MAM secreted by Faecalibacterium prausnitzii ameliorates colitis through activation of autophagy and modulation of gut microbiota

MAM secreted by Faecalibacterium prausnitzii ameliorates colitis through activation of autophagy and modulation of gut microbiota | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article MAM secreted by Faecalibacterium prausnitzii ameliorates colitis through activation of autophagy and modulation of gut microbiota Xue Guo, Wenji Chen, Yan Zhang, Jing Xu, Jianhong Li, Haoming Xu, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7091778/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Dec, 2025 Read the published version in Journal of Translational Medicine → Version 1 posted 4 You are reading this latest preprint version Abstract Objective: Faecalibacterium prausnitzii is a major commensal bacterium that contributes to intestinal homeostasis. Its secreted microbial anti-inflammatory molecule (MAM) has been identified as a potential therapeutic agent for inflammatory bowel disease (IBD). However, the underlying molecular mechanisms through which MAM exerts its beneficial effects remain incompletely understood. This study aimed to investigate whether MAM modulates autophagy and to evaluate its therapeutic potential in a murine model of colitis. Methods: A genetically engineered Lactococcus lactis strain expressing MAM was administered to mice with dextran sulfate sodium (DSS)-induced colitis. The therapeutic effects of MAM were evaluated by clinical scoring, histopathological analysis, and measurement of inflammatory cytokines. Intestinal barrier function was assessed by measuring tight junction protein expression. Autophagy-related signaling pathways were analyzed using Western blotting and immunohistochemistry. Gut microbiota composition was profiled via 16S rRNA sequencing. To assess the role of autophagy in MAM-mediated protection, an autophagy inhibitor was administered to a subset of DSS-treated mice. Results: MAM treatment significantly alleviated DSS-induced colitis, as indicated by reduced disease activity index (DAI), improved histopathological scores, and decreased levels of pro-inflammatory cytokines such as TNF-α and IL-6. MAM enhanced intestinal barrier integrity by upregulating ZO-1 and occludin. Mechanistically, MAM modulated key autophagy-related proteins, including P62 and Beclin-1. Notably, even under conditions of autophagy inhibition, MAM retained partial anti-inflammatory effects, suggesting that its therapeutic action is not solely dependent on autophagy. Furthermore, 16S rRNA sequencing revealed that MAM treatment enriched beneficial taxa such as Lactobacillus and Lachnospiraceae_NK4A136_group , indicating a potential role in microbiota remodeling. Conclusion: This study identifies MAM as a multifunctional microbial effector with potent anti-inflammatory properties. Through dual mechanisms involving modulation of autophagy and gut microbiota composition, MAM improves intestinal barrier function and attenuates experimental colitis. These findings highlight the translational potential of MAM and support further investigation into its use as a novel therapeutic strategy for IBD. Faecalibacterium prausnitzii MAM Autophagy Gut microbiota Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Inflammatory Bowel Disease (IBD), encompassing Crohn’s disease (CD) and ulcerative colitis (UC), comprises a group of chronic gastrointestinal disorders characterized by recurrent episodes of intestinal inflammation [ 1 ]. Although the precise etiology of IBD remains elusive, mounting evidence indicates that its pathogenesis involves a complex interplay among environmental triggers, genetic susceptibility, gut microbiota dysbiosis, and immune system dysfunction [ 2 , 3 ]. Advances in multi-omics technologies, such as metagenomics, transcriptomics, and metabolomics have underscored that the dynamic equilibrium between the host and gut microbiota is essential for maintaining intestinal homeostasis [ 4 , 5 ] Dysbiosis, defined as an imbalance in gut microbial composition, is one of the early events in IBD pathogenesis. It can disrupt immune tolerance, promote the overproduction of pro-inflammatory cytokines, and ultimately drive chronic intestinal inflammation [ 6 ]. Faecalibacterium prausnitzii (F. prausnitzii) , one of the most abundant commensal bacteria in the healthy human gut, is widely recognized for its beneficial and anti-inflammatory properties[ 7 ]. Numerous studies have reported a significant reduction in F. prausnitzii abundance in IBD patients, which is negatively correlated with disease severity[ 8 ]. Notably, supplementation with F. prausnitzii or its supernatant can effectively alleviate experimental colitis in animal models, improving weight loss, lowering histopathological scores, and suppressing pro-inflammatory cytokine expression[ 9 ]. In 2014, E Quévrain et al. identified a 15 kDa protein secreted by F. prausnitzii , termed Microbial Anti-inflammatory Molecule (MAM). MAM exhibits potent anti-inflammatory activity through inhibition of the NF-κB signaling pathway, thereby significantly reducing intestinal inflammation [ 10 ]. This discovery shed light on the immunomodulatory mechanisms by which F. prausnitzii exerts its protective effects in the gut. Autophagy is essential for maintaining intestinal epithelial integrity and immune homeostasis [ 11 ]. It regulates various aspects of intestinal physiology, including epithelial renewal, metabolic balance, functions of epithelial subtypes, modulation of inflammatory responses, and defense against pathogens [ 12 – 14 ]. Impaired autophagy has been implicated in IBD pathogenesis, with mutations in autophagy-related genes (e.g., ATG16L2, LC3) identified as genetic risk factors for IBD [ 15 , 16 ]. Furthermore, autophagy can influence the composition of gut microbiota, linking host immunity with microbiota. Disruption of this process can lead to microbial imbalance and exacerbate immune dysregulation [ 17 , 18 ]. Although previous studies have highlighted the therapeutic potential of MAM in alleviating colitis, the underlying molecular mechanisms remain largely undefined. This study constructed recombinant plasmids encoding the MAM gene (pILMAM) and corresponding empty vector controls (pILEMPTY), using Lactococcus lactis as a delivery vehicle to investigate the functional role of MAM in a dextran sulfate sodium (DSS)-induced colitis mouse model. The results showed that MAM administration significantly ameliorated colitis symptoms and modulated the expression of key proteins involved in the autophagy pathway. In order to further elucidate the contribution of autophagy to MAM's anti-inflammatory effects, this study employed pharmacological autophagy inhibitors. MAM treatment partially attenuated the exacerbated inflammation induced by autophagy inhibition, suggesting that its therapeutic efficacy may be mediated through the positive regulation of autophagy. In conclusion, this study uncovers a novel mechanism by which MAM promotes intestinal homeostasis and suppresses inflammation through modulation of the gut microbiota and activation of autophagy pathways. These findings provide theoretical insights into the therapeutic potential of F. prausnitzii and its metabolites in IBD treatment and establish a foundation for developing innovative probiotic formulations or targeted therapies for IBD centered on MAM. MATERIALS AND METHODS Animal Model Six- to eight-week-old male C57BL/6 mice were purchased from the Guangdong Medical Laboratory Animal Center (license number: SYXK 2022-0002). The animals were housed under specific pathogen-free (SPF) conditions with a 12-hour light/dark cycle, controlled temperature (24 ± 1°C), and 50%-70% humidity. After one week of acclimatization, acute colitis was induced by administering 3% DSS in drinking water for 7 days. In order to evaluate the therapeutic effects of various interventions, mice were pretreated with the corresponding agents 7 days prior to DSS administration, making the total experimental period 14 days. (1) For evaluating the effects of F prausnitzii and its supernatant, the mice were divided into four groups (n = 6): (i) Normal control, (ii) DSS + phosphate-buffered saline (PBS), (iii) DSS + F prausnitzii , and (iv) DSS + F. prausnitzii supernatant. The treatments were administered via oral gavage at 5 × 10⁹ CFU/mL (100 µL per 10 g body weight). (2) In order to assess the effects of pILMAM, four groups (n = 6 per group) were established: (i) Normal control group, (ii) DSS + PBS group, (iii) DSS + pILMAM group, and (iv) DSS + pILEMPTY group, using the same dosage and administration route. (3) The role of autophagy in the therapeutic effect of pILMAM was explored using five groups (n = 5 per group): (i) Normal control group, (ii) DSS group, (iii) DSS + hydroxychloroquine (HCQ) group, (iv) DSS + HCQ + pILMAM group, and (v) DSS + HCQ + pILEMPTY group, with HCQ administered orally at 40 mg/kg. All procedures were approved by the Animal Ethics Committee of the Second Affiliated Hospital of South China University of Technology (Guangzhou First People's Hospital). Plasmid Construction According to Quévrain et al. [ 10 ], recombinant plasmids containing the MAM gene (pILMAM) and empty control plasmids (pILEMPTY) were constructed and subsequently transformed into Lactococcus lactis MG1363 strain for subsequent animal experiments. Bacterial Culture F prausnitzii (strain A2-165) was derived from the American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured overnight at 37°C in YCFA medium under anaerobic conditions (90% N₂, 5% CO₂, and 5% H₂). Then, F prausnitzii was harvested by centrifugation at 1500 × g for 15 min at 4°C and resuspended in PBS to 5 × 10⁹ CFU/mL. The supernatant was filtered through a 0.22 µm membrane and stored for further use. L. lactis MG1363 strains carrying pILMAM or pILEMPTY were grown overnight at 30°C in MRS broth, harvested by centrifugation, resuspended in PBS, and administered to mice via oral gavage. Disease Activity Index (DAI) Scores Mice were weighed daily, and their weight loss was scored according to the percentage decrease (Table 1 ). Diarrhea severity was assessed based on stool consistency and water content, with scores ranging from 0 to 4. Rectal bleeding was assessed by detecting occult or visible blood in feces and scored from 0 to 4. The overall disease activity index (DAI) was calculated as the average of the three individual scores. Table 1 Disease Activity Index (DAI) Scoring Table[ 19 ] Weight Loss(%) Stool Consistency Occult Blood/Visible Blood in Stool Score 0 Normal (formed stool) Normal 0 ≥ 1 and < 5 Intermediate / 1 ≥ 5 and < 10 Loose (increased water content, not adhering to anus) Occult blood test positive 2 ≥ 10 and < 15 Intermediate / 3 ≥ 15 Watery (adhering to anus) Visible blood 4 Histological Evaluation of Colitis And AB-PAS Staining At the end of the experiment, fresh colon tissues were harvested from each group, rinsed, and fixed in 4% paraformaldehyde solution for 24 hours. The tissues were then dehydrated, embedded, and sectioned into 4 µm slices. Hematoxylin and eosin (H&E) staining was performed to evaluate general histopathological changes. Additionally, Alcian Blue-Periodic Acid Schiff (AB-PAS) staining was conducted to assess mucin production and goblet cell morphology. Histopathological scoring was performed by a blinded observer using a previously established scoring system (Table 2 ). Table 2 Histopathological Scoring [ 20 ] Mucosal Epithelial Damage Inflammatory Cell Infiltration Score No epithelial damage Rare inflammatory cell infiltration in the lamina propria 0 Single epithelial damage Increased inflammatory cells and neutrophil infiltration in the lamina propria 1 Mucosal fusion and ulceration Inflammatory cell infiltration also found in the submucosa 2 Extensive damage involving the entire layer of the mucosal epithelium Full-thickness inflammatory cell infiltration in the submucosa 3 Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR) Total RNA was extracted from colon tissues using Trizol reagent (Takara, Japan) following the manufacturer's instructions. Complementary DNA (cDNA) was synthesized from total RNA using the PrimeScript™ RT Master Mix (Takara, Japan). RT-qPCR was performed to assess the mRNA expression levels of target genes using gene-specific primers listed in Table 3 . Relative mRNA expression was quantified using the comparative cycle threshold method (2⁻ΔΔCt), with Actb (β-actin) as the internal reference gene. Table 3 Primer sequences used for realtime-PCR Primers Sequence ACTB Forward CATTGCTGACAGGATGCAGAAGG Reverse TGCTGGAAGGTGGACAGTGAGG TFF3 Forward TCCAAGCCAATGTATGGTGCCG Reverse CAGGGCACATTTGGGATACTGG Occludin1 Forward TGGCAAGCGATCATACCCAGAG Reverse CTGCCTGAAGTCATCCACACTC MUC2 Forward CCCAGAAGGGACTGTGTATG Reverse TGCAGACACACTGCTCACA ZO-1 Forward GTTGGTACGGTGCCCTGAAAGA Reverse GCTGACAGGTAGGACAGACGAT IL18 Forward GACAGCCTGTGTTCGAGGATATG Reverse TGTTCTTACAGGAGAGGGTAGAC IL6 Forward TACCACTTCACAAGTCGGAGGC Reverse CTGCAAGTGCATCATCGTTGTTC IL1β Forward TGGACCTTCCAGGATGAGGACA Reverse GTTCATCTCGGAGCCTGTAGTG TNF-α Forward TTAGAAAGGGGATTATGGCTCA Reverse ACTCTCCCTTTGCAGAACTCAG Western Blot Analysis Colon protein samples were prepared using RIPA buffer (Beyotime, China) supplemented with a protease inhibitor cocktail (Solarbio, China). Proteins were separated by 10% SDS-PAGE gel and transferred onto a PVDF membrane (Invitrogen, USA). After blocking with 10% non-fat milk for 1 hour at room temperature, membranes were incubated overnight at 4°C with primary antibodies (Table 4 ). After washing, the membrane was incubated with HRP-conjugated secondary antibodies for one hour at room temperature. Protein bands were visualized using an ECL detection kit (Fdbio Science, China), with β-Actin as the internal protein. Densitometric analysis was performed using ImageJ software. Immunohistochemistry (IHC) Paraffin-embedded tissue sections (3 µm) were dewaxed and subjected to antigen retrieval. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide, and the sections were blocked with 3% bovine serum albumin (BSA) before incubation with primary antibodies overnight at 4°C. After secondary antibody incubation conjugated to mouse or rabbit IgG on the following day, immunostaining was visualized using diaminobenzidine (DAB) chromogen, and nuclei were counterstained with hematoxylin. Images were captured under a light microscope and analyzed using Fiji: ImageJ software. Immunofluorescence (IF) The tissue sections were incubated with primary antibodies overnight at 4°C, followed by fluorescent secondary antibodies for 1 hour at room temperature. After PBS washing, sections were mounted with 4',6-diamidino-2-phenylindole (DAPI) to stain nuclei. Fluorescent images were acquired using a fluorescence microscope (Leica, Germany) and analyzed using Fiji: ImageJ software. Table 4 Antibody Details Antibodies SOURCE IDENTIFIER MUC2 Abclonal A4767 Claudin1 Abcam 307692 ZO-1 Abcam 96587 Atg5 CST 12994S Beclin1 Abcam 62557 P62 Abclonal A19700 16S rDNA sequencing for gut microbiota Mouse fecal samples were collected, flash-frozen in liquid nitrogen, and stored at -80°C until further processing. Genomic DNA was extracted using the QIAamp Fast DNA Stool Mini Kit (Qiagen, Cat. No. 51504) following the manufacturer's instructions. PCR reagents were purchased from TOYOBO (Japan). The V3-V4 region of 16S rRNA was amplified using primers 341F (5'-CCTACGGGNGGCWGCAG-3') and 806R (5'-GGACTACHVGGGTATCTAAT-3') and sequenced on the Illumina Novaseq 6000 platform (GENE DENOVO, Guangzhou, China). Bioinformatic analysis was performed using Omicsmart, an interactive real-time online platform for data analysis http://www.omicsmart.com ). Statistical Analysis Unpaired Student's t-test, Wilcox test, or Mann-Whitney test was used for two-group comparisons, while one-way ANOVA, Kruskal-Wallis's test, and Tukey's post hoc test were applied for comparisons among three or more groups. The results were considered statistically significant at P < 0.05 (* P < 0.05, ** P < 0.01, *** P < 0.005, **** P < 0.0001). GraphPad Prism 9.4.0 and SPSS 26 software were employed in all analyses. Results Treatment with F. prausnitzii and its supernatant improves experimental ulcerative colitis in mice Previous studies demonstrated that F. prausnitzii A2-165 and its supernatant effectively ameliorate symptoms of TNBS-induced colitis in mice, including attenuated weight loss and reduced colon inflammation [ 21 ]. Here, we established a mouse model of acute colitis induced by 3% DSS and treated intragastrically with PBS (DSS + PBS), F. prausnitzii (DSS + A2-165), or its supernatant (DSS + A2-165 Sup) as shown in Fig. 1 A. By day 4 post-induction, DSS-treated mice exhibited progressive weight loss and diarrhea. By day 5, a statistically significant difference in body weight was observed between the DSS and control groups (Fig. 1 B), accompanied by hematochezia. Clinical symptoms worsened by days 6 and 7, including lethargy, marked weight loss, severe diarrhea, and bloody stools, leading to significantly elevated Disease Activity Index (DAI) values (Fig. 1 C) and pronounced colon shortening (Fig. 1 D-E). Both F. prausnitzii and its supernatant alleviated weight loss, decreased DAI scores, and mitigated colon shortening. HE staining revealed that DSS-induced colitis was associated with epithelial damage, inflammatory cell infiltration, and goblet cell depletion. These pathological changes were substantially reversed in mice treated with either F. prausnitzii or its supernatant (Fig. 1 F-G). Quantitative PCR analysis indicated upregulation of intestinal barrier-related genes (including TFF3, Occludin1, MUC2, and ZO-1) in both treatment groups (Fig. 1 H), alongside downregulation of pro-inflammatory cytokines IL-18, IL-6, and IL-1β (Fig. 1 I-K). Immunofluorescence analysis corroborated these mRNA findings (Fig. 1 L), supporting the enhancement of intestinal barrier function by both F. prausnitzii and its supernatant (Fig. 1 M). Taken together, these data suggest that both F. prausnitzii and its supernatant confer protection against DSS-induced colitis in mice by reinforcing the intestinal barrier and dampening pro-inflammatory cytokine production. MAM from F. prausnitzii supernatant improves experimental acute colitis in mice E Quévrain et al. [ 10 ] identified MAM (Microbial Anti-Inflammatory Molecule), a 15 kDa protein produced by F. prausnitzii , as a potent anti-inflammatory mediator. This study cloned the MAM-encoding plasmid (pILMAM) into Lactococcus lactis MG1363 and prepared an empty vector control (pILEMPTY) using an identical methodology [ 22 ]. One week prior to the induction of acute colitis with 3% DSS, mice received intragastric administration of L. lactis MG1363 harboring either pILMAM or pILEMPTY. Four days after DSS induction, mice in both the DSS + PBS and DSS + pILEMPTY groups displayed weight loss and diarrhea, whereas those in the DSS + pILMAM group gained weight, with statistically significant differences compared to the other two groups (Fig. 2B). During the entire disease course, the DSS + pILMAM group experienced significantly less weight loss. Consistently, pILMAM administration led to marked improvements in clinical symptoms, including reduced diarrhea and hematochezia, resulting in declined DAI scores (Fig. 2C). Moreover, pILMAM treatment mitigated colon shortening (Fig. 2D-E) and ameliorated histopathological damage, such as epithelial disruption and inflammatory cell infiltration (Fig. 2F-G). mRNA expression levels of pro-inflammatory cytokines IL-6, IL-1β, and TNF-α were reduced in the pILMAM group (Fig. 2H). In parallel, the expression of immune barrier proteins (Claudin1 and MUC2) was upregulated following pILMAM treatment (Fig. 2I-J). Figure 2. pILMAM alleviates DSS-induced colitis in mice. (A) Schematic representation of experimental design. (B) Body weight changes over time in mice. * represents DSS + pILMAM vs DSS + PBS, and # represents DSS + pILMAM vs DSS + pILEMPTY. Data are presented as mean ± SEM (n = 6 per group); (C) Disease Activity Index (DAI) scores of mice in each group over time. (n = 6 per group); (D) Gross appearance of the colon at the end of the experiment. (n = 6 per group); (E) Colon length measurements at the end of the experiment. (n = 6 per group); (F) Histological damage and inflammation scores. (n = 6 per group); (G) Representative images of HE-stained colon sections from each group. Scale bars represent 100 µm; (H) Relative mRNA expression levels of pro-inflammatory cytokines IL-6, IL-1β, and TNF-α in the colon. (n = 4–6 per group); (I) Relative Fluorescence Intensity of Claudin1 and MUC2 in the colon normalized to the control group. (n = 3 per group) (J) Immunofluorescence staining for Claudin1 and MUC2 in colon sections. Blue: DAPI; Green: Claudin1/MUC2. Scale bars represent 100 µm. pILMAM intervention alters gut microbiota composition and increases the abundance of beneficial bacterial genera Dysbiosis of the gut microbiota is a well-established hallmark of ulcerative colitis. In order to evaluate the effect of MAM intervention on the gut microbiota, this study performed 16S rRNA high-throughput sequencing of cecal contents. Venn diagram analysis revealed 1,094 shared operational taxonomic units (OTUs) among all three groups, with 112 OTUs uniquely present in the DSS group and 162 specifics to the pILMAM group. The OTU count significantly increased after pILMAM treatment (Fig. 3 A). Non-metric multidimensional scaling (NMDS) analysis at the OTU level (stress value = 0.070) demonstrated clear separation between groups. The pILMAM group exhibited a notably different microbiota profile compared to the DSS group (Fig. 3 B). The Shannon diversity index was used to assess species richness and evenness of the microbial community. Although the pILMAM group showed an upward trend in the Shannon index, the difference was not statistically significant (Fig. 3 C). At the phylum level, pILMAM administration resulted in an increase in Firmicutes (+ 2.59%) and Bacteroidota (+ 2.75%), alongside a reduction in Verrucomicrobiota (− 4.79%) and Patescibacteria (− 1.2653%) relative to the DSS model group (Fig. 3 D). At the genus level, pILMAM treatment led to decreased relative abundance of Akkermansia (4.782%) and increased levels of Lactobacillus (0.5081%), Lachnospiraceae_NK4A136_group (4.1946%), and Bacteroides (4.2855%) (Fig. 3 E). The Linear Discriminant Analysis (LDA) Effect Size (LEfSe) algorithm with an LDA score threshold of > 3.5 identified significant differences in the relative abundance of key taxonomic groups among cohorts, highlighting distinct microbial signatures associated with disease and therapeutic intervention (Fig. 3 F). Subsequently, this study analyzed the top 10 differentially abundant bacteria at both the family and genus levels. As shown in Fig. 3 G, Bacteroidaceae, Enterobacteriaceae, Lachnospiraceae, Bacteroides , and Lachnospiraceae_NK4A136_group were significantly enriched in the pILMAM-treated group compared to the DSS model group, with statistically significant differences. Among these, the Lachnospiraceae_NK4A136_group has been reported to produce short-chain fatty acids (SCFAs) via fermentation of dietary polysaccharides, exhibiting potential anti-colitis activity. The correlation analysis was performed between the abundance of Lachnospiraceae_NK4A136_group and other parameters, revealing a positive correlation with colon length and body weight and a negative correlation with DAI and histopathological scores (Fig. 3 H). pILMAM regulates the autophagy signaling pathway in experimental colitis Autophagy plays a pivotal role in maintaining intestinal homeostasis and promoting mucosal repair processes [ 12 ]. Previous publication demonstrated that autophagy activity is impaired in colitis, whereas its activation could alleviate inflammation and support intestinal barrier integrity [ 23 ]. Based on these findings, this study investigated whether pILMAM intervention could modulate autophagic responses in a DSS-induced colitis model. Consequently, qPCR was conducted on colon samples, assessing mRNA expression levels of markers associated with autophagy (including mTOR, Atg5, Atg16l1, LC3b, and P62), tight junction proteins (ZO-1, Claudin1, and Occludin), mucin secretion (Relmb, MUC2, and TFF3), and pro-inflammatory cytokines (IL-6, IL-18, IL-1β, and TNF-α) (Fig. 4A). Compared to the DSS model group, pILMAM-treated mice exhibited enhanced expression of barrier-protective and mucin-related genes, downregulation of inflammatory mediators, and upregulation of autophagy-related transcripts. These transcriptional changes were further corroborated by WB (Fig. 4B-E) and IHC (Fig. 4F G) staining, which demonstrated increased expression of autophagy-related proteins in the pILMAM group. These findings suggest that the therapeutic effects of MAM on colitis may be closely associated with the activation of autophagic pathways. Figure 4. pILMAM intervention influences autophagy levels in mice. A. Heatmap analysis of gene expression related to mucin secretion, tight junction proteins, inflammation, and autophagy (n = 5–6 per group); B-D. Quantitative analysis of Atg16L1 (B), P62 (C)and Beclin1 (D) protein levels (n = 3 per group); E. Western blot analysis of Atg16L1, P62, Beclin1, and β-actin protein levels (n = 3 per group); F. Immunohistochemical staining of ATG5 and Beclin1 in colon tissues (n = 3 per group); G. Quantitative analysis of IHC scoring for ATG5 and Beclin1(n = 4–6 per group). pILMAM ameliorates aggravated colitis caused by autophagy inhibition Hydroxychloroquine (HCQ), an antimalarial agent, is widely recognized for its ability to inhibit autophagy in various pathological contexts [ 24 ]. To further elucidate the role of MAM in modulating autophagy in colitis mice, we co-administered HCQ and pILMAM or pILEMPTY to DSS-induced colitis mice and evaluated disease severity across treatment groups. As shown in Fig. 6B and 6C, HCQ treatment exacerbated colitis symptoms, as evidenced by increased weight loss and elevated DAI scores compared to the DSS group. pILMAM administration attenuated HCQ-induced exacerbation of colitis, whereas no protective effect was observed in the pILEMPTY group. Measurements of colon length (Fig. 6D E) and histopathological analysis (Fig. 6F G) revealed that HCQ led to pronounced colon shortening, epithelial damage, and inflammatory infiltration compared to the DSS group, all of which were substantially ameliorated by pILMAM treatment. The mRNA expression of intestinal barrier-related proteins and pro-inflammatory cytokines was further assessed using qPCR. The results verified that pILMAM restored the expression of key barrier proteins and suppressed the HCQ-induced upregulation of IL-6 and TNF-α. These molecular findings were corroborated by immunofluorescence staining, which showed increased expression of Claudin1, MUC2, and ZO-1 in the pILMAM-treated group, indicating enhanced epithelial integrity and barrier function. Taken together, the above data indicate that MAM counteracts HCQ-aggravated colitis by restoring autophagy-mediated intestinal barrier integrity and suppressing inflammation. DISCUSSION F prausnitzii , a gut symbiotic probiotic, has long been the focus of research due to its critical role in maintaining intestinal homeostasis. However, its strict anaerobic nature poses significant challenges for in vitro cultivation, hindering mechanistic studies. F prausnitzii and its metabolites possess potent anti-inflammatory properties with documented therapeutic benefits in IBD models. This study further validated that both whole F prausnitzii and their supernatants effectively alleviate DSS-induced colitis in mice. This is evidenced by reduced body weight loss, improved colon shortening, decreased DAI scores, and enhanced intestinal barrier integrity, consistent with prior findings [ 25 , 26 ]. Among the bioactive components secreted by F. prausnitzii , the MAM protein has recently emerged as a key effector with substantial immunomodulatory activity. It can inhibit aberrant activation of the NF-κB signaling pathway and promote the differentiation of regulatory T cells (Treg), thereby effectively alleviating intestinal inflammation in experimental colitis models [ 27 ]. In this study, by engineering Lactococcus lactis to express the MAM protein and administering it orally, the biological effects of F. prausnitzii supernatant were successfully recapitulated, confirming MAM's central role in IBD treatment [ 27 , 28 ]. In recent years, autophagy has garnered considerable attention as a key regulator of intestinal immune homeostasis and a critical player in IBD pathogenesis. Autophagy contributes to intracellular pathogen clearance, modulates antigen presentation, and influences intestinal barrier integrity and immune signaling through pathways such as NF-κB, mTOR, and AMPK [ 29 , 30 ]. Polymorphisms in autophagy-related genes (including ATG16L2 and LC3) have been associated with increased susceptibility to IBD, suggesting that autophagy dysfunction may be closely related to disease development [ 16 , 31 , 32 ]. This study first demonstrated that the F. prausnitzii -derived MAM protein modulates the autophagy pathway. MAM significantly upregulated the expression of the autophagy marker Beclin1 while reducing P62 levels, indicating its potential to inhibit intestinal inflammation by activating the autophagy pathway. These molecular changes coincided with improved intestinal barrier function and downregulation of pro-inflammatory cytokines, suggesting that MAM may exert anti-inflammatory effects through the activation of autophagy. In order to validate this mechanism, this study employed the autophagy inhibitor HCQ in DSS-induced colitis models. MAM administration partially reversed the disease exacerbation caused by autophagy inhibition, supporting the hypothesis. Beyond its direct immunomodulatory effects, MAM significantly impacts gut microbiota composition. 16S rRNA sequencing revealed that although MAM intervention had a slight effect on α-diversity, it significantly reshaped microbial community structure. In particular, the relative abundance of beneficial bacteria, such as Lactobacillus and Lachnospiraceae_NK4A136_group , increased significantly. Lachnospiraceae_NK4A136_group abundance showed a positive correlation with colon length and body weight and a negative correlation with DAI and histopathological scores, suggesting a potential role in MAM-mediated intestinal protection. These results disclose that MAM can modulate the gut microbiome, providing compelling evidence for "probiotic-microbiota interactions." However, whether MAM exerts its anti-inflammatory effects through a "host-microbiota interaction" network remains an open question. Intestinal homeostasis relies on dynamic equilibrium among intestinal barrier integrity, immune homeostasis, and microbial composition [ 33 , 34 ]. MAM enhances the expression of tight junction proteins and improves intestinal barrier integrity. Meanwhile, it inhibits the release of pro-inflammatory cytokines by activating the autophagy pathway, thereby reshaping the local immune microenvironment. MAM can also foster the proliferation of beneficial bacteria, forming a benign anti-inflammatory milieu. These multidimensional effects synergistically constitute MAM's therapeutic advantages in IBD treatment. In conclusion, this study reveals a novel mechanism by which MAM ameliorates IBD through activation of the autophagy pathway, providing a solid theoretical foundation for the development of precision therapeutics based on F. prausnitzii or its functional components. Engineered probiotics or recombinant protein-based formulations of MAM hold promise as next-generation interventions for IBD and other chronic inflammatory conditions. However, several limitations remain. The precise molecular targets of MAM have yet to be identified, and whether it regulates autophagy through specific receptors or signaling pathways warrants further investigation. Additionally, the differential efficacy of MAM in various IBD subtypes (e.g., ulcerative colitis vs. Crohn's disease), its long-term safety, and translational potential relevance in human subjects require further exploration. Declarations Availability of data and material The data used to support the findings of this study are available in NCBI-SRA under accession number PRJNA1265921 (https://www.ncbi.nlm.nih.gov/sra/?term=PRJNA1265921). Authors' contributions X.G, W.J.C. designed the study and drafted the manuscript; Y.Z, J.X, and J.H. L. performed animal experiments, statistical analysis and interpretation of the data; H.M.X, Y.T.L, Y.C.Z, N.J, Y.Y.L.P participated in animal experiments, recorded general status of experimental animals, collected samples and related tests; T.L.Z, Y.J.Z, Y.Q.N, interpreted the data and revised the manuscript; Y.Q.L, C.H, and Y.J.Z. designed and organized the study, interpreted the data and revised the manuscript. The author(s) read and approved the final manuscript. Funding This work was supported by the grants from the National Natural Science Foundation of China (82370552, 82200574), Natural Science Foundation of Guangdong Province (2023A1515030214), and Guangzhou Key Laboratory of Digestive Diseases (2022–2023) (KY17010003) supported this work. Competing interests The authors declare no competing interests. References Kaser A, Zeissig S, Blumberg RS: Inflammatory bowel disease. Annual Review of Immunology 2010, 28: 573-621. Piovani D, Danese S, Peyrin-Biroulet L, Nikolopoulos GK, Lytras T, Bonovas S: Environmental Risk Factors for Inflammatory Bowel Diseases: An Umbrella Review of Meta-analyses. Gastroenterology 2019, 157 . Khor B, Gardet A, Xavier RJ: Genetics and pathogenesis of inflammatory bowel disease. Nature 2011, 474: 307-317. Yadegar A, Bar-Yoseph H, Monaghan TM, Pakpour S, Severino A, Kuijper EJ, Smits WK, Terveer EM, Neupane S, Nabavi-Rad A, et al: Fecal microbiota transplantation: current challenges and future landscapes. Clinical Microbiology Reviews 2024, 37: e0006022. Jostins L, Ripke S, Weersma RK, Duerr RH, McGovern DP, Hui KY, Lee JC, Schumm LP, Sharma Y, Anderson CA, et al: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. Nature 2012, 491: 119-124. Ni J, Wu GD, Albenberg L, Tomov VT: Gut microbiota and IBD: causation or correlation? Nature Reviews Gastroenterology & Hepatology 2017, 14: 573-584. Sokol H, Pigneur B, Watterlot L, Lakhdari O, Bermúdez-Humarán LG, Gratadoux J-J, Blugeon S, Bridonneau C, Furet J-P, Corthier G, et al: Faecalibacterium prausnitzii is an anti-inflammatory commensal bacterium identified by gut microbiota analysis of Crohn disease patients. Proceedings of the National Academy of Sciences of the United States of America 2008, 105: 16731-16736. Martín R, Rios-Covian D, Huillet E, Auger S, Khazaal S, Bermúdez-Humarán LG, Sokol H, Chatel J-M, Langella P: Faecalibacterium: a bacterial genus with promising human health applications. FEMS Microbiology Reviews 2023, 47 . Mohebali N, Weigel M, Hain T, Sütel M, Bull J, Kreikemeyer B, Breitrück A: Faecalibacterium prausnitzii, Bacteroides faecis and Roseburia intestinalis attenuate clinical symptoms of experimental colitis by regulating Treg/Th17 cell balance and intestinal barrier integrity. Biomedicine & Pharmacotherapy = Biomedecine & Pharmacotherapie 2023, 167: 115568. Quévrain E, Maubert MA, Michon C, Chain F, Marquant R, Tailhades J, Miquel S, Carlier L, Bermúdez-Humarán LG, Pigneur B, et al: Identification of an anti-inflammatory protein from Faecalibacterium prausnitzii, a commensal bacterium deficient in Crohn's disease. Gut 2016, 65: 415-425. Lassen KG, Xavier RJ: Mechanisms and function of autophagy in intestinal disease. Autophagy 2018, 14: 216-220. Foerster EG, Mukherjee T, Cabral-Fernandes L, Rocha JDB, Girardin SE, Philpott DJ: How autophagy controls the intestinal epithelial barrier. Autophagy 2022, 18 . Naama M, Bel S: Autophagy-ER stress crosstalk controls mucus secretion and susceptibility to gut inflammation. Autophagy 2023, 19: 3014-3016. Ke P, Shao B-Z, Xu Z-Q, Chen X-W, Liu C: Intestinal Autophagy and Its Pharmacological Control in Inflammatory Bowel Disease. Frontiers In Immunology 2016, 7: 695. Don Wai Luu L, Kaakoush NO, Castaño-Rodríguez N: The role of ATG16L2 in autophagy and disease. Autophagy 2022, 18: 2537-2546. Wu M-Y, Wang E-J, Ye RD, Lu J-H: Enhancement of LC3-associated efferocytosis for the alleviation of intestinal inflammation. Autophagy 2024, 20: 1442-1443. Subramanian A, Jahabardeen A, Thamaraikani T, Vellapandian C: More on the interplay between gut microbiota, autophagy, and inflammatory bowel disease is needed. World Journal of Gastroenterology 2024, 30: 3356-3360. Kim S, Lee J-Y, Shin SG, Kim JK, Silwal P, Kim YJ, Shin N-R, Kim PS, Won M, Lee S-H, et al: ESRRA (estrogen related receptor alpha) is a critical regulator of intestinal homeostasis through activation of autophagic flux via gut microbiota. Autophagy 2021, 17: 2856-2875. Liu Y-J, Tang B, Wang F-C, Tang L, Lei Y-Y, Luo Y, Huang S-J, Yang M, Wu L-Y, Wang W, et al: Parthenolide ameliorates colon inflammation through regulating Treg/Th17 balance in a gut microbiota-dependent manner. Theranostics 2020, 10: 5225-5241. Wirtz S, Popp V, Kindermann M, Gerlach K, Weigmann B, Fichtner-Feigl S, Neurath MF: Chemically induced mouse models of acute and chronic intestinal inflammation. Nature Protocols 2017, 12: 1295-1309. Zhou Y, Xu H, Xu J, Guo X, Zhao H, Chen Y, Zhou Y, Nie Y: F. prausnitzii and its supernatant increase SCFAs-producing bacteria to restore gut dysbiosis in TNBS-induced colitis. AMB Express 2021, 11: 33. Langella P, Le Loir Y, Ehrlich SD, Gruss A: Efficient plasmid mobilization by pIP501 in Lactococcus lactis subsp. lactis. Journal of Bacteriology 1993, 175: 5806-5813. Guo X, Xu J, Huang C, Zhang Y, Zhao H, Zhu M, Wang J, Nie Y, Xu H, Zhou Y, Zhou Y: Rapamycin extenuates experimental colitis by modulating the gut microbiota. Journal of Gastroenterology and Hepatology 2023, 38: 2130-2141. Ferreira PMP, Sousa RWRd, Ferreira JRdO, Militão GCG, Bezerra DP: Chloroquine and hydroxychloroquine in antitumor therapies based on autophagy-related mechanisms. Pharmacological Research 2021, 168: 105582. Qiu X, Zhang M, Yang X, Hong N, Yu C: Faecalibacterium prausnitzii upregulates regulatory T cells and anti-inflammatory cytokines in treating TNBS-induced colitis. Journal of Crohn's & Colitis 2013, 7: e558-e568. Liu M-C, Shu Y-A, Wang Y-C, Tseng H-Y, Li M-J, Yu Y-T, Cheng H-C, Tsai P-J, Yang Y-J: Faecalibacterium prausnitzii Colonization Attenuates Gut Inflammation and Epithelial Damage in a DSS-Induced Colitis Mice Model. Mediators of Inflammation 2025, 2025: 7280675. Breyner NM, Michon C, de Sousa CS, Vilas Boas PB, Chain F, Azevedo VA, Langella P, Chatel JM: Microbial Anti-Inflammatory Molecule (MAM) from Faecalibacterium prausnitzii Shows a Protective Effect on DNBS and DSS-Induced Colitis Model in Mice through Inhibition of NF- κB Pathway. Frontiers In Microbiology 2017, 8: 114. Xu J, Liang R, Zhang W, Tian K, Li J, Chen X, Yu T, Chen Q: Faecalibacterium prausnitzii-derived microbial anti-inflammatory molecule regulates intestinal integrity in diabetes mellitus mice via modulating tight junction protein expression. Journal of Diabetes 2020, 12: 224-236. Moraes Holst L, Halfvarson J, Carlson M, Hedin C, Kruse R, Lindqvist CM, Bergemalm D, Almér S, Bresso F, Ling Lundström M, et al: Downregulated Mucosal Autophagy, Alpha Kinase-1 and IL-17 Signaling Pathways in Active and Quiescent Ulcerative Colitis. Clinical and Experimental Gastroenterology 2022, 15: 129-144. Yang S, Li F, Lu S, Ren L, Bian S, Liu M, Zhao D, Wang S, Wang J: Ginseng root extract attenuates inflammation by inhibiting the MAPK/NF- κB signaling pathway and activating autophagy and p62-Nrf2-Keap1 signaling in vitro and in vivo. Journal of Ethnopharmacology 2022, 283: 114739. Sazonovs A, Stevens CR, Venkataraman GR, Yuan K, Avila B, Abreu MT, Ahmad T, Allez M, Ananthakrishnan AN, Atzmon G, et al: Large-scale sequencing identifies multiple genes and rare variants associated with Crohn's disease susceptibility. Nature Genetics 2022, 54: 1275-1283. Wu M-Y, Liu L, Wang E-J, Xiao H-T, Cai C-Z, Wang J, Su H, Wang Y, Tan J, Zhang Z, et al: PI3KC3 complex subunit NRBF2 is required for apoptotic cell clearance to restrict intestinal inflammation. Autophagy 2021, 17: 1096-1111. Round JL, Mazmanian SK: The gut microbiota shapes intestinal immune responses during health and disease. Nature Reviews Immunology 2009, 9: 313-323. Chen Y, Cui W, Li X, Yang H: Interaction Between Commensal Bacteria, Immune Response and the Intestinal Barrier in Inflammatory Bowel Disease. Frontiers In Immunology 2021, 12: 761981. Cite Share Download PDF Status: Published Journal Publication published 19 Dec, 2025 Read the published version in Journal of Translational Medicine → Version 1 posted Reviewers agreed at journal 11 Aug, 2025 Reviewers invited by journal 11 Aug, 2025 Editor assigned by journal 15 Jul, 2025 First submitted to journal 14 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7091778","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":498803894,"identity":"31af858c-7aea-4ec7-af2d-d63a2500a8e9","order_by":0,"name":"Xue Guo","email":"","orcid":"","institution":"South China University of Technology School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xue","middleName":"","lastName":"Guo","suffix":""},{"id":498803895,"identity":"e1159781-a53b-4c82-aa61-ef6c5537ef5e","order_by":1,"name":"Wenji Chen","email":"","orcid":"","institution":"South China University of Technology School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Wenji","middleName":"","lastName":"Chen","suffix":""},{"id":498803896,"identity":"468aed0f-7278-41e6-88b6-7f70043016f8","order_by":2,"name":"Yan Zhang","email":"","orcid":"","institution":"South China University of Technology School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Zhang","suffix":""},{"id":498803897,"identity":"feb32947-498e-45ed-8c0e-9c9dd58436f4","order_by":3,"name":"Jing Xu","email":"","orcid":"","institution":"South China University of Technology School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Xu","suffix":""},{"id":498803898,"identity":"f59c83ec-7470-4d9d-91c0-b532684d7e60","order_by":4,"name":"Jianhong Li","email":"","orcid":"","institution":"South China University of Technology School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jianhong","middleName":"","lastName":"Li","suffix":""},{"id":498803899,"identity":"dbff10a8-9fb6-46d0-8e12-5eea648d10d7","order_by":5,"name":"Haoming Xu","email":"","orcid":"","institution":"South China University of Technology School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Haoming","middleName":"","lastName":"Xu","suffix":""},{"id":498803900,"identity":"c9dda638-4e83-4a26-89fe-666fafb0f431","order_by":6,"name":"Yitong Liao","email":"","orcid":"","institution":"South China University of Technology School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yitong","middleName":"","lastName":"Liao","suffix":""},{"id":498803901,"identity":"186e7ab3-8d52-41f5-890f-d7a8ffba8bcc","order_by":7,"name":"Yuchen Zhao","email":"","orcid":"","institution":"South China University of Technology School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yuchen","middleName":"","lastName":"Zhao","suffix":""},{"id":498803902,"identity":"816e1e37-d8e9-4262-bc7f-8d95ebdba3f0","order_by":8,"name":"Na Jin","email":"","orcid":"","institution":"South China University of Technology School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"Jin","suffix":""},{"id":498803903,"identity":"f7d4bcb2-f1a3-4eb8-af1a-3ae73076a92a","order_by":9,"name":"Yunyun Pan Lai","email":"","orcid":"","institution":"South China University of Technology School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yunyun","middleName":"Pan","lastName":"Lai","suffix":""},{"id":498803904,"identity":"fb678bac-1575-40ef-9c60-d068103c70e3","order_by":10,"name":"Leiting Zhang","email":"","orcid":"","institution":"South China University of Technology School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Leiting","middleName":"","lastName":"Zhang","suffix":""},{"id":498803905,"identity":"41cdbbd0-acd7-49cb-9a66-4ab2b033a048","order_by":11,"name":"Yongjian Zhou","email":"","orcid":"","institution":"South China University of Technology School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yongjian","middleName":"","lastName":"Zhou","suffix":""},{"id":498803906,"identity":"2af728dc-4f61-43fc-be7e-ab130d6c37ac","order_by":12,"name":"Yuqiang Nie","email":"","orcid":"","institution":"South China University of Technology School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yuqiang","middleName":"","lastName":"Nie","suffix":""},{"id":498803907,"identity":"a8ff1075-95f6-4aec-8286-e705d4689b40","order_by":13,"name":"Yongqiang Li","email":"","orcid":"","institution":"South China University of Technology School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yongqiang","middleName":"","lastName":"Li","suffix":""},{"id":498803908,"identity":"7f9cd0fe-6668-456e-ac46-61b6897f3a3c","order_by":14,"name":"Chen Huang","email":"","orcid":"","institution":"South China University of Technology School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Chen","middleName":"","lastName":"Huang","suffix":""},{"id":498803909,"identity":"25e48cbc-eb5a-4289-b79e-620c0d693c9e","order_by":15,"name":"Youlian Zhou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBUlEQVRIiWNgGAWjYNCCAgkgwQPEFVABHoJaDGBazgAxG3FaoCYzthGhhV8ix/Axj4GFvDn/2YOPeefVyRvcb2B88LaNQd4chxbJGTnGxjwGEoY7G84lG/NuO2y44RgDs+HcNgagCA4n3cgxkwZqYdxwsMdMmnfbgQSDYwxs0rxtDAkGB7BrsYdqsd9wmAeoZU4dSAv7b3xaDCQgWhI3HANpaWAG28KMT4vEmWfFhnMMJJI3nOExNpxz7LDhzGOJzZJzzkkYbsChhb89eeODNxV1thvOnzF88KamTp7v8OGDH96U2cjjsoVBIMMAXYixAWQ9DvUga44/wC05CkbBKBgFowAEAKT5UsvPHycOAAAAAElFTkSuQmCC","orcid":"","institution":"South China University of Technology School of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Youlian","middleName":"","lastName":"Zhou","suffix":""}],"badges":[],"createdAt":"2025-07-10 10:10:34","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7091778/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7091778/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12967-025-07493-0","type":"published","date":"2025-12-19T15:57:49+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":89397558,"identity":"568bb6bd-3642-42d2-88cf-300523d425b1","added_by":"auto","created_at":"2025-08-19 13:48:31","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1430923,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eF. prausnitzii\u003c/em\u003e and its supernatant alleviate DSS-induced colitis in mice. (A) Schematic representation of the experimental design; (B) Body weight changes over time in mice. Data are presented as mean ± SEM (n = 6 per group); (C) Disease Activity Index (DAI) scores of mice in each group over time. (n = 6 per group); (D) Colon length measurements at the end of the experiment. (n = 6 per group); (E) The gross appearance of the colon in each group of mice; (F) Quantification of histological damage and inflammation scores (n = 6 per group); (G) Representative images of HE-stained colon sections from each group. Scale bars represent 100 μm; (H) Relative mRNA expression levels of barrier proteins TFF3, Occludin1, MUC2, and ZO-1 in the colon. (n = 4-6 per group); (I-K) Relative mRNA expression levels of pro-inflammatory cytokines IL-18, IL-6, and IL-1β in the colon. (n = 4-6 per group); (L) Immunofluorescence staining for MUC2 in colon sections. Blue: DAPI; Green: MUC2. Scale bars represent 100 μm; (M) Relative Fluorescence Intensity of MUC2 in the colon normalized to the control group. (n = 3 per group).\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7091778/v1/c9c3b468c23310caca23167a.png"},{"id":89397559,"identity":"e7d0a46f-66fa-41f3-8d11-b32aad657ed3","added_by":"auto","created_at":"2025-08-19 13:48:31","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1301771,"visible":true,"origin":"","legend":"\u003cp\u003epILMAM alleviates DSS-induced colitis in mice. (A) Schematic representation of experimental design. (B) Body weight changes over time in mice. * represents DSS+pILMAM vs DSS+PBS, and # represents DSS+pILMAM vs DSS+pILEMPTY. Data are presented as mean ± SEM (n = 6 per group); (C) Disease Activity Index (DAI) scores of mice in each group over time. (n = 6 per group); (D) Gross appearance of the colon at the end of the experiment. (n = 6 per group); (E) Colon length measurements at the end of the experiment. (n = 6 per group); (F) Histological damage and inflammation scores. (n = 6 per group); (G) Representative images of HE-stained colon sections from each group. Scale bars represent 100 μm; (H) Relative mRNA expression levels of pro-inflammatory cytokines IL-6, IL-1β, and TNF-α in the colon. (n = 4-6 per group); (I) Relative Fluorescence Intensity of Claudin1 and MUC2 in the colon normalized to the control group. (n = 3 per group) (J) Immunofluorescence staining for Claudin1 and MUC2 in colon sections. Blue: DAPI; Green: Claudin1/MUC2. Scale bars represent 100 μm.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7091778/v1/91c946e7a45c3e4e9c91cdeb.png"},{"id":89398983,"identity":"66635144-180e-442d-adb8-b94a166f51a5","added_by":"auto","created_at":"2025-08-19 13:56:31","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":568932,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of MAM on the gut microbiota and colitis in DSS-induced mice. (A)Venn diagram showing the shared and unique OTUs；(B) NMDS plot based on Bray-Curtis dissimilarity indices of the gut microbiota composition in each group；(C) Shannon diversity index of the gut microbiota in each group. (n = 6 per group); (D) Relative abundance of phylum-level in each group; (E) Relative abundance of genus-level in each group; (F) Cladogram generated by LEfSe analysis; (G) Relative abundance of selected bacteria at the family level and genus level in each group. (n = 4-6 per group); (H) Spearman correlation analysis between the relative abundance of \u003cem\u003eLachnospiraceae_NK4A136_group\u003c/em\u003e and DAI score, weight loss, histological score, and colon length. (n = 5 per group).\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7091778/v1/035d63fffbc7690a3bbb45b4.png"},{"id":89397565,"identity":"403343d8-fbc7-40a3-84cd-6e3f96afad64","added_by":"auto","created_at":"2025-08-19 13:48:31","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1179534,"visible":true,"origin":"","legend":"\u003cp\u003epILMAM intervention influences autophagy levels in mice. A. Heatmap analysis of gene expression related to mucin secretion, tight junction proteins, inflammation, and autophagy (n =5-6 per group); B-D. Quantitative analysis of Atg16L1 (B), P62 (C）and Beclin1 (D) protein levels (n =3 per group); E. Western blot analysis of Atg16L1, P62, Beclin1, and β-actin protein levels (n =3 per group); F. Immunohistochemical staining of ATG5 and Beclin1 in colon tissues (n =3 per group); G. Quantitative analysis of IHC scoring for ATG5 and Beclin1(n =4-6 per group).\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7091778/v1/b7545e0356ddebdffe3be749.png"},{"id":89397563,"identity":"07661d2f-ad77-4bfb-ab75-8410277a0a06","added_by":"auto","created_at":"2025-08-19 13:48:31","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1413445,"visible":true,"origin":"","legend":"\u003cp\u003epILMAM ameliorates aggravated colitis caused by autophagy inhibition. A. Experimental design. Schematic representation of the experimental protocol. (n =5 per group); B. Body weight changes over time in mice. (n = 5 per group); C. Disease Activity Index (DAI). Line graph showing the DAI scores over time in each group. (n = 5 per group); D. Macroscopic assessment of colon length; E. Colon length. Bar graph showing the colon length in each group; F. Histological score. Bar graph showing the histological scores for tissue damage and inflammation infiltration in each group (n = 5 per group); G. Histological analysis. Representative H\u0026amp;E and AB-PAS staining images of colon tissues from each group. Scale bar = 100 μm; H-K. mRNA expression levels of tight junction proteins and inflammatory cytokines. Bar graphs showing the relative mRNA expression levels of Claudin1 (H), ZO-1 (I), IL-6 (J), and TNF-α (K) in each group; L-N. Immunofluorescence staining of tight junction proteins. Representative immunofluorescence images of Claudin1 (L), MUC2 (M), and ZO-1 (N) in colon tissues from each group. Nuclei were stained with DAPI. Scale bar = 50 μm.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7091778/v1/1aa3ec92fdc4f5b9d6aac859.png"},{"id":98815200,"identity":"f310055e-6d88-4345-a796-30210f2d3e56","added_by":"auto","created_at":"2025-12-22 16:14:02","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7677621,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7091778/v1/1092a6d4-ccae-464c-8400-1e2e995365cf.pdf"}],"financialInterests":"","formattedTitle":"MAM secreted by Faecalibacterium prausnitzii ameliorates colitis through activation of autophagy and modulation of gut microbiota","fulltext":[{"header":"Introduction","content":"\u003cp\u003eInflammatory Bowel Disease (IBD), encompassing Crohn\u0026rsquo;s disease (CD) and ulcerative colitis (UC), comprises a group of chronic gastrointestinal disorders characterized by recurrent episodes of intestinal inflammation [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Although the precise etiology of IBD remains elusive, mounting evidence indicates that its pathogenesis involves a complex interplay among environmental triggers, genetic susceptibility, gut microbiota dysbiosis, and immune system dysfunction [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eAdvances in multi-omics technologies, such as metagenomics, transcriptomics, and metabolomics have underscored that the dynamic equilibrium between the host and gut microbiota is essential for maintaining intestinal homeostasis [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/p\u003e\u003cp\u003eDysbiosis, defined as an imbalance in gut microbial composition, is one of the early events in IBD pathogenesis. It can disrupt immune tolerance, promote the overproduction of pro-inflammatory cytokines, and ultimately drive chronic intestinal inflammation [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003cem\u003eFaecalibacterium prausnitzii (F. prausnitzii)\u003c/em\u003e, one of the most abundant commensal bacteria in the healthy human gut, is widely recognized for its beneficial and anti-inflammatory properties[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Numerous studies have reported a significant reduction in \u003cem\u003eF. prausnitzii\u003c/em\u003e abundance in IBD patients, which is negatively correlated with disease severity[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Notably, supplementation with \u003cem\u003eF. prausnitzii\u003c/em\u003e or its supernatant can effectively alleviate experimental colitis in animal models, improving weight loss, lowering histopathological scores, and suppressing pro-inflammatory cytokine expression[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn 2014, E Qu\u0026eacute;vrain et al. identified a 15 kDa protein secreted by \u003cem\u003eF. prausnitzii\u003c/em\u003e, termed Microbial Anti-inflammatory Molecule (MAM). MAM exhibits potent anti-inflammatory activity through inhibition of the NF-κB signaling pathway, thereby significantly reducing intestinal inflammation [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. This discovery shed light on the immunomodulatory mechanisms by which \u003cem\u003eF. prausnitzii\u003c/em\u003e exerts its protective effects in the gut.\u003c/p\u003e\u003cp\u003eAutophagy is essential for maintaining intestinal epithelial integrity and immune homeostasis [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. It regulates various aspects of intestinal physiology, including epithelial renewal, metabolic balance, functions of epithelial subtypes, modulation of inflammatory responses, and defense against pathogens [\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Impaired autophagy has been implicated in IBD pathogenesis, with mutations in autophagy-related genes (e.g., ATG16L2, LC3) identified as genetic risk factors for IBD [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Furthermore, autophagy can influence the composition of gut microbiota, linking host immunity with microbiota. Disruption of this process can lead to microbial imbalance and exacerbate immune dysregulation [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eAlthough previous studies have highlighted the therapeutic potential of MAM in alleviating colitis, the underlying molecular mechanisms remain largely undefined. This study constructed recombinant plasmids encoding the MAM gene (pILMAM) and corresponding empty vector controls (pILEMPTY), using Lactococcus lactis as a delivery vehicle to investigate the functional role of MAM in a dextran sulfate sodium (DSS)-induced colitis mouse model. The results showed that MAM administration significantly ameliorated colitis symptoms and modulated the expression of key proteins involved in the autophagy pathway. In order to further elucidate the contribution of autophagy to MAM's anti-inflammatory effects, this study employed pharmacological autophagy inhibitors. MAM treatment partially attenuated the exacerbated inflammation induced by autophagy inhibition, suggesting that its therapeutic efficacy may be mediated through the positive regulation of autophagy.\u003c/p\u003e\u003cp\u003eIn conclusion, this study uncovers a novel mechanism by which MAM promotes intestinal homeostasis and suppresses inflammation through modulation of the gut microbiota and activation of autophagy pathways. These findings provide theoretical insights into the therapeutic potential of \u003cem\u003eF. prausnitzii\u003c/em\u003e and its metabolites in IBD treatment and establish a foundation for developing innovative probiotic formulations or targeted therapies for IBD centered on MAM.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003eAnimal Model\u003c/p\u003e\u003cp\u003eSix- to eight-week-old male C57BL/6 mice were purchased from the Guangdong Medical Laboratory Animal Center (license number: SYXK 2022-0002). The animals were housed under specific pathogen-free (SPF) conditions with a 12-hour light/dark cycle, controlled temperature (24\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C), and 50%-70% humidity. After one week of acclimatization, acute colitis was induced by administering 3% DSS in drinking water for 7 days. In order to evaluate the therapeutic effects of various interventions, mice were pretreated with the corresponding agents 7 days prior to DSS administration, making the total experimental period 14 days.\u003c/p\u003e\u003cp\u003e(1) For evaluating the effects of \u003cem\u003eF prausnitzii\u003c/em\u003e and its supernatant, the mice were divided into four groups (n\u0026thinsp;=\u0026thinsp;6): (i) Normal control, (ii) DSS\u0026thinsp;+\u0026thinsp;phosphate-buffered saline (PBS), (iii) DSS\u0026thinsp;+\u0026thinsp;\u003cem\u003eF prausnitzii\u003c/em\u003e, and (iv) DSS\u0026thinsp;+\u0026thinsp;\u003cem\u003eF. prausnitzii\u003c/em\u003e supernatant. The treatments were administered via oral gavage at 5 \u0026times; 10⁹ CFU/mL (100 \u0026micro;L per 10 g body weight). (2) In order to assess the effects of pILMAM, four groups (n\u0026thinsp;=\u0026thinsp;6 per group) were established: (i) Normal control group, (ii) DSS\u0026thinsp;+\u0026thinsp;PBS group, (iii) DSS\u0026thinsp;+\u0026thinsp;pILMAM group, and (iv) DSS\u0026thinsp;+\u0026thinsp;pILEMPTY group, using the same dosage and administration route. (3) The role of autophagy in the therapeutic effect of pILMAM was explored using five groups (n\u0026thinsp;=\u0026thinsp;5 per group): (i) Normal control group, (ii) DSS group, (iii) DSS\u0026thinsp;+\u0026thinsp;hydroxychloroquine (HCQ) group, (iv) DSS\u0026thinsp;+\u0026thinsp;HCQ\u0026thinsp;+\u0026thinsp;pILMAM group, and (v) DSS\u0026thinsp;+\u0026thinsp;HCQ\u0026thinsp;+\u0026thinsp;pILEMPTY group, with HCQ administered orally at 40 mg/kg.\u003c/p\u003e\u003cp\u003e All procedures were approved by the Animal Ethics Committee of the Second Affiliated Hospital of South China University of Technology (Guangzhou First People's Hospital).\u003c/p\u003e\u003cp\u003ePlasmid Construction\u003c/p\u003e\u003cp\u003eAccording to Qu\u0026eacute;vrain et al. [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], recombinant plasmids containing the MAM gene (pILMAM) and empty control plasmids (pILEMPTY) were constructed and subsequently transformed into \u003cem\u003eLactococcus lactis\u003c/em\u003e MG1363 strain for subsequent animal experiments.\u003c/p\u003e\u003cp\u003eBacterial Culture\u003c/p\u003e\u003cp\u003e\u003cem\u003eF prausnitzii\u003c/em\u003e (strain A2-165) was derived from the American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured overnight at 37\u0026deg;C in YCFA medium under anaerobic conditions (90% N₂, 5% CO₂, and 5% H₂). Then, \u003cem\u003eF prausnitzii\u003c/em\u003e was harvested by centrifugation at 1500 \u0026times; g for 15 min at 4\u0026deg;C and resuspended in PBS to 5 \u0026times; 10⁹ CFU/mL. The supernatant was filtered through a 0.22 \u0026micro;m membrane and stored for further use.\u003c/p\u003e\u003cp\u003e\u003cem\u003eL. lactis MG1363\u003c/em\u003e strains carrying pILMAM or pILEMPTY were grown overnight at 30\u0026deg;C in MRS broth, harvested by centrifugation, resuspended in PBS, and administered to mice via oral gavage.\u003c/p\u003e\u003cp\u003eDisease Activity Index (DAI) Scores\u003c/p\u003e\u003cp\u003eMice were weighed daily, and their weight loss was scored according to the percentage decrease (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Diarrhea severity was assessed based on stool consistency and water content, with scores ranging from 0 to 4. Rectal bleeding was assessed by detecting occult or visible blood in feces and scored from 0 to 4. The overall disease activity index (DAI) was calculated as the average of the three individual scores.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eDisease Activity Index (DAI) Scoring Table[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eWeight Loss(%)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eStool Consistency\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eOccult Blood/Visible Blood in Stool\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eScore\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNormal (formed stool)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNormal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u0026ge;\u0026thinsp;1 and \u0026lt;\u0026thinsp;5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIntermediate\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u0026ge;\u0026thinsp;5 and \u0026lt;\u0026thinsp;10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLoose (increased water content, not adhering to anus)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eOccult blood test positive\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u0026ge;\u0026thinsp;10 and \u0026lt;\u0026thinsp;15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIntermediate\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u0026ge;\u0026thinsp;15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eWatery (adhering to anus)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eVisible blood\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"4\"\u003eHistological Evaluation of Colitis And AB-PAS Staining\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eAt the end of the experiment, fresh colon tissues were harvested from each group, rinsed, and fixed in 4% paraformaldehyde solution for 24 hours. The tissues were then dehydrated, embedded, and sectioned into 4 \u0026micro;m slices. Hematoxylin and eosin (H\u0026amp;E) staining was performed to evaluate general histopathological changes. Additionally, Alcian Blue-Periodic Acid Schiff (AB-PAS) staining was conducted to assess mucin production and goblet cell morphology. Histopathological scoring was performed by a blinded observer using a previously established scoring system (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eHistopathological Scoring [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMucosal Epithelial Damage\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eInflammatory Cell Infiltration\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eScore\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNo epithelial damage\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRare inflammatory cell infiltration in the lamina propria\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSingle epithelial damage\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIncreased inflammatory cells and neutrophil infiltration in the lamina propria\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMucosal fusion and ulceration\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eInflammatory cell infiltration also found in the submucosa\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eExtensive damage involving the entire layer of the mucosal epithelium\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFull-thickness inflammatory cell infiltration in the submucosa\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"3\"\u003eReverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR)\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eTotal RNA was extracted from colon tissues using Trizol reagent (Takara, Japan) following the manufacturer's instructions. Complementary DNA (cDNA) was synthesized from total RNA using the PrimeScript\u0026trade; RT Master Mix (Takara, Japan). RT-qPCR was performed to assess the mRNA expression levels of target genes using gene-specific primers listed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Relative mRNA expression was quantified using the comparative cycle threshold method (2⁻ΔΔCt), with Actb (β-actin) as the internal reference gene.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences used for realtime-PCR\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimers\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSequence\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eACTB\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCATTGCTGACAGGATGCAGAAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGCTGGAAGGTGGACAGTGAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTFF3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCCAAGCCAATGTATGGTGCCG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAGGGCACATTTGGGATACTGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eOccludin1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGGCAAGCGATCATACCCAGAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGCCTGAAGTCATCCACACTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMUC2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCCAGAAGGGACTGTGTATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGCAGACACACTGCTCACA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eZO-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGTTGGTACGGTGCCCTGAAAGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCTGACAGGTAGGACAGACGAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIL18\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGACAGCCTGTGTTCGAGGATATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGTTCTTACAGGAGAGGGTAGAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIL6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTACCACTTCACAAGTCGGAGGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGCAAGTGCATCATCGTTGTTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIL1β\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGGACCTTCCAGGATGAGGACA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGTTCATCTCGGAGCCTGTAGTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTNF-α\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTAGAAAGGGGATTATGGCTCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACTCTCCCTTTGCAGAACTCAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"3\"\u003eWestern Blot Analysis\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eColon protein samples were prepared using RIPA buffer (Beyotime, China) supplemented with a protease inhibitor cocktail (Solarbio, China). Proteins were separated by 10% SDS-PAGE gel and transferred onto a PVDF membrane (Invitrogen, USA). After blocking with 10% non-fat milk for 1 hour at room temperature, membranes were incubated overnight at 4\u0026deg;C with primary antibodies (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). After washing, the membrane was incubated with HRP-conjugated secondary antibodies for one hour at room temperature. Protein bands were visualized using an ECL detection kit (Fdbio Science, China), with β-Actin as the internal protein. Densitometric analysis was performed using ImageJ software.\u003c/p\u003e\u003cp\u003eImmunohistochemistry (IHC)\u003c/p\u003e\u003cp\u003eParaffin-embedded tissue sections (3 \u0026micro;m) were dewaxed and subjected to antigen retrieval. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide, and the sections were blocked with 3% bovine serum albumin (BSA) before incubation with primary antibodies overnight at 4\u0026deg;C. After secondary antibody incubation conjugated to mouse or rabbit IgG on the following day, immunostaining was visualized using diaminobenzidine (DAB) chromogen, and nuclei were counterstained with hematoxylin. Images were captured under a light microscope and analyzed using Fiji: ImageJ software.\u003c/p\u003e\u003cp\u003eImmunofluorescence (IF)\u003c/p\u003e\u003cp\u003eThe tissue sections were incubated with primary antibodies overnight at 4\u0026deg;C, followed by fluorescent secondary antibodies for 1 hour at room temperature. After PBS washing, sections were mounted with 4',6-diamidino-2-phenylindole (DAPI) to stain nuclei. Fluorescent images were acquired using a fluorescence microscope (Leica, Germany) and analyzed using Fiji: ImageJ software.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eAntibody Details\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibodies\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSOURCE\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eIDENTIFIER\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMUC2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAbclonal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eA4767\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eClaudin1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAbcam\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e307692\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eZO-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAbcam\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e96587\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAtg5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCST\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e12994S\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBeclin1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAbcam\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e62557\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP62\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAbclonal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eA19700\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"3\"\u003e16S rDNA sequencing for gut microbiota\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eMouse fecal samples were collected, flash-frozen in liquid nitrogen, and stored at -80\u0026deg;C until further processing. Genomic DNA was extracted using the QIAamp Fast DNA Stool Mini Kit (Qiagen, Cat. No. 51504) following the manufacturer's instructions. PCR reagents were purchased from TOYOBO (Japan). The V3-V4 region of 16S rRNA was amplified using primers 341F (5'-CCTACGGGNGGCWGCAG-3') and 806R (5'-GGACTACHVGGGTATCTAAT-3') and sequenced on the Illumina Novaseq 6000 platform (GENE DENOVO, Guangzhou, China). Bioinformatic analysis was performed using Omicsmart, an interactive real-time online platform for data analysis \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.omicsmart.com\u003c/span\u003e\u003cspan address=\"http://www.omicsmart.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eUnpaired Student's t-test, Wilcox test, or Mann-Whitney test was used for two-group comparisons, while one-way ANOVA, Kruskal-Wallis's test, and Tukey's post hoc test were applied for comparisons among three or more groups. The results were considered statistically significant at \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 (*\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.005, ****\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). GraphPad Prism 9.4.0 and SPSS 26 software were employed in all analyses.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eTreatment with\u003c/b\u003e \u003cb\u003eF. prausnitzii\u003c/b\u003e \u003cb\u003eand its supernatant improves experimental ulcerative colitis in mice\u003c/b\u003e\u003c/p\u003e\u003cp\u003ePrevious studies demonstrated that \u003cem\u003eF. prausnitzii\u003c/em\u003e A2-165 and its supernatant effectively ameliorate symptoms of TNBS-induced colitis in mice, including attenuated weight loss and reduced colon inflammation [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Here, we established a mouse model of acute colitis induced by 3% DSS and treated intragastrically with PBS (DSS\u0026thinsp;+\u0026thinsp;PBS), \u003cem\u003eF. prausnitzii\u003c/em\u003e (DSS\u0026thinsp;+\u0026thinsp;A2-165), or its supernatant (DSS\u0026thinsp;+\u0026thinsp;A2-165 Sup) as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. By day 4 post-induction, DSS-treated mice exhibited progressive weight loss and diarrhea. By day 5, a statistically significant difference in body weight was observed between the DSS and control groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), accompanied by hematochezia. Clinical symptoms worsened by days 6 and 7, including lethargy, marked weight loss, severe diarrhea, and bloody stools, leading to significantly elevated Disease Activity Index (DAI) values (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC) and pronounced colon shortening (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-E). Both \u003cem\u003eF. prausnitzii\u003c/em\u003e and its supernatant alleviated weight loss, decreased DAI scores, and mitigated colon shortening. HE staining revealed that DSS-induced colitis was associated with epithelial damage, inflammatory cell infiltration, and goblet cell depletion. These pathological changes were substantially reversed in mice treated with either \u003cem\u003eF. prausnitzii\u003c/em\u003e or its supernatant (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF-G). Quantitative PCR analysis indicated upregulation of intestinal barrier-related genes (including TFF3, Occludin1, MUC2, and ZO-1) in both treatment groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH), alongside downregulation of pro-inflammatory cytokines IL-18, IL-6, and IL-1β (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eI-K). Immunofluorescence analysis corroborated these mRNA findings (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eL), supporting the enhancement of intestinal barrier function by both \u003cem\u003eF. prausnitzii\u003c/em\u003e and its supernatant (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eM). Taken together, these data suggest that both \u003cem\u003eF. prausnitzii\u003c/em\u003e and its supernatant confer protection against DSS-induced colitis in mice by reinforcing the intestinal barrier and dampening pro-inflammatory cytokine production.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eMAM from\u003c/b\u003e \u003cb\u003eF. prausnitzii\u003c/b\u003e \u003cb\u003esupernatant improves experimental acute colitis in mice\u003c/b\u003e\u003c/p\u003e\u003cp\u003eE Qu\u0026eacute;vrain et al. [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] identified MAM (Microbial Anti-Inflammatory Molecule), a 15 kDa protein produced by \u003cem\u003eF. prausnitzii\u003c/em\u003e, as a potent anti-inflammatory mediator. This study cloned the MAM-encoding plasmid (pILMAM) into \u003cem\u003eLactococcus lactis\u003c/em\u003e MG1363 and prepared an empty vector control (pILEMPTY) using an identical methodology [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. One week prior to the induction of acute colitis with 3% DSS, mice received intragastric administration of L. lactis MG1363 harboring either pILMAM or pILEMPTY. Four days after DSS induction, mice in both the DSS\u0026thinsp;+\u0026thinsp;PBS and DSS\u0026thinsp;+\u0026thinsp;pILEMPTY groups displayed weight loss and diarrhea, whereas those in the DSS\u0026thinsp;+\u0026thinsp;pILMAM group gained weight, with statistically significant differences compared to the other two groups (Fig.\u0026nbsp;2B). During the entire disease course, the DSS\u0026thinsp;+\u0026thinsp;pILMAM group experienced significantly less weight loss. Consistently, pILMAM administration led to marked improvements in clinical symptoms, including reduced diarrhea and hematochezia, resulting in declined DAI scores (Fig.\u0026nbsp;2C). Moreover, pILMAM treatment mitigated colon shortening (Fig.\u0026nbsp;2D-E) and ameliorated histopathological damage, such as epithelial disruption and inflammatory cell infiltration (Fig.\u0026nbsp;2F-G). mRNA expression levels of pro-inflammatory cytokines IL-6, IL-1β, and TNF-α were reduced in the pILMAM group (Fig.\u0026nbsp;2H). In parallel, the expression of immune barrier proteins (Claudin1 and MUC2) was upregulated following pILMAM treatment (Fig.\u0026nbsp;2I-J).\u003c/p\u003e\u003cp\u003eFigure 2. pILMAM alleviates DSS-induced colitis in mice. (A) Schematic representation of experimental design. (B) Body weight changes over time in mice. * represents DSS\u0026thinsp;+\u0026thinsp;pILMAM vs DSS\u0026thinsp;+\u0026thinsp;PBS, and # represents DSS\u0026thinsp;+\u0026thinsp;pILMAM vs DSS\u0026thinsp;+\u0026thinsp;pILEMPTY. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM (n\u0026thinsp;=\u0026thinsp;6 per group); (C) Disease Activity Index (DAI) scores of mice in each group over time. (n\u0026thinsp;=\u0026thinsp;6 per group); (D) Gross appearance of the colon at the end of the experiment. (n\u0026thinsp;=\u0026thinsp;6 per group); (E) Colon length measurements at the end of the experiment. (n\u0026thinsp;=\u0026thinsp;6 per group); (F) Histological damage and inflammation scores. (n\u0026thinsp;=\u0026thinsp;6 per group); (G) Representative images of HE-stained colon sections from each group. Scale bars represent 100 \u0026micro;m; (H) Relative mRNA expression levels of pro-inflammatory cytokines IL-6, IL-1β, and TNF-α in the colon. (n\u0026thinsp;=\u0026thinsp;4\u0026ndash;6 per group); (I) Relative Fluorescence Intensity of Claudin1 and MUC2 in the colon normalized to the control group. (n\u0026thinsp;=\u0026thinsp;3 per group) (J) Immunofluorescence staining for Claudin1 and MUC2 in colon sections. Blue: DAPI; Green: Claudin1/MUC2. Scale bars represent 100 \u0026micro;m.\u003c/p\u003e\u003cp\u003e\u003cb\u003epILMAM intervention alters gut microbiota composition and increases the abundance of beneficial bacterial genera\u003c/b\u003e\u003c/p\u003e\u003cp\u003eDysbiosis of the gut microbiota is a well-established hallmark of ulcerative colitis. In order to evaluate the effect of MAM intervention on the gut microbiota, this study performed 16S rRNA high-throughput sequencing of cecal contents. Venn diagram analysis revealed 1,094 shared operational taxonomic units (OTUs) among all three groups, with 112 OTUs uniquely present in the DSS group and 162 specifics to the pILMAM group. The OTU count significantly increased after pILMAM treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Non-metric multidimensional scaling (NMDS) analysis at the OTU level (stress value\u0026thinsp;=\u0026thinsp;0.070) demonstrated clear separation between groups. The pILMAM group exhibited a notably different microbiota profile compared to the DSS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The Shannon diversity index was used to assess species richness and evenness of the microbial community. Although the pILMAM group showed an upward trend in the Shannon index, the difference was not statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003eAt the phylum level, pILMAM administration resulted in an increase in \u003cem\u003eFirmicutes\u003c/em\u003e (+\u0026thinsp;2.59%) and \u003cem\u003eBacteroidota\u003c/em\u003e (+\u0026thinsp;2.75%), alongside a reduction in \u003cem\u003eVerrucomicrobiota\u003c/em\u003e (\u0026minus;\u0026thinsp;4.79%) and \u003cem\u003ePatescibacteria\u003c/em\u003e (\u0026minus;\u0026thinsp;1.2653%) relative to the DSS model group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). At the genus level, pILMAM treatment led to decreased relative abundance of \u003cem\u003eAkkermansia\u003c/em\u003e (4.782%) and increased levels of \u003cem\u003eLactobacillus\u003c/em\u003e (0.5081%), \u003cem\u003eLachnospiraceae_NK4A136_group\u003c/em\u003e (4.1946%), and \u003cem\u003eBacteroides\u003c/em\u003e (4.2855%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). The Linear Discriminant Analysis (LDA) Effect Size (LEfSe) algorithm with an LDA score threshold of \u0026gt;\u0026thinsp;3.5 identified significant differences in the relative abundance of key taxonomic groups among cohorts, highlighting distinct microbial signatures associated with disease and therapeutic intervention (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eF).\u003c/p\u003e\u003cp\u003eSubsequently, this study analyzed the top 10 differentially abundant bacteria at both the family and genus levels. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eG, \u003cem\u003eBacteroidaceae, Enterobacteriaceae, Lachnospiraceae, Bacteroides\u003c/em\u003e, and \u003cem\u003eLachnospiraceae_NK4A136_group\u003c/em\u003e were significantly enriched in the pILMAM-treated group compared to the DSS model group, with statistically significant differences. Among these, the \u003cem\u003eLachnospiraceae_NK4A136_group\u003c/em\u003e has been reported to produce short-chain fatty acids (SCFAs) via fermentation of dietary polysaccharides, exhibiting potential anti-colitis activity. The correlation analysis was performed between the abundance of \u003cem\u003eLachnospiraceae_NK4A136_group\u003c/em\u003e and other parameters, revealing a positive correlation with colon length and body weight and a negative correlation with DAI and histopathological scores (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eH).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003epILMAM regulates the autophagy signaling pathway in experimental colitis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAutophagy plays a pivotal role in maintaining intestinal homeostasis and promoting mucosal repair processes [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Previous publication demonstrated that autophagy activity is impaired in colitis, whereas its activation could alleviate inflammation and support intestinal barrier integrity [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Based on these findings, this study investigated whether pILMAM intervention could modulate autophagic responses in a DSS-induced colitis model.\u003c/p\u003e\u003cp\u003eConsequently, qPCR was conducted on colon samples, assessing mRNA expression levels of markers associated with autophagy (including mTOR, Atg5, Atg16l1, LC3b, and P62), tight junction proteins (ZO-1, Claudin1, and Occludin), mucin secretion (Relmb, MUC2, and TFF3), and pro-inflammatory cytokines (IL-6, IL-18, IL-1β, and TNF-α) (Fig.\u0026nbsp;4A). Compared to the DSS model group, pILMAM-treated mice exhibited enhanced expression of barrier-protective and mucin-related genes, downregulation of inflammatory mediators, and upregulation of autophagy-related transcripts.\u003c/p\u003e\u003cp\u003eThese transcriptional changes were further corroborated by WB (Fig.\u0026nbsp;4B-E) and IHC (Fig.\u0026nbsp;4F G) staining, which demonstrated increased expression of autophagy-related proteins in the pILMAM group. These findings suggest that the therapeutic effects of MAM on colitis may be closely associated with the activation of autophagic pathways.\u003c/p\u003e\u003cp\u003eFigure 4. pILMAM intervention influences autophagy levels in mice. A. Heatmap analysis of gene expression related to mucin secretion, tight junction proteins, inflammation, and autophagy (n\u0026thinsp;=\u0026thinsp;5\u0026ndash;6 per group); B-D. Quantitative analysis of Atg16L1 (B), P62 (C)and Beclin1 (D) protein levels (n\u0026thinsp;=\u0026thinsp;3 per group); E. Western blot analysis of Atg16L1, P62, Beclin1, and β-actin protein levels (n\u0026thinsp;=\u0026thinsp;3 per group); F. Immunohistochemical staining of ATG5 and Beclin1 in colon tissues (n\u0026thinsp;=\u0026thinsp;3 per group); G. Quantitative analysis of IHC scoring for ATG5 and Beclin1(n\u0026thinsp;=\u0026thinsp;4\u0026ndash;6 per group).\u003c/p\u003e\u003cp\u003e\u003cb\u003epILMAM ameliorates aggravated colitis caused by autophagy inhibition\u003c/b\u003e\u003c/p\u003e\u003cp\u003eHydroxychloroquine (HCQ), an antimalarial agent, is widely recognized for its ability to inhibit autophagy in various pathological contexts [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. To further elucidate the role of MAM in modulating autophagy in colitis mice, we co-administered HCQ and pILMAM or pILEMPTY to DSS-induced colitis mice and evaluated disease severity across treatment groups. As shown in Fig.\u0026nbsp;6B and 6C, HCQ treatment exacerbated colitis symptoms, as evidenced by increased weight loss and elevated DAI scores compared to the DSS group. pILMAM administration attenuated HCQ-induced exacerbation of colitis, whereas no protective effect was observed in the pILEMPTY group. Measurements of colon length (Fig.\u0026nbsp;6D E) and histopathological analysis (Fig.\u0026nbsp;6F G) revealed that HCQ led to pronounced colon shortening, epithelial damage, and inflammatory infiltration compared to the DSS group, all of which were substantially ameliorated by pILMAM treatment.\u003c/p\u003e\u003cp\u003eThe mRNA expression of intestinal barrier-related proteins and pro-inflammatory cytokines was further assessed using qPCR. The results verified that pILMAM restored the expression of key barrier proteins and suppressed the HCQ-induced upregulation of IL-6 and TNF-α. These molecular findings were corroborated by immunofluorescence staining, which showed increased expression of Claudin1, MUC2, and ZO-1 in the pILMAM-treated group, indicating enhanced epithelial integrity and barrier function. Taken together, the above data indicate that MAM counteracts HCQ-aggravated colitis by restoring autophagy-mediated intestinal barrier integrity and suppressing inflammation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003e\u003cem\u003eF prausnitzii\u003c/em\u003e, a gut symbiotic probiotic, has long been the focus of research due to its critical role in maintaining intestinal homeostasis. However, its strict anaerobic nature poses significant challenges for in vitro cultivation, hindering mechanistic studies. \u003cem\u003eF prausnitzii\u003c/em\u003e and its metabolites possess potent anti-inflammatory properties with documented therapeutic benefits in IBD models. This study further validated that both whole \u003cem\u003eF prausnitzii\u003c/em\u003e and their supernatants effectively alleviate DSS-induced colitis in mice. This is evidenced by reduced body weight loss, improved colon shortening, decreased DAI scores, and enhanced intestinal barrier integrity, consistent with prior findings [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eAmong the bioactive components secreted by \u003cem\u003eF. prausnitzii\u003c/em\u003e, the MAM protein has recently emerged as a key effector with substantial immunomodulatory activity. It can inhibit aberrant activation of the NF-κB signaling pathway and promote the differentiation of regulatory T cells (Treg), thereby effectively alleviating intestinal inflammation in experimental colitis models [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn this study, by engineering Lactococcus lactis to express the MAM protein and administering it orally, the biological effects of \u003cem\u003eF. prausnitzii\u003c/em\u003e supernatant were successfully recapitulated, confirming MAM's central role in IBD treatment [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn recent years, autophagy has garnered considerable attention as a key regulator of intestinal immune homeostasis and a critical player in IBD pathogenesis. Autophagy contributes to intracellular pathogen clearance, modulates antigen presentation, and influences intestinal barrier integrity and immune signaling through pathways such as NF-κB, mTOR, and AMPK [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Polymorphisms in autophagy-related genes (including ATG16L2 and LC3) have been associated with increased susceptibility to IBD, suggesting that autophagy dysfunction may be closely related to disease development [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThis study first demonstrated that the \u003cem\u003eF. prausnitzii\u003c/em\u003e-derived MAM protein modulates the autophagy pathway. MAM significantly upregulated the expression of the autophagy marker Beclin1 while reducing P62 levels, indicating its potential to inhibit intestinal inflammation by activating the autophagy pathway. These molecular changes coincided with improved intestinal barrier function and downregulation of pro-inflammatory cytokines, suggesting that MAM may exert anti-inflammatory effects through the activation of autophagy. In order to validate this mechanism, this study employed the autophagy inhibitor HCQ in DSS-induced colitis models. MAM administration partially reversed the disease exacerbation caused by autophagy inhibition, supporting the hypothesis.\u003c/p\u003e\u003cp\u003eBeyond its direct immunomodulatory effects, MAM significantly impacts gut microbiota composition. 16S rRNA sequencing revealed that although MAM intervention had a slight effect on α-diversity, it significantly reshaped microbial community structure. In particular, the relative abundance of beneficial bacteria, such as \u003cem\u003eLactobacillus\u003c/em\u003e and \u003cem\u003eLachnospiraceae_NK4A136_group\u003c/em\u003e, increased significantly. \u003cem\u003eLachnospiraceae_NK4A136_group\u003c/em\u003e abundance showed a positive correlation with colon length and body weight and a negative correlation with DAI and histopathological scores, suggesting a potential role in MAM-mediated intestinal protection. These results disclose that MAM can modulate the gut microbiome, providing compelling evidence for \"probiotic-microbiota interactions.\" However, whether MAM exerts its anti-inflammatory effects through a \"host-microbiota interaction\" network remains an open question.\u003c/p\u003e\u003cp\u003eIntestinal homeostasis relies on dynamic equilibrium among intestinal barrier integrity, immune homeostasis, and microbial composition [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. MAM enhances the expression of tight junction proteins and improves intestinal barrier integrity. Meanwhile, it inhibits the release of pro-inflammatory cytokines by activating the autophagy pathway, thereby reshaping the local immune microenvironment. MAM can also foster the proliferation of beneficial bacteria, forming a benign anti-inflammatory milieu. These multidimensional effects synergistically constitute MAM's therapeutic advantages in IBD treatment.\u003c/p\u003e\u003cp\u003eIn conclusion, this study reveals a novel mechanism by which MAM ameliorates IBD through activation of the autophagy pathway, providing a solid theoretical foundation for the development of precision therapeutics based on \u003cem\u003eF. prausnitzii\u003c/em\u003e or its functional components. Engineered probiotics or recombinant protein-based formulations of MAM hold promise as next-generation interventions for IBD and other chronic inflammatory conditions. However, several limitations remain. The precise molecular targets of MAM have yet to be identified, and whether it regulates autophagy through specific receptors or signaling pathways warrants further investigation. Additionally, the differential efficacy of MAM in various IBD subtypes (e.g., ulcerative colitis vs. Crohn's disease), its long-term safety, and translational potential relevance in human subjects require further exploration.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data used to support the findings of this study are available in NCBI-SRA under accession number PRJNA1265921 (https://www.ncbi.nlm.nih.gov/sra/?term=PRJNA1265921).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eX.G, W.J.C. designed the study and drafted the manuscript; Y.Z, J.X, and J.H. L. performed animal experiments, statistical analysis and interpretation of the data; \u0026nbsp; H.M.X, Y.T.L, Y.C.Z, N.J, Y.Y.L.P \u0026nbsp;participated in animal experiments, recorded general status of experimental animals, collected samples and related tests; T.L.Z, Y.J.Z, Y.Q.N, interpreted the data and revised the manuscript; Y.Q.L, C.H, and Y.J.Z. designed and organized the study, interpreted the data and revised the manuscript. The author(s) read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the grants from the National Natural Science Foundation of China (82370552, 82200574), Natural Science Foundation of Guangdong Province (2023A1515030214), and Guangzhou Key Laboratory of Digestive Diseases (2022\u0026ndash;2023) (KY17010003) supported this work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKaser A, Zeissig S, Blumberg RS: \u003cstrong\u003eInflammatory bowel disease.\u003c/strong\u003e \u003cem\u003eAnnual Review of Immunology \u003c/em\u003e2010, \u003cstrong\u003e28:\u003c/strong\u003e573-621.\u003c/li\u003e\n\u003cli\u003ePiovani D, Danese S, Peyrin-Biroulet L, Nikolopoulos GK, Lytras T, Bonovas S: \u003cstrong\u003eEnvironmental Risk Factors for Inflammatory Bowel Diseases: An Umbrella Review of Meta-analyses.\u003c/strong\u003e \u003cem\u003eGastroenterology \u003c/em\u003e2019, \u003cstrong\u003e157\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eKhor B, Gardet A, Xavier RJ: \u003cstrong\u003eGenetics and pathogenesis of inflammatory bowel disease.\u003c/strong\u003e \u003cem\u003eNature \u003c/em\u003e2011, \u003cstrong\u003e474:\u003c/strong\u003e307-317.\u003c/li\u003e\n\u003cli\u003eYadegar A, Bar-Yoseph H, Monaghan TM, Pakpour S, Severino A, Kuijper EJ, Smits WK, Terveer EM, Neupane S, Nabavi-Rad A, et al: \u003cstrong\u003eFecal microbiota transplantation: current challenges and future landscapes.\u003c/strong\u003e \u003cem\u003eClinical Microbiology Reviews \u003c/em\u003e2024, \u003cstrong\u003e37:\u003c/strong\u003ee0006022.\u003c/li\u003e\n\u003cli\u003eJostins L, Ripke S, Weersma RK, Duerr RH, McGovern DP, Hui KY, Lee JC, Schumm LP, Sharma Y, Anderson CA, et al: \u003cstrong\u003eHost-microbe interactions have shaped the genetic architecture of inflammatory bowel disease.\u003c/strong\u003e \u003cem\u003eNature \u003c/em\u003e2012, \u003cstrong\u003e491:\u003c/strong\u003e119-124.\u003c/li\u003e\n\u003cli\u003eNi J, Wu GD, Albenberg L, Tomov VT: \u003cstrong\u003eGut microbiota and IBD: causation or correlation?\u003c/strong\u003e \u003cem\u003eNature Reviews Gastroenterology \u0026amp; Hepatology \u003c/em\u003e2017, \u003cstrong\u003e14:\u003c/strong\u003e573-584.\u003c/li\u003e\n\u003cli\u003eSokol H, Pigneur B, Watterlot L, Lakhdari O, Berm\u0026uacute;dez-Humar\u0026aacute;n LG, Gratadoux J-J, Blugeon S, Bridonneau C, Furet J-P, Corthier G, et al: \u003cstrong\u003eFaecalibacterium prausnitzii is an anti-inflammatory commensal bacterium identified by gut microbiota analysis of Crohn disease patients.\u003c/strong\u003e \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America \u003c/em\u003e2008, \u003cstrong\u003e105:\u003c/strong\u003e16731-16736.\u003c/li\u003e\n\u003cli\u003eMart\u0026iacute;n R, Rios-Covian D, Huillet E, Auger S, Khazaal S, Berm\u0026uacute;dez-Humar\u0026aacute;n LG, Sokol H, Chatel J-M, Langella P: \u003cstrong\u003eFaecalibacterium: a bacterial genus with promising human health applications.\u003c/strong\u003e \u003cem\u003eFEMS Microbiology Reviews \u003c/em\u003e2023, \u003cstrong\u003e47\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eMohebali N, Weigel M, Hain T, S\u0026uuml;tel M, Bull J, Kreikemeyer B, Breitr\u0026uuml;ck A: \u003cstrong\u003eFaecalibacterium prausnitzii, Bacteroides faecis and Roseburia intestinalis attenuate clinical symptoms of experimental colitis by regulating Treg/Th17 cell balance and intestinal barrier integrity.\u003c/strong\u003e \u003cem\u003eBiomedicine \u0026amp; Pharmacotherapy = Biomedecine \u0026amp; Pharmacotherapie \u003c/em\u003e2023, \u003cstrong\u003e167:\u003c/strong\u003e115568.\u003c/li\u003e\n\u003cli\u003eQu\u0026eacute;vrain E, Maubert MA, Michon C, Chain F, Marquant R, Tailhades J, Miquel S, Carlier L, Berm\u0026uacute;dez-Humar\u0026aacute;n LG, Pigneur B, et al: \u003cstrong\u003eIdentification of an anti-inflammatory protein from Faecalibacterium prausnitzii, a commensal bacterium deficient in Crohn\u0026apos;s disease.\u003c/strong\u003e \u003cem\u003eGut \u003c/em\u003e2016, \u003cstrong\u003e65:\u003c/strong\u003e415-425.\u003c/li\u003e\n\u003cli\u003eLassen KG, Xavier RJ: \u003cstrong\u003eMechanisms and function of autophagy in intestinal disease.\u003c/strong\u003e \u003cem\u003eAutophagy \u003c/em\u003e2018, \u003cstrong\u003e14:\u003c/strong\u003e216-220.\u003c/li\u003e\n\u003cli\u003eFoerster EG, Mukherjee T, Cabral-Fernandes L, Rocha JDB, Girardin SE, Philpott DJ: \u003cstrong\u003eHow autophagy controls the intestinal epithelial barrier.\u003c/strong\u003e \u003cem\u003eAutophagy \u003c/em\u003e2022, \u003cstrong\u003e18\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eNaama M, Bel S: \u003cstrong\u003eAutophagy-ER stress crosstalk controls mucus secretion and susceptibility to gut inflammation.\u003c/strong\u003e \u003cem\u003eAutophagy \u003c/em\u003e2023, \u003cstrong\u003e19:\u003c/strong\u003e3014-3016.\u003c/li\u003e\n\u003cli\u003eKe P, Shao B-Z, Xu Z-Q, Chen X-W, Liu C: \u003cstrong\u003eIntestinal Autophagy and Its Pharmacological Control in Inflammatory Bowel Disease.\u003c/strong\u003e \u003cem\u003eFrontiers In Immunology \u003c/em\u003e2016, \u003cstrong\u003e7:\u003c/strong\u003e695.\u003c/li\u003e\n\u003cli\u003eDon Wai Luu L, Kaakoush NO, Casta\u0026ntilde;o-Rodr\u0026iacute;guez N: \u003cstrong\u003eThe role of ATG16L2 in autophagy and disease.\u003c/strong\u003e \u003cem\u003eAutophagy \u003c/em\u003e2022, \u003cstrong\u003e18:\u003c/strong\u003e2537-2546.\u003c/li\u003e\n\u003cli\u003eWu M-Y, Wang E-J, Ye RD, Lu J-H: \u003cstrong\u003eEnhancement of LC3-associated efferocytosis for the alleviation of intestinal inflammation.\u003c/strong\u003e \u003cem\u003eAutophagy \u003c/em\u003e2024, \u003cstrong\u003e20:\u003c/strong\u003e1442-1443.\u003c/li\u003e\n\u003cli\u003eSubramanian A, Jahabardeen A, Thamaraikani T, Vellapandian C: \u003cstrong\u003eMore on the interplay between gut microbiota, autophagy, and inflammatory bowel disease is needed.\u003c/strong\u003e \u003cem\u003eWorld Journal of Gastroenterology \u003c/em\u003e2024, \u003cstrong\u003e30:\u003c/strong\u003e3356-3360.\u003c/li\u003e\n\u003cli\u003eKim S, Lee J-Y, Shin SG, Kim JK, Silwal P, Kim YJ, Shin N-R, Kim PS, Won M, Lee S-H, et al: \u003cstrong\u003eESRRA (estrogen related receptor alpha) is a critical regulator of intestinal homeostasis through activation of autophagic flux via gut microbiota.\u003c/strong\u003e \u003cem\u003eAutophagy \u003c/em\u003e2021, \u003cstrong\u003e17:\u003c/strong\u003e2856-2875.\u003c/li\u003e\n\u003cli\u003eLiu Y-J, Tang B, Wang F-C, Tang L, Lei Y-Y, Luo Y, Huang S-J, Yang M, Wu L-Y, Wang W, et al: \u003cstrong\u003eParthenolide ameliorates colon inflammation through regulating Treg/Th17 balance in a gut microbiota-dependent manner.\u003c/strong\u003e \u003cem\u003eTheranostics \u003c/em\u003e2020, \u003cstrong\u003e10:\u003c/strong\u003e5225-5241.\u003c/li\u003e\n\u003cli\u003eWirtz S, Popp V, Kindermann M, Gerlach K, Weigmann B, Fichtner-Feigl S, Neurath MF: \u003cstrong\u003eChemically induced mouse models of acute and chronic intestinal inflammation.\u003c/strong\u003e \u003cem\u003eNature Protocols \u003c/em\u003e2017, \u003cstrong\u003e12:\u003c/strong\u003e1295-1309.\u003c/li\u003e\n\u003cli\u003eZhou Y, Xu H, Xu J, Guo X, Zhao H, Chen Y, Zhou Y, Nie Y: \u003cstrong\u003eF. prausnitzii and its supernatant increase SCFAs-producing bacteria to restore gut dysbiosis in TNBS-induced colitis.\u003c/strong\u003e \u003cem\u003eAMB Express \u003c/em\u003e2021, \u003cstrong\u003e11:\u003c/strong\u003e33.\u003c/li\u003e\n\u003cli\u003eLangella P, Le Loir Y, Ehrlich SD, Gruss A: \u003cstrong\u003eEfficient plasmid mobilization by pIP501 in Lactococcus lactis subsp. lactis.\u003c/strong\u003e \u003cem\u003eJournal of Bacteriology \u003c/em\u003e1993, \u003cstrong\u003e175:\u003c/strong\u003e5806-5813.\u003c/li\u003e\n\u003cli\u003eGuo X, Xu J, Huang C, Zhang Y, Zhao H, Zhu M, Wang J, Nie Y, Xu H, Zhou Y, Zhou Y: \u003cstrong\u003eRapamycin extenuates experimental colitis by modulating the gut microbiota.\u003c/strong\u003e \u003cem\u003eJournal of Gastroenterology and Hepatology \u003c/em\u003e2023, \u003cstrong\u003e38:\u003c/strong\u003e2130-2141.\u003c/li\u003e\n\u003cli\u003eFerreira PMP, Sousa RWRd, Ferreira JRdO, Milit\u0026atilde;o GCG, Bezerra DP: \u003cstrong\u003eChloroquine and hydroxychloroquine in antitumor therapies based on autophagy-related mechanisms.\u003c/strong\u003e \u003cem\u003ePharmacological Research \u003c/em\u003e2021, \u003cstrong\u003e168:\u003c/strong\u003e105582.\u003c/li\u003e\n\u003cli\u003eQiu X, Zhang M, Yang X, Hong N, Yu C: \u003cstrong\u003eFaecalibacterium prausnitzii upregulates regulatory T cells and anti-inflammatory cytokines in treating TNBS-induced colitis.\u003c/strong\u003e \u003cem\u003eJournal of Crohn\u0026apos;s \u0026amp; Colitis \u003c/em\u003e2013, \u003cstrong\u003e7:\u003c/strong\u003ee558-e568.\u003c/li\u003e\n\u003cli\u003eLiu M-C, Shu Y-A, Wang Y-C, Tseng H-Y, Li M-J, Yu Y-T, Cheng H-C, Tsai P-J, Yang Y-J: \u003cstrong\u003eFaecalibacterium prausnitzii Colonization Attenuates Gut Inflammation and Epithelial Damage in a DSS-Induced Colitis Mice Model.\u003c/strong\u003e \u003cem\u003eMediators of Inflammation \u003c/em\u003e2025, \u003cstrong\u003e2025:\u003c/strong\u003e7280675.\u003c/li\u003e\n\u003cli\u003eBreyner NM, Michon C, de Sousa CS, Vilas Boas PB, Chain F, Azevedo VA, Langella P, Chatel JM: \u003cstrong\u003eMicrobial Anti-Inflammatory Molecule (MAM) from Faecalibacterium prausnitzii Shows a Protective Effect on DNBS and DSS-Induced Colitis Model in Mice through Inhibition of NF-\u003c/strong\u003e\u003cstrong\u003e\u0026kappa;B Pathway.\u003c/strong\u003e \u003cem\u003eFrontiers In Microbiology \u003c/em\u003e2017, \u003cstrong\u003e8:\u003c/strong\u003e114.\u003c/li\u003e\n\u003cli\u003eXu J, Liang R, Zhang W, Tian K, Li J, Chen X, Yu T, Chen Q: \u003cstrong\u003eFaecalibacterium prausnitzii-derived microbial anti-inflammatory molecule regulates intestinal integrity in diabetes mellitus mice via modulating tight junction protein expression.\u003c/strong\u003e \u003cem\u003eJournal of Diabetes \u003c/em\u003e2020, \u003cstrong\u003e12:\u003c/strong\u003e224-236.\u003c/li\u003e\n\u003cli\u003eMoraes Holst L, Halfvarson J, Carlson M, Hedin C, Kruse R, Lindqvist CM, Bergemalm D, Alm\u0026eacute;r S, Bresso F, Ling Lundstr\u0026ouml;m M, et al: \u003cstrong\u003eDownregulated Mucosal Autophagy, Alpha Kinase-1 and IL-17 Signaling Pathways in Active and Quiescent Ulcerative Colitis.\u003c/strong\u003e \u003cem\u003eClinical and Experimental Gastroenterology \u003c/em\u003e2022, \u003cstrong\u003e15:\u003c/strong\u003e129-144.\u003c/li\u003e\n\u003cli\u003eYang S, Li F, Lu S, Ren L, Bian S, Liu M, Zhao D, Wang S, Wang J: \u003cstrong\u003eGinseng root extract attenuates inflammation by inhibiting the MAPK/NF-\u003c/strong\u003e\u003cstrong\u003e\u0026kappa;B signaling pathway and activating autophagy and p62-Nrf2-Keap1 signaling in vitro and in vivo.\u003c/strong\u003e \u003cem\u003eJournal of Ethnopharmacology \u003c/em\u003e2022, \u003cstrong\u003e283:\u003c/strong\u003e114739.\u003c/li\u003e\n\u003cli\u003eSazonovs A, Stevens CR, Venkataraman GR, Yuan K, Avila B, Abreu MT, Ahmad T, Allez M, Ananthakrishnan AN, Atzmon G, et al: \u003cstrong\u003eLarge-scale sequencing identifies multiple genes and rare variants associated with Crohn\u0026apos;s disease susceptibility.\u003c/strong\u003e \u003cem\u003eNature Genetics \u003c/em\u003e2022, \u003cstrong\u003e54:\u003c/strong\u003e1275-1283.\u003c/li\u003e\n\u003cli\u003eWu M-Y, Liu L, Wang E-J, Xiao H-T, Cai C-Z, Wang J, Su H, Wang Y, Tan J, Zhang Z, et al: \u003cstrong\u003ePI3KC3 complex subunit NRBF2 is required for apoptotic cell clearance to restrict intestinal inflammation.\u003c/strong\u003e \u003cem\u003eAutophagy \u003c/em\u003e2021, \u003cstrong\u003e17:\u003c/strong\u003e1096-1111.\u003c/li\u003e\n\u003cli\u003eRound JL, Mazmanian SK: \u003cstrong\u003eThe gut microbiota shapes intestinal immune responses during health and disease.\u003c/strong\u003e \u003cem\u003eNature Reviews Immunology \u003c/em\u003e2009, \u003cstrong\u003e9:\u003c/strong\u003e313-323.\u003c/li\u003e\n\u003cli\u003eChen Y, Cui W, Li X, Yang H: \u003cstrong\u003eInteraction Between Commensal Bacteria, Immune Response and the Intestinal Barrier in Inflammatory Bowel Disease.\u003c/strong\u003e \u003cem\u003eFrontiers In Immunology \u003c/em\u003e2021, \u003cstrong\u003e12:\u003c/strong\u003e761981.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-translational-medicine","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jtrm","sideBox":"Learn more about [Journal of Translational Medicine](http://translational-medicine.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/jtrm/default.aspx","title":"Journal of Translational Medicine","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Faecalibacterium prausnitzii, MAM, Autophagy, Gut microbiota","lastPublishedDoi":"10.21203/rs.3.rs-7091778/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7091778/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective:\u003c/h2\u003e\u003cp\u003e\u003cem\u003eFaecalibacterium prausnitzii\u003c/em\u003e is a major commensal bacterium that contributes to intestinal homeostasis. Its secreted microbial anti-inflammatory molecule (MAM) has been identified as a potential therapeutic agent for inflammatory bowel disease (IBD). However, the underlying molecular mechanisms through which MAM exerts its beneficial effects remain incompletely understood. This study aimed to investigate whether MAM modulates autophagy and to evaluate its therapeutic potential in a murine model of colitis.\u003c/p\u003e\u003ch2\u003eMethods:\u003c/h2\u003e\u003cp\u003eA genetically engineered \u003cem\u003eLactococcus lactis\u003c/em\u003e strain expressing MAM was administered to mice with dextran sulfate sodium (DSS)-induced colitis. The therapeutic effects of MAM were evaluated by clinical scoring, histopathological analysis, and measurement of inflammatory cytokines. Intestinal barrier function was assessed by measuring tight junction protein expression. Autophagy-related signaling pathways were analyzed using Western blotting and immunohistochemistry. Gut microbiota composition was profiled via 16S rRNA sequencing. To assess the role of autophagy in MAM-mediated protection, an autophagy inhibitor was administered to a subset of DSS-treated mice.\u003c/p\u003e\u003ch2\u003eResults:\u003c/h2\u003e\u003cp\u003eMAM treatment significantly alleviated DSS-induced colitis, as indicated by reduced disease activity index (DAI), improved histopathological scores, and decreased levels of pro-inflammatory cytokines such as TNF-α and IL-6. MAM enhanced intestinal barrier integrity by upregulating ZO-1 and occludin. Mechanistically, MAM modulated key autophagy-related proteins, including P62 and Beclin-1. Notably, even under conditions of autophagy inhibition, MAM retained partial anti-inflammatory effects, suggesting that its therapeutic action is not solely dependent on autophagy. Furthermore, 16S rRNA sequencing revealed that MAM treatment enriched beneficial taxa such as \u003cem\u003eLactobacillus\u003c/em\u003e and \u003cem\u003eLachnospiraceae_NK4A136_group\u003c/em\u003e, indicating a potential role in microbiota remodeling.\u003c/p\u003e\u003ch2\u003eConclusion:\u003c/h2\u003e\u003cp\u003eThis study identifies MAM as a multifunctional microbial effector with potent anti-inflammatory properties. Through dual mechanisms involving modulation of autophagy and gut microbiota composition, MAM improves intestinal barrier function and attenuates experimental colitis. These findings highlight the translational potential of MAM and support further investigation into its use as a novel therapeutic strategy for IBD.\u003c/p\u003e","manuscriptTitle":"MAM secreted by Faecalibacterium prausnitzii ameliorates colitis through activation of autophagy and modulation of gut microbiota","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-19 13:48:26","doi":"10.21203/rs.3.rs-7091778/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-08-11T13:21:36+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-11T13:15:55+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-15T13:55:40+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Translational Medicine","date":"2025-07-14T07:22:49+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-translational-medicine","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jtrm","sideBox":"Learn more about [Journal of Translational Medicine](http://translational-medicine.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/jtrm/default.aspx","title":"Journal of Translational Medicine","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a9011a08-6528-4034-8e86-35766f3a434a","owner":[],"postedDate":"August 19th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-12-22T16:11:33+00:00","versionOfRecord":{"articleIdentity":"rs-7091778","link":"https://doi.org/10.1186/s12967-025-07493-0","journal":{"identity":"journal-of-translational-medicine","isVorOnly":false,"title":"Journal of Translational Medicine"},"publishedOn":"2025-12-19 15:57:49","publishedOnDateReadable":"December 19th, 2025"},"versionCreatedAt":"2025-08-19 13:48:26","video":"","vorDoi":"10.1186/s12967-025-07493-0","vorDoiUrl":"https://doi.org/10.1186/s12967-025-07493-0","workflowStages":[]},"version":"v1","identity":"rs-7091778","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7091778","identity":"rs-7091778","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}