra may play a key role in regulating both ion channel and sarcomeric gene expression through Qki and Pitx2c > Wnt signaling, and its dysregulation could contribute to arrhythmogenic cardiac pathologies such as AF. In MEC1 epicardial cells, Alien interacts with both nuclear and cytoplasmic proteins, supporting the notion that lncRNA function can vary depending on the cellular context [100]. GO analysis revealed a strong enrichment in EMT, and notably identified Wt1 among the interacting proteins. Wt1 is a well-known transcription factor essential for epicardial EMT [12,101], and our data showed that Wt1 represses Alien , suggesting its involvement in EMT regulation. Functional assays showed that Alien overexpression impaired epicardial cell migration, while its inhibition had no apparent effect. For this lncRNA, functions have been described in other biological contexts, such as the liver, where in vitro studies have shown that it regulates the expression of Foxa2 transcription factor, thereby modulating the progression of liver fibrosis [73]. Alien -Foxa2 interaction has also been described in the lung, where it forms a regulatory feedback loop that maintains epithelial barrier integrity and suppresses cell migration [102]. Numerous studies in other biological systems have demonstrated that lncRNAs can modulate cell migration and EMT through diverse mechanisms, for example, MEG3 , lncRNA-HIT , and lncTCF7 in different cancer types [103–105], or lncRNA-ATB and MALAT1 in pulmonary fibrosis-associated EMT [106,107]. However, in the cardiac context, our understanding of these processes remains limited, highlighting the need to further research to identify new lncRNAs with critical functions in epicardial EMT. To further understand this behavior, we analyzed the expression of key EMT markers following ASO treatment, and we observed dose-dependent effects on gene expression, highlighting the significant impact of this lncRNA on EMT regulation. Such variability is consistent with studies showing that ASO activity is not only sequence-specific but also dependent on dose and tissue distribution, which can critically influence knockdown efficiency and downstream effects [108,109]. Overall, our data support a role for Alien in EMT regulation, mediated through transcription factors and adhesion molecules in epicardial cells. To confirm these findings, we performed ex vivo EMT essays, in which collagen gel experiments demonstrated that sustained overexpression of Alien promotes EMT in epicardial cells, a finding consistent with qPCR data showing upregulation of EMT markers such as Wt1 , Snai1 and Snai2 , and downregulation of the epicardial marker Cdh1 . Collectively, these data support the role of Alien as a regulatory factor in the control of epicardial EMT, suggesting that its participation is essential during embryonic epicardial development. In summary, our results provide evidence that both lncRNAs, Elektra and Alien , are widely expressed across multiple embryonic and adult tissues, exhibiting cell-type-specific subcellular localization and transcriptional regulation. Functionally, in the myocardial context, Elektra regulates the expression of ion channel and sarcomeric contraction genes, through its interaction with Qki and modulation of the Pitx2c > Wnt pathway (Figure 8) . In contrast, Alien directly interacts with Wt1 and regulates pivotal genes involved in the cell migration and EMT process (Figure 8) , highlighting its potential role in epicardial embryonic development. CONCLUSIONS This study identifies Elektra and Alien as key lncRNAs with different and specific functions in the developing heart. Elektra acts in myocardial cells by interacting with Qki and controlling pathways related to electrical activity and contractility, while Alien modulates epicardial cell migration and EMT through its interaction with Wt1. These findings underscore the importance of lncRNAs as context-dependent regulators of cardiac development and support their potential involvement in tissue-specific processes. Abbreviations AF Atrial fibrillation ASO Antisense oligonucleotide BP Biological process CC Cellular component cDNA Complementary DNA EE Embryonic epicardium EMT Epithelial to mensenchymal transition EPDCs Epicardial derived cells GO Gene ontology HF Heart failure lncRNAs Long non-coding RNAs MF Molecular function miRNAs MicroRNAs mRNAs Messeger RNAs MS Mass spectrometry ncRNAs Non-coding RNAs P/S Penicillim/streptromycin PBS Phosphate buffer saline PD Pull-down PE Proepicardium PFA Paraformaldehyde RBPs Ribonucleoproteins RIP RNA immunoprecipitation rRNAs Ribosomal RNAs RT-qPCR Reverse transcriptase-quantitative polymerase chain reaction SCRINSHOT Single cell resolution in situ hybridization on tissues siRNA Small interfering RNA snoRNAs Small nucleolar RNAs snRNAs Small nuclear RNAs tRNAs Transfer RNAs Declarations Ethics approval This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of the University of Jaén (code 14/03/2022/038). Consent for publication Not applicable Availability of data and material RNAseq data were uploaded into Gene Expresssion Onmibus platform with accession number GSE189344 [53]. https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE189344 Competing interests The authors declare that they have no competing interest. Funding This work was supported by grants of the Ministerio de Innovación y Ciencia of the Spanish Government to DF (PID2022-138163OB-C32), Consejería de Universidad, Investigación e Innovación of the Junta de Andalucía Regional Council to DF (ProyExcel_00409) and FEDER-UJA 2023 (M.1.B.B TA_000622) to ELV. Author´s contributions All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by SC-C and EL-V. The first draft of the manuscript was written by DF and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Acknowledgments We would like to thank the excellent technical support of the CICT-Universidad de Jaén. References Kelly RG, Brown NA, Buckingham ME. The Arterial Pole of the Mouse Heart Forms from Fgf10-Expressing Cells in Pharyngeal Mesoderm. Developmental Cell. 2001 Sep;1(3):435–40. Zaffran S, Kelly RG, Meilhac SM, Buckingham ME, Brown NA. Right Ventricular Myocardium Derives From the Anterior Heart Field. Circulation Research. 2004 Aug 6;95(3):261–8. Christoffels VM, Habets PEMH, Franco D, Campione M, De Jong F, Lamers WH, Bao ZZ, Palmer S, Biben C, Harvey RP, et al. Chamber Formation and Morphogenesis in the Developing Mammalian Heart. Developmental Biology. 2000 Jul;223(2):266–78. Le Garrec JF, Domínguez JN, Desgrange A, Ivanovitch KD, Raphaël E, Bangham JA, Torres M, Coen E, Mohun TJ, Meilhac SM. A predictive model of asymmetric morphogenesis from 3D reconstructions of mouse heart looping dynamics. eLife. 2017 Nov 28;6:e28951. Virágh S, Gittenberger-de Groot AC, Poelmann RE, Kálmán F. Early development of quail heart epicardium and associated vascular and glandular structures. Anat Embryol [Internet]. 1993 Oct [cited 2025 Apr 16];188(4). Available from: http://link.springer.com/10.1007/BF00185947 Männer J, Pérez-Pomares JM, Macías D, Muñoz-Chápuli R. The Origin, Formation and Developmental Significance of the Epicardium: A Review. Cells Tissues Organs. 2001;169(2):89–103. Katz TC, Singh MK, Degenhardt K, Rivera-Feliciano J, Johnson RL, Epstein JA, Tabin CJ. Distinct Compartments of the Proepicardial Organ Give Rise to Coronary Vascular Endothelial Cells. Developmental Cell. 2012 Mar;22(3):639–50. Ratajska A, Czarnowska E, Ciszek B. Embryonic development of the proepicardium and coronary vessels. Int J Dev Biol. 2008;52(2–3):229–36. Pérez-Pomares JM, Macías D, García-Garrido L, Muñoz-Chápuli R. The Origin of the Subepicardial Mesenchyme in the Avian Embryo: An Immunohistochemical and Quail–Chick Chimera Study. Developmental Biology. 1998 Aug;200(1):57–68. Carmona R, González-Iriarte M, Pérez-Pomares JM, Muñoz-Chápuli R. Localization of the Wilm’s tumour protein WT1 in avian embryos. Cell Tissue Res. 2001 Feb;303(2):173–86. Gittenberger-de Groot AC, Winter EM, Poelmann RE. Epicardium derived cells (EPDCs) in development, cardiac disease and repair of ischemia. Journal of Cellular and Molecular Medicine. 2010 Apr;no-no. Martínez-Estrada OM, Lettice LA, Essafi A, Guadix JA, Slight J, Velecela V, Hall E, Reichmann J, Devenney PS, Hohenstein P, et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 2010 Jan;42(1):89–93. Von Gise A, Zhou B, Honor LB, Ma Q, Petryk A, Pu WT. WT1 regulates epicardial epithelial to mesenchymal transition through β-catenin and retinoic acid signaling pathways. Developmental Biology. 2011 Aug;356(2):421–31. Gittenberger-de Groot AC, Bartelings MM, Deruiter MC, Poelmann RE. Basics of Cardiac Development for the Understanding of Congenital Heart Malformations. Pediatr Res. 2005 Feb;57(2):169–76. Buckingham M, Meilhac S, Zaffran S. Building the mammalian heart from two sources of myocardial cells. Nat Rev Genet. 2005 Nov;6(11):826–35. Vincent SD, Buckingham ME. How to Make a Heart. In: Current Topics in Developmental Biology [Internet]. Elsevier; 2010 [cited 2025 Apr 16]. p. 1–41. Available from: https://linkinghub.elsevier.com/retrieve/pii/S007021531090001X Meilhac SM, Buckingham ME. The deployment of cell lineages that form the mammalian heart. Nat Rev Cardiol. 2018 Nov;15(11):705–24. Silverman ME, Hollman A. Discovery of the sinus node by Keith and Flack: on the centennial of their 1907 publication. Heart. 2007 Oct 1;93(10):1184–7. Flenner F, Jungen C, Küpker N, Ibel A, Kruse M, Koivumäki JT, Rinas A, Zech ATL, Rhoden A, Wijnker PJM, et al. Translational investigation of electrophysiology in hypertrophic cardiomyopathy. Journal of Molecular and Cellular Cardiology. 2021 Aug;157:77–89. Coronel R, Wilders R, Verkerk AO, Wiegerinck RF, Benoist D, Bernus O. Electrophysiological changes in heart failure and their implications for arrhythmogenesis. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 2013 Dec;1832(12):2432–41. Lozano-Velasco E, Franco D, Aranega A, Daimi H. Genetics and Epigenetics of Atrial Fibrillation. IJMS. 2020 Aug 10;21(16):5717. Linz D, Gawalko M, Betz K, Hendriks JM, Lip GYH, Vinter N, Guo Y, Johnsen S. Atrial fibrillation: epidemiology, screening and digital health. The Lancet Regional Health - Europe. 2024 Feb;37:100786. Feghaly J, Zakka P, London B, MacRae CA, Refaat MM. Genetics of Atrial Fibrillation. JAHA. 2018 Oct 16;7(20):e009884. Kany S, Reissmann B, Metzner A, Kirchhof P, Darbar D, Schnabel RB. Genetics of atrial fibrillation—practical applications for clinical management: if not now, when and how? Cardiovascular Research. 2021 Jun 16;117(7):1718–31. Lee SP, Ashley EA, Homburger J, Caleshu C, Green EM, Jacoby D, Colan SD, Arteaga-Fernández E, Day SM, Girolami F, et al. Incident Atrial Fibrillation Is Associated With MYH7 Sarcomeric Gene Variation in Hypertrophic Cardiomyopathy: Results From the International Sarcomeric Human Cardiomyopathy Registry. Circ: Heart Failure. 2018 Sep;11(9):e005191. Gudbjartsson DF, Holm H, Sulem P, Masson G, Oddsson A, Magnusson OTh, Saemundsdottir J, Helgadottir HTh, Helgason H, Johannsdottir H, et al. A frameshift deletion in the sarcomere gene MYL4 causes early-onset familial atrial fibrillation. Eur Heart J. 2017 Jan 1;38(1):27–34. Chinchilla A, Daimi H, Lozano-Velasco E, Dominguez JN, Caballero R, Delpón E, Tamargo J, Cinca J, Hove-Madsen L, Aranega AE, et al. PITX2 Insufficiency Leads to Atrial Electrical and Structural Remodeling Linked to Arrhythmogenesis. Circ Cardiovasc Genet. 2011 Jun;4(3):269–79. Tarifa C, Serra SA, Herraiz-Martínez A, Lozano-Velasco E, Benítez R, Aranega A, Franco D, Hove-Madsen L. Pitx2c deficiency confers cellular electrophysiological hallmarks of atrial fibrillation to isolated atrial myocytes. Biomedicine & Pharmacotherapy. 2023 Jun;162:114577. George TP, Subramanian S, Supriya MH. A brief review of noncoding RNA. Egypt J Med Hum Genet. 2024 Sep 2;25(1):98. Cerutti P, Holt JW, Miller N. Detection and determination of 5,6-dihydrouridine and 4-thiouridine in transfer ribonucleic acid from different sources. Journal of Molecular Biology. 1968 Jun;34(3):505–18. Zieve G, Penman S. Small RNA species of the HeLa cell: Metabolism and subcellular localization. Cell. 1976 May;8(1):19–31. Lin Y, Zheng J, Lin D. PIWI-interacting RNAs in human cancer. Seminars in Cancer Biology. 2021 Oct;75:15–28. Mattick JS, Amaral PP, Carninci P, Carpenter S, Chang HY, Chen LL, Chen R, Dean C, Dinger ME, Fitzgerald KA, et al. Long non-coding RNAs: definitions, functions, challenges and recommendations. Nat Rev Mol Cell Biol. 2023 Jun;24(6):430–47. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. Identification of Novel Genes Coding for Small Expressed RNAs. Science. 2001 Oct 26;294(5543):853–8. Ha M, Kim VN. Regulation of microRNA biogenesis. Nat Rev Mol Cell Biol. 2014 Aug;15(8):509–24. Broughton JP, Lovci MT, Huang JL, Yeo GW, Pasquinelli AE. Pairing beyond the Seed Supports MicroRNA Targeting Specificity. Molecular Cell. 2016 Oct;64(2):320–33. Makarova JA, Shkurnikov MU, Wicklein D, Lange T, Samatov TR, Turchinovich AA, Tonevitsky AG. Intracellular and extracellular microRNA: An update on localization and biological role. Progress in Histochemistry and Cytochemistry. 2016 Nov;51(3–4):33–49. Wu H, Yang L, Chen LL. The Diversity of Long Noncoding RNAs and Their Generation. Trends in Genetics. 2017 Aug;33(8):540–52. Martianov I, Ramadass A, Serra Barros A, Chow N, Akoulitchev A. Repression of the human dihydrofolate reductase gene by a non-coding interfering transcript. Nature. 2007 Feb;445(7128):666–70. Tripathi V, Ellis JD, Shen Z, Song DY, Pan Q, Watt AT, Freier SM, Bennett CF, Sharma A, Bubulya PA, et al. The Nuclear-Retained Noncoding RNA MALAT1 Regulates Alternative Splicing by Modulating SR Splicing Factor Phosphorylation. Molecular Cell. 2010 Sep;39(6):925–38. Beltran M, Puig I, Peña C, García JM, Álvarez AB, Peña R, Bonilla F, De Herreros AG. A natural antisense transcript regulates Zeb2/Sip1 gene expression during Snail1-induced epithelial–mesenchymal transition. Genes Dev. 2008 Mar 15;22(6):756–69. Campalans A, Kondorosi A, Crespi M. Enod40, a Short Open Reading Frame–Containing mRNA, Induces Cytoplasmic Localization of a Nuclear RNA Binding Protein in Medicago truncatula . Plant Cell. 2004 Apr;16(4):1047–59. Klattenhoff CA, Scheuermann JC, Surface LE, Bradley RK, Fields PA, Steinhauser ML, Ding H, Butty VL, Torrey L, Haas S, et al. Braveheart, a Long Noncoding RNA Required for Cardiovascular Lineage Commitment. Cell. 2013 Jan;152(3):570–83. Ounzain S, Micheletti R, Arnan C, Plaisance I, Cecchi D, Schroen B, Reverter F, Alexanian M, Gonzales C, Ng SY, et al. CARMEN, a human super enhancer-associated long noncoding RNA controlling cardiac specification, differentiation and homeostasis. Journal of Molecular and Cellular Cardiology. 2015 Dec;89:98–112. Schuettengruber B, Chourrout D, Vervoort M, Leblanc B, Cavalli G. Genome Regulation by Polycomb and Trithorax Proteins. Cell. 2007 Feb;128(4):735–45. Kurian L, Aguirre A, Sancho-Martinez I, Benner C, Hishida T, Nguyen TB, Reddy P, Nivet E, Krause MN, Nelles DA, et al. Identification of Novel Long Noncoding RNAs Underlying Vertebrate Cardiovascular Development. Circulation. 2015 Apr 7;131(14):1278–90. Caño-Carrillo S, Garcia-Padilla C, Aranega AE, Lozano-Velasco E, Franco D. Mef2c- and Nkx2-5-Divergent Transcriptional Regulation of Chick WT1_76127 and Mouse Gm14014 lncRNAs and Their Implication in Epicardial Cell Migration. IJMS. 2024 Nov 30;25(23):12904. Lozano-Velasco E, Garcia-Padilla C, Del Mar Muñoz-Gallardo M, Martinez-Amaro FJ, Caño-Carrillo S, Castillo-Casas JM, Sanchez-Fernandez C, Aranega AE, Franco D. Post-Transcriptional Regulation of Molecular Determinants during Cardiogenesis. IJMS. 2022 Mar 4;23(5):2839. Kawaguchi S, Moukette B, Hayasaka T, Haskell AK, Mah J, Sepúlveda MN, Tang Y, Kim I man. Noncoding RNAs as Key Regulators for Cardiac Development and Cardiovascular Diseases. JCDD. 2023 Apr 12;10(4):166. Atianand MK, Fitzgerald KA. Long non-coding RNAs and control of gene expression in the immune system. Trends in Molecular Medicine. 2014 Nov;20(11):623–31. Long Y, Wang X, Youmans DT, Cech TR. How do lncRNAs regulate transcription? Sci Adv. 2017 Sep;3(9):eaao2110. Viereck J, Bührke A, Foinquinos A, Chatterjee S, Kleeberger JA, Xiao K, Janssen-Peters H, Batkai S, Ramanujam D, Kraft T, et al. Targeting muscle-enriched long non-coding RNA H19reverses pathological cardiac hypertrophy. European Heart Journal. 2020 Sep 21;41(36):3462–74. Castillo-Casas JM, Dueñas Á, Hernández-Torres F, Carmona R, Muñoz-Chápuli R, Dopazo A, Álvarez R, De Luis EV, Aranega AE, Franco D, et al. Foxf1-mediated co-regulation of miR-495 and let-7c modulates epicardial cell migration and myocardial specification. Cell Mol Life Sci. 2025 Jun 25;82(1):254. D’Amato G, Luxán G, Del Monte-Nieto G, Martínez-Poveda B, Torroja C, Walter W, Bochter MS, Benedito R, Cole S, Martinez F, et al. Sequential Notch activation regulates ventricular chamber development. Nat Cell Biol. 2016 Jan;18(1):7–20. Ruiz-Villalba A, Ziogas A, Ehrbar M, Pérez-Pomares JM. Characterization of Epicardial-Derived Cardiac Interstitial Cells: Differentiation and Mobilization of Heart Fibroblast Progenitors. Zhou Z, editor. PLoS ONE. 2013 Jan 18;8(1):e53694. Le BT, Agarwal S, Veedu RN. Evaluation of DNA segments in 2′-modified RNA sequences in designing efficient splice switching antisense oligonucleotides. RSC Adv. 2021;11(23):14029–35. Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. 2001 Dec;25(4):402–8. Sountoulidis A, Liontos A, Nguyen HP, Firsova AB, Fysikopoulos A, Qian X, Seeger W, Sundström E, Nilsson M, Samakovlis C. SCRINSHOT enables spatial mapping of cell states in tissue sections with single-cell resolution. Rawlins E, editor. PLoS Biol. 2020 Nov 20;18(11):e3000675. Panda A, Martindale J, Gorospe M. Affinity Pulldown of Biotinylated RNA for Detection of Protein-RNA Complexes. BIO-PROTOCOL [Internet]. 2016 [cited 2024 Nov 18];6(24). Available from: https://bio-protocol.org/e2062 García-Padilla C, Domínguez JN, Lodde V, Munk R, Abdelmohsen K, Gorospe M, Jiménez-Sábado V, Ginel A, Hove-Madsen L, Aránega AE, et al. Identification of atrial-enriched lncRNA Walras linked to cardiomyocyte cytoarchitecture and atrial fibrillation. FASEB J. 2022 Jan;36(1):e22051. Ascione F, Vasaturo A, Caserta S, D’Esposito V, Formisano P, Guido S. Comparison between fibroblast wound healing and cell random migration assays in vitro. Experimental Cell Research. 2016 Sep;347(1):123–32. Statello L, Guo CJ, Chen LL, Huarte M. Gene regulation by long non-coding RNAs and its biological functions. Nat Rev Mol Cell Biol. 2021 Feb;22(2):96–118. Ferrer J, Dimitrova N. Transcription regulation by long non-coding RNAs: mechanisms and disease relevance. Nat Rev Mol Cell Biol. 2024 May;25(5):396–415. Wang KC, Chang HY. Molecular Mechanisms of Long Noncoding RNAs. Molecular Cell. 2011 Sep;43(6):904–14. Carlevaro-Fita J, Rahim A, Guigó R, Vardy LA, Johnson R. Cytoplasmic long noncoding RNAs are frequently bound to and degraded at ribosomes in human cells. RNA. 2016 Jun;22(6):867–82. Li X, Wu Z, Fu X, Han W. lncRNAs: Insights into their function and mechanics in underlying disorders. Mutation Research/Reviews in Mutation Research. 2014 Oct;762:1–21. Jiang C, Li Y, Zhao Z, Lu J, Chen H, Ding N, Wang G, Xu J, Li X. Identifying and functionally characterizing tissue-specific and ubiquitously expressed human lncRNAs. Oncotarget. 2016 Feb 9;7(6):7120–33. Bridges MC, Daulagala AC, Kourtidis A. LNCcation: lncRNA localization and function. J Cell Biol. 2021 Feb 1;220(2):e202009045. Han L, Yang L. Multidimensional Mechanistic Spectrum of Long Non-coding RNAs in Heart Development and Disease. Front Cardiovasc Med. 2021 Sep 16;8:728746. Li X, Wang H, Yao B, Xu W, Chen J, Zhou X. lncRNA H19/miR-675 axis regulates cardiomyocyte apoptosis by targeting VDAC1 in diabetic cardiomyopathy. Sci Rep. 2016 Oct 31;6(1):36340. Liu J, Liu S, Han L, Sheng Y, Zhang Y, Kim IM, Wan J, Yang L. LncRNA HBL1 is required for genome-wide PRC2 occupancy and function in cardiogenesis from human pluripotent stem cells. Development. 2021 Jul 1;148(13):dev199628. Zhuo C, Jiang R, Lin X, Shao M. LncRNA H19 inhibits autophagy by epigenetically silencing of DIRAS3 in diabetic cardiomyopathy. Oncotarget. 2017 Jan 3;8(1):1429–37. Sergeeva OV, Korinfskaya SA, Kurochkin II, Zatsepin TS. Long Noncoding RNA LL35/Falcor Regulates Expression of Transcription Factor Foxa2 in Hepatocytes in Normal and Fibrotic Mouse Liver. Acta Naturae. 2019 Sep 15;11(3):66–74. Lam F, Leisegang MS, Brandes RP. LncRNAs Are Key Regulators of Transcription Factor-Mediated Endothelial Stress Responses. IJMS. 2024 Sep 8;25(17):9726. Franco D, Sedmera D, Lozano-Velasco E. Multiple Roles of Pitx2 in Cardiac Development and Disease. JCDD. 2017 Oct 11;4(4):16. Wang J, Xin YF, Xu WJ, Liu ZM, Qiu XB, Qu XK, Xu L, Li X, Yang YQ. Prevalence and spectrum of PITX2c mutations associated with congenital heart disease. DNA Cell Biol. 2013 Dec;32(12):708–16. Materna SC, Sinha T, Barnes RM, Lammerts Van Bueren K, Black BL. Cardiovascular development and survival require Mef2c function in the myocardial but not the endothelial lineage. Developmental Biology. 2019 Jan;445(2):170–7. Lin Q, Schwarz J, Bucana C, N. Olson E. Control of Mouse Cardiac Morphogenesis and Myogenesis by Transcription Factor MEF2C. Science. 1997 May 30;276(5317):1404–7. Deshpande A, Shetty PMV, Frey N, Rangrez AY. SRF: a seriously responsible factor in cardiac development and disease. J Biomed Sci [Internet]. 2022 Jun 9 [cited 2025 Jul 20];29(1). Available from: https://jbiomedsci.biomedcentral.com/articles/10.1186/s12929-022-00820-3 Nelson T, Balzajr R, Xiao Q, Misra R. SRF-dependent gene expression in isolated cardiomyocytes: Regulation of genes involved in cardiac hypertrophy. Journal of Molecular and Cellular Cardiology. 2005 Sep;39(3):479–89. Akazawa H, Komuro I. Cardiac transcription factor Csx/Nkx2-5: Its role in cardiac development and diseases. Pharmacology & Therapeutics. 2005 Aug;107(2):252–68. Cao C, Li L, Zhang Q, Li H, Wang Z, Wang A, Liu J. Nkx2.5: a crucial regulator of cardiac development, regeneration and diseases. Front Cardiovasc Med. 2023;10:1270951. Zhu L, Choudhary K, Gonzalez-Teran B, Ang YS, Thomas R, Stone NR, Liu L, Zhou P, Zhu C, Ruan H, et al. Transcription Factor GATA4 Regulates Cell Type–Specific Splicing Through Direct Interaction With RNA in Human Induced Pluripotent Stem Cell–Derived Cardiac Progenitors. Circulation. 2022 Sep 6;146(10):770–87. Matkovich SJ, Edwards JR, Grossenheider TC, De Guzman Strong C, Dorn GW. Epigenetic coordination of embryonic heart transcription by dynamically regulated long noncoding RNAs. Proc Natl Acad Sci USA. 2014 Aug 19;111(33):12264–9. Miyagawa R, Tano K, Mizuno R, Nakamura Y, Ijiri K, Rakwal R, Shibato J, Masuo Y, Mayeda A, Hirose T, et al. Identification of -cis- and -trans- acting factors involved in the localization of MALAT-1 noncoding RNA to nuclear speckles. RNA. 2012 Apr;18(4):738–51. Zhang X, Hamblin MH, Yin KJ. The long noncoding RNA Malat1: Its physiological and pathophysiological functions. RNA Biology. 2017 Dec 2;14(12):1705–14. Wang Q, Lu G, Chen Z. MALAT1 promoted cell proliferation and migration via MALAT1/miR‐155/MEF2A pathway in hypoxia of cardiac stem cells. J of Cellular Biochemistry. 2019 Apr;120(4):6384–94. Li L, Wang Q, Yuan Z, Chen A, Liu Z, Wang Z, Li H. LncRNA-MALAT1 promotes CPC proliferation and migration in hypoxia by up-regulation of JMJD6 via sponging miR-125. Biochemical and Biophysical Research Communications. 2018 May;499(3):711–8. Zhang Y, Jiao L, Sun L, Li Y, Gao Y, Xu C, Shao Y, Li M, Li C, Lu Y, et al. LncRNA ZFAS1 as a SERCA2a Inhibitor to Cause Intracellular Ca2+ Overload and Contractile Dysfunction in a Mouse Model of Myocardial Infarction. Circulation Research. 2018 May 11;122(10):1354–68. Jiao L, Li M, Shao Y, Zhang Y, Gong M, Yang X, Wang Y, Tan Z, Sun L, Xuan L, et al. lncRNA-ZFAS1 induces mitochondria-mediated apoptosis by causing cytosolic Ca2+ overload in myocardial infarction mice model. Cell Death Dis. 2019 Dec 9;10(12):942. Montañés-Agudo P, Aufiero S, Schepers EN, Van Der Made I, Cócera-Ortega L, Ernault AC, Richard S, Kuster DWD, Christoffels VM, Pinto YM, et al. The RNA-binding protein QKI governs a muscle-specific alternative splicing program that shapes the contractile function of cardiomyocytes. Cardiovascular Research. 2023 May 22;119(5):1161–74. Yu J, Yang Y, Xu Z, Lan C, Chen C, Li C, Chen Z, Yu C, Xia X, Liao Q, et al. Long Noncoding RNA Ahit Protects Against Cardiac Hypertrophy Through SUZ12 (Suppressor of Zeste 12 Protein Homolog)-Mediated Downregulation of MEF2A (Myocyte Enhancer Factor 2A). Circ: Heart Failure [Internet]. 2020 Jan [cited 2025 Jul 20];13(1). Available from: https://www.ahajournals.org/doi/10.1161/CIRCHEARTFAILURE.119.006525 Noh JH, Kim KM, McClusky WG, Abdelmohsen K, Gorospe M. Cytoplasmic functions of long noncoding RNAs. WIREs RNA [Internet]. 2018 May [cited 2025 Jul 20];9(3). Available from: https://wires.onlinelibrary.wiley.com/doi/10.1002/wrna.1471 Chen X, Liu Y, Xu C, Ba L, Liu Z, Li X, Huang J, Simpson E, Gao H, Cao D, et al. QKI is a critical pre-mRNA alternative splicing regulator of cardiac myofibrillogenesis and contractile function. Nat Commun [Internet]. 2021 Jan 4 [cited 2025 Jul 20];12(1). Available from: https://www.nature.com/articles/s41467-020-20327-5 Li N, Dobrev D, Wehrens XHT. PITX2: a master regulator of cardiac channelopathy in atrial fibrillation? Cardiovasc Res. 2016 Mar 1;109(3):345–7. Lozano-Velasco E, Hernández-Torres F, Daimi H, Serra SA, Herraiz A, Hove-Madsen L, Aránega A, Franco D. Pitx2 impairs calcium handling in a dose-dependent manner by modulating Wnt signalling. Cardiovasc Res. 2016 Jan 1;109(1):55–66. Mancuso G, Marsan M, Neroni P, Soddu C, Lai F, Serventi L, Cau M, Coiana A, Incani F, Murru S, et al. Clinical and Genetic Heterogeneity of HCM: The Possible Role of a Deletion Involving MYH6 and MYH7. Genes (Basel). 2025 Feb 10;16(2):212. Anfinson M, Fitts RH, Lough JW, James JM, Simpson PM, Handler SS, Mitchell ME, Tomita-Mitchell A. Significance of α-Myosin Heavy Chain (MYH6) Variants in Hypoplastic Left Heart Syndrome and Related Cardiovascular Diseases. JCDD. 2022 May 3;9(5):144. Barrick SK, Greenberg MJ. Cardiac myosin contraction and mechanotransduction in health and disease. Journal of Biological Chemistry. 2021 Nov;297(5):101297. Di Mauro V, Barandalla-Sobrados M, Catalucci D. The noncoding-RNA landscape in cardiovascular health and disease. Non-coding RNA Research. 2018 Mar;3(1):12–9. Braitsch CM, Kanisicak O, van Berlo JH, Molkentin JD, Yutzey KE. Differential expression of embryonic epicardial progenitor markers and localization of cardiac fibrosis in adult ischemic injury and hypertensive heart disease. J Mol Cell Cardiol. 2013 Dec;65:108–19. Swarr DT, Herriges M, Li S, Morley M, Fernandes S, Sridharan A, Zhou S, Garcia BA, Stewart K, Morrisey EE. The long noncoding RNA Falcor regulates Foxa2 expression to maintain lung epithelial homeostasis and promote regeneration. Genes Dev. 2019 Jun 1;33(11–12):656–68. Mondal T, Subhash S, Vaid R, Enroth S, Uday S, Reinius B, Mitra S, Mohammed A, James AR, Hoberg E, et al. MEG3 long noncoding RNA regulates the TGF-β pathway genes through formation of RNA–DNA triplex structures. Nat Commun. 2015 Jul 24;6(1):7743. Richards EJ, Zhang G, Li ZP, Permuth-Wey J, Challa S, Li Y, Kong W, Dan S, Bui MM, Coppola D, et al. Long non-coding RNAs (LncRNA) regulated by transforming growth factor (TGF) β. LncRNA-HIT-MEDIATED TGF-INDUCED EPITHELIAL TO MESENCHYMAL TRANSITION IN MAMMARY EPITHELIA. Journal of Biological Chemistry. 2016 Oct;291(43):22860. Wang Y, He L, Du Y, Zhu P, Huang G, Luo J, Yan X, Ye B, Li C, Xia P, et al. The Long Noncoding RNA lncTCF7 Promotes Self-Renewal of Human Liver Cancer Stem Cells through Activation of Wnt Signaling. Cell Stem Cell. 2015 Apr;16(4):413–25. Liu Y, Li Y, Xu Q, Yao W, Wu Q, Yuan J, Yan W, Xu T, Ji X, Ni C. Long non-coding RNA-ATB promotes EMT during silica-induced pulmonary fibrosis by competitively binding miR-200c. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 2018 Feb;1864(2):420–31. Yan W, Wu Q, Yao W, Li Y, Liu Y, Yuan J, Han R, Yang J, Ji X, Ni C. MiR-503 modulates epithelial-mesenchymal transition in silica-induced pulmonary fibrosis by targeting PI3K p85 and is sponged by lncRNA MALAT1. Sci Rep. 2017 Sep 12;7(1):11313. Bäckström E, Bonetti A, Johnsson P, Öhlin S, Dahlén A, Andersson P, Andersson S, Gennemark P. Tissue pharmacokinetics of antisense oligonucleotides. Molecular Therapy - Nucleic Acids. 2024 Mar;35(1):102133. Ottesen EW, Luo D, Singh NN, Singh RN. High Concentration of an ISS-N1-Targeting Antisense Oligonucleotide Causes Massive Perturbation of the Transcriptome. IJMS. 2021 Aug 4;22(16):8378. Supplementary Files SupplementaryLegends.docx SuppFigure1.pdf SuppFigure2.pdf SuppFigure3.pdf SuppFigure4.pdf SupplementaryTable1.docx SupplementaryTable2.docx SupplementaryTable3.docx SupplementaryTable4.docx SupplementaryTable5.docx Cite Share Download PDF Status: Under Revision Version 1 posted Reviewers agreed at journal 18 Dec, 2025 Reviewers invited by journal 17 Dec, 2025 Editor assigned by journal 14 Nov, 2025 First submitted to journal 12 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8097679","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":561724881,"identity":"5af11927-58e9-4cf9-ba66-5f614f965af0","order_by":0,"name":"Sheila Caño-Carrillo","email":"","orcid":"","institution":"University of Jaen Faculty of Experimental Sciences: Universidad de Jaen Facultad de Ciencias Experimentales","correspondingAuthor":false,"prefix":"","firstName":"Sheila","middleName":"","lastName":"Caño-Carrillo","suffix":""},{"id":561724882,"identity":"4281cdf0-7491-44ab-93a7-6db02d22935c","order_by":1,"name":"Estefanía Lozano-Velasco","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA00lEQVRIiWNgGAWjYHACxgMgkp+BIYF4PWAtkg0kazE4QKxyfonkAwd+/LGTM76R8PDDxx0McvINBLRIzkhLONjblmxsdiMhWXLmGQZjgtYZnDljcIC34UDithsJCdK8bQyJGwg5zP7M+Q8H//w5kLh5RkLy779tDPXzCTnMgL2H4TAP24HEDRIJadKMbcBgI+QwieNtBodlgX6ROPMgzbK3TcJwAyEt/M3MDx++AYYYf3tO8o2fbTbyBEMMCfAkgGwlXj0QsBNy0SgYBaNgFIxUAACun0WPf+/z/QAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-5615-2754","institution":"Universidad de Jaen Facultad de Ciencias Experimentales","correspondingAuthor":true,"prefix":"","firstName":"Estefanía","middleName":"","lastName":"Lozano-Velasco","suffix":""},{"id":561724883,"identity":"4473c8f3-15b3-4c13-8943-4f871c252deb","order_by":2,"name":"Diego Franco","email":"","orcid":"https://orcid.org/0000-0002-5669-7164","institution":"University of Jaen Faculty of Experimental Sciences: Universidad de Jaen Facultad de Ciencias Experimentales","correspondingAuthor":false,"prefix":"","firstName":"Diego","middleName":"","lastName":"Franco","suffix":""}],"badges":[],"createdAt":"2025-11-12 15:05:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8097679/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8097679/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":98628659,"identity":"876beade-6352-4288-910a-a9a9f36bbb48","added_by":"auto","created_at":"2025-12-19 17:12:00","extension":"xml","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12067,"visible":true,"origin":"","legend":"","description":"","filename":"lifeLIFED2503086.xml","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/eb37c519fbb6899d8050fc86.xml"},{"id":98628137,"identity":"7a070d90-e0b5-4813-8543-1c6fa4b8fb7a","added_by":"auto","created_at":"2025-12-19 17:11:00","extension":"xml","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1594,"visible":true,"origin":"","legend":"","description":"","filename":"LIFED250308656941.go.xml","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/2c9e4d668dedeb37e2445d7d.xml"},{"id":98628061,"identity":"c881143f-ac22-47c9-b675-df06ddc46b3c","added_by":"auto","created_at":"2025-12-19 17:10:57","extension":"xml","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":874,"visible":true,"origin":"","legend":"","description":"","filename":"LIFED2503086Import.xml","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/bbb67771b2211b08f26767d3.xml"},{"id":98590507,"identity":"a11f9167-c084-4570-baab-ec35c46a5c2a","added_by":"auto","created_at":"2025-12-19 10:31:06","extension":"xml","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":296301,"visible":true,"origin":"","legend":"","description":"","filename":"LIFED25030860enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/e599bcc1be6167155373ad1f.xml"},{"id":98590515,"identity":"07e22b28-cdd3-4eb9-adf7-e347024ae83d","added_by":"auto","created_at":"2025-12-19 10:31:06","extension":"pdf","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2528710,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/1397c9b30570d9238b8458dc.pdf"},{"id":98628304,"identity":"d188eedb-4154-4d3b-b8c4-40e3060ffe04","added_by":"auto","created_at":"2025-12-19 17:11:14","extension":"pdf","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":629347,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/610f9f21bd5fb277b2615545.pdf"},{"id":98590517,"identity":"f913c19b-1adf-40eb-b958-a1e18a882d4f","added_by":"auto","created_at":"2025-12-19 10:31:06","extension":"pdf","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2407913,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/d43a17caba18ef00658d0713.pdf"},{"id":98590519,"identity":"15f5561a-d9e2-425a-9104-9e1289010d6d","added_by":"auto","created_at":"2025-12-19 10:31:06","extension":"pdf","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7217436,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/1bb879d999d2f6e4c1d5f8c5.pdf"},{"id":98590522,"identity":"c06849d7-c6d0-43fd-9cff-08571efe8e87","added_by":"auto","created_at":"2025-12-19 10:31:07","extension":"pdf","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8446238,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/59170fa054a5fd35006e9ebb.pdf"},{"id":98628180,"identity":"dd22cb3f-9d33-402d-b94a-4040745d6341","added_by":"auto","created_at":"2025-12-19 17:11:05","extension":"pdf","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":33867065,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/07fc13bde861961b957655b3.pdf"},{"id":98628652,"identity":"eaa2506a-e0e1-4c62-84b5-45c9e36263fb","added_by":"auto","created_at":"2025-12-19 17:12:00","extension":"pdf","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3873620,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/0c340386c9cdb0d71889615d.pdf"},{"id":98628081,"identity":"620780fd-4cf7-4dab-9f0f-d98e9d812b8e","added_by":"auto","created_at":"2025-12-19 17:10:58","extension":"pdf","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3751348,"visible":true,"origin":"","legend":"","description":"","filename":"Figure8.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/61f132a935faddd446e44b44.pdf"},{"id":98629301,"identity":"541b4334-cd7a-46f1-9539-3f30a88bd048","added_by":"auto","created_at":"2025-12-19 17:13:33","extension":"xml","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":294786,"visible":true,"origin":"","legend":"","description":"","filename":"LIFED25030860structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/170c194af8da23b556cb8eb6.xml"},{"id":98590518,"identity":"334de435-9977-414d-993f-e7f06984c1a9","added_by":"auto","created_at":"2025-12-19 10:31:06","extension":"html","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":334440,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/0611f0f6c5b5640b228b0629.html"},{"id":98628800,"identity":"f98c74dc-1212-4490-9ac0-3be490fac7fd","added_by":"auto","created_at":"2025-12-19 17:12:32","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":805721,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExpression and cellular distribution of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eElektra \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eand \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAlien \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003elncRNAs during embryonic development and adulthood.\u003c/strong\u003e Panel \u003cstrong\u003e(A)\u003c/strong\u003e. Volcano plot showing differentially expressed lncRNAs identified by RNA-seq analysis of PE (E9.5) and EE (E10.5) samples. \u003cem\u003eAlien \u003c/em\u003eand \u003cem\u003eElektra\u003c/em\u003e are highlighted as two of the most significantly altered lncRNAs, being downregulated and upregulated in EE, respectively. Panels \u003cstrong\u003e(B-C)\u003c/strong\u003e. qPCR analysis showing tissue expression (n=3) of \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien \u003c/em\u003eat E13.5 \u003cstrong\u003e(B) \u003c/strong\u003eand adult stage \u003cstrong\u003e(C)\u003c/strong\u003e. \u003cem\u003eElektra\u003c/em\u003e is highly expressed in the kidney at E13.5 and restricted to the heart in adults. \u003cem\u003eAlien \u003c/em\u003eshows high expression in the lung, stomach and liver in both embryonic and adult stages. Panel \u003cstrong\u003e(D)\u003c/strong\u003e. Percentage of \u003cem\u003eElektra\u003c/em\u003e-positive cells during cardiac development stages (E10.5 to P30) using SCRINSHOT analysis, whose expression is higher during early embryogenesis and reduces over time with transient increases at postnatal day 2 (P2) and postnatal day 30 (P30). Panel \u003cstrong\u003e(E)\u003c/strong\u003e. Percentage of \u003cem\u003eAlien\u003c/em\u003e-positive cells during cardiac development stages (E10.5 to P30). \u003cem\u003eAlien \u003c/em\u003eexpression is higher at E13.5, decreases by early postnatal stages (P2 and P7), and reactivates at P21 and P30. Statistical analysis: t-student (95% confidence interval); * p-value \u0026lt; 0.05; ** p-value \u0026lt; 0.005; *** p-value \u0026lt; 0.001; **** p-value \u0026lt;0.0001. Schemes made with TissUUmaps software.\u003c/p\u003e","description":"","filename":"Binder11.png","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/556fc1dea01fb94da9fec8dd.png"},{"id":98627746,"identity":"a22944de-e1a0-4673-a3b8-675f2e4c0821","added_by":"auto","created_at":"2025-12-19 17:10:36","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":117528,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eElektra\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAlien \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003elncRNAs have distinct subcellular localization and cell-type-specific transcriptional regulation in cardiac cell lines. \u003c/strong\u003ePanel \u003cstrong\u003e(A)\u003c/strong\u003e. RT-qPCR analyses of \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien \u003c/em\u003eexpression in HL1 cardiomyocytes, MEC1 and EPIC epicardial cells and MEVEC endocardial cells. \u003cem\u003eElektra\u003c/em\u003eshows the highest expression in MEVEC endocardial cells. Followed by epicardial cells, and lowest in HL1 cells. In contrast, \u003cem\u003eAlien \u003c/em\u003eis most highly expressed in epicardial cells. Panel \u003cstrong\u003e(B)\u003c/strong\u003e. RT-qPCR analyses of nuclear and cytoplasmic distribution. \u003cem\u003eElektra\u003c/em\u003eshows variable localization depending on cell type, while \u003cem\u003eAlien \u003c/em\u003eis mainly nuclear in all cell lines. Panel \u003cstrong\u003e(C)\u003c/strong\u003e. RT-qPCR analyses of \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien \u003c/em\u003eexpression following overexpression of \u003cem\u003ePitx2c\u003c/em\u003e, \u003cem\u003eMef2c\u003c/em\u003e, \u003cem\u003eSrf\u003c/em\u003e and \u003cem\u003eNkx2.5\u003c/em\u003e in HL1, MEC1, EPIC and MEVEC cells (n=3; each biological replicate corresponds to a single transfection assay). Panel \u003cstrong\u003e(D)\u003c/strong\u003e. RT-qPCR analyses of \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien \u003c/em\u003eexpression following siRNA-mediated silencing of \u003cem\u003ePitx2c\u003c/em\u003e, \u003cem\u003eMef2c\u003c/em\u003e, \u003cem\u003eSrf\u003c/em\u003e and \u003cem\u003eNkx2.5\u003c/em\u003e in HL1, MEC1, EPIC and MEVEC cells (n=3). These data reveal cell-type-specific transcriptional responses. Statistical analysis: t-student (95% confidence interval); * p-value \u0026lt; 0.05; ** p-value \u0026lt; 0.005; *** p-value \u0026lt; 0.001; **** p-value \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Binder12.png","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/2d30e0bf3c7aee3638206441.png"},{"id":98590496,"identity":"22d858c8-a4f9-477b-b92c-72c4b329ed6e","added_by":"auto","created_at":"2025-12-19 10:31:05","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":110905,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDistinct protein interaction networks of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eElektra\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAlien \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ein cardiac cell types. \u003c/strong\u003ePanel \u003cstrong\u003e(A)\u003c/strong\u003e. Schematic representation of the RNA pull-down (PD) and mass spectrometry (MS) workflow used to identify lncRNA-associated proteins in HL1 cardiomyocytes, MEVEC endocardial cells and MEC1 epicardial cells. PD experiments were performed in biological triplicates (n=3). Panel \u003cstrong\u003e(B)\u003c/strong\u003e. Number of unique \u003cem\u003eElektra\u003c/em\u003e-associated proteins identified in HL1 cells compared to \u003cem\u003eGapdh\u003c/em\u003e and Input conditions. Panel \u003cstrong\u003e(C)\u003c/strong\u003e. Subcellular classification of \u003cem\u003eElektra\u003c/em\u003e-binding proteins in HL1 cells, showing enrichment in the cytoplasm. Panel \u003cstrong\u003e(D)\u003c/strong\u003e. GO enrichment analysis of \u003cem\u003eElektra\u003c/em\u003e interactors in HL1 cells, highlighting RNA binding, RNA splicing, ion channel regulation and membrane-related functions. Panel \u003cstrong\u003e(E)\u003c/strong\u003e. Number of unique \u003cem\u003eAlien\u003c/em\u003e-associated proteins identified in MEC1 epicardial cells compared to \u003cem\u003eGapdh\u003c/em\u003e and Input conditions. Panel \u003cstrong\u003e(F)\u003c/strong\u003e. Subcellular distribution of \u003cem\u003eAlien\u003c/em\u003e-associated proteins, with a predominance in the cytoplasm. Panel \u003cstrong\u003e(G).\u003c/strong\u003e GO analysis of \u003cem\u003eAlien \u003c/em\u003einteractors in MEC1 epicardial cells, showing enrichment in EMT, cytoskeletal remodeling, RNA processing and mitochondrial translation. Schemes were created using Biorender (https://www.biorender.com/).\u003c/p\u003e","description":"","filename":"Binder13.png","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/75f04c8f02100c89678333c8.png"},{"id":98629225,"identity":"50d03dad-007e-4ac5-8c31-4beb5548ff0a","added_by":"auto","created_at":"2025-12-19 17:13:25","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":978343,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eElektra\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e silencing alters cardiac ion channel expression through \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eQki\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e-mediated regulation.\u003c/strong\u003e Panel \u003cstrong\u003e(A)\u003c/strong\u003e. RT-qPCR analyses of \u003cem\u003eElektra\u003c/em\u003eenrichment in Qki RIP assays from HL1 cardiomyocytes compared to IgG control. Panel \u003cstrong\u003e(B)\u003c/strong\u003e. RT-qPCR validation of \u003cem\u003eElektra\u003c/em\u003e silencing and overexpression using siRNA and pcDNA3.1 vector, respectively, in HL1 cells (n=3). Panel \u003cstrong\u003e(C)\u003c/strong\u003e. Representative images for immunofluorescence analysis of Qki protein levels after \u003cem\u003eElektra\u003c/em\u003e loss- and gain-of-function. Increased Qki levels are observed upon \u003cem\u003eElektra\u003c/em\u003e inhibition (n=3). Panel \u003cstrong\u003e(D)\u003c/strong\u003e. RT-qPCR analyses of calcium, sodium and potassium channel gene expression in HL1 cells following \u003cem\u003eElektra\u003c/em\u003esilencing and overexpression (n=3). Notably, lncRNA knockdown leads to upregulation of \u003cem\u003eQki\u003c/em\u003e, \u003cem\u003eRyr2\u003c/em\u003e, \u003cem\u003eAtp2a2\u003c/em\u003e and \u003cem\u003eNcx1\u003c/em\u003e, and downregulation of \u003cem\u003eCacnb3\u003c/em\u003e and \u003cem\u003eCasq2\u003c/em\u003e, while \u003cem\u003eElektra\u003c/em\u003e overexpression causes opposite effects for some genes. Both treatments increased \u003cem\u003eKcnn3\u003c/em\u003eexpression. Panel \u003cstrong\u003e(E)\u003c/strong\u003e. RT-qPCR analysis for \u003cem\u003eQki \u003c/em\u003esilencing validation in HL1 cardiomyocytes (n=3). Panel \u003cstrong\u003e(F)\u003c/strong\u003e. RT-qPCR analysis showing that knockdown of \u003cem\u003eQki\u003c/em\u003eleads to a significant decrease in \u003cem\u003eElektra\u003c/em\u003eexpression levels in HL1 cardiomyocytes (n=3). Panel \u003cstrong\u003e(G)\u003c/strong\u003e. RT-qPCR analyses of gene expression changes in cardiac ion channel-related genes following \u003cem\u003eQki\u003c/em\u003einhibition in HL1 cardiomyocytes. Silencing \u003cem\u003eQki\u003c/em\u003eled to upregulation of \u003cem\u003eCacnb2\u003c/em\u003e and \u003cem\u003eNcx1\u003c/em\u003e, and downregulation of \u003cem\u003eRyr2\u003c/em\u003e, \u003cem\u003eCacna1c\u003c/em\u003e, \u003cem\u003eCacnb3\u003c/em\u003e, \u003cem\u003eCacnb4\u003c/em\u003e, \u003cem\u003eAtp2a2\u003c/em\u003e, \u003cem\u003eCasq2\u003c/em\u003e, \u003cem\u003eScn5a\u003c/em\u003e and \u003cem\u003eKcnn3\u003c/em\u003e (n=3). Statistical analysis: t-student (95% confidence interval); * p-value \u0026lt; 0.05; ** p-value \u0026lt; 0.005; *** p-value \u0026lt; 0.001; **** p-value \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Binder14.png","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/6d340cb9b4c6e1ed27fc7e68.png"},{"id":98627630,"identity":"47e5292a-9b3a-4b37-9ab3-d2640118d5e3","added_by":"auto","created_at":"2025-12-19 17:10:31","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":584140,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eElektra\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e modulated \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePitx2c\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eWnt\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e signaling, affecting cardiac ion channel and sarcomeric gene expression.\u003c/strong\u003e Panel \u003cstrong\u003e(A)\u003c/strong\u003e. RT-qPCR analyses of \u003cem\u003ePitx2c\u003c/em\u003e, \u003cem\u003eWnt11 \u003c/em\u003eand \u003cem\u003eWnt8a\u003c/em\u003e expression in HL1 cardiomyocytes after silencing and overexpression of \u003cem\u003eElektra\u003c/em\u003e (n=3). \u003cem\u003eElektra\u003c/em\u003e knockdown led to upregulation of \u003cem\u003ePitx2c\u003c/em\u003e and \u003cem\u003eWnt11\u003c/em\u003e, while \u003cem\u003eElektra\u003c/em\u003eoverexpression decreased their expression. \u003cem\u003eWnt8a\u003c/em\u003elevels were not significantly affected. Panels \u003cstrong\u003e(B-D)\u003c/strong\u003e. RT-qPCR analyses showing the effect of \u003cem\u003ePitx2c\u003c/em\u003e overexpression \u003cstrong\u003e(B)\u003c/strong\u003e, \u003cem\u003eWnt8a\u003c/em\u003e overexpression \u003cstrong\u003e(C)\u003c/strong\u003e, and \u003cem\u003eWnt11\u003c/em\u003e overexpression \u003cstrong\u003e(D) \u003c/strong\u003eon \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eQki\u003c/em\u003e expression in HL1 cardiomyocytes (n=3). \u003cem\u003ePitx2c\u003c/em\u003e and \u003cem\u003eWnt8a\u003c/em\u003eoverexpression upregulated \u003cem\u003eElektra\u003c/em\u003eand downregulated \u003cem\u003eQki\u003c/em\u003e, whereas \u003cem\u003eWnt11\u003c/em\u003e overexpression did not affect \u003cem\u003eElektra\u003c/em\u003e levels. Panel \u003cstrong\u003e(E)\u003c/strong\u003e. RT-qPCR analysis of \u003cem\u003ePitx2c\u003c/em\u003e expression following \u003cem\u003eQki \u003c/em\u003eknockdown in HL1 cells (n=3), showing decreased \u003cem\u003ePitx2c\u003c/em\u003e levels. Panel \u003cstrong\u003e(F)\u003c/strong\u003e. Representative images of immunofluorescence analysis of MF-20 and pHH3 protein expression in HL1 cardiomyocytes after \u003cem\u003eElektra\u003c/em\u003einhibition (n=3), showing reduced MF-20 signal compared to controls, whereas no significant changes were observed for pHH3. Panel \u003cstrong\u003e(G)\u003c/strong\u003e. RT-qPCR analyses of \u003cem\u003eMyh6\u003c/em\u003eand \u003cem\u003eMyh7\u003c/em\u003e after \u003cem\u003eElektra\u003c/em\u003e inhibition (n=3), which are significantly downregulated. Panel \u003cstrong\u003e(H)\u003c/strong\u003e. RT-qPCR analysis of \u003cem\u003eTnnt2\u003c/em\u003e after \u003cem\u003eElektra\u003c/em\u003e inhibition (n=3), with no significant differences. Statistical analysis: t-student (95% confidence interval); * p-value \u0026lt; 0.05; ** p-value \u0026lt; 0.005; *** p-value \u0026lt; 0.001; **** p-value \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Binder15.png","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/ca35cc35fd04ea66cbd4b9ea.png"},{"id":98627496,"identity":"3a6bf451-0989-41b4-908c-177fb2bc5c98","added_by":"auto","created_at":"2025-12-19 17:10:23","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":929423,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eAlien \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003emodulates EMT-related gene expression and epicardial cell migration.\u003c/strong\u003e Panel \u003cstrong\u003e(A)\u003c/strong\u003e. RT-qPCR analysis of \u003cem\u003eAlien \u003c/em\u003eenrichment following RNA immunoprecipitation (RIP) with Wt1-specific antibody versus IgG control in MEC1 epicardial cells. Panels \u003cstrong\u003e(B-C)\u003c/strong\u003e. RT-qPCR analyses showing \u003cem\u003eWt1\u003c/em\u003e and \u003cem\u003eAlien \u003c/em\u003eexpression after \u003cem\u003eWt1\u003c/em\u003eknockdown with siRNA at 48h \u003cstrong\u003e(B) \u003c/strong\u003eand 72h \u003cstrong\u003e(C) \u003c/strong\u003epost-transfection (n=3), demonstrating increased lncRNA levels following \u003cem\u003eWt1\u003c/em\u003e silencing. Panel \u003cstrong\u003e(D)\u003c/strong\u003e. RT-qPCR analysis of \u003cem\u003eAlien \u003c/em\u003eexpression at 6h and 24h after transfection with ASO1 and ASO2 in MEC1 epicardial cells, showing overexpression with ASO1 and transient knockdown followed by overexpression with ASO2 (n=3). Panel \u003cstrong\u003e(E)\u003c/strong\u003e. Representative images of scratch assay of MEC1 epicardial cells at 6h,12h and 24h after transfection with ASO1 and ASO2. Note that ASO1 significantly reduces migration, while ASO2 shows no significant effect. Panel \u003cstrong\u003e(F)\u003c/strong\u003e. RT-qPCR analysis of \u003cem\u003eAlien \u003c/em\u003elevels at 6h and 24h following ASO2 treatment at 20nM and 80nM concentrations, confirming similar expression pattern in both conditions (n=3). Panel \u003cstrong\u003e(G)\u003c/strong\u003e. RT-qPCR analysis of EMT-related genes (\u003cem\u003eWt1\u003c/em\u003e, \u003cem\u003eSnai1\u003c/em\u003e, \u003cem\u003eSnai2\u003c/em\u003e, \u003cem\u003eCdh1\u003c/em\u003e, \u003cem\u003eCdh2\u003c/em\u003e, \u003cem\u003eCdh5\u003c/em\u003e) at 6h and 24h post-ASO2 \u003cem\u003eAlien \u003c/em\u003etransfection at 20nM (n=3). Panel \u003cstrong\u003e(H)\u003c/strong\u003e. RT-qPCR analysis of EMT-related genes (\u003cem\u003eWt1\u003c/em\u003e, \u003cem\u003eSnai1\u003c/em\u003e, \u003cem\u003eSnai2\u003c/em\u003e, \u003cem\u003eCdh1\u003c/em\u003e, \u003cem\u003eCdh2\u003c/em\u003e, \u003cem\u003eCdh5\u003c/em\u003e) at 6h and 24h post-ASO2 \u003cem\u003eAlien \u003c/em\u003etransfection at 80nM (n=3). Statistical analysis: t-student (95% confidence interval); * p-value \u0026lt; 0.05; ** p-value \u0026lt; 0.005; *** p-value \u0026lt; 0.001; **** p-value \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Binder16.png","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/d3bc9272ad02635077cf415a.png"},{"id":98627490,"identity":"6a17c06c-942b-4c7f-8874-a9b5ac4210f0","added_by":"auto","created_at":"2025-12-19 17:10:23","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":558290,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eAlien \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eregulates EMT-related gene expression and promotes mesenchymal transition in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eex vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e epicardial cells. \u003c/strong\u003ePanel \u003cstrong\u003e(A)\u003c/strong\u003e. RT-qPCR analysis of \u003cem\u003eAlien \u003c/em\u003eexpression at 6h and 24h after ASO2 treatment\u003cstrong\u003e \u003c/strong\u003eat 20nM and 80nM in epicardial cells isolated from E10.5 mouse ventricular explants (each biological sample (n) corresponds to a pool of 7-10 explants). Note that overexpression is seen at 20nM and transient downregulation followed by overexpression is observed at 80nM. Panel \u003cstrong\u003e(B)\u003c/strong\u003e. RT-qPCR analysis of EMT-related gene expression (\u003cem\u003eWt1\u003c/em\u003e, \u003cem\u003eSnai1\u003c/em\u003e, \u003cem\u003eSnai2\u003c/em\u003e, \u003cem\u003eCdh1\u003c/em\u003e, \u003cem\u003eCdh2\u003c/em\u003e, \u003cem\u003eCdh5\u003c/em\u003e) at 6h and 24h after 20nM ASO2 treatment (n=3). At 24h, \u003cem\u003eAlien \u003c/em\u003eoverexpression leads to upregulation of \u003cem\u003eWt1\u003c/em\u003e, \u003cem\u003eSnai1\u003c/em\u003e, \u003cem\u003eSnai2\u003c/em\u003e and \u003cem\u003eCdh2\u003c/em\u003e, with reduced \u003cem\u003eCdh1\u003c/em\u003e and \u003cem\u003eCdh5\u003c/em\u003e levels. Panel \u003cstrong\u003e(C)\u003c/strong\u003e. RT-qPCR analysis of EMT-related genes (\u003cem\u003eWt1\u003c/em\u003e, \u003cem\u003eSnai1\u003c/em\u003e, \u003cem\u003eSnai2\u003c/em\u003e, \u003cem\u003eCdh1\u003c/em\u003e, \u003cem\u003eCdh2\u003c/em\u003e, \u003cem\u003eCdh5\u003c/em\u003e) at 6h and 24h after 80nM ASO2 treatment (n=3). Panel \u003cstrong\u003e(D)\u003c/strong\u003e. Representative images of collagen gel EMT assay performed \u003cem\u003eex vivo\u003c/em\u003e on epicardial cells from ventricular explants after TGF-β and ASO2 treatment at 20nM and 80nM. While explants do not initiate EMT without any treatment, transfection with TGF-β and ASO2 at 20nM induces EMT, in contrast to ASO2 at 80nM, for which no significant differences were observed (n= 5-8 explants per condition). Statistical analysis: t-student (95% confidence interval); * p-value \u0026lt; 0.05; ** p-value \u0026lt; 0.005; *** p-value \u0026lt; 0.001; **** p-value \u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Binder17.png","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/ffc656a80af925cd5499b737.png"},{"id":98628077,"identity":"b32e73d0-838d-434b-bafa-3b9aca789c57","added_by":"auto","created_at":"2025-12-19 17:10:58","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":116278,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eProposed working model of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eElektra\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAlien\u0026nbsp;\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003efunction during cardiac development.\u003c/strong\u003e Schematic representation summarizing the functional roles of \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003ein distinct cardiac lineages. In myocardial cells, \u003cem\u003eElektra\u003c/em\u003e interacts with Qki and modulates \u003cem\u003ePitx2c\u003c/em\u003e \u0026gt; \u003cem\u003eWnt\u003c/em\u003e signaling, thereby regulating the expression of ion channels and sarcomeric genes, contributing to electrical and contractile homeostasis. In epicardial cells, \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003einteracts with Wt1 and regulates EMT-associated genes, influencing cell migration and promoting a partial epithelial-mesenchymal transition. Schemes were created using Biorender (https://www.biorender.com/).\u003c/p\u003e","description":"","filename":"Binder18.png","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/1b868babd3640ea6b0db1ea6.png"},{"id":98632183,"identity":"f6a7dcaa-6980-446e-9dc9-d55fbd815c17","added_by":"auto","created_at":"2025-12-19 17:21:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6388115,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/9c5e1900-8a5f-4608-8b7d-4cc7db0b6454.pdf"},{"id":98628235,"identity":"1c0708a9-ae4a-4e99-92c2-2ba23eb26603","added_by":"auto","created_at":"2025-12-19 17:11:12","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":15222,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryLegends.docx","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/7d61cb2bd13da281ccb48a25.docx"},{"id":98590524,"identity":"b00a393c-c1e6-414a-94a3-4a30748a3d37","added_by":"auto","created_at":"2025-12-19 10:31:07","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":22509245,"visible":true,"origin":"","legend":"","description":"","filename":"SuppFigure1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/89fd42ef8985892bc56ee17a.pdf"},{"id":98628021,"identity":"b75dbc59-fd1e-4e7b-9b6b-1303b1f81595","added_by":"auto","created_at":"2025-12-19 17:10:53","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":622117,"visible":true,"origin":"","legend":"","description":"","filename":"SuppFigure2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/091102f1732993fbbeed54fd.pdf"},{"id":98590511,"identity":"0cec1460-6644-43ff-af2c-bf99dbd67275","added_by":"auto","created_at":"2025-12-19 10:31:06","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":1110207,"visible":true,"origin":"","legend":"","description":"","filename":"SuppFigure3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/0272961050b5563ce0fa230a.pdf"},{"id":98628093,"identity":"a796cd90-d0e0-4210-801e-affd650214e7","added_by":"auto","created_at":"2025-12-19 17:10:58","extension":"pdf","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":506549,"visible":true,"origin":"","legend":"","description":"","filename":"SuppFigure4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/061b73c878fc42624f710665.pdf"},{"id":98628300,"identity":"a2b0942f-9e7d-462f-96ff-42faedc28100","added_by":"auto","created_at":"2025-12-19 17:11:14","extension":"docx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":26501,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable1.docx","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/e87164def0ac89aec2b46445.docx"},{"id":98628892,"identity":"e1e4e10e-8334-483c-bc05-366738a2f91d","added_by":"auto","created_at":"2025-12-19 17:12:44","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":30544,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable2.docx","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/50ed0bc1e5e74e878a0475a2.docx"},{"id":98628248,"identity":"18ad87a7-a7e3-4a36-ab93-0c0ad129bb42","added_by":"auto","created_at":"2025-12-19 17:11:12","extension":"docx","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":26447,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable3.docx","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/6512d626d5415f0cea7f1c6c.docx"},{"id":98628291,"identity":"b99f5204-15e7-4a75-861b-044c589189e3","added_by":"auto","created_at":"2025-12-19 17:11:14","extension":"docx","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":48556,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable4.docx","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/d146b1ff09571d83f81a5b65.docx"},{"id":98627979,"identity":"6dadba87-b838-4c40-9e7b-f1892818fb84","added_by":"auto","created_at":"2025-12-19 17:10:50","extension":"docx","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":160061,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable5.docx","url":"https://assets-eu.researchsquare.com/files/rs-8097679/v1/15d63b3f4b42b9d0492efc23.docx"}],"financialInterests":"","formattedTitle":"Elektra-Qki and Alien-Wt1 lncRNA-protein interaction controls myocardial ion channel expression and epicardial EMT during heart development","fulltext":[{"header":"BACKGROUND","content":"\u003cp\u003eThe formation of the heart is a complex developmental process that initiates soon after gastrulation with the configuration of the bilateral precardiac precursors that will subsequently fuse in the embryonic midline forming a cardiac straight tube [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The linear cardiac tube, initially composed of myocardium and endocardium, begins to grow and elongate due to cardiomyocyte proliferation. This structure undergoes a rightward looping, which is the first evidence of asymmetry in heart development [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Then, the third and final cellular layer of the heart, the embryonic epicardium (EE) originates from the proepicardium (PE), a transient cauliflower-structure located near the venous pole [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. This transient structure exhibits high cellular heterogeneity, as evidenced by the differential expression of several gene markers, suggesting the presence of distinct cell populations within the PE [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. After PE formation, proepicardial cells delaminate and generate vesicles that float in the pericardial cavity until they reach the myocardium, where they adhere and begin to cover the myocardial surface [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Epicardial development is essential for correct cardiac morphogenesis, since once established, a cellular subset undergoes an epithelial-mesenchymal transition (EMT), giving rise to epicardial-derived cells (EPDCs) that invade the myocardium. These EPDCs can differentiate into various cell types, including smooth muscle cells, fibroblasts and endothelial cells [\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Due to its importance in cardiac development, epicardial EMT is a highly regulated process, involving several signaling pathways and transcription factors, such as \u003cem\u003eWt1\u003c/em\u003e, \u003cem\u003eSnai1\u003c/em\u003e or \u003cem\u003eSnai2\u003c/em\u003e [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Once the embryonic heart has developed three distinct cardiac layers, each chamber is subsequently divided into right and left parts as development proceeds, resulting in the configuration of the fully formed four-chambered heart with distinct inlet and outlet connections [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe heart is the first organ that is functional during embryonic development [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. As soon as the cardiac straight tube is formed, a peristaltic contraction is initiated and blood is directionally pumped [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. As development proceeds, the synchronous chamber contraction initiates and the configuration of the atrial and ventricular cardiac action potentials takes place, involving distinct sodium, calcium and potassium ion channels [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. For efficient pumping of blood throughout the body, it is essential that the heart precisely coordinates its structural changes and functional responses. Alterations in the heart contractile capacity can lead to cardiovascular diseases such as cardiomyopathies or arrhythmias, including atrial fibrillation (AF), which can potentially result, eventually, in heart failure (HF) [\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In particular, AF is the most common arrhythmias and its prevalence has significantly increased in recent years [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Mutations in sarcomeric genes can induce structural alterations in the atria and affect the expression of ion channels and other proteins involved in electrical conduction, resulting in arrhythmia development [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In addition to sarcomeric genes such as \u003cem\u003eMyh7\u003c/em\u003e [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] or \u003cem\u003eMyl4\u003c/em\u003e [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], the transcription factor \u003cem\u003ePitx2c\u003c/em\u003e has been shown to play a key role in establishing AF. \u003cem\u003ePitx2c\u003c/em\u003e mutations have been associated with alterations in cardiac electrophysiology, including disruptions in calcium homeostasis, which can trigger arrhythmogenesis [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn recent years, the mechanisms of transcriptional and post-transcriptional regulation have become more complex due to the discovery of non-coding RNAs (ncRNAs), which are involved in regulating multiple biological processes [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. ncRNAs can be classified according to various criteria, including their biological function. In this context, the term \u0026ldquo;housekeeping RNAs\u0026rdquo; is used to describe a group that includes ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs) and small nucleolar RNAs (snoRNAs) [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. On the other hand, regulatory ncRNAs can be divided into two large groups according to their length [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Small non-coding RNAs, which are less than 200 nucleotides, include microRNAs (miRNAs) [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. These molecules, which consist of 19\u0026ndash;25 nucleotides, exert a pivotal role in post-transcriptional control by binding to the 3\u0026rsquo; UTR regions of messenger RNAs (mRNAs), thereby inducing their degradation and reducing their expression [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. However, additional functions have recently been described at both nuclear and cytoplasmic levels, including transcriptional and translational regulation [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. In contrast, another group of regulatory ncRNAs are long non-coding RNAs (lncRNAs), which exceed 200 nucleotides and share several structural features with mRNAs [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Functionally, lncRNAs can act in both the nucleus and the cytoplasm, regulating processes such as transcription, alternative splicing, translation and/or protein distribution [\u003cspan additionalcitationids=\"CR40 CR41\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the heart, several lncRNAs play a role in cardiac development by regulating key cellular mechanisms [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. These include \u003cem\u003eBraveheart\u003c/em\u003e, \u003cem\u003eCARMEN\u003c/em\u003e or \u003cem\u003eFendrr\u003c/em\u003e lncRNAs, which are primarily involved in cardiac differentiation during the early stages of development [\u003cspan additionalcitationids=\"CR44\" citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Another relevant lncRNA is \u003cem\u003eALIEN\u003c/em\u003e, which is associated with the specification of cardiac mesoderm [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. However, its function at later stages of development remains unclear. In addition to their role in differentiation, lncRNAs also regulate aspects of cardiac morphogenesis, including epicardial cell migration, formation of the cardiac chambers, trabeculation, or establishment of the conduction system and electrophysiology [\u003cspan additionalcitationids=\"CR48\" citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Dysregulation of these processes has been associated with multiple cardiac pathologies, including cardiomyopathies and electrical conduction disorders [\u003cspan additionalcitationids=\"CR51\" citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eUsing RNA-seq analysis, we recently identified two lncRNAs, \u003cem\u003eElektra\u003c/em\u003e (also known as \u003cem\u003eGm35533\u003c/em\u003e) and \u003cem\u003eAlien\u003c/em\u003e (also known as \u003cem\u003eDEANR1\u003c/em\u003e, \u003cem\u003eFalcor\u003c/em\u003e or \u003cem\u003e9030622O22Rik\u003c/em\u003e), which are differentially expressed between the PE and the EE [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. In this study, we characterized these lncRNAs in the different cardiac cell types by analyzing their expression, subcellular distribution, and transcriptional regulation. Additionally, we identified key proteins that directly interact with these lncRNAs and are essential for epicardial development and cardiac electrophysiology regulation. Our results reveal that \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien\u003c/em\u003e directly interact with Qki and Wt1, respectively, thereby regulating genes associated with voltage-gated ion channels in the myocardium, and also key genes involved in the epithelial-to-mesenchymal transition in epicardial cells. These findings suggest a potential regulatory role for these lncRNAs in essential cardiac processes such as myocardial contractility and epicardial development.\u003c/p\u003e"},{"header":"METHODS","content":"\u003cp\u003e\u003cem\u003eMouse embryonic tissues\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eCD1 mice were bred and embryos were collected at different embryonic stages (E10.5, E13.5, E16.5, E19.5) as well as postnatal (P2, P7 and P21) and adult stages. Pregnant females were euthanized by cervical dislocation to obtain the embryos while neonatal mice were decapitated. For each embryonic and postnatal stage, the heart was carefully isolated, dissected and stored at -80\u0026deg;C until further used. To obtain epicardial cells, ventricles from E10.5 mouse embryos were isolated and cultured in 24-well plates for 48 h to allow the migration and expansion of epicardial cells. Additionally, tissues from the lung, stomach and liver were collected from embryonic (E13.5) and adult stages and stored following the same procedure. Approved consent of the Andalusian Ethic Committee was obtained prior to the initiation of the study (#09/07/2024/096 corresponding to the ALURES platform code NTS-ES-001583).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003esiRNA and ASO transfections\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eHL1 cardiomyocytes (SCC065, Sigma Aldrich), MEVEC endocardial cells\u0026nbsp;[54], MEC1 (SCC187, Sigma Aldrich) and EPIC epicardial cells\u0026nbsp;[55]\u0026nbsp;were cultured on 24-well plates (6 x 10\u003csup\u003e4\u003c/sup\u003e cells per well) and transfected with \u003cem\u003ePitx2c\u003c/em\u003e-siRNA, \u003cem\u003eMef2c\u003c/em\u003e-siRNA, \u003cem\u003eSrf\u003c/em\u003e-siRNA, \u003cem\u003eNkx2.5\u003c/em\u003e-siRNA, \u003cem\u003eElektra\u003c/em\u003e-siRNA, \u003cem\u003eQki\u003c/em\u003e-siRNA, \u003cem\u003eWt1\u003c/em\u003e-siRNA (Sigma, Aldrich, Munich, Germany), respectively. Antisense oligonucleotides (ASOs) were designed according to the method described by Le \u003cem\u003eet al\u003c/em\u003e. [56] with a backbone of 10-12 DNA bases flanked by 5 modified 2\u0026rsquo; O-Methyl RNA bases in both 5\u0026rsquo; and 3\u0026rsquo;-arms. The sequences of siRNAs and ASOs are provided in \u003cstrong\u003eSupplementary Table 1\u003c/strong\u003e. Transfections were carried out using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) and Opti-MEM I (1X) (Gibco\u0026trade;, 31985070) following the manufacturer\u0026rsquo;s guidelines. siRNAs and ASOs concentration used ranged from 20nM to 80nM and validation of the inhibition was carried out by RT-qPCR assays.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePlasmid transfections\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eElektra\u003c/em\u003e lncRNA was cloned into the pcDNA3.1 vector to achieve gain-of-function expression. To clone the \u0026sim;700 bp \u003cem\u003eElektra\u003c/em\u003e insert in sense orientation under the SP6 promoter, primers were designed with EcoRI and HindIII restriction sites at the 5\u0026rsquo; ends of the forward and reverse primers, respectively. These enzymes do not cut within the insert, preserving its sequence integrity. The primer sequences used for cloning are detailed in \u003cstrong\u003eSupplementary Table 1\u003c/strong\u003e. HL1 cardiomyocytes were transfected with 300 ng of the plasmid using Lipofectamine 2000, as described above. Overexpression was validated by RT-qPCR assays.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eRNA isolation and cDNA synthesis\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA isolation was carried out using ReliaPrep\u0026trade; RNA Miniprep Systems (Promega, Z6011) according to the manufacturer\u0026apos;s instructions. For RNA extraction from both tissue and cells, pooled samples were collected and stored at -80\u0026deg;C. First-strand cDNA synthesis for real-time RT-PCR (qPCR) was performed using PrimeScript\u0026trade; RT Master Mix (Perfect Real Time) (Takara, RR036A) following the manufacturer\u0026apos;s guidelines. For the analysis of lncRNAs and mRNA expression, a range of 100-500 ng total RNA was used for retrotranscription. Subsequently, the cDNA was diluted to a ratio of 1/40 for use in qPCR. To avoid genomic DNA contamination, a negative control reaction was set up without reverse transcriptase enzyme, which produced no amplification signal during qPCR.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eNucleus /cytoplasm subcellular isolation\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eNuclear and cytoplasmic RNA fractions were isolated from MEC1 and EPIC epicardial cells, MEVEC endocardial cells and HL1 cardiomyocytes using Cytoplasmic \u0026amp; Nuclear RNA Purification Kit (Norgen, Belmont, CA. USA, Cat. 21000) according to the manufacturer\u0026rsquo;s instructions. Separation of RNA fractions from proteins or genomic DNA was achieved by column chromatography with Norgen resin. To verify the successful separation of nuclear and cytoplasmic RNA, the expression levels of nuclear-enriched mRNA (\u003cem\u003eXist2\u003c/em\u003e) and cytoplasmic-enriched mRNA (\u003cem\u003eGapdh\u003c/em\u003e) were analyzed by qPCR in each fraction.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eqPCR analyses (mRNA and lncRNA)\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eReal-time PCR was performed using 2\u0026micro;L of cDNA (prepared as described above), 5\u0026nbsp;\u0026micro;L of GoTaq\u0026reg; qPCR Master Mix (Promega), and 1\u0026micro;L of specific primer (2.5nM). The reactions were conducted on a CFX384\u003csup\u003eTM\u003c/sup\u003e thermocycler (Bio-Rad) following the manufacturer\u0026apos;s recommendations. The expression levels of the different mRNAs and lncRNAs were analyzed according to the ∆∆CT method described by Livak \u0026amp; Schmittgen [57] using \u003cem\u003eGapdh\u003c/em\u003e as an internal normalization control. Each reaction was prepared in triplicate using three biological samples. Negative control reactions, prepared without cDNA, showed no amplification signal. The sequences of all primers used are provided in \u003cstrong\u003eSupplementary Table 1\u003c/strong\u003e. Primer design was performed using Primer3Plus software (https://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) and they were synthesized by IDT (Integrated DNA Technologies).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eSCRINSHOT in situ hybridization\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eSCRINSHOT \u003cem\u003e(Single-Cell Resolution IN Situ Hybridization On Tissues)\u0026nbsp;\u003c/em\u003eassay was performed as described by Sountoulidis \u003cem\u003eet al\u003c/em\u003e. [58]. Hearts were collected at different embryonic (E10.5, E13.5, E16.5, E19.5) and postnatal stages (P2, P7, P21). All samples were washed in PBS 1X (pH=7.4), frozen in OCT (FSC22 Clear, Leica), and stored at -80\u0026deg;C until used. Heart tissues were sectioned at a thickness of 5 \u0026micro;m using a cryostat (Leica CM3050S) and mounted onto Superfrost Plus slides. Padlock probes and detection oligos were designed using the IDT PrimerQuest\u0026trade; Tool and RStudio. Padlock probes (ordered from IDT), were used at a concentration of 0.04 \u0026micro;M, while detection oligos (ordered from Eurofins), were employed at concentrations ranging from 0.02 \u0026micro;M to 0.01 \u0026micro;M. The sequences for both padlock probes and fluorophore-labeled detection oligos are provided in \u003cstrong\u003eSupplementary Table 1\u003c/strong\u003e. Images were captured using a Leica TCS SP5 II confocal scanning laser microscope. Subsequent image processing and analysis were performed with FIJI (v2.9.0), CellProfiler (v4.2.5), RStudio (v2024.04.2), and TissUUmaps (v3.0.10.1).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eLncRNA pull down assays\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eBiotinylated RNA pull-down was perfomed described by Panda \u003cem\u003eet al.\u003c/em\u003e [59]. For the \u003cem\u003ein vitro\u003c/em\u003e transcription of \u003cem\u003eElektra and Alien\u003c/em\u003e, primers were designed using Primer3plus adding the T7 RNA polymerase promoter sequence (T7) [5\u0026rsquo;AGTAATACGACTCACTATAGGG] upstream of the forward primer sequences. All primer sequences to obtain the DNA fragments are described in \u003cstrong\u003eSupplementary Table 1\u003c/strong\u003e. A biotinylated RNA negative control (\u003cem\u003eGapdh\u003c/em\u003e) was designed to validate the specificity of interaction between the RNA-binding proteins (RBPs) and the mRNA of interest. Two fragments were obtained for the \u003cem\u003eElektra\u003c/em\u003e sequence, seven fragments for \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eand one fragment for \u003cem\u003eGapdh.\u003c/em\u003e DNA fragments obtained by PCR were transcribed \u003cem\u003ein vitro\u003c/em\u003e into RNA using MaxiScript T7 kit (Thermo Fisher Scientific, Invitrogen) and biotinylated with Biotin-14-CTP (Thermo Fisher Scientific, Invitrogen). Whole cells lysates (500\u0026micro;g) from MEC1 epicardial cells, MEVEC endocardial cells and HL1 myocardial cells were incubated with 1 \u0026micro;g of biotinylated RNA fragments and streptavidin-coupled dynabeads for 2h at room temperature. A negative control sample (input), incubated without RNA fragments, was prepared to ensure specificity. All samples were processed in triplicate and analyzed by mass spectrometry (MS). Proteins uniquely associated with \u003cem\u003eElektra and\u0026nbsp;\u003c/em\u003e\u003cem\u003eAlien\u0026nbsp;\u003c/em\u003ewere selected and analyzed using the DAVID database (v2023q4).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eRIP assay\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eRibonucleoprotein immunoprecipitation (RIP) assays for Qki and Wt1 proteins were respectively performed as previously described [60]. Whole-cell lysates from HL1 cardiomyocytes and MEC1 epicardial cells were prepared using PEB buffer (100 mM KCl, 5 mM MgCl2, 10 mM HEPES pH 7.0, 0.5% Nonidet P-40). Cells were lysed on ice for 10 min and centrifuged at 10 000 x g during 15 min at 4\u0026deg;C. For Qki RIP, the supernatant was incubated with protein A Sepharose beads (Abcam, ab193256) and antibodies recognizing Qki (ThermoFisher, 1D1N6) and IgG (Abcam, ab7085) proteins. For Wt1 RIP protein G Sepharose beads (Abcam, ab193259) and antibodies recognizing Wt1 (ThermoFisher, 6F-H2) and IgG (Santa Cruz, sc-52256) were used. Antibody-bead complexes were diluted in NT2 buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1mM MgCl2, 0.05% Nonidet P-40). The samples were incubated during 1-2 h at 4\u0026deg;C and washed with NT2 buffer. To eliminate contaminating DNA and proteins, samples were treated sequentially with Ambion\u0026trade; DNase I (Invitrogen, AM2222) and Proteinase K (20 mg/mL; Invitrogen, 17916). Purified RNA was analyzed by RT-qPCR.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCell migration assay\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eCell migration was evaluated using a scratch wound assay, following the protocol established by Ascione \u003cem\u003eet al\u003c/em\u003e. [61]. MEC1 epicardial cells were seeded in 24-well plates at a density of 6 \u0026times; 10⁵ cells per well and cultured until reaching 90\u0026ndash;100% confluence. A uniform scratch was then made across the cell monolayer using a P200 pipette tip. After scratching, the cells were rinsed with PBS to remove debris, and the medium was replaced with serum-free culture medium. For the experimental condition, lipid vesicles loaded with antisense oligonucleotides (ASOs) were added, while control cells received empty lipid vesicles. Images were captured at 6h, 12h and 24h after treatment to assess wound closure.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCollagen Gel Assay for EMT Analysis\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTo assess the ability of MEC1 epicardial cells and E10.5 ventricular explants to undergo EMT, cells were cultured on collagen gels in 24-well plates. Collagen gels were prepared using Corning\u0026trade; Collagen I (rat tail, Fisher Scientific), 199 Medium, 1 M NaOH, and penicillin/streptomycin (P/S). The mixture was allowed to solidify by incubating the plates for 30 minutes at 37 \u0026deg;C. After polymerization, gels were washed three times with EMT medium consisting of high-glucose DMEM supplemented with GlutaMAX (ThermoFisher), Insulin-Transferrin-Selenium (1\u0026times;) (Gibco), and P/S (1\u0026times;). Following the specific treatments, gels were fixed and stained with DAPI (1:1000) for nuclear labeling and Phalloidin-iFluor 488 (1:1000) (Abcam, ab176753) to visualize F-actin filaments. Imaging was performed using a Leica TCS SP5 II confocal scanning laser microscope.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eImmunohistochemical analyses\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eHL1 cardiomyocytes were fixed with 4% paraformaldehyde (PFA) for 10 min at room temperature. After fixation, samples were washed twice with PBS for 5 min and incubated with permeation solution (50 nM NH\u003csub\u003e4\u003c/sub\u003eCl, 0.2% Triton X-100, PBS 1X) during 10 min. Samples were washed twice with PBS 5 min each. Blocking was performed using 0.2% gelatin (Sigma-Aldrich, G1393) dissolved in PBS applied twice during 10 min. The primary antibody for Qki was diluted in blocking solution (1:200) and incubated at 4\u0026deg;C overnight. Following primary antibody incubation, samples were washed three times with PBS and incubated with Alexa-Fluor 488-conjugated secondary antibody (Invitrogen) for 30 min at room temperature. Finally, cells were washed with PBS, incubated with DAPI (1:1000) for nuclei labelling and stored in PBS until imaging using a Leica TCS SP5 II confocal scanning laser microscope. Negative controls were carried out without incubation of the corresponding specific primary antibody, and no signal was obtained in any of them after incubation with the secondary antibody.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eStatistical analyses\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eFor statistical analyses of datasets, unpaired Student\u0026rsquo;s t-tests were used with an 95% confidence interval. Significance levels of p-values are stated in each corresponding figure legend: * p-value \u0026lt; 0.05; ** p-value \u0026lt; 0.005; *** p-value \u0026lt; 0.001; **** p-value \u0026lt;0.0001. GraphPad Prims software (v8.0.2) was used for statistical analysis and graphical representation. \u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eElektra\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;and \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eare developmentally expressed in multiple tissues displaying different cardiac expression profiles in adulthood\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo gain insight into the molecular changes associated with the transition from PE (E9.5) to EE (E10.5), we performed a comparative RNA-seq analysis of embryonic samples at these stages [53]. This analysis revealed a set of lncRNAs differentially expressed between the two conditions. Among them, we focused our attention on two particularly relevant lncRNAs, \u003cem\u003eAlien\u003c/em\u003e, which was downregulated in EE, and \u003cem\u003eElektra\u003c/em\u003e, which was upregulated in EE at E10.5, as they were among the most significantly altered transcripts identified in this dataset \u003cstrong\u003e(Figure 1A)\u003c/strong\u003e. Based on these findings, we further characterize their expression patterns at two distinct developmental time points (E13.5 and adult) across various tissues and organs in mice. At E13.5, \u003cem\u003eElektra\u003c/em\u003e is highly expressed in the kidney, moderately expressed in the heart, lung and stomach and barely detectable in the head \u003cstrong\u003e(Figure 1B)\u003c/strong\u003e. Curiously, in adulthood, expression was exclusively confined to the heart, displaying similar expression levels in the ventricles and left atrium while it was significantly decreased in the right atrium \u003cstrong\u003e(Figure 1C)\u003c/strong\u003e. For \u003cem\u003eAlien,\u003c/em\u003e high expression levels were observed in the embryonic lung, stomach and liver, with moderate levels in the head and intestine and lower levels in the heart and kidney \u003cstrong\u003e(Figure 1B)\u003c/strong\u003e. This expression pattern was largely maintained in adulthood, with elevated \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003elevels persisting in the lung, stomach, intestine and liver. In contrast, its expression remained low in the kidney, skeletal muscle and the heart, where similar levels were found in the atria and the ventricle \u003cstrong\u003e(Figure 1C)\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAlthough \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eare not among the most highly expressed lncRNAs in cardiac tissue, we selected them for further analysis due to their potential involvement in heart development. To investigate their possible regulatory roles, we subsequently performed SCRINSHOT analyses to dissect their cellular distribution along cardiac development \u003cstrong\u003e(Figure 1D, E)\u003c/strong\u003e. Globally, \u003cem\u003eElektra\u003c/em\u003e expression is more abundant at early developmental stages (E10.5 and E13.5; corresponding to \u0026sim; 5% of the total number of cells), decreasing as development proceeds (E16.5 and E19.5; corresponding to \u0026sim; 2% of the total number of cells). Surprisingly a transient increase was observed at P2 (corresponding to \u0026sim; 5% of the total number of cells), while becoming barely detectable at later postnatal stages (P7 and P21) corresponding to \u0026sim; 1% of the total cells \u003cstrong\u003e(Figure 1D)\u003c/strong\u003e. Notably, at P30, the proportion of \u003cem\u003eElektra\u003c/em\u003e-positive cells slightly increased again to \u0026sim; 2% of the total cell population. Overall these data illustrate that \u003cem\u003eElektra\u003c/em\u003e expression decreases during cardiac maturation, with transient increases at P2 and P30, suggesting dynamic postnatal regulation. We subsequently performed colocalization analyses with epicardial (\u003cem\u003eCol1a2\u003c/em\u003e), endothelial (\u003cem\u003ePecam\u003c/em\u003e) and myocardial (\u003cem\u003eTnnt2\u003c/em\u003e) at different developmental stages \u003cstrong\u003e(Supplementary Figure 1A)\u003c/strong\u003e. Our data demonstrated that \u003cem\u003eElektra\u003c/em\u003e is expressed in all three distinct cell types, with comparable abundance on each of them at all developmental stages analyzed.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eexpression levels were substantially higher than those of \u003cem\u003eElektra\u003c/em\u003e, but displayed a similar embryonic expression pattern \u003cstrong\u003e(Figure 1E)\u003c/strong\u003e. The highest expression levels were detected at E10.5, E13.5 and E16.5, with up to 93% of positive cells at E13.5. This was followed by a marked decrease in expression at E19.5 and early postnatal stages (P2 and P7), reaching \u0026sim; 7% of total cells. Interestingly, at later postnatal stages (P21 and P30), expression increased again, obtaining \u0026sim; 68% of positive cells at P30, comparable to the levels detected during embryogenesis. Furthermore, in line with the colocalization percentages, these data suggest that this lncRNA is expressed in the three cardiac cell types \u003cstrong\u003e(Supplementary Figure 1B)\u003c/strong\u003e. These results indicate that \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eexpression decreases progressively during cardiac development, reaching a minimum in early postnatal stages, but reactivates at late postnatal stages.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSubcellular distribution and transcriptional regulation of \u003cem\u003eElektra and Alien \u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further characterize \u003cem\u003eElektra\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Alien\u003c/em\u003e, we subsequently analyzed their relative expression in different cardiac cell types, as well as their subcellular distribution. We examined the expression of both lncRNAs in HL1 atrial cardiomyocytes, MEC1 and EPIC epicardial cells and MEVEC endocardial cells, demonstrating that \u003cem\u003eElektra\u003c/em\u003e displayed the highest expression levels in endocardial cells, followed by epicardial cells, with the lowest levels observed in the myocardial cells \u003cstrong\u003e(Figure 2A)\u003c/strong\u003e. In contrast, \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003ewas most highly expressed in epicardial cells, followed by endocardial cells, and, similarly to \u003cem\u003eElektra\u003c/em\u003e, showed the lowest expression in cardiomyocytes \u003cstrong\u003e(Figure 2A)\u003c/strong\u003e. We further analyzed their subcellular distribution, after validating the correct nucleus-cytoplasm isolation \u003cstrong\u003e(Supplementary Figure 2A)\u003c/strong\u003e, and found that \u003cem\u003eElektra\u003c/em\u003e was equally distributed in the nucleus and cytoplasm in myocardial cells, prominently distributed in the cytoplasm in epicardial cells (both EPIC and MEC1) and almost exclusively cytoplasmic in endocardial cells (MEVEC) \u003cstrong\u003e(Figure 2B)\u003c/strong\u003e. These findings indicate that \u003cem\u003eElektra\u0026nbsp;\u003c/em\u003ehas a specific subcellular localization on each cardiac cell type, which supports the notion that this lncRNA can exert distinct functional roles in a cell-specific manner in the cardiac context. In contrast, \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003ewas mainly located in the nucleus in all three cardiac cells type \u003cstrong\u003e(Figure 2B)\u003c/strong\u003e, suggesting a conserved nuclear function across these cell types.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLncRNAs are transcriptionally regulated by RNA polymerase II in conjunction with distinct transcription factors, as previously reported [62,63]. To investigate whether cardiac-enriched transcription factors modulate the expression of \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien\u003c/em\u003e, we performed gain- and loss-of-function for different transcriptional factors, such as \u003cem\u003ePitx2c\u003c/em\u003e, \u003cem\u003eMef2c\u003c/em\u003e, \u003cem\u003eSrf\u0026nbsp;\u003c/em\u003eand \u003cem\u003eNkx2.5\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e(Supplementary Figure 2B)\u003c/strong\u003e, in distinct cardiovascular cell lines, such as HL1 atrial cardiomyocytes, MEC1 and EPIC epicardial cells and MEVEC endocardial cells. Focusing in \u003cem\u003eElektra\u003c/em\u003e, \u003cem\u003ePitx2c\u003c/em\u003e overexpression leads to downregulation in MEVEC endocardial, MEC1 and EPIC epicardial cells, while induces upregulation in HL1 cardiomyocytes \u003cstrong\u003e(Figure 2C)\u003c/strong\u003e. On the other hand, \u003cem\u003ePitx2c\u003c/em\u003e inhibition resulted in \u003cem\u003eElektra\u003c/em\u003e upregulation in EPIC epicardial cells and downregulation in all the other cell types \u003cstrong\u003e(Figure 2D)\u003c/strong\u003e. \u003cem\u003eMef2c\u003c/em\u003e overexpression leads to \u003cem\u003eElektra\u003c/em\u003e downregulation in EPIC and MEC1 epicardial cells as well as in MEVEC endocardial cells, whereas it is upregulated in HL1 cardiomyocytes \u003cstrong\u003e(Figure 2C)\u003c/strong\u003e. In contrast, \u003cem\u003eMef2c\u003c/em\u003e silencing resulted in \u003cem\u003eElektra\u003c/em\u003e upregulation in EPIC epicardial cells while it was downregulated in MEVEC endocardial cells. In HL1 cardiomyocytes and MEC1 epicardial cells, no significant differences were identified \u003cstrong\u003e(Figure 2D)\u003c/strong\u003e. Similarly, \u003cem\u003eSrf\u0026nbsp;\u003c/em\u003eoverexpression downregulated \u003cem\u003eElektra\u003c/em\u003e in both EPIC and MEC1 epicardial cells while no significant differences were detected in HL1 and MEVEC cells \u003cstrong\u003e(Figure 2C)\u003c/strong\u003e, whereas \u003cem\u003eSrf\u003c/em\u003e silencing caused upregulation in EPIC epicardial cells, downregulation in MEVEC endocardial cells and no significant effect in HL1 and MEC1 cells \u003cstrong\u003e(Figure 2D)\u003c/strong\u003e. Finally, \u003cem\u003eNkx2.5\u003c/em\u003e overexpression downregulated \u003cem\u003eElektra\u003c/em\u003e in EPIC and MEC1 epicardial cells and MEVEC endocardial cells while no significant differences were observed in HL1 cardiomyocytes \u003cstrong\u003e(Figure 2C)\u003c/strong\u003e, whereas \u003cem\u003eNkx2.5\u003c/em\u003e inhibition leads to \u003cem\u003eElektra\u003c/em\u003e upregulation in EPIC epicardial, downregulation in MEC1 epicardial cells and no significant changes in HL1 cardiomyocytes \u003cstrong\u003e(Figure 2D)\u003c/strong\u003e. Collectively, these data demonstrate that \u003cem\u003eElektra\u003c/em\u003e is regulated by distinct cardiac-enriched transcription factors, displaying a cell type specific regulation, with all tested transcriptional factors playing a pivotal regulation role in EPIC epicardial cells, and \u003cem\u003ePitx2c\u003c/em\u003e particularly in HL1 cardiomyocytes.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRegarding the transcriptional regulation of \u003cem\u003eAlien\u003c/em\u003e, \u003cem\u003ePitx2c\u003c/em\u003e overexpression reduced its expression levels in MEVEC endocardial cells and both EPIC and MEC1 epicardial cells, while no changes are observed in HL1 cardiomyocytes \u003cstrong\u003e(Figure 2C)\u003c/strong\u003e. Conversely, loss of \u003cem\u003ePitx2c\u003c/em\u003e function resulted in increased \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eexpression in HL1 cardiomyocytes and EPIC epicardial cells, decreased expression in MEC1 epicardial cells, and no changes in MEVEC endocardial cells \u003cstrong\u003e(Figure 2D)\u003c/strong\u003e. \u003cem\u003eMef2c\u003c/em\u003e overexpression reduced \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003elevels in MEVEC endocardial and MEC1 epicardial cells, but upregulated it in HL1 cardiomyocytes, with no effect in EPIC epicardial cells \u003cstrong\u003e(Figure 2C)\u003c/strong\u003e. In contrast, \u003cem\u003eMef2c\u003c/em\u003e inhibition upregulated \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eexpression in HL1 cardiomyocytes and MEC1 epicardial cells, while downregulation in MEVEC endocardial and EPIC epicardial cells was observed \u003cstrong\u003e(Figure 2D)\u003c/strong\u003e. In addition, overexpression of\u003cem\u003e\u0026nbsp;Srf\u003c/em\u003e reduced \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003elevels in MEC1 epicardial cells, upregulated it in HL1 cardiomyocytes and MEVEC endocardial cells, and did not affect its expression in EPIC epicardial cells \u003cstrong\u003e(Figure 2C)\u003c/strong\u003e. Conversely, \u003cem\u003eSrf\u003c/em\u003e loss-of-function only increased \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eexpression in MEC1 and EPIC epicardial cells, with no differences in the other cell types \u003cstrong\u003e(Figure 2D)\u003c/strong\u003e. Notably, \u003cem\u003eNkx2.5\u003c/em\u003e overexpression reduced \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eexpression in MEC1 epicardial cells and increased it in HL1 cardiomyocytes, while there were no significant differences in EPIC epicardial and MEVEC endocardial cells \u003cstrong\u003e(Figure 2C)\u003c/strong\u003e. On the other hand, \u003cem\u003eNkx2.5\u003c/em\u003e inhibition upregulated \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003ein HL1 cardiomyocytes, MEVEC endocardial and EPIC epicardial cells, while downregulated it in MEC1 epicardial cells \u003cstrong\u003e(Figure 2D)\u003c/strong\u003e. Therefore, \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eis also regulated by cardiac transcription factors in a cell-type-specific manner, with \u003cem\u003ePitx2c\u003c/em\u003e exerting a significant influence in EPIC cells, while \u003cem\u003eMef2c\u003c/em\u003e and \u003cem\u003eSrf\u003c/em\u003e predominantly regulate its expression in MEC1 cells. \u0026nbsp;In summary, the differential responses observed across various cardiac cell types underscore the complexity of transcriptional regulation governing lncRNAs, \u003cem\u003ei.e.\u003c/em\u003e \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003ein the cardiovascular context.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProteomic analysis reveals cell-type-specific interactions of \u003cem\u003eElektra\u0026nbsp;\u003c/em\u003eand \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003elncRNAs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLncRNAs can exert multiple functions interacting with different types of molecules, including other RNAs species and protein [64]. Therefore, dissecting lncRNA-protein interactions can provide hints of their putative transcriptional and/or post-transcriptional functional role \u0026nbsp;[39,65]. In order to get further insights into the molecular mechanisms driven by \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003elncRNAs in the cardiac context, we performed RNA pull-down (PD) assays followed by mass spectrometry (MS) to identify associated proteins with both lncRNAs, respectively \u003cstrong\u003e(Figure 3A)\u003c/strong\u003e. Since both lncRNAs showed cell type-dependent expression and specific transcriptional regulation, PD experiments were performed in different cardiac cell lines (HL1 cardiomyocytes, MEVEC endocardial cells and MEC1 epicardial cells for \u003cem\u003eElektra\u003c/em\u003e; and MEC1 epicardial cells for \u003cem\u003eAlien\u003c/em\u003e) to identify proteins potentially associated with each lncRNA in different cellular contexts.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn epicardial cells, a total of 71 unique proteins that interact directly with \u003cem\u003eElektra\u003c/em\u003e were identified in MEC1 epicardial cells, as compared with \u003cem\u003eGapdh\u003c/em\u003e and Input pull-down control \u003cstrong\u003e(Supplementary Figure 3A)\u003c/strong\u003e. Approximately 32% of these proteins were exclusively nuclear, \u0026sim; 22% were uniquely cytoplasmic and \u0026sim; 32% were detected in both compartments \u003cstrong\u003e(Supplementary Figure 3B, Supplementary Table 2)\u003c/strong\u003e. Gene Ontology (GO) analysis of these proteins revealed an enrichment of biological processes (BPs) and molecular functions (MFs) associated with chromatin organization, nucleosome assembly, protein heterodimerization, and cytoplasmic translation \u003cstrong\u003e(Supplementary Figure 3C)\u003c/strong\u003e. These results indicate a variety of protein interactions involving \u003cem\u003eElektra\u003c/em\u003e in MEC1 epicardial cells. Supporting this, GO analyses of cellular components (CCs) identified the nucleus, nucleoplasm, cytosol and ribosomes as associated compartments \u003cstrong\u003e(Supplementary Figure 3C)\u003c/strong\u003e, suggesting a dual localization of \u003cem\u003eElektra\u003c/em\u003e within both nuclear and cytoplasmic regions.\u003c/p\u003e\n\u003cp\u003eA total of 29 unique \u003cem\u003eElektra\u003c/em\u003e-associated proteins were identified in MEVEC endocardial cells \u003cstrong\u003e(Supplementary Figure 3D)\u003c/strong\u003e, the majority of which were exclusively cytoplasmic (\u0026sim; 38%), located only in the nucleus (\u0026sim; 21%), or found in both compartments (\u0026sim; 21%) \u003cstrong\u003e(Supplementary Figure 3E, Supplementary Table 3)\u003c/strong\u003e. These percentages are in line with the GO analysis of cellular components (CCs), where the most representative compartment were the cytosol, ribosomes and cytoplasm, and with a lower proportion, the nucleus \u003cstrong\u003e(Supplementary Figure 3F)\u003c/strong\u003e. The major biological processes (BPs) and associated molecular functions (MFs) included cytoplasmic translation, rRNA processing, transcriptional regulation by RNA polymerases I and III, and protein binding \u003cstrong\u003e(Supplementary Figure 3F)\u003c/strong\u003e. These results suggest a more significant presence and potential function for \u003cem\u003eElektra\u003c/em\u003e in the cytoplasm, due to the high number of associated proteins found in this compartment.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn the myocardial context, a total of 175 proteins were uniquely identified in the \u003cem\u003eElektra\u003c/em\u003e PD assays, as compared to Input and \u003cem\u003eGapdh\u003c/em\u003e PD controls in HL1 cardiomyocytes \u003cstrong\u003e(Figure 3B, Supplementary Table 4\u003c/strong\u003e). Approximately\u0026nbsp;11% were exclusively nuclear,\u0026nbsp;\u0026sim;\u0026nbsp;50% were exclusively cytoplasmic and\u0026nbsp;\u0026sim;\u0026nbsp;20% were present in both compartments (\u003cstrong\u003eFigure 3C\u003c/strong\u003e). Gene ontology (GO) analyses of uniquely identified proteins in \u003cem\u003eElektra\u003c/em\u003e PD were primarily involved in biological processes (BPs) such as cell surface receptor protein tyrosine kinase pathway, secondary palate development, protein import into nucleus, regulation of RNA splicing membrane fission and animal organ morphogenesis among the most significant pathways (\u003cstrong\u003eFigure 3D\u003c/strong\u003e). These results suggest the prominent role of\u003cem\u003e\u0026nbsp;Elektra\u003c/em\u003e in association with cytoplasmic biological processes, in line with its predominant cytoplasmic localization, although distinct nuclear and cytoplasmic biological functions are also identified. GO analyses of cellular components (CCs) revealed that the plasma membrane, cytoplasm, lysosomal membrane, spliceosomal complex and nucleus are the most representative compartments (\u003cstrong\u003eFigure 3D\u003c/strong\u003e). Finally, GO molecular function (MF) analysis identified RNA binding, protein binding, ubiquitin-protein transferase activity and protein homodimerization activity as the most represented functions (\u003cstrong\u003eFigure 3D\u003c/strong\u003e). Thus, all GO analyses support a dual nuclear and cytoplasmic role for \u003cem\u003eElektra\u003c/em\u003e in myocardial cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eComparative analyses of PD and MS data from MEC1, MEVEC and HL1 cells were performed to determine whether \u003cem\u003eElektra\u003c/em\u003e binds to similar proteins in different cardiac cell types. Curiously, we did not identify any proteins in common \u003cstrong\u003e(Supplementary Figure 3G)\u003c/strong\u003e, supporting the idea that lncRNA-protein interactions and their functions are cell-type-specific. Furthermore, despite the lower expression of \u003cem\u003eElektra\u003c/em\u003e in HL1 cardiomyocytes compared to the other cell types, the highest number of \u003cem\u003eElektra\u003c/em\u003e-associated proteins was detected in these cells, suggesting a higher functional relevance of the interaction in HL1 cardiomyocytes. Therefore, further functional analyses were performed in the myocardial context. We subsequently focused our attention on those cellular compartments and molecular and biological functions with a higher number of uniquely identified proteins in \u003cem\u003eElektra\u003c/em\u003e PD in HL1 cardiomyocytes, \u003cem\u003ei.e.\u003c/em\u003e plasma membrane, cytoplasm, RNA binding, protein binding, protein import to the nucleus and regulation of RNA splicing \u003cstrong\u003e(Figure 3D)\u003c/strong\u003e. Among these categories, several families of proteins are highly represented, such distinct ion channels (e.g. Cacnb4, Kcnn3, KCa2.3), canonical Wnt signaling (Wnt8, Wnt11) and splicing mRNA stability (Qki, Snrnp70, Snrpd2). These findings suggest therefore that \u003cem\u003eElektra\u0026nbsp;\u003c/em\u003emight be involved in RNA binding and regulation of RNA splicing, plausible playing a role in ion channel expression and/or remodeling.\u003c/p\u003e\n\u003cp\u003eFor \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003elncRNA, a total of 903 proteins that specifically interact with this lncRNA were identified in MEC1 epicardial cells, after comparison with the Input and \u003cem\u003eGapdh\u003c/em\u003e PD controls \u003cstrong\u003e(Figure 3E, Supplementary Table 5)\u003c/strong\u003e. Approximately 12% of the total enriched proteins were classified as exclusively nuclear, \u0026sim; 39% as exclusively cytoplasmic and \u0026sim; 20% as localized in both nuclear and cytoplasmic compartments \u003cstrong\u003e(Figure 3F)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eGene Ontology (GO) analyses revealed that the most prevalent biological processes (BPs) include protein modification, mRNA processing, mitochondrial translation, and most notably, epithelial-mesenchymal transition (EMT) \u003cstrong\u003e(Figure 3G)\u003c/strong\u003e. In terms of molecular functions (MFs), \u003cem\u003eAlien\u003c/em\u003e-associated proteins are mainly related to nucleic acid binding, ion binding, and RNA binding. Furthermore, the most representative cellular components include cell projections, the cytoplasm and the nucleus. Taken together, these results suggest that \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003emay exert a functional role at both nuclear and cytoplasmic levels in MEC1 epicardial cells, possibly predominating in the cytoplasm due to the higher representation of cytoplasmic proteins. In addition, among the biological processes identified, the presence of key proteins involved in the maintenance and remodeling of the cytoskeleton (\u003cem\u003ee.g.\u003c/em\u003e Krt39, Krt33a, Pacsin3, Pkp4), as well as the regulation of EMT (including factors such as Wt1, Tgfb1, Tgfb1r and Wnt11), is noteworthy. These findings may indicate a possible direct involvement of \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003ein these cellular processes in epicardial cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eElektra\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;modulates the gene expression of the cardiac action potential determinants by interacting with Qki and \u003cem\u003ePitx2\u003c/em\u003e\u0026gt;\u003cem\u003eWnt\u003c/em\u003e signaling\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSince \u003cem\u003eElektra\u003c/em\u003e is dually expressed in both nuclear and cytoplasmic subcellular compartments in cardiomyocytes, we designed siRNAs and ASO against this lncRNA to distinctly target its cytoplasmic (siRNA) and nuclear (ASO) molecular function. Additionally, we cloned \u003cem\u003eElektra\u003c/em\u003e into an expression vector, providing therefore a mean to overexpress this lncRNA. We subsequently tested the molecular function of \u003cem\u003eElektra\u003c/em\u003e loss-of-function and gain-of-function in the most significantly signaling pathways identified by MS/GO analyses, i.e. splicing/mRNA stability, cardiac ion channel and \u003cem\u003eWnt\u003c/em\u003e signaling.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFirst, we validated the direct interaction between \u003cem\u003eElektra\u003c/em\u003e and the Qki protein, which is involved in splicing and mRNA stability, by RIP. We observed a significant enrichment of \u003cem\u003eElektra\u003c/em\u003e upon immunoprecipitation with Qki-specific antibody compared to the IgG control \u003cstrong\u003e(Figure 4A)\u003c/strong\u003e. Then, we validated gain- and loss-of-function of \u003cem\u003eElektra\u003c/em\u003e \u003cstrong\u003e(Figure 4B)\u0026nbsp;\u003c/strong\u003eand fluorescent immunohistochemistry assays revealed that \u003cem\u003eElektra\u003c/em\u003e inhibition results in Qki upregulation, whereas lncRNA overexpression did not significantly alter Qki protein levels \u003cstrong\u003e(Figure 4C)\u003c/strong\u003e. However, at the mRNA level changes were observed in both conditions: loss of \u003cem\u003eElektra\u003c/em\u003e function led to increased Qki expression while gain of \u003cem\u003eElektra\u003c/em\u003e function reduced Qki levels \u003cstrong\u003e(Figure 4D)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eIn addition, inhibition of \u003cem\u003eElektra\u0026nbsp;\u003c/em\u003eby siRNA lead to upregulation of genes coding for calcium handling proteins such as \u003cem\u003eRyr2\u003c/em\u003e, \u003cem\u003eAtp2a2\u003c/em\u003e and \u003cem\u003eNcx1\u003c/em\u003e, downregulation of \u003cem\u003eCacnb3\u003c/em\u003e and \u003cem\u003eCasq2\u003c/em\u003e, while no significant differences were observed for \u003cem\u003eCacna1c\u003c/em\u003e and \u003cem\u003eCacnb4\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e(Figure 4D)\u003c/strong\u003e. On the other hand, overexpression of \u003cem\u003eElektra\u003c/em\u003e lead to downregulation of \u003cem\u003eAtp2a2\u003c/em\u003e and \u003cem\u003eCasq2\u003c/em\u003e, upregulation of \u003cem\u003eCacnb3\u003c/em\u003e, while no significant differences were observed for \u003cem\u003eRyr2\u003c/em\u003e, \u003cem\u003eCacna1c\u003c/em\u003e, \u003cem\u003eCacnb2\u003c/em\u003e, \u003cem\u003eCacnb4\u003c/em\u003e and \u003cem\u003eNcx1\u003c/em\u003e. Curiously, both inhibition and overexpression of \u003cem\u003eElektra\u003c/em\u003e leads to upregulation of the potassium channel \u003cem\u003eKcnn3\u003c/em\u003e, while for the sodium channel \u003cem\u003eScn5a\u003c/em\u003e, the silencing of \u003cem\u003eElektra\u003c/em\u003e does not alter its expression and the overexpression significantly decreases \u003cem\u003eScn5a\u003c/em\u003e expression \u003cstrong\u003e(Figure 4D)\u003c/strong\u003e. These results suggest that the effects observed upon siRNA-mediated silencing of \u003cem\u003eElektra\u003c/em\u003e are predominantly linked to the loss of its cytoplasmic function.\u003c/p\u003e\n\u003cp\u003eSince \u003cem\u003eElektra\u003c/em\u003e is expressed in the nucleus and cytoplasm of HL1 cardiomyocytes, the loss of function of this lncRNA was performed using an antisense oligo (ASO) to explore the functional analysis of \u003cem\u003eElektra\u003c/em\u003e in both compartments. ASO-mediated silencing of \u003cem\u003eElektra\u003c/em\u003e was evaluated at two time points: 6h post-transfection, when the lncRNA was efficiently inhibited, and 24h, when its expression was not significantly suppressed \u003cstrong\u003e(Supplementary Figure 4A-B)\u003c/strong\u003e. Thus, \u003cem\u003eElektra\u003c/em\u003e inhibition resulted in the upregulation of calcium channels genes such as \u003cem\u003eCacnb3\u003c/em\u003e, \u003cem\u003eCasq2\u003c/em\u003e and \u003cem\u003eNcx1;\u003c/em\u003e sodium channel \u003cem\u003eScn5a\u003c/em\u003e, and potassium channels \u003cem\u003eKcnn3\u003c/em\u003e and \u003cem\u003eKcnk3\u003c/em\u003e. In contrast, \u003cem\u003eRyr2\u003c/em\u003e and \u003cem\u003eCacnb4\u003c/em\u003e expression was downregulated, while the levels of \u003cem\u003eCacna1c\u003c/em\u003e, \u003cem\u003eCacnb2\u0026nbsp;\u003c/em\u003eand \u003cem\u003eAtp2a2\u003c/em\u003e were no modified \u003cstrong\u003e(Supplementary Figure 4A)\u003c/strong\u003e. Furthermore, 24h after ASO transfection, when \u003cem\u003eElektra\u003c/em\u003e expression was not modified, reduced levels of \u003cem\u003eQki\u003c/em\u003e, \u003cem\u003eRyr2\u003c/em\u003e, \u003cem\u003eCacn1c\u003c/em\u003e, \u003cem\u003eCacnb2\u003c/em\u003e, \u003cem\u003eCacnb4\u003c/em\u003e, \u003cem\u003eAtp2a2\u003c/em\u003e, \u003cem\u003eNcx1\u003c/em\u003e, \u003cem\u003eScn5a\u003c/em\u003e as well as an upregulation of \u003cem\u003eCacnb3\u003c/em\u003e were identified. However, no changes in the expression levels of \u003cem\u003eCasq2\u003c/em\u003e, \u003cem\u003eKcnn3\u003c/em\u003e and \u003cem\u003eKcnk3\u003c/em\u003e were observed \u003cstrong\u003e(Supplementary Figure 4B)\u003c/strong\u003e. Both inhibition methods of \u003cem\u003eElektra\u003c/em\u003e, siRNA and ASO, affect the expression of genes related to ion channels, showing both similarities and differences that suggest specific functions in different cellular compartments. Notably, \u003cem\u003eNcx1\u0026nbsp;\u003c/em\u003eis upregulated after lncRNA inhibition by both approaches. siRNA, which primarily acts in the cytoplasm, causes a \u003cem\u003eCacnb3\u003c/em\u003e and \u003cem\u003eCasq2\u003c/em\u003e downregulation, along with \u003cem\u003eRyr2\u003c/em\u003e and \u003cem\u003eAtp2a2\u003c/em\u003e upregulation. In contrast, ASO inhibition, which affects both the nucleus and cytoplasm, induces upregulation of \u003cem\u003eCacnb3\u003c/em\u003e, \u003cem\u003eCasq2\u003c/em\u003e, \u003cem\u003eKcnn3\u003c/em\u003e, \u003cem\u003eKcnk3\u003c/em\u003e, and \u003cem\u003eScn5a\u003c/em\u003e. These differences suggest that \u003cem\u003eElektra\u003c/em\u003e may have distinct functions in the nucleus and cytoplasm, modulating gene expression in a compartment-specific manner but, curiously, affecting in both cases the expression of ion channel genes.\u003c/p\u003e\n\u003cp\u003eAdditionally, we tested whether \u003cem\u003eQki\u0026nbsp;\u003c/em\u003esilencing could modulate \u003cem\u003eElektra\u003c/em\u003e and its downstream partners. \u003cem\u003eQki\u003c/em\u003e inhibition \u003cstrong\u003e(Figure 4E)\u0026nbsp;\u003c/strong\u003eleads to downregulation of \u003cem\u003eElektra\u003c/em\u003e \u003cstrong\u003e(Figure 4F)\u003c/strong\u003e as well as reduced levels of \u003cem\u003eRyr2\u003c/em\u003e, \u003cem\u003eAtp2a2\u003c/em\u003e, \u003cem\u003eCasq2\u003c/em\u003e, \u003cem\u003eScn5a\u003c/em\u003e, \u003cem\u003eCacna1c, Cancb3\u003c/em\u003e, \u003cem\u003eCanb4\u003c/em\u003e and \u003cem\u003eKcnn3\u003c/em\u003e, while \u003cem\u003eCacnb2\u003c/em\u003e and \u003cem\u003eNcx1\u003c/em\u003e are upregulated \u003cstrong\u003e(Figure 4G)\u003c/strong\u003e. These data suggest the existence of a feedback mechanism between \u003cem\u003eElektra\u003c/em\u003e and Qki, which supports the hypothesis that \u003cem\u003eElektra\u0026nbsp;\u003c/em\u003eregulates Qki expression. Therefore, our results propose that \u003cem\u003eElektra\u003c/em\u003e may act as an indirect regulator of ion channel gene expression by exerting post-transcriptional control through Qki.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGiven that pull-down and mass spectrometry analyses identified \u003cem\u003eWnt\u003c/em\u003e pathway proteins, such as \u003cem\u003eWnt8a\u003c/em\u003e, \u003cem\u003eWnt8b\u003c/em\u003e, and \u003cem\u003eWnt11\u003c/em\u003e, as potential interactors of \u003cem\u003eElektra\u003c/em\u003e, we investigated whether this lncRNA could influence \u003cem\u003eWnt\u0026nbsp;\u003c/em\u003esignaling. In this context, it is important to highlight that we have previously reported the \u003cem\u003ePitx2\u003c/em\u003e \u0026gt; \u003cem\u003eWnt\u003c/em\u003e signaling is essential for maintaining cardiac action potential homeostasis. For this reason, we subsequently analyzed the regulatory role of \u003cem\u003eElektra\u003c/em\u003e on \u003cem\u003ePitx2c\u003c/em\u003e and the \u003cem\u003eWnt\u003c/em\u003e signaling pathway. In this context, silencing \u003cem\u003eElektra\u003c/em\u003e led to upregulation of \u003cem\u003ePitx2c\u003c/em\u003e and \u003cem\u003eWnt11\u003c/em\u003e, whereas overexpression of \u003cem\u003eElektra\u003c/em\u003e resulted in reduced \u003cem\u003ePitx2c\u003c/em\u003e and \u003cem\u003eWnt11\u003c/em\u003e levels, with no significant differences in \u003cem\u003eWnt8a\u003c/em\u003e expression \u003cstrong\u003e(Figure 5A)\u003c/strong\u003e. Taken together, these data demonstrate that the lncRNA \u003cem\u003eElektra\u003c/em\u003e can distinctly modulate the expression of \u003cem\u003eQki\u003c/em\u003e, \u003cem\u003eWnt\u0026nbsp;\u003c/em\u003esignaling, and cardiac ion channels. Therefore, we explored the interlinks between these signaling pathways and \u003cem\u003eElektra\u003c/em\u003e. For that purpose, we analyzed \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eQki\u003c/em\u003e expression after gain-of-function assays of \u003cem\u003ePitx2c\u003c/em\u003e and \u003cem\u003eWnt\u003c/em\u003e signaling, demonstrating that \u003cem\u003ePitx2c\u003c/em\u003e overexpression upregulated \u003cem\u003eElektra\u003c/em\u003e and downregulated \u003cem\u003eQki\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e(Figure 5B)\u003c/strong\u003e. Similarly, canonical \u003cem\u003eWnt8a\u003c/em\u003e overexpression resulted in \u003cem\u003eElektra\u0026nbsp;\u003c/em\u003eupregulation and \u003cem\u003eQki\u003c/em\u003e downregulation \u003cstrong\u003e(Figure 5C)\u003c/strong\u003e, whereas non-canonical \u003cem\u003eWnt11\u0026nbsp;\u003c/em\u003edoes not alter \u003cem\u003eElektra\u0026nbsp;\u003c/em\u003eexpression \u003cstrong\u003e(Figure 5D)\u003c/strong\u003e. In addition, \u003cem\u003eQki\u003c/em\u003e knockdown led to a decrease in \u003cem\u003ePitx2c\u0026nbsp;\u003c/em\u003eexpression levels \u003cstrong\u003e(Figure 5E)\u003c/strong\u003e, suggesting a regulatory feedback loop involving \u003cem\u003eQki\u003c/em\u003e, \u003cem\u003ePitx2c\u003c/em\u003e and \u003cem\u003eElektra\u003c/em\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSince \u003cem\u003eElektra\u003c/em\u003e play a regulatory role in modulating cardiac ion channel expression and key signaling pathways such as \u003cem\u003eQki\u003c/em\u003e and \u003cem\u003ePitx2c\u003c/em\u003e \u0026gt; \u003cem\u003eWnt\u003c/em\u003e, both essential for proper electrical activity, we explored how this lncRNA could also modulate the contractile apparatus of cardiomyocytes. We therefore investigated myosin heavy chain protein expression after \u003cem\u003eElektra\u003c/em\u003e inhibition, which resulted in decreased MF20 immunoreactivity compared to controls \u003cstrong\u003e(Figure 5F)\u003c/strong\u003e, in the absence of differences in cell proliferation \u003cstrong\u003e(Figure 5F)\u003c/strong\u003e. Furthermore, qPCR analyses demonstrated that both sarcomeric myosin \u003cem\u003eMhy6\u003c/em\u003e and \u003cem\u003eMhy7\u003c/em\u003e transcripts were significantly downregulated after \u003cem\u003eElektra\u003c/em\u003e inhibition \u003cstrong\u003e(Figure 5G)\u003c/strong\u003e, in the absence of modulation of cardiac troponin T, \u003cem\u003eTnnt2\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e(Figure 5H)\u003c/strong\u003e. These results suggest that the inhibition of \u003cem\u003eElektra\u003c/em\u003e modulates the sarcomere function by regulating the expression of sarcomeric myosins, such as \u003cem\u003eMyh6\u003c/em\u003e and \u003cem\u003eMyh7\u003c/em\u003e. Therefore, \u003cem\u003eElektra\u003c/em\u003e may play also a significant role in regulating cardiac contraction in cardiomyocytes.\u003c/p\u003e\n\u003cp\u003eOverall, these data demonstrate that \u003cem\u003eElektra\u003c/em\u003e can modulate \u003cem\u003ePitx2c\u0026nbsp;\u003c/em\u003e\u0026gt; \u003cem\u003eWnt\u003c/em\u003e signaling as well as Qki pathway impacting the expression of multiple genes coding for ion channels that are essential for the cardiac action potential configuration and, additionally, contributes to cardiomyocyte contractile function by controlling sarcomeric myosin expression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAlien\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003emodulates \u003cem\u003ein vitro\u003c/em\u003e expression of EMT-related genes and epicardial cell migration\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGiven that \u003cem\u003eAlien\u003c/em\u003e displays differential expression between PE and EE, with predominant expression in MEC1 epicardial cells and primary nuclear localization, we performed loss-of-function assays using antisense oligonucleotides (ASOs) to investigate its potential role in epicardial development. ASOs were tested at two different concentrations (20 nM and 80 nM) and two post-transfection time points were analyzed (6h and 24h). Previous PD and MS data identified several \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003e-associated proteins involved in EMT, suggesting that this lncRNA may exert a regulatory role in this biological process.\u003c/p\u003e\n\u003cp\u003eAmong the proteins related to the EMT process, Wt1 stands out, and it has been identified as one of the proteins that directly interacts with \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003ein MS assays \u003cstrong\u003e(Supplementary Table 5)\u003c/strong\u003e. This interaction was validated using RNA immunoprecipitation (RIP), which revealed a significant enrichment of \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003ein the Wt1-immunoprecipitated fraction compared to the IgG control \u003cstrong\u003e(Figure 6A)\u003c/strong\u003e. Furthermore, to analyze the functional relevance of this interaction, Wt1 loss-of-function assays were performed using siRNA, in which the inhibition of Wt1 at 48h \u003cstrong\u003e(Figure 6B)\u003c/strong\u003e and 72h \u003cstrong\u003e(Figure 6C)\u003c/strong\u003e upregulated \u003cem\u003eAlien\u003c/em\u003e expression \u003cstrong\u003e(Figure 6B-C)\u003c/strong\u003e. These results suggest that Wt1 may act as a negative regulator of \u003cem\u003eAlien\u003c/em\u003e, controlling its expression through direct interaction.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo investigate the possible epicardial role of \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003ethrough its interaction with Wt1, we also analyzed its impact on the migratory capacity of epicardial cells. To achieve this, we used two ASO molecules to generate different lncRNA expression profiles over time. Specifically, one of the ASOs (ASO1) treatment did not alter \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eexpression at 6h, but led to a significant upregulation at 24h. The second ASO (ASO2) caused a transient lncRNA knockdown at 6h, followed by gain-of-function at 24h \u003cstrong\u003e(Figure 6D)\u003c/strong\u003e. Scratch migration assays revealed a significant decrease in migratory capacity in ASO1-treated cells, whereas cells treated with ASO2 showed no relevant differences compared to controls \u003cstrong\u003e(Figure 6E)\u003c/strong\u003e. Overall, these results suggest that \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eoverexpression could limit epicardial cell migration, while transient inhibition would not be sufficient to induce a significant functional change.\u003c/p\u003e\n\u003cp\u003eIn addition, we analyzed the expression of several genes involved in the EMT process, such as \u003cem\u003eSnai1\u003c/em\u003e, \u003cem\u003eSnai2\u003c/em\u003e and different cadherins. We conducted loss-of-function assays of \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eusing ASO2 at two concentrations (20 nM and 80 nM), evaluating their impact after 6 and 24h. A consistent pattern was observed: transient inhibition of \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eat 6h, followed by lncRNA overexpression at 24h \u003cstrong\u003e(Figure 6F)\u003c/strong\u003e. Due to these results, the functional effects at both times were analyzed. While the levels of inhibition and overexpression were comparable at both concentrations, the response of EMT-associated genes differed. After 6h, the inhibition of \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eat 20 nM increased the expression of \u003cem\u003eCdh1\u003c/em\u003e and \u003cem\u003eCdh5\u003c/em\u003e while reducing the expression of \u003cem\u003eWt1\u003c/em\u003e and \u003cem\u003eCdh2\u003c/em\u003e, without affecting the levels of \u003cem\u003eSnai1\u003c/em\u003e and \u003cem\u003eSnai2\u003c/em\u003e \u003cstrong\u003e(Figure 6G)\u003c/strong\u003e. In contrast, \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eoverexpression at 24h significantly upregulated \u003cem\u003eSnai1\u003c/em\u003e, \u003cem\u003eSnai2\u003c/em\u003e, \u003cem\u003eCdh1\u003c/em\u003e and \u003cem\u003eCdh5\u003c/em\u003e, without affecting \u003cem\u003eWt1\u003c/em\u003e and \u003cem\u003eCdh2\u003c/em\u003e \u003cstrong\u003e(Figure 6G)\u003c/strong\u003e. These data suggest that overexpression of lncRNA could partially activates the EMT process without fully suppressing epithelial identity, as evidenced by the elevated increase in \u003cem\u003eCdh1\u003c/em\u003e. Overall, these results suggest that \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003emay enhanced EMT-genes which promote an intermediate state of epithelial-to-mesenchymal transition in MEC1 epicardial cells.\u003c/p\u003e\n\u003cp\u003eOn the other hand, inhibiting \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003efor 6h with an ASO2 at 80 nM increased the expression of \u003cem\u003eWt1\u003c/em\u003e, reduced the expression of \u003cem\u003eSnai1\u003c/em\u003e, \u003cem\u003eSnai2\u003c/em\u003e, \u003cem\u003eCdh2\u003c/em\u003e and \u003cem\u003eCdh5\u003c/em\u003e, without significantly altering \u003cem\u003eCdh1\u003c/em\u003e levels \u003cstrong\u003e(Figure 6H)\u003c/strong\u003e. However, after 24h, when \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eoverexpression was detected, \u003cem\u003eWt1\u003c/em\u003e, \u003cem\u003eSnai1\u003c/em\u003e, \u003cem\u003eSnai2\u003c/em\u003e, \u003cem\u003eCdh1\u003c/em\u003e and \u003cem\u003eCdh5\u003c/em\u003e levels remained elevated, with reduced levels observed in \u003cem\u003eCdh2\u0026nbsp;\u003c/em\u003e\u003cstrong\u003e(Figure 6H)\u003c/strong\u003e. These findings suggest that \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eoverexpression induces a mixed transcriptional profile that could correspond to an intermediate epithelial-to-mesenchymal state. Overall, these data support the notion that \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eexerts a modulatory role in EMT, whose expression levels regulate the balance between epithelial and mesenchymal phenotypes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAlien\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003emodulates \u003cem\u003eex vivo\u003c/em\u003e EMT-associated gene expression and promotes epicardial cell EMT\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGiven the potential regulatory role of \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eon genes involved in the EMT and the epicardial cell migration, we also performed loss-of-function assays in \u003cem\u003eex vivo\u003c/em\u003e experiments using epicardial cells isolated from ventricular explants of E10.5 mouse embryos. Consistent with the \u003cem\u003ein vitro\u003c/em\u003e results obtained in MEC1 epicardial cells, \u003cem\u003eex vivo\u003c/em\u003e treatment with 80 nM ASO2 led to a transient downregulation of \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eat 6h, followed by a significant overexpression at 24h \u003cstrong\u003e(Figure 7A)\u003c/strong\u003e. In contrast, treatment with a lower concentration (20 nM) did not alter \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eexpression at 6h but induced its overexpression at 24h \u003cstrong\u003e(Figure 7A)\u003c/strong\u003e. Based on these expression dynamics, we assessed the mRNA levels of EMT-related genes \u003cstrong\u003e(Figures 7B-C)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eFollowing 20 nM ASO2 treatment, a significant increase in \u003cem\u003eSnai2\u003c/em\u003e, \u003cem\u003eCdh2\u003c/em\u003e and \u003cem\u003eCdh5\u003c/em\u003e mRNA levels was observed at 6h, while no changes were detected in \u003cem\u003eWt1\u003c/em\u003e, \u003cem\u003eSnai1\u003c/em\u003e or \u003cem\u003eCdh1\u003c/em\u003e expression \u003cstrong\u003e(Figure 7B)\u003c/strong\u003e. At 24h, the overexpression of \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eresulted in downregulation of \u003cem\u003eCdh1\u0026nbsp;\u003c/em\u003eand \u003cem\u003eCdh5\u003c/em\u003e, along with upregulation of \u003cem\u003eWt1\u003c/em\u003e, \u003cem\u003eSnai1\u003c/em\u003e, \u003cem\u003eSnai2\u003c/em\u003e and \u003cem\u003eCdh2\u003c/em\u003e \u003cstrong\u003e(Figure 7B)\u003c/strong\u003e. Altogether, these results indicate that the overexpression of \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003epromotes the upregulation of several genes associated with the EMT program, including \u003cem\u003eWt1\u003c/em\u003e, \u003cem\u003eSnai1\u003c/em\u003e, \u003cem\u003eSnai2\u003c/em\u003e and \u003cem\u003eCdh2\u003c/em\u003e, while reducing epithelial markers such as \u003cem\u003eCdh1\u003c/em\u003e. These findings suggest that this lncRNA may play a role in promoting a mesenchymal transcriptional profile in epicardial cells. In contrast, an initial knockdown of \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eusing a higher ASO2 concentration (80 nM) did not produce the same effect in epicardial cells. The loss-of-function of the lncRNA at 6h led to an increase in the expression of \u003cem\u003eWt1\u003c/em\u003e, \u003cem\u003eSnai1\u003c/em\u003e, \u003cem\u003eSnai2\u003c/em\u003e, \u003cem\u003eCdh2\u003c/em\u003e and \u003cem\u003eCdh5\u003c/em\u003e, without affecting \u003cem\u003eCdh1\u003c/em\u003e levels \u003cstrong\u003e(Figure 7C)\u003c/strong\u003e. However, at 24h, when a significant \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eoverexpression was observed, only \u003cem\u003eSnai2\u003c/em\u003e, \u003cem\u003eCdh2\u003c/em\u003e and \u003cem\u003eCdh1\u003c/em\u003e were upregulated, with \u003cem\u003eCdh1\u003c/em\u003e showing the most consistent increase. On the other hand, no significant changes were detected in the expression of \u003cem\u003eWt1\u003c/em\u003e, \u003cem\u003eSnai1\u003c/em\u003e or \u003cem\u003eCdh5\u003c/em\u003e. This pattern suggests that \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eknockdown may partially promote the expression of EMT-related genes, although with a more limited effect. Altogether, these findings suggest that \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eplays a regulatory role in EMT, with prolonged expression promoting the upregulation of EMT-related genes, including \u003cem\u003eWt1\u003c/em\u003e, \u003cem\u003eSnai1\u003c/em\u003e and \u003cem\u003eSnai2\u003c/em\u003e, and the downregulation of \u003cem\u003eCdh1\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003eIn order to confirm the transcriptional EMT modulation by \u003cem\u003eAlien\u003c/em\u003e, we performed \u003cem\u003eex vivo\u003c/em\u003e functional EMT assays using collagen gels. Although epicardial cells isolated from explants did not spontaneously initiate the EMT process, we confirmed their capacity to undergo EMT upon treatment with TGF-\u0026beta;, a key inducer of epithelial-to-mesenchymal transition. This EMT-inducing ability was also observed in epicardial cells treated with 20 nM ASO2, whereas no significant changes were detected using the higher concentration (80 nM) \u003cstrong\u003e(Figure 7D)\u003c/strong\u003e. These data support the mRNA results, suggesting that sustained overexpression of \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003epromotes the EMT in epicardial cells.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eLong non-coding RNAs are increasingly recognized as important regulators of gene expression in different biological processes [39,66]. However, their functional roles during embryonic development remain largely uncharacterized. In previous studies, we identified two lncRNAs, \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien\u003c/em\u003e, with differential expression between the PE and EE [53]. These lncRNAs may play crucial roles in epicardial development since their expression in embryonic and adult tissues suggests diverse functions depending on the developmental stage or tissue context [67,68]. Although both lncRNAs are expressed at low levels in the heart, we focused on this organ due to its developmental relevance. qPCR and SCRINSHOT assays demonstrated their presence in cardiomyocytes, endocardial and epicardial cells, with \u003cem\u003eElektra\u003c/em\u003e enriched in MEVEC endocardial cells and \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003ein MEC1 epicardial cells. \u003cem\u003eElektra\u0026nbsp;\u003c/em\u003eshows cell-type-specific subcellular distribution, since it was mainly cytoplasmic in MEVEC, but nuclear and cytoplasmic in the other cell types. These data suggest that \u003cem\u003eElektra\u003c/em\u003e may regulate transcriptional processes in the nucleus, while it acts as a post-transcriptional modulator in the cytoplasm, similar to other lncRNAs such as \u003cem\u003eHBL1\u003c/em\u003e or \u003cem\u003eH19\u003c/em\u003e [69,70]. In the cytoplasm \u003cem\u003eHBL1\u003c/em\u003e sponges \u003cem\u003emiR-1\u003c/em\u003e, regulating cardiogenic differentiation, while \u003cem\u003eH19\u003c/em\u003e modulates cardiomyocyte apoptosis via \u003cem\u003emiR-675\u003c/em\u003e [69,70]. However, in the nucleus, both lncRNAs participate in epigenetic regulation through the PRC2 complex [52,71,72]. In contrast, our data show that \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003edisplays a predominantly nuclear localization in the cardiac cell types analyzed, indicating its nuclear function. Interestingly, previous studies reported that this lncRNA exhibits nuclear, perinuclear and cytoplasmic localization in vascular progenitors, while in liver cells its expression is mainly nuclear [73], indicating that its subcellular distribution and function may depend on the developmental stage or the cell type context [46].\u003c/p\u003e\n\u003cp\u003eSeveral studies highlight the importance of transcription factors in modulating lncRNA expression [47,63,74]. We investigated the regulatory effects of cardiogenic transcriptional factors, such as \u003cem\u003ePitx2c\u003c/em\u003e [75,76], \u003cem\u003eMef2c\u003c/em\u003e [77,78], \u003cem\u003eSrf\u003c/em\u003e [79,80] and \u003cem\u003eNkx2.5\u0026nbsp;\u003c/em\u003e[81,82], on \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eexpression through loss- and gain-of-function experiments. Our data indicate cell-type-specific transcriptional regulation, since all transcription factors modulate \u003cem\u003eElektra\u003c/em\u003e expression in epicardial cells, whereas \u003cem\u003ePitx2c\u003c/em\u003e predominantly controls \u003cem\u003eElektra\u003c/em\u003e in myocardial cells. Similarly, \u003cem\u003ePitx2c\u003c/em\u003e regulates \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003ein EPIC epicardial cells, while \u003cem\u003eSrf\u0026nbsp;\u003c/em\u003eand \u003cem\u003eMef2c\u003c/em\u003e exert stronger control in MEC1 epicardial cells. These findings demonstrate the context-dependent regulation of lncRNAs by transcriptional factors within cardiac cell types [33,83,84].\u003c/p\u003e\n\u003cp\u003eTo explore the biological function of \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien\u003c/em\u003e, we performed PD assay followed by MS to identify specific proteins directly interacting with each lncRNA. For \u003cem\u003eElektra\u003c/em\u003e, assays were conducted in the three cardiac cell types, and, surprisingly, no common shared interacting proteins were found among them, highlighting the functional specificity of this lncRNA in different cellular contexts. In MEC1 epicardial cells and MEVEC endocardial cells, \u003cem\u003eElektra\u003c/em\u003e interacted with proteins from both nuclear and cytoplasmic compartments, consistent with its localization. These findings support a dual role for \u003cem\u003eElektra\u003c/em\u003e in both transcriptional and post-transcriptional regulation, as previously reported for other cardiac lncRNAs such as \u003cem\u003eMALAT1\u003c/em\u003e, which regulates gene expression in the nucleus by controlling nuclear speckle localization and splicing factors, while acts in the cytoplasm as a miRNA sponge for \u003cem\u003emiR-155\u003c/em\u003e and \u003cem\u003emiR-125\u003c/em\u003e, modulating different cardiac processes [85\u0026ndash;88]. In HL1 myocardial cells, most interacting proteins were cytoplasmic, indicating a more relevant post-transcriptional role of \u003cem\u003eElektra\u003c/em\u003e in this context, in line with other lncRNAs, such as \u003cem\u003eZFAS1\u003c/em\u003e, that acts in the cytoplasm by binding to \u003cem\u003eAtp2a2\u003c/em\u003e to regulate its expression and therefore modulate cardiomyocyte calcium homeostasis [89,90].\u003c/p\u003e\n\u003cp\u003eGene Ontology (GO) analysis of the \u003cem\u003eElektra\u0026nbsp;\u003c/em\u003einteractome in cardiomyocytes revealed enrichment in cytoplasmic processes such as RNA splicing regulation. Notably, one of the interacting proteins was the KH-domain RNA-binding protein Qki, a well-established regulator of alternative splicing in cardiomyocytes [91]. Functional assays showed that \u003cem\u003eElektra\u003c/em\u003e negatively regulates \u003cem\u003eQki\u003c/em\u003e, with its knockdown increasing \u003cem\u003eQki\u003c/em\u003e levels and altering ion channel gene expression. These effects were mainly associated with the cytoplasmic fraction of \u003cem\u003eElektra\u003c/em\u003e, suggesting a post-transcriptional regulation. In contrast, nuclear \u003cem\u003eElektra\u003c/em\u003e showed a distinct regulatory pattern, with only \u003cem\u003eNcx1\u0026nbsp;\u003c/em\u003econsistently affected in both compartments, emphasizing the importance of subcellular localization in lncRNA function [92,93]. Previous studies have shown that Qki regulates the splicing of genes related to cardiac contraction and electrophysiology, including \u003cem\u003eRyr2\u003c/em\u003e and \u003cem\u003eCacnb1\u003c/em\u003e [91,94]. Our findings suggest that \u003cem\u003eElektra\u003c/em\u003e modulates these pathways by regulating \u003cem\u003eQki\u003c/em\u003e levels, without affecting the Qki-driven alternative splicing of these ion channels (data not shown). Moreover, \u003cem\u003eQki\u003c/em\u003e inhibition reduced \u003cem\u003eElektra\u003c/em\u003e expression, in addition to altering the levels of several calcium, sodium and potassium channel genes, in line with previous data [91,94]. These results suggest a regulatory feedback for maintaining proper splicing and ion channel expression in cardiomyocytes.\u003c/p\u003e\n\u003cp\u003eAdditionally, \u003cem\u003eElektra\u003c/em\u003e interacts with proteins of the \u003cem\u003eWnt\u0026nbsp;\u003c/em\u003esignaling pathway such as \u003cem\u003eWnt8a\u003c/em\u003e, \u003cem\u003eWnt8b\u003c/em\u003e and \u003cem\u003eWnt11\u003c/em\u003e, a pathway involved in cardiac electrophysiology and regulated by \u003cem\u003ePitx2c\u003c/em\u003e [28,95,96]. While \u003cem\u003ePitx2c\u003c/em\u003e upregulates \u003cem\u003eElektra\u003c/em\u003e, this lncRNA inhibits \u003cem\u003ePitx2c\u003c/em\u003e and \u003cem\u003eWnt11\u003c/em\u003e, indicating a feedback loop modulating \u003cem\u003ePitx2c\u0026nbsp;\u003c/em\u003e\u0026gt; \u003cem\u003eWn\u003c/em\u003et signaling. Interestingly, other lncRNAs previously investigated in our laboratory, such as \u003cem\u003eWalrad\u003c/em\u003e, \u003cem\u003eWalras\u003c/em\u003e, and \u003cem\u003eWalce\u003c/em\u003e, also participate in this pathway, suggesting a complex lncRNA network [60]. Furthermore, we found a cross-talk between \u003cem\u003eQki\u003c/em\u003e and \u003cem\u003ePitx2c\u003c/em\u003e \u0026gt; \u003cem\u003eWnt\u003c/em\u003e pathway, with reciprocal regulation. Lastly, \u003cem\u003eElektra\u0026nbsp;\u003c/em\u003ealso modulates sarcomeric gene expression essential for cardiac structure and contractile function and liked to atrial fibrillation (AF) [97\u0026ndash;99]. Therefore, \u003cem\u003eElektra\u003c/em\u003e may play a key role in regulating both ion channel and sarcomeric gene expression through \u003cem\u003eQki\u0026nbsp;\u003c/em\u003eand \u003cem\u003ePitx2c\u003c/em\u003e \u0026gt; \u003cem\u003eWnt\u003c/em\u003e signaling, and its dysregulation could contribute to arrhythmogenic cardiac pathologies such as AF.\u003c/p\u003e\n\u003cp\u003eIn MEC1 epicardial cells, \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003einteracts with both nuclear and cytoplasmic proteins, supporting the notion that lncRNA function can vary depending on the cellular context [100]. GO analysis revealed a strong enrichment in EMT, and notably identified \u003cem\u003eWt1\u003c/em\u003e among the interacting proteins. \u003cem\u003eWt1\u0026nbsp;\u003c/em\u003eis a well-known transcription factor essential for epicardial EMT [12,101], and our data showed that \u003cem\u003eWt1\u003c/em\u003e represses \u003cem\u003eAlien \u0026nbsp;\u003c/em\u003e, suggesting its involvement in EMT regulation. Functional assays showed that \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eoverexpression impaired epicardial cell migration, while its inhibition had no apparent effect. For this lncRNA, functions have been described in other biological contexts, such as the liver, where \u003cem\u003ein vitro\u003c/em\u003e studies have shown that it regulates the expression of \u003cem\u003eFoxa2\u003c/em\u003e transcription factor, thereby modulating the progression of liver fibrosis [73]. \u003cem\u003eAlien \u0026nbsp;\u003c/em\u003e-Foxa2 interaction has also been described in the lung, where it forms a regulatory feedback loop that maintains epithelial barrier integrity and suppresses cell migration [102]. Numerous studies in other biological systems have demonstrated that lncRNAs can modulate cell migration and EMT through diverse mechanisms, for example, \u003cem\u003eMEG3\u003c/em\u003e, \u003cem\u003elncRNA-HIT\u003c/em\u003e, and \u003cem\u003elncTCF7\u003c/em\u003e in different cancer types [103\u0026ndash;105], or \u003cem\u003elncRNA-ATB\u0026nbsp;\u003c/em\u003eand \u003cem\u003eMALAT1\u003c/em\u003e in pulmonary fibrosis-associated EMT [106,107]. However, in the cardiac context, our understanding of these processes remains limited, highlighting the need to further research to identify new lncRNAs with critical functions in epicardial EMT.\u003c/p\u003e\n\u003cp\u003eTo further understand this behavior, we analyzed the expression of key EMT markers following ASO treatment, and we observed dose-dependent effects on gene expression, highlighting the significant impact of this lncRNA on EMT regulation. Such variability is consistent with studies showing that ASO activity is not only sequence-specific but also dependent on dose and tissue distribution, which can critically influence knockdown efficiency and downstream effects [108,109]. Overall, our data support a role for \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003ein EMT regulation, mediated through transcription factors and adhesion molecules in epicardial cells. To confirm these findings, we performed \u003cem\u003eex vivo\u003c/em\u003e EMT essays, in which collagen gel experiments demonstrated that sustained overexpression of \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003epromotes EMT in epicardial cells, a finding consistent with qPCR data showing upregulation of EMT markers such as \u003cem\u003eWt1\u003c/em\u003e, \u003cem\u003eSnai1\u003c/em\u003e and \u003cem\u003eSnai2\u003c/em\u003e, and downregulation of the epicardial marker \u003cem\u003eCdh1\u003c/em\u003e.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eCollectively, these data support the role of \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003eas a regulatory factor in the control of epicardial EMT, suggesting that its participation is essential during embryonic epicardial development.\u003c/p\u003e\n\u003cp\u003eIn summary, our results provide evidence that both lncRNAs, \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien\u003c/em\u003e, are widely expressed across multiple embryonic and adult tissues, exhibiting cell-type-specific subcellular localization and transcriptional regulation. Functionally, in the myocardial context, \u003cem\u003eElektra\u003c/em\u003e regulates the expression of ion channel and sarcomeric contraction genes, through its interaction with Qki and modulation of the \u003cem\u003ePitx2c\u003c/em\u003e \u0026gt; \u003cem\u003eWnt\u003c/em\u003e pathway \u003cstrong\u003e(Figure 8)\u003c/strong\u003e. In contrast, \u003cem\u003eAlien\u0026nbsp;\u003c/em\u003edirectly interacts with Wt1 and regulates pivotal genes involved in the cell migration and EMT process \u003cstrong\u003e(Figure 8)\u003c/strong\u003e, highlighting its potential role in epicardial embryonic development.\u003c/p\u003e"},{"header":"CONCLUSIONS","content":"\u003cp\u003eThis study identifies \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien\u003c/em\u003e as key lncRNAs with different and specific functions in the developing heart. \u003cem\u003eElektra\u003c/em\u003e acts in myocardial cells by interacting with Qki and controlling pathways related to electrical activity and contractility, while \u003cem\u003eAlien\u003c/em\u003e modulates epicardial cell migration and EMT through its interaction with Wt1. These findings underscore the importance of lncRNAs as context-dependent regulators of cardiac development and support their potential involvement in tissue-specific processes.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAF Atrial fibrillation\u003c/p\u003e\n\u003cp\u003eASO Antisense oligonucleotide\u003c/p\u003e\n\u003cp\u003eBP Biological process\u003c/p\u003e\n\u003cp\u003eCC Cellular component\u003c/p\u003e\n\u003cp\u003ecDNA Complementary DNA\u003c/p\u003e\n\u003cp\u003eEE Embryonic epicardium\u003c/p\u003e\n\u003cp\u003eEMT Epithelial to mensenchymal transition\u003c/p\u003e\n\u003cp\u003eEPDCs Epicardial derived cells\u003c/p\u003e\n\u003cp\u003eGO Gene ontology\u003c/p\u003e\n\u003cp\u003eHF Heart failure\u003c/p\u003e\n\u003cp\u003elncRNAs Long non-coding RNAs\u003c/p\u003e\n\u003cp\u003eMF Molecular function\u003c/p\u003e\n\u003cp\u003emiRNAs MicroRNAs\u003c/p\u003e\n\u003cp\u003emRNAs Messeger RNAs\u003c/p\u003e\n\u003cp\u003eMS Mass spectrometry\u003c/p\u003e\n\u003cp\u003encRNAs Non-coding RNAs\u003c/p\u003e\n\u003cp\u003eP/S Penicillim/streptromycin\u003c/p\u003e\n\u003cp\u003ePBS Phosphate buffer saline\u003c/p\u003e\n\u003cp\u003ePD Pull-down\u003c/p\u003e\n\u003cp\u003ePE Proepicardium\u003c/p\u003e\n\u003cp\u003ePFA Paraformaldehyde\u003c/p\u003e\n\u003cp\u003eRBPs Ribonucleoproteins\u003c/p\u003e\n\u003cp\u003eRIP RNA immunoprecipitation\u003c/p\u003e\n\u003cp\u003erRNAs Ribosomal RNAs\u003c/p\u003e\n\u003cp\u003eRT-qPCR Reverse transcriptase-quantitative polymerase chain reaction\u003c/p\u003e\n\u003cp\u003eSCRINSHOT Single cell resolution in situ hybridization on tissues\u003c/p\u003e\n\u003cp\u003esiRNA Small interfering RNA\u003c/p\u003e\n\u003cp\u003esnoRNAs Small nucleolar RNAs\u003c/p\u003e\n\u003cp\u003esnRNAs Small nuclear RNAs\u003c/p\u003e\n\u003cp\u003etRNAs Transfer RNAs\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eEthics approval\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of the University of Ja\u0026eacute;n (code 14/03/2022/038).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eConsent for publication\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAvailability of data and material\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRNAseq data were uploaded into Gene Expresssion Onmibus platform with accession number GSE189344 [53].\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE189344\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCompeting interests\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eFunding\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants of the Ministerio de Innovaci\u0026oacute;n y Ciencia of the Spanish Government to DF (PID2022-138163OB-C32), Consejer\u0026iacute;a de Universidad, Investigaci\u0026oacute;n e Innovaci\u0026oacute;n of the Junta de Andaluc\u0026iacute;a Regional Council to DF (ProyExcel_00409) and FEDER-UJA 2023 (M.1.B.B TA_000622) to ELV.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAuthor\u0026acute;s contributions\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. \u0026nbsp; Material preparation, data collection and analysis were performed by SC-C and EL-V. The first draft of the manuscript was written by DF and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAcknowledgments\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank the excellent technical support of the CICT-Universidad de Ja\u0026eacute;n.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKelly RG, Brown NA, Buckingham ME. The Arterial Pole of the Mouse Heart Forms from Fgf10-Expressing Cells in Pharyngeal Mesoderm. Developmental Cell. 2001 Sep;1(3):435\u0026ndash;40. \u003c/li\u003e\n\u003cli\u003eZaffran S, Kelly RG, Meilhac SM, Buckingham ME, Brown NA. Right Ventricular Myocardium Derives From the Anterior Heart Field. Circulation Research. 2004 Aug 6;95(3):261\u0026ndash;8. \u003c/li\u003e\n\u003cli\u003eChristoffels VM, Habets PEMH, Franco D, Campione M, De Jong F, Lamers WH, Bao ZZ, Palmer S, Biben C, Harvey RP, et al. Chamber Formation and Morphogenesis in the Developing Mammalian Heart. Developmental Biology. 2000 Jul;223(2):266\u0026ndash;78. \u003c/li\u003e\n\u003cli\u003eLe Garrec JF, Dom\u0026iacute;nguez JN, Desgrange A, Ivanovitch KD, Rapha\u0026euml;l E, Bangham JA, Torres M, Coen E, Mohun TJ, Meilhac SM. A predictive model of asymmetric morphogenesis from 3D reconstructions of mouse heart looping dynamics. eLife. 2017 Nov 28;6:e28951. \u003c/li\u003e\n\u003cli\u003eVir\u0026aacute;gh S, Gittenberger-de Groot AC, Poelmann RE, K\u0026aacute;lm\u0026aacute;n F. Early development of quail heart epicardium and associated vascular and glandular structures. Anat Embryol [Internet]. 1993 Oct [cited 2025 Apr 16];188(4). Available from: http://link.springer.com/10.1007/BF00185947\u003c/li\u003e\n\u003cli\u003eM\u0026auml;nner J, P\u0026eacute;rez-Pomares JM, Mac\u0026iacute;as D, Mu\u0026ntilde;oz-Ch\u0026aacute;puli R. The Origin, Formation and Developmental Significance of the Epicardium: A Review. Cells Tissues Organs. 2001;169(2):89\u0026ndash;103. \u003c/li\u003e\n\u003cli\u003eKatz TC, Singh MK, Degenhardt K, Rivera-Feliciano J, Johnson RL, Epstein JA, Tabin CJ. Distinct Compartments of the Proepicardial Organ Give Rise to Coronary Vascular Endothelial Cells. Developmental Cell. 2012 Mar;22(3):639\u0026ndash;50. \u003c/li\u003e\n\u003cli\u003eRatajska A, Czarnowska E, Ciszek B. Embryonic development of the proepicardium and coronary vessels. Int J Dev Biol. 2008;52(2\u0026ndash;3):229\u0026ndash;36. \u003c/li\u003e\n\u003cli\u003eP\u0026eacute;rez-Pomares JM, Mac\u0026iacute;as D, Garc\u0026iacute;a-Garrido L, Mu\u0026ntilde;oz-Ch\u0026aacute;puli R. The Origin of the Subepicardial Mesenchyme in the Avian Embryo: An Immunohistochemical and Quail\u0026ndash;Chick Chimera Study. Developmental Biology. 1998 Aug;200(1):57\u0026ndash;68. \u003c/li\u003e\n\u003cli\u003eCarmona R, Gonz\u0026aacute;lez-Iriarte M, P\u0026eacute;rez-Pomares JM, Mu\u0026ntilde;oz-Ch\u0026aacute;puli R. Localization of the Wilm\u0026rsquo;s tumour protein WT1 in avian embryos. Cell Tissue Res. 2001 Feb;303(2):173\u0026ndash;86. \u003c/li\u003e\n\u003cli\u003eGittenberger-de Groot AC, Winter EM, Poelmann RE. Epicardium derived cells (EPDCs) in development, cardiac disease and repair of ischemia. Journal of Cellular and Molecular Medicine. 2010 Apr;no-no. \u003c/li\u003e\n\u003cli\u003eMart\u0026iacute;nez-Estrada OM, Lettice LA, Essafi A, Guadix JA, Slight J, Velecela V, Hall E, Reichmann J, Devenney PS, Hohenstein P, et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 2010 Jan;42(1):89\u0026ndash;93. \u003c/li\u003e\n\u003cli\u003eVon Gise A, Zhou B, Honor LB, Ma Q, Petryk A, Pu WT. WT1 regulates epicardial epithelial to mesenchymal transition through \u0026beta;-catenin and retinoic acid signaling pathways. Developmental Biology. 2011 Aug;356(2):421\u0026ndash;31. \u003c/li\u003e\n\u003cli\u003eGittenberger-de Groot AC, Bartelings MM, Deruiter MC, Poelmann RE. Basics of Cardiac Development for the Understanding of Congenital Heart Malformations. Pediatr Res. 2005 Feb;57(2):169\u0026ndash;76. \u003c/li\u003e\n\u003cli\u003eBuckingham M, Meilhac S, Zaffran S. Building the mammalian heart from two sources of myocardial cells. Nat Rev Genet. 2005 Nov;6(11):826\u0026ndash;35. \u003c/li\u003e\n\u003cli\u003eVincent SD, Buckingham ME. How to Make a Heart. In: Current Topics in Developmental Biology [Internet]. Elsevier; 2010 [cited 2025 Apr 16]. p. 1\u0026ndash;41. Available from: https://linkinghub.elsevier.com/retrieve/pii/S007021531090001X\u003c/li\u003e\n\u003cli\u003eMeilhac SM, Buckingham ME. The deployment of cell lineages that form the mammalian heart. Nat Rev Cardiol. 2018 Nov;15(11):705\u0026ndash;24. \u003c/li\u003e\n\u003cli\u003eSilverman ME, Hollman A. Discovery of the sinus node by Keith and Flack: on the centennial of their 1907 publication. Heart. 2007 Oct 1;93(10):1184\u0026ndash;7. \u003c/li\u003e\n\u003cli\u003eFlenner F, Jungen C, K\u0026uuml;pker N, Ibel A, Kruse M, Koivum\u0026auml;ki JT, Rinas A, Zech ATL, Rhoden A, Wijnker PJM, et al. Translational investigation of electrophysiology in hypertrophic cardiomyopathy. Journal of Molecular and Cellular Cardiology. 2021 Aug;157:77\u0026ndash;89. \u003c/li\u003e\n\u003cli\u003eCoronel R, Wilders R, Verkerk AO, Wiegerinck RF, Benoist D, Bernus O. Electrophysiological changes in heart failure and their implications for arrhythmogenesis. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 2013 Dec;1832(12):2432\u0026ndash;41. \u003c/li\u003e\n\u003cli\u003eLozano-Velasco E, Franco D, Aranega A, Daimi H. Genetics and Epigenetics of Atrial Fibrillation. IJMS. 2020 Aug 10;21(16):5717. \u003c/li\u003e\n\u003cli\u003eLinz D, Gawalko M, Betz K, Hendriks JM, Lip GYH, Vinter N, Guo Y, Johnsen S. Atrial fibrillation: epidemiology, screening and digital health. The Lancet Regional Health - Europe. 2024 Feb;37:100786. \u003c/li\u003e\n\u003cli\u003eFeghaly J, Zakka P, London B, MacRae CA, Refaat MM. Genetics of Atrial Fibrillation. JAHA. 2018 Oct 16;7(20):e009884. \u003c/li\u003e\n\u003cli\u003eKany S, Reissmann B, Metzner A, Kirchhof P, Darbar D, Schnabel RB. Genetics of atrial fibrillation\u0026mdash;practical applications for clinical management: if not now, when and how? Cardiovascular Research. 2021 Jun 16;117(7):1718\u0026ndash;31. \u003c/li\u003e\n\u003cli\u003eLee SP, Ashley EA, Homburger J, Caleshu C, Green EM, Jacoby D, Colan SD, Arteaga-Fern\u0026aacute;ndez E, Day SM, Girolami F, et al. Incident Atrial Fibrillation Is Associated With \u003cem\u003eMYH7\u003c/em\u003e Sarcomeric Gene Variation in Hypertrophic Cardiomyopathy: Results From the International Sarcomeric Human Cardiomyopathy Registry. Circ: Heart Failure. 2018 Sep;11(9):e005191. \u003c/li\u003e\n\u003cli\u003eGudbjartsson DF, Holm H, Sulem P, Masson G, Oddsson A, Magnusson OTh, Saemundsdottir J, Helgadottir HTh, Helgason H, Johannsdottir H, et al. A frameshift deletion in the sarcomere gene \u003cem\u003eMYL4\u003c/em\u003e causes early-onset familial atrial fibrillation. Eur Heart J. 2017 Jan 1;38(1):27\u0026ndash;34. \u003c/li\u003e\n\u003cli\u003eChinchilla A, Daimi H, Lozano-Velasco E, Dominguez JN, Caballero R, Delp\u0026oacute;n E, Tamargo J, Cinca J, Hove-Madsen L, Aranega AE, et al. PITX2 Insufficiency Leads to Atrial Electrical and Structural Remodeling Linked to Arrhythmogenesis. Circ Cardiovasc Genet. 2011 Jun;4(3):269\u0026ndash;79. \u003c/li\u003e\n\u003cli\u003eTarifa C, Serra SA, Herraiz-Mart\u0026iacute;nez A, Lozano-Velasco E, Ben\u0026iacute;tez R, Aranega A, Franco D, Hove-Madsen L. Pitx2c deficiency confers cellular electrophysiological hallmarks of atrial fibrillation to isolated atrial myocytes. Biomedicine \u0026amp; Pharmacotherapy. 2023 Jun;162:114577. \u003c/li\u003e\n\u003cli\u003eGeorge TP, Subramanian S, Supriya MH. A brief review of noncoding RNA. Egypt J Med Hum Genet. 2024 Sep 2;25(1):98. \u003c/li\u003e\n\u003cli\u003eCerutti P, Holt JW, Miller N. Detection and determination of 5,6-dihydrouridine and 4-thiouridine in transfer ribonucleic acid from different sources. Journal of Molecular Biology. 1968 Jun;34(3):505\u0026ndash;18. \u003c/li\u003e\n\u003cli\u003eZieve G, Penman S. Small RNA species of the HeLa cell: Metabolism and subcellular localization. Cell. 1976 May;8(1):19\u0026ndash;31. \u003c/li\u003e\n\u003cli\u003eLin Y, Zheng J, Lin D. PIWI-interacting RNAs in human cancer. Seminars in Cancer Biology. 2021 Oct;75:15\u0026ndash;28. \u003c/li\u003e\n\u003cli\u003eMattick JS, Amaral PP, Carninci P, Carpenter S, Chang HY, Chen LL, Chen R, Dean C, Dinger ME, Fitzgerald KA, et al. Long non-coding RNAs: definitions, functions, challenges and recommendations. Nat Rev Mol Cell Biol. 2023 Jun;24(6):430\u0026ndash;47. \u003c/li\u003e\n\u003cli\u003eLagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. Identification of Novel Genes Coding for Small Expressed RNAs. Science. 2001 Oct 26;294(5543):853\u0026ndash;8. \u003c/li\u003e\n\u003cli\u003eHa M, Kim VN. Regulation of microRNA biogenesis. Nat Rev Mol Cell Biol. 2014 Aug;15(8):509\u0026ndash;24. \u003c/li\u003e\n\u003cli\u003eBroughton JP, Lovci MT, Huang JL, Yeo GW, Pasquinelli AE. Pairing beyond the Seed Supports MicroRNA Targeting Specificity. Molecular Cell. 2016 Oct;64(2):320\u0026ndash;33. \u003c/li\u003e\n\u003cli\u003eMakarova JA, Shkurnikov MU, Wicklein D, Lange T, Samatov TR, Turchinovich AA, Tonevitsky AG. Intracellular and extracellular microRNA: An update on localization and biological role. Progress in Histochemistry and Cytochemistry. 2016 Nov;51(3\u0026ndash;4):33\u0026ndash;49. \u003c/li\u003e\n\u003cli\u003eWu H, Yang L, Chen LL. The Diversity of Long Noncoding RNAs and Their Generation. Trends in Genetics. 2017 Aug;33(8):540\u0026ndash;52. \u003c/li\u003e\n\u003cli\u003eMartianov I, Ramadass A, Serra Barros A, Chow N, Akoulitchev A. Repression of the human dihydrofolate reductase gene by a non-coding interfering transcript. Nature. 2007 Feb;445(7128):666\u0026ndash;70. \u003c/li\u003e\n\u003cli\u003eTripathi V, Ellis JD, Shen Z, Song DY, Pan Q, Watt AT, Freier SM, Bennett CF, Sharma A, Bubulya PA, et al. The Nuclear-Retained Noncoding RNA MALAT1 Regulates Alternative Splicing by Modulating SR Splicing Factor Phosphorylation. Molecular Cell. 2010 Sep;39(6):925\u0026ndash;38. \u003c/li\u003e\n\u003cli\u003eBeltran M, Puig I, Pe\u0026ntilde;a C, Garc\u0026iacute;a JM, \u0026Aacute;lvarez AB, Pe\u0026ntilde;a R, Bonilla F, De Herreros AG. A natural antisense transcript regulates Zeb2/Sip1 gene expression during Snail1-induced epithelial\u0026ndash;mesenchymal transition. Genes Dev. 2008 Mar 15;22(6):756\u0026ndash;69. \u003c/li\u003e\n\u003cli\u003eCampalans A, Kondorosi A, Crespi M. Enod40, a Short Open Reading Frame\u0026ndash;Containing mRNA, Induces Cytoplasmic Localization of a Nuclear RNA Binding Protein in \u003cem\u003eMedicago truncatula\u003c/em\u003e. Plant Cell. 2004 Apr;16(4):1047\u0026ndash;59. \u003c/li\u003e\n\u003cli\u003eKlattenhoff CA, Scheuermann JC, Surface LE, Bradley RK, Fields PA, Steinhauser ML, Ding H, Butty VL, Torrey L, Haas S, et al. Braveheart, a Long Noncoding RNA Required for Cardiovascular Lineage Commitment. Cell. 2013 Jan;152(3):570\u0026ndash;83. \u003c/li\u003e\n\u003cli\u003eOunzain S, Micheletti R, Arnan C, Plaisance I, Cecchi D, Schroen B, Reverter F, Alexanian M, Gonzales C, Ng SY, et al. CARMEN, a human super enhancer-associated long noncoding RNA controlling cardiac specification, differentiation and homeostasis. Journal of Molecular and Cellular Cardiology. 2015 Dec;89:98\u0026ndash;112. \u003c/li\u003e\n\u003cli\u003eSchuettengruber B, Chourrout D, Vervoort M, Leblanc B, Cavalli G. Genome Regulation by Polycomb and Trithorax Proteins. Cell. 2007 Feb;128(4):735\u0026ndash;45. \u003c/li\u003e\n\u003cli\u003eKurian L, Aguirre A, Sancho-Martinez I, Benner C, Hishida T, Nguyen TB, Reddy P, Nivet E, Krause MN, Nelles DA, et al. Identification of Novel Long Noncoding RNAs Underlying Vertebrate Cardiovascular Development. Circulation. 2015 Apr 7;131(14):1278\u0026ndash;90. \u003c/li\u003e\n\u003cli\u003eCa\u0026ntilde;o-Carrillo S, Garcia-Padilla C, Aranega AE, Lozano-Velasco E, Franco D. Mef2c- and Nkx2-5-Divergent Transcriptional Regulation of Chick WT1_76127 and Mouse Gm14014 lncRNAs and Their Implication in Epicardial Cell Migration. IJMS. 2024 Nov 30;25(23):12904. \u003c/li\u003e\n\u003cli\u003eLozano-Velasco E, Garcia-Padilla C, Del Mar Mu\u0026ntilde;oz-Gallardo M, Martinez-Amaro FJ, Ca\u0026ntilde;o-Carrillo S, Castillo-Casas JM, Sanchez-Fernandez C, Aranega AE, Franco D. Post-Transcriptional Regulation of Molecular Determinants during Cardiogenesis. IJMS. 2022 Mar 4;23(5):2839. \u003c/li\u003e\n\u003cli\u003eKawaguchi S, Moukette B, Hayasaka T, Haskell AK, Mah J, Sep\u0026uacute;lveda MN, Tang Y, Kim I man. Noncoding RNAs as Key Regulators for Cardiac Development and Cardiovascular Diseases. JCDD. 2023 Apr 12;10(4):166. \u003c/li\u003e\n\u003cli\u003eAtianand MK, Fitzgerald KA. Long non-coding RNAs and control of gene expression in the immune system. Trends in Molecular Medicine. 2014 Nov;20(11):623\u0026ndash;31. \u003c/li\u003e\n\u003cli\u003eLong Y, Wang X, Youmans DT, Cech TR. How do lncRNAs regulate transcription? Sci Adv. 2017 Sep;3(9):eaao2110. \u003c/li\u003e\n\u003cli\u003eViereck J, B\u0026uuml;hrke A, Foinquinos A, Chatterjee S, Kleeberger JA, Xiao K, Janssen-Peters H, Batkai S, Ramanujam D, Kraft T, et al. Targeting muscle-enriched long non-coding RNA H19reverses pathological cardiac hypertrophy. European Heart Journal. 2020 Sep 21;41(36):3462\u0026ndash;74. \u003c/li\u003e\n\u003cli\u003eCastillo-Casas JM, Due\u0026ntilde;as \u0026Aacute;, Hern\u0026aacute;ndez-Torres F, Carmona R, Mu\u0026ntilde;oz-Ch\u0026aacute;puli R, Dopazo A, \u0026Aacute;lvarez R, De Luis EV, Aranega AE, Franco D, et al. Foxf1-mediated co-regulation of miR-495 and let-7c modulates epicardial cell migration and myocardial specification. Cell Mol Life Sci. 2025 Jun 25;82(1):254. \u003c/li\u003e\n\u003cli\u003eD\u0026rsquo;Amato G, Lux\u0026aacute;n G, Del Monte-Nieto G, Mart\u0026iacute;nez-Poveda B, Torroja C, Walter W, Bochter MS, Benedito R, Cole S, Martinez F, et al. Sequential Notch activation regulates ventricular chamber development. Nat Cell Biol. 2016 Jan;18(1):7\u0026ndash;20. \u003c/li\u003e\n\u003cli\u003eRuiz-Villalba A, Ziogas A, Ehrbar M, P\u0026eacute;rez-Pomares JM. Characterization of Epicardial-Derived Cardiac Interstitial Cells: Differentiation and Mobilization of Heart Fibroblast Progenitors. Zhou Z, editor. PLoS ONE. 2013 Jan 18;8(1):e53694. \u003c/li\u003e\n\u003cli\u003eLe BT, Agarwal S, Veedu RN. Evaluation of DNA segments in 2\u0026prime;-modified RNA sequences in designing efficient splice switching antisense oligonucleotides. RSC Adv. 2021;11(23):14029\u0026ndash;35. \u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2\u0026minus;\u0026Delta;\u0026Delta;CT Method. Methods. 2001 Dec;25(4):402\u0026ndash;8. \u003c/li\u003e\n\u003cli\u003eSountoulidis A, Liontos A, Nguyen HP, Firsova AB, Fysikopoulos A, Qian X, Seeger W, Sundstr\u0026ouml;m E, Nilsson M, Samakovlis C. SCRINSHOT enables spatial mapping of cell states in tissue sections with single-cell resolution. Rawlins E, editor. PLoS Biol. 2020 Nov 20;18(11):e3000675. \u003c/li\u003e\n\u003cli\u003ePanda A, Martindale J, Gorospe M. Affinity Pulldown of Biotinylated RNA for Detection of Protein-RNA Complexes. BIO-PROTOCOL [Internet]. 2016 [cited 2024 Nov 18];6(24). Available from: https://bio-protocol.org/e2062\u003c/li\u003e\n\u003cli\u003eGarc\u0026iacute;a-Padilla C, Dom\u0026iacute;nguez JN, Lodde V, Munk R, Abdelmohsen K, Gorospe M, Jim\u0026eacute;nez-S\u0026aacute;bado V, Ginel A, Hove-Madsen L, Ar\u0026aacute;nega AE, et al. Identification of atrial-enriched lncRNA Walras linked to cardiomyocyte cytoarchitecture and atrial fibrillation. FASEB J. 2022 Jan;36(1):e22051. \u003c/li\u003e\n\u003cli\u003eAscione F, Vasaturo A, Caserta S, D\u0026rsquo;Esposito V, Formisano P, Guido S. Comparison between fibroblast wound healing and cell random migration assays in vitro. Experimental Cell Research. 2016 Sep;347(1):123\u0026ndash;32. \u003c/li\u003e\n\u003cli\u003eStatello L, Guo CJ, Chen LL, Huarte M. Gene regulation by long non-coding RNAs and its biological functions. Nat Rev Mol Cell Biol. 2021 Feb;22(2):96\u0026ndash;118. \u003c/li\u003e\n\u003cli\u003eFerrer J, Dimitrova N. Transcription regulation by long non-coding RNAs: mechanisms and disease relevance. Nat Rev Mol Cell Biol. 2024 May;25(5):396\u0026ndash;415. \u003c/li\u003e\n\u003cli\u003eWang KC, Chang HY. Molecular Mechanisms of Long Noncoding RNAs. Molecular Cell. 2011 Sep;43(6):904\u0026ndash;14. \u003c/li\u003e\n\u003cli\u003eCarlevaro-Fita J, Rahim A, Guig\u0026oacute; R, Vardy LA, Johnson R. Cytoplasmic long noncoding RNAs are frequently bound to and degraded at ribosomes in human cells. RNA. 2016 Jun;22(6):867\u0026ndash;82. \u003c/li\u003e\n\u003cli\u003eLi X, Wu Z, Fu X, Han W. lncRNAs: Insights into their function and mechanics in underlying disorders. Mutation Research/Reviews in Mutation Research. 2014 Oct;762:1\u0026ndash;21. \u003c/li\u003e\n\u003cli\u003eJiang C, Li Y, Zhao Z, Lu J, Chen H, Ding N, Wang G, Xu J, Li X. Identifying and functionally characterizing tissue-specific and ubiquitously expressed human lncRNAs. Oncotarget. 2016 Feb 9;7(6):7120\u0026ndash;33. \u003c/li\u003e\n\u003cli\u003eBridges MC, Daulagala AC, Kourtidis A. LNCcation: lncRNA localization and function. J Cell Biol. 2021 Feb 1;220(2):e202009045. \u003c/li\u003e\n\u003cli\u003eHan L, Yang L. Multidimensional Mechanistic Spectrum of Long Non-coding RNAs in Heart Development and Disease. Front Cardiovasc Med. 2021 Sep 16;8:728746. \u003c/li\u003e\n\u003cli\u003eLi X, Wang H, Yao B, Xu W, Chen J, Zhou X. lncRNA H19/miR-675 axis regulates cardiomyocyte apoptosis by targeting VDAC1 in diabetic cardiomyopathy. Sci Rep. 2016 Oct 31;6(1):36340. \u003c/li\u003e\n\u003cli\u003eLiu J, Liu S, Han L, Sheng Y, Zhang Y, Kim IM, Wan J, Yang L. LncRNA HBL1 is required for genome-wide PRC2 occupancy and function in cardiogenesis from human pluripotent stem cells. Development. 2021 Jul 1;148(13):dev199628. \u003c/li\u003e\n\u003cli\u003eZhuo C, Jiang R, Lin X, Shao M. LncRNA H19 inhibits autophagy by epigenetically silencing of DIRAS3 in diabetic cardiomyopathy. Oncotarget. 2017 Jan 3;8(1):1429\u0026ndash;37. \u003c/li\u003e\n\u003cli\u003eSergeeva OV, Korinfskaya SA, Kurochkin II, Zatsepin TS. Long Noncoding RNA LL35/Falcor Regulates Expression of Transcription Factor Foxa2 in Hepatocytes in Normal and Fibrotic Mouse Liver. Acta Naturae. 2019 Sep 15;11(3):66\u0026ndash;74. \u003c/li\u003e\n\u003cli\u003eLam F, Leisegang MS, Brandes RP. LncRNAs Are Key Regulators of Transcription Factor-Mediated Endothelial Stress Responses. IJMS. 2024 Sep 8;25(17):9726. \u003c/li\u003e\n\u003cli\u003eFranco D, Sedmera D, Lozano-Velasco E. Multiple Roles of Pitx2 in Cardiac Development and Disease. JCDD. 2017 Oct 11;4(4):16. \u003c/li\u003e\n\u003cli\u003eWang J, Xin YF, Xu WJ, Liu ZM, Qiu XB, Qu XK, Xu L, Li X, Yang YQ. Prevalence and spectrum of PITX2c mutations associated with congenital heart disease. DNA Cell Biol. 2013 Dec;32(12):708\u0026ndash;16. \u003c/li\u003e\n\u003cli\u003eMaterna SC, Sinha T, Barnes RM, Lammerts Van Bueren K, Black BL. Cardiovascular development and survival require Mef2c function in the myocardial but not the endothelial lineage. Developmental Biology. 2019 Jan;445(2):170\u0026ndash;7. \u003c/li\u003e\n\u003cli\u003eLin Q, Schwarz J, Bucana C, N. Olson E. Control of Mouse Cardiac Morphogenesis and Myogenesis by Transcription Factor MEF2C. Science. 1997 May 30;276(5317):1404\u0026ndash;7. \u003c/li\u003e\n\u003cli\u003eDeshpande A, Shetty PMV, Frey N, Rangrez AY. SRF: a seriously responsible factor in cardiac development and disease. J Biomed Sci [Internet]. 2022 Jun 9 [cited 2025 Jul 20];29(1). Available from: https://jbiomedsci.biomedcentral.com/articles/10.1186/s12929-022-00820-3\u003c/li\u003e\n\u003cli\u003eNelson T, Balzajr R, Xiao Q, Misra R. SRF-dependent gene expression in isolated cardiomyocytes: Regulation of genes involved in cardiac hypertrophy. Journal of Molecular and Cellular Cardiology. 2005 Sep;39(3):479\u0026ndash;89. \u003c/li\u003e\n\u003cli\u003eAkazawa H, Komuro I. Cardiac transcription factor Csx/Nkx2-5: Its role in cardiac development and diseases. Pharmacology \u0026amp; Therapeutics. 2005 Aug;107(2):252\u0026ndash;68. \u003c/li\u003e\n\u003cli\u003eCao C, Li L, Zhang Q, Li H, Wang Z, Wang A, Liu J. Nkx2.5: a crucial regulator of cardiac development, regeneration and diseases. Front Cardiovasc Med. 2023;10:1270951. \u003c/li\u003e\n\u003cli\u003eZhu L, Choudhary K, Gonzalez-Teran B, Ang YS, Thomas R, Stone NR, Liu L, Zhou P, Zhu C, Ruan H, et al. Transcription Factor GATA4 Regulates Cell Type\u0026ndash;Specific Splicing Through Direct Interaction With RNA in Human Induced Pluripotent Stem Cell\u0026ndash;Derived Cardiac Progenitors. Circulation. 2022 Sep 6;146(10):770\u0026ndash;87. \u003c/li\u003e\n\u003cli\u003eMatkovich SJ, Edwards JR, Grossenheider TC, De Guzman Strong C, Dorn GW. Epigenetic coordination of embryonic heart transcription by dynamically regulated long noncoding RNAs. Proc Natl Acad Sci USA. 2014 Aug 19;111(33):12264\u0026ndash;9. \u003c/li\u003e\n\u003cli\u003eMiyagawa R, Tano K, Mizuno R, Nakamura Y, Ijiri K, Rakwal R, Shibato J, Masuo Y, Mayeda A, Hirose T, et al. Identification of -cis- and -trans- acting factors involved in the localization of MALAT-1 noncoding RNA to nuclear speckles. RNA. 2012 Apr;18(4):738\u0026ndash;51. \u003c/li\u003e\n\u003cli\u003eZhang X, Hamblin MH, Yin KJ. The long noncoding RNA Malat1: Its physiological and pathophysiological functions. RNA Biology. 2017 Dec 2;14(12):1705\u0026ndash;14. \u003c/li\u003e\n\u003cli\u003eWang Q, Lu G, Chen Z. MALAT1 promoted cell proliferation and migration via MALAT1/miR‐155/MEF2A pathway in hypoxia of cardiac stem cells. J of Cellular Biochemistry. 2019 Apr;120(4):6384\u0026ndash;94. \u003c/li\u003e\n\u003cli\u003eLi L, Wang Q, Yuan Z, Chen A, Liu Z, Wang Z, Li H. LncRNA-MALAT1 promotes CPC proliferation and migration in hypoxia by up-regulation of JMJD6 via sponging miR-125. Biochemical and Biophysical Research Communications. 2018 May;499(3):711\u0026ndash;8. \u003c/li\u003e\n\u003cli\u003eZhang Y, Jiao L, Sun L, Li Y, Gao Y, Xu C, Shao Y, Li M, Li C, Lu Y, et al. LncRNA ZFAS1 as a SERCA2a Inhibitor to Cause Intracellular Ca2+ Overload and Contractile Dysfunction in a Mouse Model of Myocardial Infarction. Circulation Research. 2018 May 11;122(10):1354\u0026ndash;68. \u003c/li\u003e\n\u003cli\u003eJiao L, Li M, Shao Y, Zhang Y, Gong M, Yang X, Wang Y, Tan Z, Sun L, Xuan L, et al. lncRNA-ZFAS1 induces mitochondria-mediated apoptosis by causing cytosolic Ca2+ overload in myocardial infarction mice model. Cell Death Dis. 2019 Dec 9;10(12):942. \u003c/li\u003e\n\u003cli\u003eMonta\u0026ntilde;\u0026eacute;s-Agudo P, Aufiero S, Schepers EN, Van Der Made I, C\u0026oacute;cera-Ortega L, Ernault AC, Richard S, Kuster DWD, Christoffels VM, Pinto YM, et al. The RNA-binding protein QKI governs a muscle-specific alternative splicing program that shapes the contractile function of cardiomyocytes. Cardiovascular Research. 2023 May 22;119(5):1161\u0026ndash;74. \u003c/li\u003e\n\u003cli\u003eYu J, Yang Y, Xu Z, Lan C, Chen C, Li C, Chen Z, Yu C, Xia X, Liao Q, et al. Long Noncoding RNA Ahit Protects Against Cardiac Hypertrophy Through SUZ12 (Suppressor of Zeste 12 Protein Homolog)-Mediated Downregulation of MEF2A (Myocyte Enhancer Factor 2A). Circ: Heart Failure [Internet]. 2020 Jan [cited 2025 Jul 20];13(1). Available from: https://www.ahajournals.org/doi/10.1161/CIRCHEARTFAILURE.119.006525\u003c/li\u003e\n\u003cli\u003eNoh JH, Kim KM, McClusky WG, Abdelmohsen K, Gorospe M. Cytoplasmic functions of long noncoding RNAs. WIREs RNA [Internet]. 2018 May [cited 2025 Jul 20];9(3). Available from: https://wires.onlinelibrary.wiley.com/doi/10.1002/wrna.1471\u003c/li\u003e\n\u003cli\u003eChen X, Liu Y, Xu C, Ba L, Liu Z, Li X, Huang J, Simpson E, Gao H, Cao D, et al. QKI is a critical pre-mRNA alternative splicing regulator of cardiac myofibrillogenesis and contractile function. Nat Commun [Internet]. 2021 Jan 4 [cited 2025 Jul 20];12(1). Available from: https://www.nature.com/articles/s41467-020-20327-5\u003c/li\u003e\n\u003cli\u003eLi N, Dobrev D, Wehrens XHT. PITX2: a master regulator of cardiac channelopathy in atrial fibrillation? Cardiovasc Res. 2016 Mar 1;109(3):345\u0026ndash;7. \u003c/li\u003e\n\u003cli\u003eLozano-Velasco E, Hern\u0026aacute;ndez-Torres F, Daimi H, Serra SA, Herraiz A, Hove-Madsen L, Ar\u0026aacute;nega A, Franco D. Pitx2 impairs calcium handling in a dose-dependent manner by modulating Wnt signalling. Cardiovasc Res. 2016 Jan 1;109(1):55\u0026ndash;66. \u003c/li\u003e\n\u003cli\u003eMancuso G, Marsan M, Neroni P, Soddu C, Lai F, Serventi L, Cau M, Coiana A, Incani F, Murru S, et al. Clinical and Genetic Heterogeneity of HCM: The Possible Role of a Deletion Involving MYH6 and MYH7. Genes (Basel). 2025 Feb 10;16(2):212. \u003c/li\u003e\n\u003cli\u003eAnfinson M, Fitts RH, Lough JW, James JM, Simpson PM, Handler SS, Mitchell ME, Tomita-Mitchell A. Significance of \u0026alpha;-Myosin Heavy Chain (MYH6) Variants in Hypoplastic Left Heart Syndrome and Related Cardiovascular Diseases. JCDD. 2022 May 3;9(5):144. \u003c/li\u003e\n\u003cli\u003eBarrick SK, Greenberg MJ. Cardiac myosin contraction and mechanotransduction in health and disease. Journal of Biological Chemistry. 2021 Nov;297(5):101297. \u003c/li\u003e\n\u003cli\u003eDi Mauro V, Barandalla-Sobrados M, Catalucci D. The noncoding-RNA landscape in cardiovascular health and disease. Non-coding RNA Research. 2018 Mar;3(1):12\u0026ndash;9. \u003c/li\u003e\n\u003cli\u003eBraitsch CM, Kanisicak O, van Berlo JH, Molkentin JD, Yutzey KE. Differential expression of embryonic epicardial progenitor markers and localization of cardiac fibrosis in adult ischemic injury and hypertensive heart disease. J Mol Cell Cardiol. 2013 Dec;65:108\u0026ndash;19. \u003c/li\u003e\n\u003cli\u003eSwarr DT, Herriges M, Li S, Morley M, Fernandes S, Sridharan A, Zhou S, Garcia BA, Stewart K, Morrisey EE. The long noncoding RNA Falcor regulates Foxa2 expression to maintain lung epithelial homeostasis and promote regeneration. Genes Dev. 2019 Jun 1;33(11\u0026ndash;12):656\u0026ndash;68. \u003c/li\u003e\n\u003cli\u003eMondal T, Subhash S, Vaid R, Enroth S, Uday S, Reinius B, Mitra S, Mohammed A, James AR, Hoberg E, et al. MEG3 long noncoding RNA regulates the TGF-\u0026beta; pathway genes through formation of RNA\u0026ndash;DNA triplex structures. Nat Commun. 2015 Jul 24;6(1):7743. \u003c/li\u003e\n\u003cli\u003eRichards EJ, Zhang G, Li ZP, Permuth-Wey J, Challa S, Li Y, Kong W, Dan S, Bui MM, Coppola D, et al. Long non-coding RNAs (LncRNA) regulated by transforming growth factor (TGF) \u0026beta;. LncRNA-HIT-MEDIATED TGF-INDUCED EPITHELIAL TO MESENCHYMAL TRANSITION IN MAMMARY EPITHELIA. Journal of Biological Chemistry. 2016 Oct;291(43):22860. \u003c/li\u003e\n\u003cli\u003eWang Y, He L, Du Y, Zhu P, Huang G, Luo J, Yan X, Ye B, Li C, Xia P, et al. The Long Noncoding RNA lncTCF7 Promotes Self-Renewal of Human Liver Cancer Stem Cells through Activation of Wnt Signaling. Cell Stem Cell. 2015 Apr;16(4):413\u0026ndash;25. \u003c/li\u003e\n\u003cli\u003eLiu Y, Li Y, Xu Q, Yao W, Wu Q, Yuan J, Yan W, Xu T, Ji X, Ni C. Long non-coding RNA-ATB promotes EMT during silica-induced pulmonary fibrosis by competitively binding miR-200c. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 2018 Feb;1864(2):420\u0026ndash;31. \u003c/li\u003e\n\u003cli\u003eYan W, Wu Q, Yao W, Li Y, Liu Y, Yuan J, Han R, Yang J, Ji X, Ni C. MiR-503 modulates epithelial-mesenchymal transition in silica-induced pulmonary fibrosis by targeting PI3K p85 and is sponged by lncRNA MALAT1. Sci Rep. 2017 Sep 12;7(1):11313. \u003c/li\u003e\n\u003cli\u003eB\u0026auml;ckstr\u0026ouml;m E, Bonetti A, Johnsson P, \u0026Ouml;hlin S, Dahl\u0026eacute;n A, Andersson P, Andersson S, Gennemark P. Tissue pharmacokinetics of antisense oligonucleotides. Molecular Therapy - Nucleic Acids. 2024 Mar;35(1):102133. \u003c/li\u003e\n\u003cli\u003eOttesen EW, Luo D, Singh NN, Singh RN. High Concentration of an ISS-N1-Targeting Antisense Oligonucleotide Causes Massive Perturbation of the Transcriptome. IJMS. 2021 Aug 4;22(16):8378. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cellular-and-molecular-life-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"life","sideBox":"Learn more about [Cellular and Molecular Life Sciences](https://link.springer.com/journal/18)","snPcode":"18","submissionUrl":"https://www.editorialmanager.com/life/default2.aspx","title":"Cellular and Molecular Life Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Open","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"lncRNAs, myocardium, epicardium, ion channels, EMT","lastPublishedDoi":"10.21203/rs.3.rs-8097679/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8097679/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eThe heart is the first organ to develop during embryogenesis, reflecting its vital role maintaining oxygen and nutrient delivery to the developing embryo. Initially, the heart forms as a linear tube composed of two distinct layers: the myocardium and the endocardium. A third layer, the embryonic epicardium (EE), originates soon thereafter from a transient structure called the proepicardium (PE). PE cells migrate over the myocardial surface to generate the EE, and, in subsequent stages, a subset of these epicardial cells undergoes an epithelial-to-mesenchymal transition (EMT), invades the subepicardial space and leads to epicardial-derived cells (EPDCs) colonizing the embryonic myocardium and differentiating into multiple cardiac lineages. In recent years, long non-coding RNAs (lncRNAs) have emerged as key regulators of cardiac development. Previous data from our laboratory identified two murine lncRNAs, \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien\u003c/em\u003e, with differential expression between the PE and the EE.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eIn this study, we performed a comprehensive characterization of both lncRNAs, analyzing their expression in embryonic and adult tissues with a focus on the three main cardiac cell types. We evaluated their transcriptional regulation by cardiogenic transcription factors and identified lncRNA-binding proteins via RNA pull-down (PD) and mass spectrometry (MS) assays, followed by validation using RNA immunoprecipitation (RIP). Functional analyses through loss-of-function experiments, qPCR, cell migration and EMT assays revealed distinct roles for each lncRNA.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003e \u003cem\u003eElektra\u003c/em\u003e regulated the expression of ion channel genes in the myocardium through interaction with Qki protein, while \u003cem\u003eAlien\u003c/em\u003e modulates the epicardial EMT process by interacting with Wt1 and controlling EMT-related genes, including \u003cem\u003eSnai1\u003c/em\u003e, \u003cem\u003eSnai2\u003c/em\u003e, \u003cem\u003eCdh1\u003c/em\u003e and \u003cem\u003eCdh2\u003c/em\u003e.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eAltogether, our findings reveal that \u003cem\u003eElektra\u003c/em\u003e and \u003cem\u003eAlien\u003c/em\u003e exert important roles in cardiac development by regulating myocardial ion channel expression and epicardial EMT, respectively, supporting new insights into lncRNA-mediated regulation of heart morphogenesis.\u003c/p\u003e","manuscriptTitle":"Elektra-Qki and Alien-Wt1 lncRNA-protein interaction controls myocardial ion channel expression and epicardial EMT during heart development","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-19 10:31:00","doi":"10.21203/rs.3.rs-8097679/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-12-18T16:29:44+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-17T11:06:36+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-11-14T17:49:17+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cellular and Molecular Life Sciences","date":"2025-11-12T10:04:49+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cellular-and-molecular-life-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"life","sideBox":"Learn more about [Cellular and Molecular Life Sciences](https://link.springer.com/journal/18)","snPcode":"18","submissionUrl":"https://www.editorialmanager.com/life/default2.aspx","title":"Cellular and Molecular Life Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Open","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7471b2fd-9796-43bf-a84c-c6d548d9e13a","owner":[],"postedDate":"December 19th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2026-04-17T14:05:53+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-19 10:31:00","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8097679","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8097679","identity":"rs-8097679","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}