Exercise Attenuates Obesity-Related Cognitive and Sleep-Circadian Dysfunctions by Attenuating Neuroinflammation via JAK/STAT in Sex and Age Specific Manner

Exercise Attenuates Obesity-Related Cognitive and Sleep-Circadian Dysfunctions by Attenuating Neuroinflammation via JAK/STAT in Sex and Age Specific Manner | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Exercise Attenuates Obesity-Related Cognitive and Sleep-Circadian Dysfunctions by Attenuating Neuroinflammation via JAK/STAT in Sex and Age Specific Manner Girish Melkani, Archana Yadav, Morgan Barkley, John Watson, Dev Patel, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8563103/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Genetic obesity is an escalating health challenge with profound consequences for brain function, yet the mechanisms linking metabolic dysfunction to disrupted brain aging remain poorly understood. Although sphingolipid dysmetabolism is strongly associated with the obesity–neuronal axis, its mechanistic basis has not been fully explored. To address this gap, our study identifies a loss-of-function mutation in sphingosine kinase 2 ( Sk2 ), the Drosophila ortholog of human sphingosine kinase 2 (SPHK2), as a key driver of obesity-associated neural dysfunction and evaluates the ability of exercise to mitigate these effects. We demonstrate that Sk2-driven obesity results in cognitive decline characterized by impaired memory, lipid dysregulation, chronic neuroinflammation, and disrupted sleep–circadian rhythms in a sex- and tissue-specific manner. Importantly, we show that exercise acts as a robust therapeutic intervention, reversing memory deficits, restoring brain lipid homeostasis, and normalizing sleep–circadian activity. Mechanistically, our findings identify the JAK/STAT signaling pathway as a critical mediator of exercise-induced neuroprotection, linking reduced neuroinflammation with enhanced cognitive resilience. Notably, we uncover distinct sex- and age-dependent differences in both obesity-induced impairments and responsiveness to exercise, indicating divergent regulatory mechanisms between males and females. Together, these findings establish a novel link between genetic obesity, brain dysfunction, and lifestyle-based interventions, highlighting exercise as a promising non-pharmacological strategy to counteract obesity-associated neurocognitive and circadian disturbances. Biological sciences/Physiology/Metabolism/Metabolic diseases/Obesity Biological sciences/Neuroscience/Cognitive neuroscience/Cognitive control Genetic obesity cognitive dysfunction sleep/circadian activity neuroinflammation exercise Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Obesity is a major global health challenge that accelerates age related decline in brain function. Among the most harmful effects are cognitive decline and circadian rhythm disruption, which raise the risk of neurodegenerative diseases and lower quality of life in older adults ( 1 ). These changes not only compromise quality of life in older adults but also impose a significant societal burden ( 2 ). The prevalence of obesity is expected to rise sharply: by 2035, more than half of the world's population will be overweight or obese, potentially affecting over 4 billion people, which is like the COVID-19 pandemic. Approximately 16% of adults were obese as of 2022, and since 1990, adult obesity has more than doubled globally (World Health Organization; 2022; Obesity and overweight, World Obesity Federation; 2023; World Obesity Atlas 2023. Report). A rise in obesity-related morbidity coincides with this growing obesity issue. The risk of type 2 diabetes, cardiovascular disease, non-alcoholic fatty liver disease, and several types of cancer is greatly increased by excess adiposity ( 3 – 5 ). These illnesses are caused by endothelial dysfunction, insulin resistance, dysregulated adipokine signaling, and chronic inflammation ( 3 – 5 ). These pathological alterations worsen the decline in brain health by causing systemic metabolic imbalance ( 3 – 5 ). Genome-wide association studies (GWAS) have identified many single-nucleotide polymorphisms (SNPs) associated with obesity-related traits, highlighting a strong genetic link between obesity susceptibility, sleep/wake cycle regulation, and metabolic control ( 6 ). Despite these insights, the mechanistic basis by which obesity interacts with aging to influence brain function remains incompletely understood. Circadian rhythm disruption is a critical but underexplored consequence of obesity and aging. The circadian system orchestrates daily cycles of sleep, feeding, and hormonal regulation, maintaining metabolic and cognitive homeostasis. Obesity-induced alterations in circadian signaling impair sleep quality, disrupt neuronal plasticity, and exacerbate neuroinflammation, creating a vicious cycle that accelerates cognitive decline ( 7 ). Importantly, memory processes are tightly regulated by circadian rhythms: circadian misalignment adversely affects hippocampal synaptic plasticity and impairs learning and memory performance ( 8 – 10 ). Population-based studies have also demonstrated that insufficient sleep or poor sleep quality is associated with a heightened risk of developing metabolic and neurological disorders ( 11 , 12 ). Studies in humans and model organisms reveal that circadian misalignment increases vulnerability to metabolic disorders and neurodegenerative conditions, yet the molecular pathways linking these processes remain poorly defined. One emerging mechanism involves sphingolipid metabolism, a critical regulator of cellular signaling and energy balance. The Drosophila melanogaster Sk2 gene encodes sphingosine kinase 2, which converts sphingosine to sphingosine-1-phosphate (S1P), regulating lipid metabolism and energy balance. Mutations like Sk2 KG050894 lead to obesity-like traits, including fat accumulation and hyperphagia ( 13 ) ( 14 ). Recent studies demonstrate that, Sk2 mutants also exhibit muscle dysfunction and metabolic impairment, which can be rescued by time-restricted feeding (TRF), highlighting the interplay between sphingolipid signaling, circadian rhythms, and energy homeostasis ( 14 , 15 ). Its human ortholog, sphingosine kinase 2 ( SPHK2) , similarly regulates S1P levels. SPHK2 is expressed in adipose tissue and brain, and functional studies in mammals show that Sphk2 knockout mice are protected against age-related obesity and insulin resistance, while pharmacological inhibition reduces neuroinflammation in diet-induced obesity models ( 16 , 17 ). Several loci from GWAS and eQTL analyses revealed the linkage of SPHK2 to obesity, type 2 diabetes, and metabolic dysfunction ( 18 ) ( https://www.gtexportal.org/home/gene/SPHK2 ). These findings, combined with adipose eQTL colocalization frameworks, suggest SPHK2 as a mechanistic contributor to cardiometabolic traits even when single-locus GWAS signals are modest. The conserved enzymatic function between Sk2 and SPHK2 highlights a shared evolutionary mechanism in lipid signaling, making both genes valuable models for studying obesity-related disorders and potential therapeutic interventions. Moreover, memory loss and dementia, especially among middle-aged individuals, have been strongly associated with obesity, however, there is no model exist for unraveling the mechanistic basis of this linkage ( 19 – 21 ). Obesity-driven metabolic dysfunction is further associated with chronic low-grade inflammation, which disrupts systemic homeostasis and may contribute to cognitive decline and dementia ( 22 , 23 ). Inflammatory signaling in adipose tissue can impair insulin sensitivity, alter lipid metabolism, and promote neuroinflammation, yet the precise pathways connecting these processes to cognitive impairment remain elusive. Neuroinflammation, characterized by microglial activation and cytokine release, is increasingly recognized as a driver of synaptic dysfunction and memory loss in aging brain ( 24 ). These processes may be amplified by obesity, creating a synergistic effect that accelerates neurodegeneration. Lifestyle interventions such as exercise offer a promising strategy to counteract these detrimental effects. Exercise is widely recognized as a potent modulator of aging trajectories, improving metabolic health, reducing inflammation, and enhancing cognitive resilience in humans and model organisms ( 25 ) ( 26 ). In Drosophila , endurance exercise has been shown to improve cardiac performance, climbing ability, and stress resistance, paralleling mammalian adaptations ( 27 ). Exercise also influences mitochondrial biogenesis, lipid metabolism, and neuronal signaling, mechanisms that may mitigate obesity-induced dysfunction ( 28 ). However, exercise responses are not uniform: they vary by sex, age, and genetic background. Males often exhibit stronger training adaptations than females, partly due to differences in octopaminergic signaling and energy metabolism ( 29 ). Age further modulates these effects, with younger flies displaying greater exercise-induced benefits compared to older cohorts ( 30 , 31 ). Despite these observations, few studies have systematically examined how exercise interacts with sex, age, and genetic predisposition in the context of obesity and neurodegeneration. Drosophila provides an ideal model for addressing these questions. Its short lifespan, well-characterized genetics, and conserved metabolic pathways make it a powerful system for aging research ( 32 , 33 ). The availability of exercise paradigms such as rotational or negative geotaxis-based training enables controlled studies of endurance exercise in flies, allowing researchers to dissect molecular and physiological adaptations with precision. Moreover, sex-specific, and age-dependent differences in exercise response can be readily assessed, offering insights into biological variability that are difficult to capture in mammalian models. Here, we address this critical gap by investigating the impact of endurance exercise on metabolic and functional traits in male and female Drosophila across two age groups (3 and 6 weeks), comparing Canton-S controls to Sk2 mutants. Specifically, we aim to determine whether exercise mitigates obesity-like phenotypes in Sk2 mutants, how sex and age influence susceptibility to exercise benefits, and which sex is more vulnerable to metabolic and functional decline without exercise. By integrating genetic, behavioral, and physiological analyses, our study provides novel insights into the interplay between lifestyle interventions, genetic risk, and biological sex in shaping aging trajectories. These findings have broad implications for understanding obesity-related cognitive decline and identifying targeted strategies to promote healthy aging. Material and methods Drosophila models and diets Canton-S and Sphingosine kinase 2 ( Sk2 BDSC: 14133) were obtained from Bloomington Drosophila Stock Center (BDSC) and maintained at 25°C. Sk2 is a Drosophila ortholog of human Sphingosine kinase 1. Sk2 loss-of-function mutant has been used in previous obesity-related studies in Drosophila and has demonstrated to lead to accumulation of ceramide, implicated to contributing towards obesity ( 14 , 15 , 34 ). Flies were maintained on a standard regular diet: agar 11 g/L, active dry yeast 30 g/L, yellow cornmeal 55 g/L, molasses 72 mL/L, 10% nipagen 8 mL/L, and propionic acid 6 mL/L. Flies were housed at 25°C, 50% humidity in a 12-h light/12-h dark (LD) cycle and changed to new food every 3–4 days. Olfaction aversion training assay Flies were trained using the olfactory aversive conditioning method as outlined previously ( 35 – 37 ). The flies were exposed to two neutral odors, 3-octanol and 4-methylcyclohexanol, diluted to 1/10 in mineral oil. A 100 V, 90 Hz electrical shock was used as a reinforcer. The conditioning was conducted in a T-maze apparatus (CelExplorer Labs). The olfactory aversive conditioning procedure included three phases: naïve, training, and testing. In the naïve phase, flies were exposed to both odors for 3 minutes and 30 seconds to assess their odor preference based on the chamber in which the odor was presented. During a single training round, flies were exposed to one odor paired with the electrical shock for 2 minutes, followed by 2 minutes of exposure to the other odor without shock. The electrical shock was paired with the fly’s preferred odor, as determined in the naïve phase. After three rounds of training, flies were given a 10-minute recovery period. In the testing phase, flies were given 3 minutes and 30 seconds to choose between the two odor chambers. After this time, the T-maze chambers were sealed, and the number of flies in each chamber was recorded. A performance index (PI) was calculated based on the flies' avoidance of the odor associated with the shock. To validate these results, a sensory acuity test was performed using avoidance index calculations as previously described. Cytological analysis To assess the effects of exercise on CS and Sk2 flies, the procedure was conducted as previously described ( 38 – 40 ). Fly heads were exercised under a dissecting microscope and fixed in 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) for 15 minutes at room temperature with gentle agitation. The heads were then washed three times for 10 minutes in PBS. Following this, they were submerged in a 10% sucrose solution in PBS before being placed into molds with approximately 50% Optimal Cutting Temperature (OCT) compound. After freezing, samples were sectioned at 20µm using a Leica CM3050 S cryostat and mounted on glass slides. After a 30-minute drying period, the slides were washed with PBS and blocked with 3% BSA in TBS for 30 minutes. The slides were incubated overnight at 4°C with a primary synapsin antibody (1:500), followed by washing and incubation with an AlexaFluor-594 anti-mouse secondary antibody (1:1000) for 1 hour at room temperature. After washing, slides were mounted with ProLong Diamond Antifade Mountant containing DAPI. Fluorescence images were captured using an Olympus BX63F fluorescence microscope and analyzed with CellSens software at 10× magnification. Lipid accumulation was quantified by splitting images into TRITC (lipids) and DAPI (nuclei) channels. Regions of interest (ROIs) were drawn around the brain excluding the optic lobes, and Nile Red staining intensity was measured using ImageJ. Synapsin immunofluorescence intensity was quantified in FIJI software, with background fluorescence subtracted. Multiple sections per fly were imaged, and the mean fluorescence was calculated. Sleep/circadian activity We examined the sleep activity and fragmentation patterns of Drosophila under a 12-hour light, 12-hour dark (LD) cycle. Individual flies were monitored using the Drosophila Activity Monitoring System (DAM, TriKinetics Inc MA, USA). We used 3-week-old male and female progeny of CS and Sk2 with or without exercise. For analysis, we employed a machine learning-based app developed to seamlessly process the DAM data, enabling accurate measurements of sleep bouts, bout lengths, and frequency. Drosophila sleep was defined by a period of at least 5 minutes of inactivity, demonstrated by zero beam breaks recorded. Average sleep per 24 hours (Zeitgeber Time (ZT) is a standardized way of measuring time within a circadian cycle, where ZT0 represents the beginning of the light phase and ZT12 marks the start of the dark phase), of each genotype, was calculated. Five days were used for analysis of 3-week-old flies. Real-time quantitative PCR The heads of 3-week-old flies were carefully isolated and promptly frozen ( 38 ). RNA was extracted using the Zymo Research Quick-RNA Microprep Kit, which included an on-column DNase I digestion step to ensure RNA purity. Quantitative PCR was carried out with the Sso Advanced Universal SYBR Green Supermix from Bio-Rad, utilizing the BIO-RAD CFX Opus Real-Time PCR System. Gene expression levels were normalized to the 60S ribosomal protein (RPL11) as the reference. Three biological replicates were performed, each containing 8–10 flies. Primers for qPCR are listed below: Upd1-F: CAGCGCACGTGAAATAGCAT; Upd1-R: CGAGTCCTGAGGTAAGGGGA; Upd2-F: AGCGTCGTGATGCCATTCA; Upd2-R: GCGATACGGATTGACATCGAA; Upd3-F: ATCCCCTGAAGCACCTACAGA; Upd3-R: CAGTCCAGATGCGTACTGCTG; Hop-F: CACCACCAACACCAATTC; Hop-R: GGAACGTCGTTTGGCCTTCT; Stat92e-F: CCTCGGTATGGTCACACCC; Stat92e-R: TGCCAAACTCATTGAGGGACT; Eiger-F: GATGGTCTGGATTCCATTGC; Eiger-R: TAGTCTGCGCCAACATCATC; Reaper-F: TGGCATTCTACATACCCGATCA; Reaper-R: CCAGGAATCTCCACTGTGACT; Hid-F: CACCGACCAAGTGCTATACG; Hid-R: GGCGGATACTGGAAGATTTGC; Rpl11-F: CGATCTGGGCATCAAGTACGA; Rpl11-R: TTGCGCTTCCTGTGGTTCAC; Results are presented as 2 − ΔΔCt values normalized to the expression of Rpl11 and control samples. All reactions were performed in triplicate. Statistical analysis Significance in sleep activity and qPCR gene analysis was determined using Two-way ANOVA with multiple comparisons tukey’s test. Lipid droplets count and area differences were performed by two-way ANOVA with multiple comparisons tukey’s test. Bar graphs show mean ± SEM. All statistical analyses were performed with Graph Pad Prism 10. Results Exercise counteracts obesity-linked lipid and synaptic dysregulation in a sex- and age-dependent manner Immunofluorescence imaging revealed striking sex-, and age-specific differences in brain lipid distribution and synaptic marker expression under exercise and non-exercise conditions (Fig. 1 a–i) in Drosophila . Sk2 mutants exhibited markedly higher lipid accumulation in head and less in brain, and elevated synapsin intensity compared to Canton-S (CS) controls under non-exercise conditions ( Fig. 1 a-f ). , confirming obesity-linked metabolic and synaptic dysregulation ( 13 ). These changes were evident at both 3 and 6 weeks, indicating that Sk2 mutation accelerates lipid deposition and synaptic remodeling during aging. Exercise significantly changed these alterations, but the magnitude and nature of improvement varied by sex, age, and brain region. At 3 weeks, male Sk2 mutants showed a pronounced decrease in lipid object counts in the brain compared to CS controls, while head lipid counts remained unchanged ( Fig. 1 c, e ) . In contrast, non-exercised Sk2 females displayed higher lipid object count in head but no change in brain relative to controls, suggesting sex-specific vulnerability to Sk2 -induced lipid dysregulation ( Fig. 2 a-f ) . Exercise induced distinct remodeling patterns: in males, endurance training reduced brain lipid object counts and increased object area in both head and brain, indicating redistribution of lipid stores rather than complete clearance. In females, exercise alter lipid object counts but did not alter lipid object area in the head and brain, suggesting structural reorganization of lipid deposits rather than reduction in number. Age further modulated these effects. At 6 weeks, lipid accumulation intensified in Sk2 mutants of both sexes, with males showing greater brain lipid burden than females. Exercise remained effective in reducing lipid object counts in older males ( Fig. 2 c, e ) ., though improvements were smaller than at 3 weeks, consistent with age-related decline in exercise responsiveness ( 30 , 31 ). In females, exercise continued to primarily increase lipid object area without reducing counts, reinforcing persistent sex-specific differences in lipid remodeling with age ( Fig. 2 c, e ) . Synaptic marker regulation also differed by sex. Synapsin intensity was significantly elevated in Sk2 mutant males under NE conditions compared to CS controls ( Fig. 1 i ) , consistent with obesity-linked synaptic dysregulation. Exercise reduced synapsin levels in males, suggesting partial restoration of synaptic homeostasis. In contrast, females exhibited no significant changes in synapsin expression across genotypes or exercise conditions, indicating either synaptic stability or compensatory regulation under metabolic stress ( Fig. 2 i ) . These findings align with previous reports that endurance exercise improves brain lipid metabolism and synaptic health in aging flies ( 41 ) and highlight sex-dependent differences in exercise benefits ( 29 , 42 ). Collectively, these results demonstrate that endurance exercise mitigates obesity-associated lipid and synaptic alterations in Drosophila , with distinct sex- and age-dependent patterns of brain remodeling. Males exhibit greater exercise-induced reductions in lipid counts and synapsin intensity, while females show structural remodeling of lipid deposits without major changes in synaptic markers, underscoring the complexity of sex-specific responses to metabolic stress and physical activity. Exercise modulates peripheral lipid and synaptic expression in obese flies To assess whether these effects were brain-specific or reflected systemic responses, we examined lipid and structural markers in the thorax and abdomen. In Sk2 mutant males, exercise significantly reduced elevated lipid object counts in both regions, with no change in area, suggesting modulation of lipid load without altering droplet size (Supplementary Fig. 1a-j) . In females, lipid counts, and area were elevated in the thorax and reduced with exercise, while no changes were observed in the abdomen, indicating limited plasticity (Supplementary Fig. 2a-j) . Lipid intensity in the thorax was decreased under exercised conditions in male (Supplementary Fig. 1e). Given synapsin’s presence in neuromuscular junctions and gut ( 43 , 44 ), we also analyzed peripheral tissues. Synapsin was elevated in the thorax and abdomen of Sk2 males but reduced by exercise only in the thorax, indicating region-specific normalization (Supplementary Fig. 1f, j) . In females, synapsin in the thorax followed similar patterns, both elevated in Sk2 mutants and reduced with exercise, while remaining unchanged in the abdomen at 3 weeks (Supplementary Fig. 2f, j) . By 6 weeks, these exercise-driven effects were reduced or absent, reinforcing the notion of an early developmental window for exercise-induced plasticity. Sex comparisons revealed that females generally exhibited higher lipid intensity and synaptic marker levels in the abdomen under enriched conditions at 3 weeks compared to males, suggesting a greater responsiveness to exercise during early development. These observations are consistent with reports that sex hormones modulate lipid metabolism and synaptic plasticity, influencing responsiveness to environmental stimuli. Mechanistically, exercise may stimulate lipid metabolism and synaptic plasticity in peripheral regions through systemic metabolic signaling and neuromuscular activity, which enhance mitochondrial function and neuroplasticity. Exercise attenuates neuroinflammation and apoptotic signaling in Sk2 mutants: Sex- and age-dependent effects qPCR analysis revealed that Sk2 mutants exhibit a pronounced neuroinflammatory profile characterized by elevated expression of cytokines (upd1, and upd3) and JAK/STAT signaling components ( Hop, Stat ), along with the pro-inflammatory marker (Eiger) and pro-apoptotic gene hid compared to CS controls (Fig. 3 a-l). These changes were evident at both 3 and 6 weeks, indicating that obesity accelerates inflammatory and apoptotic signaling in the brain ( 13 , 14 ). Notably, the magnitude of dysregulation was greater in females than males, particularly at 6 weeks, where Sk2 NE females showed dramatic upregulation of upd genes and JAK/STAT components (Fig. 3 a-f), suggesting heightened vulnerability to chronic inflammation with age ( 42 ). Exercise significantly mitigated these effects in both sexes, but the response was stronger in females. In Sk2 females, exercise reduced expression of upd1 and upd3 and JAK/STAT components by 50–70% at 6 weeks, while also lowering Eiger and apoptotic markers (Fig. 3 a–f). In males, exercise produced moderate reductions in upd genes and Eiger at 3 weeks, with smaller effects at 6 weeks (Fig. 3 g-l). These findings suggest that exercise exerts a neuroprotective effect by suppressing inflammatory cytokine signaling and apoptosis, with greater efficacy in females and during later life stages ( 41 ). Mechanistically, the stronger female response may reflect sex-specific differences in immune regulation and metabolic stress adaptation, as previously reported in Drosophila models ( 29 , 42 ). The age-dependent attenuation of exercise benefits in males aligns with evidence that chronic obesity and aging impair stress resilience and signaling plasticity ( 30 , 31 ). Interestingly, the observed increase in upd3 expression in thoracic tissue following exercise (Supplementary Fig. 3a–l) may indicate a JAK/STAT-mediated regenerative response linked to muscle remodeling and systemic metabolic adaptation ( 14 ). Exercise mitigates cognitive deficits in Sk2 mutants To assess cognitive dysfunction in obese flies, we evaluated olfactory aversion learning. Non-exercised Sk2 mutants exhibited pronounced impairments in short-term learning and memory at both 3 and 6 weeks, as shown by reduced performance indices in aversive conditioning assays and decision-making tasks ( Fig. 4 a-h ). These deficits were accompanied by odor avoidance impairments, indicating compromised cognitive flexibility ( Fig. 4 c, d, g, h ) . Exercise intervention significantly rescued these deficits, restoring memory retention and avoidance behavior to levels comparable to Canton-S (CS) controls. Improvements were observed in both sexes, but females demonstrated greater benefits at 6 weeks, particularly in odor avoidance and decision-making tasks ( Fig. 4 c, d, g, h ) . These cognitive improvements are likely mediated by exercise-induced enhancements in sleep architecture and circadian stability. Sleep plays a critical role in memory acquisition and consolidation in Drosophila , and sleep deprivation disrupts these ( 45 , 46 ). Exercise stabilizes circadian rhythms, increases total sleep, and reduces fragmentation in aging flies, which supports memory consolidation ( 41 , 47 ). Furthermore, circadian disruption impairs memory consolidation, highlighting the importance of rhythmicity for cognitive resilience ( 48 ). Our findings align with these studies, suggesting that exercise mitigates obesity-driven cognitive decline by improving sleep–wake regulation and reducing circadian misalignment. This dual benefit, enhanced sleep continuity and restored memory performance, underscores the systemic role of exercise in promoting neurobehavioral health during aging. These findings suggest that obesity driven by Sk2 -mediated metabolic dysfunction increases the risk of cognitive deficits, particularly in learning-memory tasks. This aligns with human studies linking midlife obesity to increased susceptibility to cognitive decline and neurodegenerative disorders ( 19 , 21 ). Effects of obesity and exercise on sleep-circadian cycle To investigate the effects of obesity on sleep architecture and circadian activity, we utilized Canton-S (CS) flies and Sk2 m utants, a genetic model of obesity ( 14 , 34 ) in age and sex-dependent manner. Sleep and activity patterns were monitored under a 12-hour light/12-hour dark cycle using standard Drosophila activity monitoring protocols ( 14 , 34 ). Three-week-old male Sk2 mutant flies showed disrupted sleep and activity patterns compared to controls, with reduced total sleep, decreased daytime sleep, and increased nighttime sleep (Fig. 5 a-f). Daytime activity was markedly elevated, indicating circadian rhythm disruption, and sleep architecture was fragmented, as shown by shorter bout lengths (Supplementary Fig. 5a-f). These findings align with previous reports linking obesity and circadian misalignment in flies ( 49 ). Exercise produced modest improvements at 3 weeks. Exercised Sk2 males showed partial restoration of daytime sleep compared to non-exercised (NE) groups (Fig. 5 a-c), although night sleep remained unchanged. Activity counts decreased slightly in exercise groups, particularly during the day, while night activity was unaffected (Fig. 5 d-f). Sleep fragmentation indices improved marginally, with exercised Sk2 males exhibiting longer bout lengths than NE counterparts (Fig. 5 g-i, Supplementary Fig. 4d-f), suggesting limited early-life exercise benefits. By 6 weeks, exercise effects were diminished. Sleep duration (total, day, night) did not differ significantly between E and NE groups, and activity counts dropped only slightly, particularly night activity in Sk2-E males sleep (Fig. 5 a-f). Fragmentation indices improved marginally in Sk2-E males during daytime, indicating some stabilization of sleep continuity with age (Fig. 5 g-i). Overall, the graphs show that at 3 weeks, Sk2-NE males had significantly lower total and daytime sleep compared to CS-NE , while exercise partially restored daytime sleep. Bout length data reveal that Sk2-NE males exhibited shorter bouts at both ages, reflecting fragmented sleep, and exercise improved bout length modestly at 3 weeks but not at 6 weeks. Female Sk2 mutants displayed similar circadian disruptions to males, with more sleep occurring at night than during the day, shorter sleep bouts, and increased fragmentation compared to CS controls (Fig. 6 a–i, Supplementary Fig. 4g-l). Females slept less overall than males but exhibited comparable activity patterns, characterized by higher daytime activity and lower nighttime activity under NE conditions (Fig. 6 a-f ) Exercise produced more pronounced benefits in females than in males. At 3 weeks, exercise significantly increased total sleep and daytime sleep in both CS and Sk2 females, with the largest improvement observed in Sk2 mutants. Night sleep also increased with exercise at both time points. Activity counts decreased in exercised females, particularly during the day, and night activity dropped sharply at 6 weeks, especially in Sk2 females (Fig. 6 a-f ) . Sleep fragmentation indices were significantly lower in exercised females compared to NE groups, with Sk2 females showing the greatest reduction at 6 weeks (Fig. 6 g-i ) , indicating improved sleep continuity. Under NE conditions, Sk2 females exhibited higher fragmentation and lower activity than CS, but exercise mitigated these differences. These findings are consistent with previous reports that endurance exercise improves sleep–wake stability and reduces fragmentation in aging Drosophila , particularly in females ( 41 , 47 ). Moreover, sex-dependent differences in sleep architecture and circadian vulnerability have been documented, with females showing greater susceptibility to disruption but also benefiting from interventions ( 42 , 50 ). Discussion This study demonstrates that exercise exerts broad neuroprotective effects in a genetic model of obesity, mitigating multiple pathological processes associated with aging and metabolic stress. Using Sk2 mutants, which exhibit sphingolipid dysregulation and obesity-like traits ( 13 ), we observed profound disruptions in sleep architecture, cognitive performance, lipid metabolism, synaptic integrity, and inflammatory signaling. These findings align with evidence that obesity accelerates neurodegenerative risk through chronic inflammation, lipid accumulation, and circadian misalignment ( 14 , 42 ). Exercise significantly improved sleep continuity and reduce fragmentation, particularly in females, which is consistent with prior reports that physical activity stabilizes circadian rhythms and enhances sleep quality in aging flies ( 41 , 47 ). Improved sleep likely contributed to the observed rescue of learning and memory deficits, as sleep is essential for memory consolidation in Drosophila ( 45 , 46 ). These behavioral benefits underscore the interplay between metabolic health, circadian regulation, and cognitive resilience. At the structural level, Sk2 mutants displayed marked lipid deposition and elevated synapsin intensity in the brain, indicating obesity-driven metabolic stress and synaptic remodeling. Exercise reduced lipid object counts and normalized synapsin levels, suggesting improved lipid clearance and synaptic homeostasis. Interestingly, females exhibited structural remodeling of lipid deposits without major synapsin changes, whereas males showed stronger synaptic normalization, Exercise reduced lipid object. These sex-specific patterns may reflect differences in energy allocation and neuronal plasticity, as previously reported in endurance exercise studies ( 29 ) Age further influenced these effects: while exercise remained beneficial at 6 weeks, improvements were Molecular profiling revealed robust activation of inflammatory cytokines (upd1, upd3), JAK/STAT components (Hop, Stat), and pro-apoptotic genes (hid) in Sk2 brains, indicating a state of chronic neuroinflammation and cell death risk. Exercise markedly downregulated these pathways, particularly in females at 6 weeks, suggesting enhanced neuroprotection during later life stages ( 41 ). The observed increase in upd3 expression in thoracic tissue following exercise may represent a JAK/STAT-mediated regenerative response linked to muscle remodeling and systemic adaptation ( 14 ). These findings align with mammalian studies showing that physical activity reduces neuroinflammatory signaling and preserves synaptic integrity during aging (Harvard Health Publishing, 2022; UCSF, 2022). Collectively, our results highlight sex and age as critical determinants of exercise benefit. Females exhibited greater improvements in sleep quality, inflammatory suppression, and metabolic remodeling, whereas males showed stronger synaptic recovery and locomotor gains. These differences may arise from sex-specific hormonal and neuromodulatory pathways influencing energy balance and immune regulation ( 29 , 42 ). Age consistently attenuated exercise benefits, emphasizing the importance of early-life interventions to maximize neuroprotective outcomes (Fig. 7 and Supplementary Fig. 5 ). Given the evolutionary conservation of lipid metabolism, circadian regulation, and JAK/STAT signaling, these findings have translational relevance for designing lifestyle interventions to combat obesity-related cognitive decline and neurodegenerative risk in humans. Future studies should explore molecular mediators of sex-specific exercise responses and assess whether combining exercise with dietary or pharmacological strategies can further enhance neuroprotection during aging. Declarations Conflict of Interest The authors declare no conflict of interest Author Contributions: GCM and AY designed the research, with feedback from AMP; AY, MB, JCW, and DP performed the research; AY, MB, and JCW analyzed the data; AY wrote the paper, & all authors reviewed. Acknowledgments Research reported in this publication was supported by the National Institutes of Health (NIH) grants AG065992 and RF1NS133378 to G.C.M. Research reported in this publication was also supported by the National Institute on Aging of the National Institutes of Health under Award Number P30AG050886. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. Data Availability Statement The data that support the findings of this study are available on request from the corresponding author. References Mir FA, Lark ARS, Nehs CJ. Unraveling the interplay between sleep, redox metabolism, and aging: implications for brain health and longevity. Front Aging. 2025;6:1605070. Epub 20250521. doi: 10.3389/fragi.2025.1605070. PubMed PMID: 40469623; PubMed Central PMCID: PMC12133771. Ragusa FS, Tanaka T, Veronese N, Mansueto P, Dominguez LJ, Barbagallo M, et al. Weight of time: exploring the link between obesity and aging. Aging Clin Exp Res. 2025;37(1):236. Epub 20250728. doi: 10.1007/s40520-025-03106-4 . PubMed PMID: 40720057; PubMed Central PMCID: PMC12304044. Banerjee D, Mani A. Obesity's systemic impact: exploring molecular and physiological links to diabetes, cardiovascular disease, and heart failure. Front Endocrinol (Lausanne). 2025;16:1681766. Epub 20251107. doi: 10.3389/fendo.2025.1681766. PubMed PMID: 41282294; PubMed Central PMCID: PMC12634369. Sun Y, Shan X, Li M, Niu Y, Sun Z, Ma X, et al. Autoimmune mechanisms and inflammation in obesity-associated type 2 diabetes, atherosclerosis, and non-alcoholic fatty liver disease. Funct Integr Genomics. 2025;25(1):84. Epub 20250409. doi: 10.1007/s10142-025-01587-0 . PubMed PMID: 40205260. Ullah MI, Tamanna S. Obesity: Clinical Impact, Pathophysiology, Complications, and Modern Innovations in Therapeutic Strategies. Medicines (Basel). 2025;12(3). Epub 20250728. doi: 10.3390/medicines12030019. PubMed PMID: 40843857; PubMed Central PMCID: PMC12372088. Halder SK, Melkani GC. The Interplay of Genetic Predisposition, Circadian Misalignment, and Metabolic Regulation in Obesity. Curr Obes Rep. 2025;14(1):21. Epub 20250301. doi: 10.1007/s13679-025-00613-3 . PubMed PMID: 40024983; PubMed Central PMCID: PMC11872776. Duez H, Staels B. Circadian Disruption and the Risk of Developing Obesity. Curr Obes Rep. 2025;14(1):20. Epub 20250213. doi: 10.1007/s13679-025-00610-6. PubMed PMID: 39939483; PubMed Central PMCID: PMC11821678. Gallego-Landin I, Berbegal-Saez P, Valverde O. Chronic circadian disruption in adolescent mice impairs hippocampal memory disrupting gene expression oscillations. Sci Rep. 2025;15(1):26291. Epub 20250719. doi: 10.1038/s41598-025-12237-7 . PubMed PMID: 40684045; PubMed Central PMCID: PMC12276311. Gerstner JR, Yin JC. Circadian rhythms and memory formation. Nat Rev Neurosci. 2010;11(8):577–88. doi: 10.1038/nrn2881 . PubMed PMID: 20648063; PubMed Central PMCID: PMC6544049. Musiek ES. Circadian clock disruption in neurodegenerative diseases: cause and effect? Front Pharmacol. 2015;6:29. Epub 20150227. doi: 10.3389/fphar.2015.00029. PubMed PMID: 25774133; PubMed Central PMCID: PMC4343016. Chaput JP, Dutil C, Featherstone R, Ross R, Giangregorio L, Saunders TJ, et al. Sleep duration and health in adults: an overview of systematic reviews. Appl Physiol Nutr Metab. 2020;45(10 (Suppl. 2)):S218–S31. doi: 10.1139/apnm-2020-0034 . PubMed PMID: 33054337. St-Onge MP, Grandner MA, Brown D, Conroy MB, Jean-Louis G, Coons M, et al. Sleep Duration and Quality: Impact on Lifestyle Behaviors and Cardiometabolic Health: A Scientific Statement From the American Heart Association. Circulation. 2016;134(18):e367–e86. Epub 20160919. doi: 10.1161/CIR.0000000000000444. PubMed PMID: 27647451; PubMed Central PMCID: PMC5567876. Walls SM, Jr., Attle SJ, Brulte GB, Walls ML, Finley KD, Chatfield DA, et al. Identification of sphingolipid metabolites that induce obesity via misregulation of appetite, caloric intake and fat storage in Drosophila. PLoS Genet. 2013;9(12):e1003970. Epub 20131205. doi: 10.1371/journal.pgen.1003970 . PubMed PMID: 24339790; PubMed Central PMCID: PMC3854795. Villanueva JE, Livelo C, Trujillo AS, Chandran S, Woodworth B, Andrade L, et al. Time-restricted feeding restores muscle function in Drosophila models of obesity and circadian-rhythm disruption. Nat Commun. 2019;10(1):2700. Epub 20190620. doi: 10.1038/s41467-019-10563-9 . PubMed PMID: 31221967; PubMed Central PMCID: PMC6586848. Livelo C, Guo Y, Abou Daya F, Rajasekaran V, Varshney S, Le HD, et al. Time-restricted feeding promotes muscle function through purine cycle and AMPK signaling in Drosophila obesity models. Nat Commun. 2023;14(1):949. Epub 20230221. doi: 10.1038/s41467-023-36474-4 . PubMed PMID: 36810287; PubMed Central PMCID: PMC9944249. Ravichandran S, Finlin BS, Kern PA, Ozcan S. Sphk2(-/-) mice are protected from obesity and insulin resistance. Biochim Biophys Acta Mol Basis Dis. 2019;1865(3):570–6. Epub 20181226. doi: 10.1016/j.bbadis.2018.12.012 . PubMed PMID: 30593892; PubMed Central PMCID: PMC6368224. Vanherle L, Skoug C, Porschen LT, Gimeno-Ferrer F, Matthes F, JM ND, et al. Sphingosine Kinase 2 Inhibition Ameliorates Neuroinflammation in Diet-Induced Obese Mice. Aging Dis. 2025. Epub 20251014. doi: 10.14336/AD.2025.0636. PubMed PMID: 41135095. Ottensmann L, Tabassum R, Ruotsalainen SE, Gerl MJ, Klose C, Widen E, et al. Genome-wide association analysis of plasma lipidome identifies 495 genetic associations. Nat Commun. 2023;14(1):6934. Epub 20231031. doi: 10.1038/s41467-023-42532-8 . PubMed PMID: 37907536; PubMed Central PMCID: PMC10618167. Fitzpatrick AL, Kuller LH, Lopez OL, Diehr P, O'Meara ES, Longstreth WT, Jr., et al. Midlife and late-life obesity and the risk of dementia: cardiovascular health study. Arch Neurol. 2009;66(3):336–42. doi: 10.1001/archneurol.2008.582. PubMed PMID: 19273752; PubMed Central PMCID: PMC3513375. Ge X, Zheng M, Hu M, Fang X, Geng D, Liu S, et al. Butyrate ameliorates quinolinic acid-induced cognitive decline in obesity models. J Clin Invest. 2023;133(4). Epub 20230215. doi: 10.1172/JCI154612. PubMed PMID: 36787221; PubMed Central PMCID: PMC9927952. Li J, Joshi P, Ang TFA, Liu C, Auerbach S, Devine S, et al. Mid- to Late-Life Body Mass Index and Dementia Risk: 38 Years of Follow-up of the Framingham Study. Am J Epidemiol. 2021;190(12):2503–10. doi: 10.1093/aje/kwab096 . PubMed PMID: 33831181; PubMed Central PMCID: PMC8796797. Dhurandhar Y, Tomar S, Das A, Prajapati JL, Singh AP, Bodake SH, et al. Chronic inflammation in obesity and neurodegenerative diseases: exploring the link in disease onset and progression. Mol Biol Rep. 2025;52(1):424. Epub 20250425. doi: 10.1007/s11033-025-10509-z . PubMed PMID: 40274681. Le Thuc O, Garcia-Caceres C. Obesity-induced inflammation: connecting the periphery to the brain. Nat Metab. 2024;6(7):1237–52. Epub 20240712. doi: 10.1038/s42255-024-01079-8 . PubMed PMID: 38997442. Schmitt LO, Gaspar JM. Obesity-Induced Brain Neuroinflammatory and Mitochondrial Changes. Metabolites. 2023;13(1). Epub 20230105. doi: 10.3390/metabo13010086 . PubMed PMID: 36677011; PubMed Central PMCID: PMC9865135. Hawley JA, Hargreaves M, Joyner MJ, Zierath JR. Integrative biology of exercise. Cell. 2014;159(4):738–49. doi: 10.1016/j.cell.2014.10.029 . PubMed PMID: 25417152. Flatt T, Partridge L. Horizons in the evolution of aging. BMC Biol. 2018;16(1):93. Epub 20180820. doi: 10.1186/s12915-018-0562-z . PubMed PMID: 30124168; PubMed Central PMCID: PMC6100731. Piazza N, Gosangi B, Devilla S, Arking R, Wessells R. Exercise-training in young Drosophila melanogaster reduces age-related decline in mobility and cardiac performance. PLoS One. 2009;4(6):e5886. Epub 20090611. doi: 10.1371/journal.pone.0005886 . PubMed PMID: 19517023; PubMed Central PMCID: PMC2691613. Heo JW, No MH, Park DH, Kang JH, Seo DY, Han J, et al. Effects of exercise on obesity-induced mitochondrial dysfunction in skeletal muscle. Korean J Physiol Pharmacol. 2017;21(6):567–77. Epub 20171030. doi: 10.4196/kjpp.2017.21.6.567 . PubMed PMID: 29200899; PubMed Central PMCID: PMC5709473. Sujkowski A, Ramesh D, Brockmann A, Wessells R. Octopamine Drives Endurance Exercise Adaptations in Drosophila. Cell Rep. 2017;21(7):1809–23. doi: 10.1016/j.celrep.2017.10.065 . PubMed PMID: 29141215; PubMed Central PMCID: PMC5693351. Peng T, Ding M, Yan H, Zhang P, Tian R, Guo Y, et al. Endurance exercise upregulates mtp expression in aged Drosophila to ameliorate age-related diastolic dysfunction and extend lifespan. Physiol Rep. 2024;12(3):e15929. doi: 10.14814/phy2.15929. PubMed PMID: 38307709; PubMed Central PMCID: PMC10837045. Wen DT, Wang WQ, Hou WQ, Cai SX, Zhai SS. Endurance exercise protects aging Drosophila from high-salt diet (HSD)-induced climbing capacity decline and lifespan decrease by enhancing antioxidant capacity. Biol Open. 2020;9(5). Epub 20200529. doi: 10.1242/bio.045260 . PubMed PMID: 32414766; PubMed Central PMCID: PMC7272356. Piper MDW, Partridge L. Drosophila as a model for ageing. Biochim Biophys Acta Mol Basis Dis. 2018;1864(9 Pt A):2707–17. Epub 20170928. doi: 10.1016/j.bbadis.2017.09 .016. PubMed PMID: 28964875. Protasiewicz J, Snider S, Khan M, Tao L, Wessells RJ, Sujkowski A. A new Drosophila model of prolonged inactivity shortens lifespan and impairs muscle function. Sci Rep. 2025;15(1):27908. Epub 20250731. doi: 10.1038/s41598-025-13446-w . PubMed PMID: 40745192; PubMed Central PMCID: PMC12314096. Livelo C, Guo Y, Madhanagopal J, Morrow C, Melkani GC. Time-restricted feeding mediated modulation of microbiota leads to changes in muscle physiology in Drosophila obesity models. Aging Cell. 2025;24(2):e14382. Epub 20241024. doi: 10.1111/acel.14382 . PubMed PMID: 39446089; PubMed Central PMCID: PMC11822661. Chocron ES, Munkacsy E, Kim HS, Karpowicz P, Jiang N, Van Skike CE, et al. Genetic and pharmacologic proteasome augmentation ameliorates Alzheimer's-like pathology in mouse and fly APP overexpression models. Sci Adv. 2022;8(23):eabk2252. Epub 20220608. doi: 10.1126/sciadv.abk2252 . PubMed PMID: 35675410; PubMed Central PMCID: PMC9177073. Meschi E, Duquenoy L, Otto N, Dempsey G, Waddell S. Compensatory enhancement of input maintains aversive dopaminergic reinforcement in hungry Drosophila. Neuron. 2024;112(14):2315–32 e8. Epub 20240524. doi: 10.1016/j.neuron.2024.04.035 . PubMed PMID: 38795709. Munkacsy E, Chocron ES, Quintanilla L, Gendron CM, Pletcher SD, Pickering AM. Neuronal-specific proteasome augmentation via Prosbeta5 overexpression extends lifespan and reduces age-related cognitive decline. Aging Cell. 2019;18(5):e13005. Epub 20190723. doi: 10.1111/acel.13005 . PubMed PMID: 31334599; PubMed Central PMCID: PMC6718538. Moraes RCM, Roth JR, Mao H, Crawley SR, Xu BP, Watson JC, et al. Apolipoprotein E Induces Lipid Accumulation Through Dgat2 That Is Prevented with Time-Restricted Feeding in Drosophila. Genes (Basel). 2024;15(11). Epub 20241025. doi: 10.3390/genes15111376 . PubMed PMID: 39596576; PubMed Central PMCID: PMC11594465. Roth JR, de Moraes RCM, Xu BP, Crawley SR, Khan MA, Melkani GC. Rapamycin reduces neuronal mutant huntingtin aggregation and ameliorates locomotor performance in Drosophila. Front Aging Neurosci. 2023;15:1223911. Epub 20230926. doi: 10.3389/fnagi.2023.1223911 . PubMed PMID: 37823007; PubMed Central PMCID: PMC10562706. Watson J, Roth JR, Melkani GC. Direct Cryosectioning of Drosophila Heads for Enhanced Brain Fluorescence Staining and Immunostaining. J Vis Exp. 2025(216). Epub 20250207. doi: 10.3791/67791. PubMed PMID: 39995173. Li Q, Wang L, Cao Y, Wang X, Tang C, Zheng L. Stable Expression of dmiR-283 in the Brain Promises Positive Effects in Endurance Exercise on Sleep-Wake Behavior in Aging Drosophila. Int J Mol Sci. 2023;24(4). Epub 20230220. doi: 10.3390/ijms24044180 . PubMed PMID: 36835595; PubMed Central PMCID: PMC9966282. Woodling N. Sex- and strain-dependent effects of ageing on sleep and activity patterns in Drosophila. PLoS One. 2024;19(8):e0308652. Epub 20240816. doi: 10.1371/journal.pone.0308652 . PubMed PMID: 39150918; PubMed Central PMCID: PMC11329114. Chou VT, Johnson SA, Van Vactor D. Synapse development and maturation at the drosophila neuromuscular junction. Neural Dev. 2020;15(1):11. Epub 20200802. doi: 10.1186/s13064-020-00147-5. PubMed PMID: 32741370; PubMed Central PMCID: PMC7397595. Miguel-Aliaga I, Jasper H, Lemaitre B. Anatomy and Physiology of the Digestive Tract of Drosophila melanogaster. Genetics. 2018;210(2):357–96. doi: 10.1534/genetics.118.300224 . PubMed PMID: 30287514; PubMed Central PMCID: PMC6216580. Li Y, Chouhan NS, Zhang SL, Moore RS, Noya SB, Shon J, et al. Modulation of RNA processing genes during sleep-dependent memory. Elife. 2024;12. Epub 20241206. doi: 10.7554/eLife.89023. PubMed PMID: 39642051; PubMed Central PMCID: PMC11623928. Marquand K, Roselli C, Cervantes-Sandoval I, Boto T. Sleep benefits different stages of memory in Drosophila. Front Physiol. 2023;14:1087025. Epub 20230119. doi: 10.3389/fphys.2023.1087025. PubMed PMID: 36744027; PubMed Central PMCID: PMC9892949. Li QF, Wang H, Zheng L, Yang F, Li HZ, Li JX, et al. Effects of Modest Hypoxia and Exercise on Cardiac Function, Sleep-Activity, Negative Geotaxis Behavior of Aged Female Drosophila. Front Physiol. 2019;10:1610. Epub 20200121. doi: 10.3389/fphys.2019.01610 . PubMed PMID: 32038290; PubMed Central PMCID: PMC6985434. Yin JCP, Cui E, Hardin PE, Zhou H. Circadian disruption of memory consolidation in Drosophila. Front Syst Neurosci. 2023;17:1129152. Epub 20230322. doi: 10.3389/fnsys.2023.1129152. PubMed PMID: 37034015; PubMed Central PMCID: PMC10073699. Boomgarden AC, Sagewalker GD, Shah AC, Haider SD, Patel P, Wheeler HE, et al. Chronic circadian misalignment results in reduced longevity and large-scale changes in gene expression in Drosophila. BMC Genomics. 2019;20(1):14. Epub 20190107. doi: 10.1186/s12864-018-5401-7 . PubMed PMID: 30616504; PubMed Central PMCID: PMC6323780. Duarte T, Loreto JS, Michelotti P, Rieder GS, Senger LR, Dos Santos EL, et al. Sex shapes the systemic response to light-induced sleep disruption in Drosophila melanogaster. J Exp Biol. 2025;228(17). Epub 20250902. doi: 10.1242/jeb.250079 . PubMed PMID: 40771107. Additional Declarations There is NO conflict of interest to disclose Supplementary Files YadavEtalSupplementaryInformation.pdf single PDF of the SI data Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: revise 06 Feb, 2026 Review # 2 received at journal 04 Feb, 2026 Review # 1 received at journal 04 Feb, 2026 Reviewer # 2 agreed at journal 22 Jan, 2026 Reviewer # 1 agreed at journal 13 Jan, 2026 Reviewers invited by journal 13 Jan, 2026 Submission checks completed at journal 12 Jan, 2026 Editor assigned by journal 09 Jan, 2026 First submitted to journal 09 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8563103","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":573849905,"identity":"5f696408-6c80-4c6d-9eda-e90946c25459","order_by":0,"name":"Girish Melkani","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxklEQVRIiWNgGAWjYHACxoMNDAw8/AwMbEAOM3F6wFokG0jVwmBwgFgt8mGHDxycUXNHxvhG8rMHDBXWiQ2EtBjeTks4uOHYMx6zG2nmBgxn0onQMjvH4OADtsNALQlmEoxth4nRkv/h4IN/h3mMZ6R/k2D8R4QWeekchoMb2w7zGEjkAG1pIEKLgXSawcGZfYd5JM68KTdIOJZuTNiW2ckPH/Z8O2zP356+7cGHGmtZwrYcQOYlEFIOtoWgoaNgFIyCUTAKADbARVRSaIasAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0003-0353-4633","institution":"University of Alabama Birmingham, Heersink School of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Girish","middleName":"","lastName":"Melkani","suffix":""},{"id":573849906,"identity":"30a456d5-e387-4628-9977-608a8de4075b","order_by":1,"name":"Archana Yadav","email":"","orcid":"","institution":"University of Alabama Birmingham, Heersink School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Archana","middleName":"","lastName":"Yadav","suffix":""},{"id":573849907,"identity":"8b8c8f7b-d9fc-44d3-abf9-26fe67184d0c","order_by":2,"name":"Morgan Barkley","email":"","orcid":"","institution":"University of Alabama Birmingham, Heersink School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Morgan","middleName":"","lastName":"Barkley","suffix":""},{"id":573849908,"identity":"4e9bac8d-3980-4293-a202-a8f692a1695c","order_by":3,"name":"John Watson","email":"","orcid":"","institution":"University of Alabama Birmingham, Heersink School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"John","middleName":"","lastName":"Watson","suffix":""},{"id":573849909,"identity":"06522443-0af3-4c4c-a3ea-d22332ba1f31","order_by":4,"name":"Dev Patel","email":"","orcid":"","institution":"University of Alabama Birmingham, Heersink School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Dev","middleName":"","lastName":"Patel","suffix":""},{"id":573849910,"identity":"d25fb18a-1006-468f-9dc9-a5d021bfe866","order_by":5,"name":"Andrew Pickering","email":"","orcid":"","institution":"The University of Texas Health Science Center at Houston","correspondingAuthor":false,"prefix":"","firstName":"Andrew","middleName":"","lastName":"Pickering","suffix":""}],"badges":[],"createdAt":"2026-01-09 17:00:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8563103/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8563103/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":100547298,"identity":"9f6dbed4-d22b-4419-9d60-ac7025bda7b1","added_by":"auto","created_at":"2026-01-19 08:15:13","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1259185,"visible":true,"origin":"","legend":"","description":"","filename":"YadavetalManuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/34338e01728a1d8cc038b5e9.docx"},{"id":100547876,"identity":"d09b3618-4301-4e0b-ae37-c0a931571a07","added_by":"auto","created_at":"2026-01-19 08:16:50","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8183,"visible":true,"origin":"","legend":"","description":"","filename":"2026IJO00047.json","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/72163ed77654bb1785a56e2d.json"},{"id":100449362,"identity":"cf0250a1-dcd0-4b48-99b6-32cea095b1e8","added_by":"auto","created_at":"2026-01-16 19:44:29","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":899912,"visible":true,"origin":"","legend":"","description":"","filename":"YadavEtalSupplementaryInformation.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/a1f4b6042af0109135a496c7.pdf"},{"id":100547543,"identity":"7f463288-30d9-4053-b71c-b0667a6bb149","added_by":"auto","created_at":"2026-01-19 08:15:57","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":144177,"visible":true,"origin":"","legend":"","description":"","filename":"2026IJO000470enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/20041e9ecefdeb9e1ba1571a.xml"},{"id":100547366,"identity":"db748d24-9232-402a-bc76-91fce343f49a","added_by":"auto","created_at":"2026-01-19 08:15:21","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1419927,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/8f137b52ca91a6779669133d.jpeg"},{"id":100547742,"identity":"6c919467-a742-4fdb-8e56-72388de1a095","added_by":"auto","created_at":"2026-01-19 08:16:31","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1394657,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/e7ec190fa1e46961d8a720f9.jpeg"},{"id":100547578,"identity":"e5412db3-8216-4def-929b-db9a99b5ff86","added_by":"auto","created_at":"2026-01-19 08:16:02","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":188493,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/53780f12a3345b38e8560464.jpeg"},{"id":100547076,"identity":"6fed9b2b-202e-4103-840c-5c52bbdde0b5","added_by":"auto","created_at":"2026-01-19 08:14:18","extension":"jpeg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1115954,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/7f5fa54dceed9d6379a186e8.jpeg"},{"id":100449372,"identity":"f224de7e-59b3-42fa-8c29-7d2b096f2665","added_by":"auto","created_at":"2026-01-16 19:44:30","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":177921,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/6a6401f59408209381ee1018.jpeg"},{"id":100547430,"identity":"6ac1df8f-a2a2-42e0-a8fa-baed41ba55c0","added_by":"auto","created_at":"2026-01-19 08:15:31","extension":"jpeg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":175248,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/20477259e3eff189650660ae.jpeg"},{"id":100449374,"identity":"47bda0ea-4c62-4a40-8c21-84412562a4e6","added_by":"auto","created_at":"2026-01-16 19:44:30","extension":"jpeg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":61907,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/6b9d9ed2fdf695d695e010c3.jpeg"},{"id":100449368,"identity":"2063ec01-84eb-4cc1-aaa1-135c8e71eb29","added_by":"auto","created_at":"2026-01-16 19:44:30","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":327893,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/44684f2c05abf7daf16716ca.png"},{"id":100547314,"identity":"f442fbd5-8891-4344-a2c1-8795b63a9358","added_by":"auto","created_at":"2026-01-19 08:15:15","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":325251,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/d61d0b0fabb2a929092cafe2.png"},{"id":100449380,"identity":"3240e1a0-e4e5-4e26-a82b-b16cc7431857","added_by":"auto","created_at":"2026-01-16 19:44:30","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":55754,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/def11e916d31c34a52a7c754.png"},{"id":100547835,"identity":"4d192b70-3694-4bcf-9ed7-da3ff595f0b7","added_by":"auto","created_at":"2026-01-19 08:16:40","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":217028,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/9407d3fafcdf9526553e5252.png"},{"id":100547883,"identity":"006dfe0c-0894-4141-80d2-d8c43045d502","added_by":"auto","created_at":"2026-01-19 08:16:51","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":61078,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/fe51dc1117ccffba320a3167.png"},{"id":100547814,"identity":"206d11e2-351a-4e04-93ab-9f08565238de","added_by":"auto","created_at":"2026-01-19 08:16:39","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":57011,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/0a901b52093e71e33c62f1ec.png"},{"id":100449376,"identity":"3a42870e-61a5-4057-8089-9808eb18fb62","added_by":"auto","created_at":"2026-01-16 19:44:30","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":33219,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/18ece63803b8170acd22adfd.png"},{"id":100449382,"identity":"461001c5-f0b5-4d07-8052-162469f819f7","added_by":"auto","created_at":"2026-01-16 19:44:30","extension":"xml","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":142781,"visible":true,"origin":"","legend":"","description":"","filename":"2026IJO000470structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/1b1d3ed32509f6b9c50b5754.xml"},{"id":100449383,"identity":"17cee28c-255a-4baa-8d1d-9c78f548759d","added_by":"auto","created_at":"2026-01-16 19:44:30","extension":"html","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":157552,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/26d2734630332290d0312c5c.html"},{"id":100547185,"identity":"57cd474c-d35c-49ef-be7f-c25c91ea9633","added_by":"auto","created_at":"2026-01-19 08:14:46","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":138557,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of exercise on brain morphology and synaptic markers in male CS and Sk2 groups at 3 and 6 weeks. \u003c/strong\u003eRepresentative immunofluorescence images (a, b) show brain sections from CS and Sk2 groups under non-exercise (NE) and exercise (E) conditions at 3 (a), and 6 (b) weeks for males. Exercise significantly reduced obesity-associated lipid accumulation in the brains and heads of 3-week and 6-week-old male (c-f), Drosophila. In Sk2 flies, lipid intensity increased in the head and showed no change in the brain at 3 weeks after exercise (g), whereas at 6 weeks it decreased in both the head and the brain (h). Compared to age-matched controls, Sk2 mutant flies showed markedly higher lipid levels and synapsin intensity (i), a protein crucial for synaptic function. Exercise intervention led to a notable reduction in lipid accumulation and synapsin levels, suggesting improved lipid metabolism and synaptic health. Images shown are representative of three independent experiments. Statistical analysis was performed using two-way ANOVA with Tukey’s multiple comparisons test (ns = p \u0026gt; 0.05, * = p \u0026lt; 0.05, ** = p \u0026lt; 0.01, *** = p \u0026lt; 0.0001). Quantitative analyses are presented as mean ± SD with individual data points.\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/6a48e292ec2d07ae2a3a7df9.jpg"},{"id":100449354,"identity":"07a3a0d2-c52c-43bc-89ec-6e3ca528a0d0","added_by":"auto","created_at":"2026-01-16 19:44:29","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":136376,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of exercise on brain morphology and synaptic markers in CS and Sk2 groups at 3 and 6 weeks in female. \u003c/strong\u003eRepresentative immunofluorescence images (a, b) show brain sections from CS and Sk2 groups under non-exercise (NE) and exercise (E) conditions at 3 (a), and 6 weeks (b), for females (a, b). At 3 weeks, exercise significantly reduced lipid count in the brain (c, d), no change in head (e, f), and no change in lipid and synaptic marker intensity (g-i), indicating less changes during early development. By 6 weeks, these exercise-driven effects were reduced or absent, suggesting that the impact of exercise is age-dependent and most pronounced during early stages (c-i). Statistical analysis was performed using two-way ANOVA with Tukey’s multiple comparisons test (ns = p \u0026gt; 0.05, * = p \u0026lt; 0.05, ** = p \u0026lt; 0.01, *** = p \u0026lt; 0.0001). Quantitative analyses are presented as mean ± SD with individual data points.\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/9ca9540fca31ec225fd6eac4.jpg"},{"id":100449358,"identity":"dd7dded6-4fc8-479a-9291-fe7f74158270","added_by":"auto","created_at":"2026-01-16 19:44:29","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":161344,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of exercise on cytokine, signaling, and apoptosis-related gene expression in female and male CS and Sk2 groups at 3 and 6 weeks. \u003c/strong\u003eqPCR analysis in female brain (a-f) further revealed elevated expression of inflammatory cytokines (Upd1, and Upd3) and their signaling components (Dome, Hop, Stat), along with the pro-inflammatory marker Eiger in Sk2 mutant brains at 3 and 6 weeks. Exercise (E) strongly down-regulated Upd1, and Upd3, and their signaling components (Hop, Stat), along with the pro-inflammatory marker Eiger in Sk2 mutant brain at 3 and 6 weeks, indicating activation of JAK/STAT signaling. Conversely, pro-apoptotic gene hid showed marked reductions with exercise, particularly at 6 weeks, suggesting suppression of apoptotic pathways. Overall, exercise enhanced cytokine signaling and reduced apoptosis-related gene expression, with effects more pronounced in Sk2 females at 6 weeks. qPCR analysis in male brain (g-l) further revealed elevated expression of inflammatory cytokines (Upd1, and Upd3) and their signaling components (Hop, Stat), along with the pro-inflammatory marker Eiger in Sk2 mutant brains at 3 and 6 weeks. Pro-apoptotic gene Hid were also changed, indicating that obesity promotes both inflammation and apoptosis. Exercise significantly downregulated these genes in Sk2 mutants, suggesting a protective effect on brain health. Importantly, exercise had no impact on gene expression in control flies. Statistical analysis was performed using two-way ANOVA with Tukey’s multiple comparisons test (ns = p \u0026gt; 0.05, * = p \u0026lt; 0.05, ** = p \u0026lt; 0.01, *** = p \u0026lt; 0.0001). Quantitative analyses are presented as mean ± SD with individual data points.\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/2830f83a869dbcd1a25f847a.jpg"},{"id":100547331,"identity":"7d5c67a1-d21e-43b8-9886-921ded10d021","added_by":"auto","created_at":"2026-01-19 08:15:18","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":121570,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of exercise on cognitive performance and avoidance behavior in CS and Sk2 groups at 3 and 6 weeks. \u003c/strong\u003eExercise rescued learning and memory deficits in Sk2 mutants. Non-exercised Sk2 males and females displayed significant memory impairments at 3, and 6 weeks of age (a, b, e, and f), as shown by reduced memory retention in aversive conditioning assays. Exercised Sk2 flies exhibited improved performance. The middle panels (c, g) show decision-making deficits in Sk2 mutants, while the right panels (d, h) reflect impaired odor avoidance behavior, both of which were improved with exercise. Data are presented as mean ± SD with individual data points for CS and Sk2 groups under non-exercise (NE) and exercise (E) conditions at 3 weeks and 6 weeks. Chi-square tests (left panels) and Two-way ANOVA with Tukey’s post-hoc (c, d, g, h) were used to assess significance. Data are shown as percentages of flies in each chamber at assay conclusion (n = 60–150 flies/genotype/condition).\u003c/p\u003e","description":"","filename":"Picture4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/0a9c04b9d534b730ef6218f1.jpg"},{"id":100449365,"identity":"cf401411-a57b-4ff9-bee6-2eede375cab4","added_by":"auto","created_at":"2026-01-16 19:44:30","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":145992,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of exercise on sleep architecture, and sleep fragmentation in CS and Sk2 male Drosophila at 3 and 6 weeks. \u003c/strong\u003eAt 3 weeks, exercise (E) produced modest improvements in sleep architecture, with a significant increase in total, and day sleep time (a, b) compared to non-exercise (NE). Night sleep (c) remained largely unchanged. Activity counts revealed that exercise slightly reduced total activity (d) and day activity (e), whereas night activity (f) remained unchanged. Sleep fragmentation indices (g-i) exhibited little change at 3 weeks, indicating that exercise had limited impact on sleep continuity at 3 weeks. By 6 weeks, these effects became more diminished and were not significant with exercise: exercise did not change total, day and night sleep duration (a-c), while activity counts dropped less significantly, particularly night activity (f) in Sk2-E and NE groups. Fragmentation indices (g-i) showed marked reductions at 6 weeks, especially in Sk2-E group during daytime, reflecting improved sleep stability and continuity over time. Data are presented as mean ± SEM with individual data points for Canton-s (CS) and Sk2 groups under NE and E conditions for 3 weeks and 6 weeks. Two-way ANOVA with Tukey’s multiple comparison test was used (n = 32 flies/group). Error bars indicate mean ± SD; significance levels: ns = p \u0026gt; 0.05, * = p \u0026lt; 0.05, ** = p \u0026lt; 0.01, *** = p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Picture5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/65a6e7efecf84bb98dae6075.jpg"},{"id":100547888,"identity":"9d811a91-4997-41e8-bde1-11570420b261","added_by":"auto","created_at":"2026-01-19 08:16:52","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":144266,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of exercise on sleep architecture, and sleep fragmentation in CS and Sk2 female Drosophila at 3 and 6 weeks. \u003c/strong\u003eIn females, exercise (E) significantly increased total sleep time (a) and day sleep (b) compared to NE in both CS and Sk2 groups, with the largest increase observed in Sk2 at 3 weeks. Night sleep (c) also increased with exercise at both time points. Exercise reduced total and day activity counts (d, e) relative to NE, while night activity (f) decreased sharply with exercise at 6 weeks, particularly in Sk2. Sleep fragmentation indices (g-i) were significantly lower in exercise groups compared to NE, with Sk2 showing the greatest reduction at 6 weeks, indicating improved sleep continuity. Under NE conditions, Sk2 exhibited higher fragmentation and lower activity than CS, but exercise mitigated these differences, demonstrating a strong positive effect of exercise on sleep quality and stability over time. Data are presented as mean ± SEM with individual data points for Canton-s (CS) and Sk2 groups under NE and E conditions for 3 weeks and 6 weeks. Two-way ANOVA with Tukey’s multiple comparison test was used (n = 32 flies/group). Error bars indicate mean ± SD; significance levels: ns = p \u0026gt; 0.05, * = p \u0026lt; 0.05, ** = p \u0026lt; 0.01, *** = p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Picture6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/175cc27c541acc664ef68524.jpg"},{"id":100449364,"identity":"b32fbe89-cf4b-4370-8aee-99559c1f9be8","added_by":"auto","created_at":"2026-01-16 19:44:30","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":59168,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eProposedmodel linking Sk2 loss to neuroinflammation, sleep disruption, and cognitive impairment, and the restorative role of exercise. \u003c/strong\u003eSchematic illustrating how loss of Sk2 leads to increased lipid accumulation in the brain, activation of Eiger/TNF signaling, and subsequent neuroinflammation via the Upd–Hop–Stat pathway. These molecular and cellular changes contribute to sleep disruption and cognitive impairment. Exercise acts as a protective intervention, reducing lipid accumulation, dampening inflammatory signaling, and restoring neural function, thereby improving sleep and cognitive outcomes. Arrows indicate the direction of influence, and dashed lines represent indirect or signaling-mediated effects.\u003c/p\u003e","description":"","filename":"Picture7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/67c1c052ed7658aab67ee977.jpg"},{"id":100547911,"identity":"760f9b1c-863c-4496-9166-f6105c5c5425","added_by":"auto","created_at":"2026-01-19 08:16:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2150003,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/8ca11841-2a35-40ec-b92a-43775620bf06.pdf"},{"id":100449360,"identity":"1759052b-1d20-4b80-9543-a2afd3afa5f4","added_by":"auto","created_at":"2026-01-16 19:44:29","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":899912,"visible":true,"origin":"","legend":"single PDF of the SI data","description":"","filename":"YadavEtalSupplementaryInformation.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8563103/v1/af9ff16c91845a46949dfc76.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose","formattedTitle":"Exercise Attenuates Obesity-Related Cognitive and Sleep-Circadian Dysfunctions by Attenuating Neuroinflammation via JAK/STAT in Sex and Age Specific Manner","fulltext":[{"header":"Introduction","content":"\u003cp\u003eObesity is a major global health challenge that accelerates age related decline in brain function. Among the most harmful effects are cognitive decline and circadian rhythm disruption, which raise the risk of neurodegenerative diseases and lower quality of life in older adults (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). These changes not only compromise quality of life in older adults but also impose a significant societal burden (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). The prevalence of obesity is expected to rise sharply: by 2035, more than half of the world's population will be overweight or obese, potentially affecting over 4\u0026nbsp;billion people, which is like the COVID-19 pandemic. Approximately 16% of adults were obese as of 2022, and since 1990, adult obesity has more than doubled globally (World Health Organization; 2022; Obesity and overweight, World Obesity Federation; 2023; World Obesity Atlas 2023. Report).\u003c/p\u003e \u003cp\u003eA rise in obesity-related morbidity coincides with this growing obesity issue. The risk of type 2 diabetes, cardiovascular disease, non-alcoholic fatty liver disease, and several types of cancer is greatly increased by excess adiposity (\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). These illnesses are caused by endothelial dysfunction, insulin resistance, dysregulated adipokine signaling, and chronic inflammation (\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). These pathological alterations worsen the decline in brain health by causing systemic metabolic imbalance (\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGenome-wide association studies (GWAS) have identified many single-nucleotide polymorphisms (SNPs) associated with obesity-related traits, highlighting a strong genetic link between obesity susceptibility, sleep/wake cycle regulation, and metabolic control (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Despite these insights, the mechanistic basis by which obesity interacts with aging to influence brain function remains incompletely understood.\u003c/p\u003e \u003cp\u003eCircadian rhythm disruption is a critical but underexplored consequence of obesity and aging. The circadian system orchestrates daily cycles of sleep, feeding, and hormonal regulation, maintaining metabolic and cognitive homeostasis. Obesity-induced alterations in circadian signaling impair sleep quality, disrupt neuronal plasticity, and exacerbate neuroinflammation, creating a vicious cycle that accelerates cognitive decline (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Importantly, memory processes are tightly regulated by circadian rhythms: circadian misalignment adversely affects hippocampal synaptic plasticity and impairs learning and memory performance (\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Population-based studies have also demonstrated that insufficient sleep or poor sleep quality is associated with a heightened risk of developing metabolic and neurological disorders (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Studies in humans and model organisms reveal that circadian misalignment increases vulnerability to metabolic disorders and neurodegenerative conditions, yet the molecular pathways linking these processes remain poorly defined.\u003c/p\u003e \u003cp\u003eOne emerging mechanism involves sphingolipid metabolism, a critical regulator of cellular signaling and energy balance. The \u003cem\u003eDrosophila melanogaster Sk2\u003c/em\u003e gene encodes sphingosine kinase 2, which converts sphingosine to sphingosine-1-phosphate (S1P), regulating lipid metabolism and energy balance. Mutations like \u003cem\u003eSk2\u003c/em\u003e\u003csup\u003e\u003cem\u003eKG050894\u003c/em\u003e\u003c/sup\u003e lead to obesity-like traits, including fat accumulation and hyperphagia (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e) (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Recent studies demonstrate that, Sk2 mutants also exhibit muscle dysfunction and metabolic impairment, which can be rescued by time-restricted feeding (TRF), highlighting the interplay between sphingolipid signaling, circadian rhythms, and energy homeostasis (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). Its human ortholog, sphingosine kinase 2 (\u003cem\u003eSPHK2)\u003c/em\u003e, similarly regulates S1P levels. \u003cem\u003eSPHK2\u003c/em\u003e is expressed in adipose tissue and brain, and functional studies in mammals show that \u003cem\u003eSphk2\u003c/em\u003e knockout mice are protected against age-related obesity and insulin resistance, while pharmacological inhibition reduces neuroinflammation in diet-induced obesity models (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). Several loci from GWAS and eQTL analyses revealed the linkage of \u003cem\u003eSPHK2\u003c/em\u003e to obesity, type 2 diabetes, and metabolic dysfunction (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.gtexportal.org/home/gene/SPHK2\u003c/span\u003e\u003cspan address=\"https://www.gtexportal.org/home/gene/SPHK2\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). These findings, combined with adipose eQTL colocalization frameworks, suggest \u003cem\u003eSPHK2\u003c/em\u003e as a mechanistic contributor to cardiometabolic traits even when single-locus GWAS signals are modest. The conserved enzymatic function between \u003cem\u003eSk2\u003c/em\u003e and \u003cem\u003eSPHK2\u003c/em\u003e highlights a shared evolutionary mechanism in lipid signaling, making both genes valuable models for studying obesity-related disorders and potential therapeutic interventions.\u003c/p\u003e \u003cp\u003eMoreover, memory loss and dementia, especially among middle-aged individuals, have been strongly associated with obesity, however, there is no model exist for unraveling the mechanistic basis of this linkage (\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). Obesity-driven metabolic dysfunction is further associated with chronic low-grade inflammation, which disrupts systemic homeostasis and may contribute to cognitive decline and dementia (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Inflammatory signaling in adipose tissue can impair insulin sensitivity, alter lipid metabolism, and promote neuroinflammation, yet the precise pathways connecting these processes to cognitive impairment remain elusive. Neuroinflammation, characterized by microglial activation and cytokine release, is increasingly recognized as a driver of synaptic dysfunction and memory loss in aging brain (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). These processes may be amplified by obesity, creating a synergistic effect that accelerates neurodegeneration.\u003c/p\u003e \u003cp\u003eLifestyle interventions such as exercise offer a promising strategy to counteract these detrimental effects. Exercise is widely recognized as a potent modulator of aging trajectories, improving metabolic health, reducing inflammation, and enhancing cognitive resilience in humans and model organisms (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e) (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). In \u003cem\u003eDrosophila\u003c/em\u003e, endurance exercise has been shown to improve cardiac performance, climbing ability, and stress resistance, paralleling mammalian adaptations (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). Exercise also influences mitochondrial biogenesis, lipid metabolism, and neuronal signaling, mechanisms that may mitigate obesity-induced dysfunction (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). However, exercise responses are not uniform: they vary by sex, age, and genetic background. Males often exhibit stronger training adaptations than females, partly due to differences in octopaminergic signaling and energy metabolism (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). Age further modulates these effects, with younger flies displaying greater exercise-induced benefits compared to older cohorts (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). Despite these observations, few studies have systematically examined how exercise interacts with sex, age, and genetic predisposition in the context of obesity and neurodegeneration.\u003c/p\u003e \u003cp\u003e \u003cem\u003eDrosophila\u003c/em\u003e provides an ideal model for addressing these questions. Its short lifespan, well-characterized genetics, and conserved metabolic pathways make it a powerful system for aging research (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). The availability of exercise paradigms such as rotational or negative geotaxis-based training enables controlled studies of endurance exercise in flies, allowing researchers to dissect molecular and physiological adaptations with precision. Moreover, sex-specific, and age-dependent differences in exercise response can be readily assessed, offering insights into biological variability that are difficult to capture in mammalian models.\u003c/p\u003e \u003cp\u003eHere, we address this critical gap by investigating the impact of endurance exercise on metabolic and functional traits in male and female \u003cem\u003eDrosophila\u003c/em\u003e across two age groups (3 and 6 weeks), comparing \u003cem\u003eCanton-S\u003c/em\u003e controls to \u003cem\u003eSk2\u003c/em\u003e mutants. Specifically, we aim to determine whether exercise mitigates obesity-like phenotypes in \u003cem\u003eSk2\u003c/em\u003e mutants, how sex and age influence susceptibility to exercise benefits, and which sex is more vulnerable to metabolic and functional decline without exercise. By integrating genetic, behavioral, and physiological analyses, our study provides novel insights into the interplay between lifestyle interventions, genetic risk, and biological sex in shaping aging trajectories. These findings have broad implications for understanding obesity-related cognitive decline and identifying targeted strategies to promote healthy aging.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cp\u003e \u003cb\u003eDrosophila\u003c/b\u003e \u003cb\u003emodels and diets\u003c/b\u003e\u003c/p\u003e \u003cp\u003eCanton-S and \u003cem\u003eSphingosine kinase 2\u003c/em\u003e (\u003cem\u003eSk2\u003c/em\u003e BDSC: 14133) were obtained from Bloomington Drosophila Stock Center (BDSC) and maintained at 25\u0026deg;C. \u003cem\u003eSk2\u003c/em\u003e is a Drosophila ortholog of human Sphingosine kinase 1. Sk2 loss-of-function mutant has been used in previous obesity-related studies in \u003cem\u003eDrosophila\u003c/em\u003e and has demonstrated to lead to accumulation of ceramide, implicated to contributing towards obesity (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). Flies were maintained on a standard regular diet: agar 11 g/L, active dry yeast 30 g/L, yellow cornmeal 55 g/L, molasses 72 mL/L, 10% nipagen 8 mL/L, and propionic acid 6 mL/L. Flies were housed at 25\u0026deg;C, 50% humidity in a 12-h light/12-h dark (LD) cycle and changed to new food every 3\u0026ndash;4 days.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eOlfaction aversion training assay\u003c/h2\u003e \u003cp\u003eFlies were trained using the olfactory aversive conditioning method as outlined previously (\u003cspan additionalcitationids=\"CR36\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). The flies were exposed to two neutral odors, 3-octanol and 4-methylcyclohexanol, diluted to 1/10 in mineral oil. A 100 V, 90 Hz electrical shock was used as a reinforcer. The conditioning was conducted in a T-maze apparatus (CelExplorer Labs). The olfactory aversive conditioning procedure included three phases: na\u0026iuml;ve, training, and testing. In the na\u0026iuml;ve phase, flies were exposed to both odors for 3 minutes and 30 seconds to assess their odor preference based on the chamber in which the odor was presented. During a single training round, flies were exposed to one odor paired with the electrical shock for 2 minutes, followed by 2 minutes of exposure to the other odor without shock. The electrical shock was paired with the fly\u0026rsquo;s preferred odor, as determined in the na\u0026iuml;ve phase. After three rounds of training, flies were given a 10-minute recovery period. In the testing phase, flies were given 3 minutes and 30 seconds to choose between the two odor chambers. After this time, the T-maze chambers were sealed, and the number of flies in each chamber was recorded. A performance index (PI) was calculated based on the flies' avoidance of the odor associated with the shock. To validate these results, a sensory acuity test was performed using avoidance index calculations as previously described.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCytological analysis\u003c/h3\u003e\n\u003cp\u003eTo assess the effects of exercise on CS and \u003cem\u003eSk2\u003c/em\u003e flies, the procedure was conducted as previously described (\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Fly heads were exercised under a dissecting microscope and fixed in 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) for 15 minutes at room temperature with gentle agitation. The heads were then washed three times for 10 minutes in PBS. Following this, they were submerged in a 10% sucrose solution in PBS before being placed into molds with approximately 50% Optimal Cutting Temperature (OCT) compound. After freezing, samples were sectioned at 20\u0026micro;m using a Leica CM3050 S cryostat and mounted on glass slides. After a 30-minute drying period, the slides were washed with PBS and blocked with 3% BSA in TBS for 30 minutes. The slides were incubated overnight at 4\u0026deg;C with a primary synapsin antibody (1:500), followed by washing and incubation with an AlexaFluor-594 anti-mouse secondary antibody (1:1000) for 1 hour at room temperature. After washing, slides were mounted with ProLong Diamond Antifade Mountant containing DAPI. Fluorescence images were captured using an Olympus BX63F fluorescence microscope and analyzed with CellSens software at 10\u0026times; magnification. Lipid accumulation was quantified by splitting images into TRITC (lipids) and DAPI (nuclei) channels. Regions of interest (ROIs) were drawn around the brain excluding the optic lobes, and Nile Red staining intensity was measured using ImageJ. Synapsin immunofluorescence intensity was quantified in FIJI software, with background fluorescence subtracted. Multiple sections per fly were imaged, and the mean fluorescence was calculated.\u003c/p\u003e\n\u003ch3\u003eSleep/circadian activity\u003c/h3\u003e\n\u003cp\u003eWe examined the sleep activity and fragmentation patterns of \u003cem\u003eDrosophila\u003c/em\u003e under a 12-hour light, 12-hour dark (LD) cycle. Individual flies were monitored using the Drosophila Activity Monitoring System (DAM, TriKinetics Inc MA, USA). We used 3-week-old male and female progeny of CS and \u003cem\u003eSk2\u003c/em\u003e with or without exercise. For analysis, we employed a machine learning-based app developed to seamlessly process the DAM data, enabling accurate measurements of sleep bouts, bout lengths, and frequency. Drosophila sleep was defined by a period of at least 5 minutes of inactivity, demonstrated by zero beam breaks recorded. Average sleep per 24 hours (Zeitgeber Time (ZT) is a standardized way of measuring time within a circadian cycle, where ZT0 represents the beginning of the light phase and ZT12 marks the start of the dark phase), of each genotype, was calculated. Five days were used for analysis of 3-week-old flies.\u003c/p\u003e\n\u003ch3\u003eReal-time quantitative PCR\u003c/h3\u003e\n\u003cp\u003eThe heads of 3-week-old flies were carefully isolated and promptly frozen (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). RNA was extracted using the Zymo Research Quick-RNA Microprep Kit, which included an on-column DNase I digestion step to ensure RNA purity. Quantitative PCR was carried out with the Sso Advanced Universal SYBR Green Supermix from Bio-Rad, utilizing the BIO-RAD CFX Opus Real-Time PCR System. Gene expression levels were normalized to the 60S ribosomal protein (RPL11) as the reference. Three biological replicates were performed, each containing 8\u0026ndash;10 flies. Primers for qPCR are listed below:\u003c/p\u003e \u003cp\u003eUpd1-F: CAGCGCACGTGAAATAGCAT; Upd1-R: CGAGTCCTGAGGTAAGGGGA;\u003c/p\u003e \u003cp\u003eUpd2-F: AGCGTCGTGATGCCATTCA; Upd2-R: GCGATACGGATTGACATCGAA;\u003c/p\u003e \u003cp\u003eUpd3-F: ATCCCCTGAAGCACCTACAGA; Upd3-R: CAGTCCAGATGCGTACTGCTG;\u003c/p\u003e \u003cp\u003eHop-F: CACCACCAACACCAATTC; Hop-R: GGAACGTCGTTTGGCCTTCT;\u003c/p\u003e \u003cp\u003eStat92e-F: CCTCGGTATGGTCACACCC; Stat92e-R: TGCCAAACTCATTGAGGGACT;\u003c/p\u003e \u003cp\u003eEiger-F: GATGGTCTGGATTCCATTGC; Eiger-R: TAGTCTGCGCCAACATCATC;\u003c/p\u003e \u003cp\u003eReaper-F: TGGCATTCTACATACCCGATCA; Reaper-R: CCAGGAATCTCCACTGTGACT;\u003c/p\u003e \u003cp\u003eHid-F: CACCGACCAAGTGCTATACG; Hid-R: GGCGGATACTGGAAGATTTGC;\u003c/p\u003e \u003cp\u003eRpl11-F: CGATCTGGGCATCAAGTACGA; Rpl11-R: TTGCGCTTCCTGTGGTTCAC;\u003c/p\u003e \u003cp\u003eResults are presented as 2\u0026thinsp;\u0026minus;\u0026thinsp;ΔΔCt values normalized to the expression of Rpl11 and control samples. All reactions were performed in triplicate.\u003c/p\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eSignificance in sleep activity and qPCR gene analysis was determined using Two-way ANOVA with multiple comparisons tukey\u0026rsquo;s test. Lipid droplets count and area differences were performed by two-way ANOVA with multiple comparisons tukey\u0026rsquo;s test. Bar graphs show mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. All statistical analyses were performed with Graph Pad Prism 10.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eExercise counteracts obesity-linked lipid and synaptic dysregulation in a sex- and age-dependent manner\u003c/h2\u003e \u003cp\u003eImmunofluorescence imaging revealed striking sex-, and age-specific differences in brain lipid distribution and synaptic marker expression under exercise and non-exercise conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea\u0026ndash;i) in \u003cem\u003eDrosophila\u003c/em\u003e. \u003cem\u003eSk2\u003c/em\u003e mutants exhibited markedly higher lipid accumulation in head and less in brain, and elevated synapsin intensity compared to \u003cem\u003eCanton-S (CS)\u003c/em\u003e controls under non-exercise conditions \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea-f\u003cb\u003e).\u003c/b\u003e, confirming obesity-linked metabolic and synaptic dysregulation (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). These changes were evident at both 3 and 6 weeks, indicating that \u003cem\u003eSk2\u003c/em\u003e mutation accelerates lipid deposition and synaptic remodeling during aging.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eExercise significantly changed these alterations, but the magnitude and nature of improvement varied by sex, age, and brain region. At 3 weeks, male \u003cem\u003eSk2\u003c/em\u003e mutants showed a pronounced decrease in lipid object counts in the brain compared to CS controls, while head lipid counts remained unchanged \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec, e\u003cb\u003e)\u003c/b\u003e. In contrast, non-exercised \u003cem\u003eSk2\u003c/em\u003e females displayed higher lipid object count in head but no change in brain relative to controls, suggesting sex-specific vulnerability to \u003cem\u003eSk2\u003c/em\u003e-induced lipid dysregulation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea-f\u003cb\u003e)\u003c/b\u003e. Exercise induced distinct remodeling patterns: in males, endurance training reduced brain lipid object counts and increased object area in both head and brain, indicating redistribution of lipid stores rather than complete clearance. In females, exercise alter lipid object counts but did not alter lipid object area in the head and brain, suggesting structural reorganization of lipid deposits rather than reduction in number.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAge further modulated these effects. At 6 weeks, lipid accumulation intensified in \u003cem\u003eSk2\u003c/em\u003e mutants of both sexes, with males showing greater brain lipid burden than females. Exercise remained effective in reducing lipid object counts in older males \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec, e\u003cb\u003e)\u003c/b\u003e., though improvements were smaller than at 3 weeks, consistent with age-related decline in exercise responsiveness (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). In females, exercise continued to primarily increase lipid object area without reducing counts, reinforcing persistent sex-specific differences in lipid remodeling with age \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec, e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eSynaptic marker regulation also differed by sex. Synapsin intensity was significantly elevated in \u003cem\u003eSk2\u003c/em\u003e mutant males under NE conditions compared to CS controls \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ei\u003cb\u003e)\u003c/b\u003e, consistent with obesity-linked synaptic dysregulation. Exercise reduced synapsin levels in males, suggesting partial restoration of synaptic homeostasis. In contrast, females exhibited no significant changes in synapsin expression across genotypes or exercise conditions, indicating either synaptic stability or compensatory regulation under metabolic stress \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ei\u003cb\u003e)\u003c/b\u003e. These findings align with previous reports that endurance exercise improves brain lipid metabolism and synaptic health in aging flies (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e) and highlight sex-dependent differences in exercise benefits (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCollectively, these results demonstrate that endurance exercise mitigates obesity-associated lipid and synaptic alterations in \u003cem\u003eDrosophila\u003c/em\u003e, with distinct sex- and age-dependent patterns of brain remodeling. Males exhibit greater exercise-induced reductions in lipid counts and synapsin intensity, while females show structural remodeling of lipid deposits without major changes in synaptic markers, underscoring the complexity of sex-specific responses to metabolic stress and physical activity.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eExercise modulates peripheral lipid and synaptic expression in obese flies\u003c/h3\u003e\n\u003cp\u003eTo assess whether these effects were brain-specific or reflected systemic responses, we examined lipid and structural markers in the thorax and abdomen. In \u003cem\u003eSk2\u003c/em\u003e mutant males, exercise significantly reduced elevated lipid object counts in both regions, with no change in area, suggesting modulation of lipid load without altering droplet size \u003cb\u003e(Supplementary Fig.\u0026nbsp;1a-j)\u003c/b\u003e. In females, lipid counts, and area were elevated in the thorax and reduced with exercise, while no changes were observed in the abdomen, indicating limited plasticity \u003cb\u003e(Supplementary Fig.\u0026nbsp;2a-j)\u003c/b\u003e. Lipid intensity in the thorax was decreased under exercised conditions in male \u003cb\u003e(Supplementary Fig.\u0026nbsp;1e).\u003c/b\u003e Given synapsin\u0026rsquo;s presence in neuromuscular junctions and gut (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e), we also analyzed peripheral tissues. Synapsin was elevated in the thorax and abdomen of \u003cem\u003eSk2\u003c/em\u003e males but reduced by exercise only in the thorax, indicating region-specific normalization \u003cb\u003e(Supplementary Fig.\u0026nbsp;1f, j)\u003c/b\u003e. In females, synapsin in the thorax followed similar patterns, both elevated in \u003cem\u003eSk2\u003c/em\u003e mutants and reduced with exercise, while remaining unchanged in the abdomen at 3 weeks \u003cb\u003e(Supplementary Fig.\u0026nbsp;2f, j)\u003c/b\u003e. By 6 weeks, these exercise-driven effects were reduced or absent, reinforcing the notion of an early developmental window for exercise-induced plasticity. Sex comparisons revealed that females generally exhibited higher lipid intensity and synaptic marker levels in the abdomen under enriched conditions at 3 weeks compared to males, suggesting a greater responsiveness to exercise during early development. These observations are consistent with reports that sex hormones modulate lipid metabolism and synaptic plasticity, influencing responsiveness to environmental stimuli. Mechanistically, exercise may stimulate lipid metabolism and synaptic plasticity in peripheral regions through systemic metabolic signaling and neuromuscular activity, which enhance mitochondrial function and neuroplasticity.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eExercise attenuates neuroinflammation and apoptotic signaling in Sk2 mutants: Sex- and age-dependent effects\u003c/h2\u003e \u003cp\u003eqPCR analysis revealed that \u003cem\u003eSk2\u003c/em\u003e mutants exhibit a pronounced neuroinflammatory profile characterized by elevated expression of cytokines (upd1, and upd3) and JAK/STAT signaling components (\u003cem\u003eHop, Stat\u003c/em\u003e), along with the pro-inflammatory marker \u003cem\u003e(Eiger)\u003c/em\u003e and pro-apoptotic gene \u003cem\u003ehid\u003c/em\u003e compared to \u003cem\u003eCS\u003c/em\u003e controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea-l). These changes were evident at both 3 and 6 weeks, indicating that obesity accelerates inflammatory and apoptotic signaling in the brain (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Notably, the magnitude of dysregulation was greater in females than males, particularly at 6 weeks, where \u003cem\u003eSk2 NE\u003c/em\u003e females showed dramatic upregulation of \u003cem\u003eupd\u003c/em\u003e genes and JAK/STAT components (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea-f), suggesting heightened vulnerability to chronic inflammation with age (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eExercise significantly mitigated these effects in both sexes, but the response was stronger in females. In \u003cem\u003eSk2\u003c/em\u003e females, exercise reduced expression of \u003cem\u003eupd1\u003c/em\u003e and \u003cem\u003eupd3\u003c/em\u003e and JAK/STAT components by 50\u0026ndash;70% at 6 weeks, while also lowering \u003cem\u003eEiger\u003c/em\u003e and apoptotic markers (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea\u0026ndash;f). In males, exercise produced moderate reductions in \u003cem\u003eupd\u003c/em\u003e genes and \u003cem\u003eEiger\u003c/em\u003e at 3 weeks, with smaller effects at 6 weeks (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg-l). These findings suggest that exercise exerts a neuroprotective effect by suppressing inflammatory cytokine signaling and apoptosis, with greater efficacy in females and during later life stages (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMechanistically, the stronger female response may reflect sex-specific differences in immune regulation and metabolic stress adaptation, as previously reported in \u003cem\u003eDrosophila\u003c/em\u003e models (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). The age-dependent attenuation of exercise benefits in males aligns with evidence that chronic obesity and aging impair stress resilience and signaling plasticity (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). Interestingly, the observed increase in \u003cem\u003eupd3\u003c/em\u003e expression in thoracic tissue following exercise \u003cb\u003e(Supplementary Fig.\u0026nbsp;3a\u0026ndash;l)\u003c/b\u003e may indicate a JAK/STAT-mediated regenerative response linked to muscle remodeling and systemic metabolic adaptation (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eExercise mitigates cognitive deficits in Sk2 mutants\u003c/h2\u003e \u003cp\u003eTo assess cognitive dysfunction in obese flies, we evaluated olfactory aversion learning. Non-exercised \u003cem\u003eSk2\u003c/em\u003e mutants exhibited pronounced impairments in short-term learning and memory at both 3 and 6 weeks, as shown by reduced performance indices in aversive conditioning assays and decision-making tasks \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea-h\u003cb\u003e).\u003c/b\u003e These deficits were accompanied by odor avoidance impairments, indicating compromised cognitive flexibility \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec, d, g, h\u003cb\u003e)\u003c/b\u003e. Exercise intervention significantly rescued these deficits, restoring memory retention and avoidance behavior to levels comparable to \u003cem\u003eCanton-S (CS)\u003c/em\u003e controls. Improvements were observed in both sexes, but females demonstrated greater benefits at 6 weeks, particularly in odor avoidance and decision-making tasks \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec, d, g, h\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThese cognitive improvements are likely mediated by exercise-induced enhancements in sleep architecture and circadian stability. Sleep plays a critical role in memory acquisition and consolidation in \u003cem\u003eDrosophila\u003c/em\u003e, and sleep deprivation disrupts these (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e). Exercise stabilizes circadian rhythms, increases total sleep, and reduces fragmentation in aging flies, which supports memory consolidation (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e). Furthermore, circadian disruption impairs memory consolidation, highlighting the importance of rhythmicity for cognitive resilience (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e). Our findings align with these studies, suggesting that exercise mitigates obesity-driven cognitive decline by improving sleep\u0026ndash;wake regulation and reducing circadian misalignment. This dual benefit, enhanced sleep continuity and restored memory performance, underscores the systemic role of exercise in promoting neurobehavioral health during aging. These findings suggest that obesity driven by \u003cem\u003eSk2\u003c/em\u003e-mediated metabolic dysfunction increases the risk of cognitive deficits, particularly in learning-memory tasks. This aligns with human studies linking midlife obesity to increased susceptibility to cognitive decline and neurodegenerative disorders (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eEffects of obesity and exercise on sleep-circadian cycle\u003c/h2\u003e \u003cp\u003eTo investigate the effects of obesity on sleep architecture and circadian activity, we utilized \u003cem\u003eCanton-S (CS)\u003c/em\u003e flies and \u003cem\u003eSk2 m\u003c/em\u003eutants, a genetic model of obesity (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e) in age and sex-dependent manner. Sleep and activity patterns were monitored under a 12-hour light/12-hour dark cycle using standard \u003cem\u003eDrosophila\u003c/em\u003e activity monitoring protocols (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). Three-week-old male \u003cem\u003eSk2\u003c/em\u003e mutant flies showed disrupted sleep and activity patterns compared to controls, with reduced total sleep, decreased daytime sleep, and increased nighttime sleep (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea-f). Daytime activity was markedly elevated, indicating circadian rhythm disruption, and sleep architecture was fragmented, as shown by shorter bout lengths (Supplementary Fig.\u0026nbsp;5a-f). These findings align with previous reports linking obesity and circadian misalignment in flies (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eExercise produced modest improvements at 3 weeks. Exercised \u003cem\u003eSk2\u003c/em\u003e males showed partial restoration of daytime sleep compared to non-exercised (NE) groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea-c), although night sleep remained unchanged. Activity counts decreased slightly in exercise groups, particularly during the day, while night activity was unaffected (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed-f). Sleep fragmentation indices improved marginally, with exercised \u003cem\u003eSk2\u003c/em\u003e males exhibiting longer bout lengths than NE counterparts (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eg-i, Supplementary Fig.\u0026nbsp;4d-f), suggesting limited early-life exercise benefits.\u003c/p\u003e \u003cp\u003eBy 6 weeks, exercise effects were diminished. Sleep duration (total, day, night) did not differ significantly between E and NE groups, and activity counts dropped only slightly, particularly night activity in \u003cem\u003eSk2-E\u003c/em\u003e males sleep (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea-f). Fragmentation indices improved marginally in \u003cem\u003eSk2-E\u003c/em\u003e males during daytime, indicating some stabilization of sleep continuity with age (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eg-i). Overall, the graphs show that at 3 weeks, \u003cem\u003eSk2-NE\u003c/em\u003e males had significantly lower total and daytime sleep compared to \u003cem\u003eCS-NE\u003c/em\u003e, while exercise partially restored daytime sleep. Bout length data reveal that \u003cem\u003eSk2-NE\u003c/em\u003e males exhibited shorter bouts at both ages, reflecting fragmented sleep, and exercise improved bout length modestly at 3 weeks but not at 6 weeks. Female \u003cem\u003eSk2\u003c/em\u003e mutants displayed similar circadian disruptions to males, with more sleep occurring at night than during the day, shorter sleep bouts, and increased fragmentation compared to \u003cem\u003eCS\u003c/em\u003e controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea\u0026ndash;i, Supplementary Fig.\u0026nbsp;4g-l). Females slept less overall than males but exhibited comparable activity patterns, characterized by higher daytime activity and lower nighttime activity under NE conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea-f\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eExercise produced more pronounced benefits in females than in males. At 3 weeks, exercise significantly increased total sleep and daytime sleep in both \u003cem\u003eCS\u003c/em\u003e and \u003cem\u003eSk2\u003c/em\u003e females, with the largest improvement observed in \u003cem\u003eSk2\u003c/em\u003e mutants. Night sleep also increased with exercise at both time points. Activity counts decreased in exercised females, particularly during the day, and night activity dropped sharply at 6 weeks, especially in \u003cem\u003eSk2\u003c/em\u003e females (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea-f\u003cb\u003e)\u003c/b\u003e. Sleep fragmentation indices were significantly lower in exercised females compared to NE groups, with \u003cem\u003eSk2\u003c/em\u003e females showing the greatest reduction at 6 weeks (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eg-i\u003cb\u003e)\u003c/b\u003e, indicating improved sleep continuity. Under NE conditions, \u003cem\u003eSk2\u003c/em\u003e females exhibited higher fragmentation and lower activity than CS, but exercise mitigated these differences. These findings are consistent with previous reports that endurance exercise improves sleep\u0026ndash;wake stability and reduces fragmentation in aging \u003cem\u003eDrosophila\u003c/em\u003e, particularly in females (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e). Moreover, sex-dependent differences in sleep architecture and circadian vulnerability have been documented, with females showing greater susceptibility to disruption but also benefiting from interventions (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study demonstrates that exercise exerts broad neuroprotective effects in a genetic model of obesity, mitigating multiple pathological processes associated with aging and metabolic stress. Using \u003cem\u003eSk2\u003c/em\u003e mutants, which exhibit sphingolipid dysregulation and obesity-like traits (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e), we observed profound disruptions in sleep architecture, cognitive performance, lipid metabolism, synaptic integrity, and inflammatory signaling. These findings align with evidence that obesity accelerates neurodegenerative risk through chronic inflammation, lipid accumulation, and circadian misalignment (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eExercise significantly improved sleep continuity and reduce fragmentation, particularly in females, which is consistent with prior reports that physical activity stabilizes circadian rhythms and enhances sleep quality in aging flies (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e). Improved sleep likely contributed to the observed rescue of learning and memory deficits, as sleep is essential for memory consolidation in Drosophila (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e). These behavioral benefits underscore the interplay between metabolic health, circadian regulation, and cognitive resilience.\u003c/p\u003e \u003cp\u003eAt the structural level, \u003cem\u003eSk2\u003c/em\u003e mutants displayed marked lipid deposition and elevated synapsin intensity in the brain, indicating obesity-driven metabolic stress and synaptic remodeling. Exercise reduced lipid object counts and normalized synapsin levels, suggesting improved lipid clearance and synaptic homeostasis. Interestingly, females exhibited structural remodeling of lipid deposits without major synapsin changes, whereas males showed stronger synaptic normalization, Exercise reduced lipid object. These sex-specific patterns may reflect differences in energy allocation and neuronal plasticity, as previously reported in endurance exercise studies (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e) Age further influenced these effects: while exercise remained beneficial at 6 weeks, improvements were\u003c/p\u003e \u003cp\u003eMolecular profiling revealed robust activation of inflammatory cytokines (upd1, upd3), JAK/STAT components (Hop, Stat), and pro-apoptotic genes (hid) in \u003cem\u003eSk2\u003c/em\u003e brains, indicating a state of chronic neuroinflammation and cell death risk. Exercise markedly downregulated these pathways, particularly in females at 6 weeks, suggesting enhanced neuroprotection during later life stages (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). The observed increase in \u003cem\u003eupd3\u003c/em\u003e expression in thoracic tissue following exercise may represent a JAK/STAT-mediated regenerative response linked to muscle remodeling and systemic adaptation (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). These findings align with mammalian studies showing that physical activity reduces neuroinflammatory signaling and preserves synaptic integrity during aging (Harvard Health Publishing, 2022; UCSF, 2022).\u003c/p\u003e \u003cp\u003eCollectively, our results highlight sex and age as critical determinants of exercise benefit. Females exhibited greater improvements in sleep quality, inflammatory suppression, and metabolic remodeling, whereas males showed stronger synaptic recovery and locomotor gains. These differences may arise from sex-specific hormonal and neuromodulatory pathways influencing energy balance and immune regulation (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). Age consistently attenuated exercise benefits, emphasizing the importance of early-life interventions to maximize neuroprotective outcomes (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e \u003cb\u003eand Supplementary Fig.\u0026nbsp;5\u003c/b\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eGiven the evolutionary conservation of lipid metabolism, circadian regulation, and JAK/STAT signaling, these findings have translational relevance for designing lifestyle interventions to combat obesity-related cognitive decline and neurodegenerative risk in humans. Future studies should explore molecular mediators of sex-specific exercise responses and assess whether combining exercise with dietary or pharmacological strategies can further enhance neuroprotection during aging.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eConflict of Interest\u003c/h2\u003e \u003cp\u003eThe authors declare no conflict of interest\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contributions:\u003c/h2\u003e \u003cp\u003eGCM and AY designed the research, with feedback from AMP; AY, MB, JCW, and DP performed the research; AY, MB, and JCW analyzed the data; AY wrote the paper, \u0026amp; all authors reviewed.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eResearch reported in this publication was supported by the National Institutes of Health (NIH) grants AG065992 and RF1NS133378 to G.C.M. Research reported in this publication was also supported by the National Institute on Aging of the National Institutes of Health under Award Number P30AG050886. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.\u003c/p\u003e\u003ch2\u003eData Availability Statement\u003c/h2\u003e \u003cp\u003eThe data that support the findings of this study are available on request from the corresponding author.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMir FA, Lark ARS, Nehs CJ. Unraveling the interplay between sleep, redox metabolism, and aging: implications for brain health and longevity. Front Aging. 2025;6:1605070. Epub 20250521. doi: 10.3389/fragi.2025.1605070. PubMed PMID: 40469623; PubMed Central PMCID: PMC12133771.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRagusa FS, Tanaka T, Veronese N, Mansueto P, Dominguez LJ, Barbagallo M, et al. Weight of time: exploring the link between obesity and aging. Aging Clin Exp Res. 2025;37(1):236. Epub 20250728. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s40520-025-03106-4\u003c/span\u003e\u003cspan address=\"10.1007/s40520-025-03106-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 40720057; PubMed Central PMCID: PMC12304044.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBanerjee D, Mani A. Obesity's systemic impact: exploring molecular and physiological links to diabetes, cardiovascular disease, and heart failure. Front Endocrinol (Lausanne). 2025;16:1681766. Epub 20251107. doi: 10.3389/fendo.2025.1681766. PubMed PMID: 41282294; PubMed Central PMCID: PMC12634369.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun Y, Shan X, Li M, Niu Y, Sun Z, Ma X, et al. Autoimmune mechanisms and inflammation in obesity-associated type 2 diabetes, atherosclerosis, and non-alcoholic fatty liver disease. Funct Integr Genomics. 2025;25(1):84. Epub 20250409. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10142-025-01587-0\u003c/span\u003e\u003cspan address=\"10.1007/s10142-025-01587-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 40205260.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUllah MI, Tamanna S. Obesity: Clinical Impact, Pathophysiology, Complications, and Modern Innovations in Therapeutic Strategies. Medicines (Basel). 2025;12(3). Epub 20250728. doi: 10.3390/medicines12030019. PubMed PMID: 40843857; PubMed Central PMCID: PMC12372088.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHalder SK, Melkani GC. The Interplay of Genetic Predisposition, Circadian Misalignment, and Metabolic Regulation in Obesity. Curr Obes Rep. 2025;14(1):21. Epub 20250301. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s13679-025-00613-3\u003c/span\u003e\u003cspan address=\"10.1007/s13679-025-00613-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 40024983; PubMed Central PMCID: PMC11872776.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuez H, Staels B. Circadian Disruption and the Risk of Developing Obesity. Curr Obes Rep. 2025;14(1):20. Epub 20250213. doi: 10.1007/s13679-025-00610-6. PubMed PMID: 39939483; PubMed Central PMCID: PMC11821678.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGallego-Landin I, Berbegal-Saez P, Valverde O. Chronic circadian disruption in adolescent mice impairs hippocampal memory disrupting gene expression oscillations. Sci Rep. 2025;15(1):26291. Epub 20250719. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-025-12237-7\u003c/span\u003e\u003cspan address=\"10.1038/s41598-025-12237-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 40684045; PubMed Central PMCID: PMC12276311.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGerstner JR, Yin JC. Circadian rhythms and memory formation. Nat Rev Neurosci. 2010;11(8):577\u0026ndash;88. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrn2881\u003c/span\u003e\u003cspan address=\"10.1038/nrn2881\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 20648063; PubMed Central PMCID: PMC6544049.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMusiek ES. Circadian clock disruption in neurodegenerative diseases: cause and effect? Front Pharmacol. 2015;6:29. Epub 20150227. doi: 10.3389/fphar.2015.00029. PubMed PMID: 25774133; PubMed Central PMCID: PMC4343016.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaput JP, Dutil C, Featherstone R, Ross R, Giangregorio L, Saunders TJ, et al. Sleep duration and health in adults: an overview of systematic reviews. Appl Physiol Nutr Metab. 2020;45(10 (Suppl. 2)):S218\u0026ndash;S31. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1139/apnm-2020-0034\u003c/span\u003e\u003cspan address=\"10.1139/apnm-2020-0034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 33054337.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSt-Onge MP, Grandner MA, Brown D, Conroy MB, Jean-Louis G, Coons M, et al. Sleep Duration and Quality: Impact on Lifestyle Behaviors and Cardiometabolic Health: A Scientific Statement From the American Heart Association. Circulation. 2016;134(18):e367\u0026ndash;e86. Epub 20160919. doi: 10.1161/CIR.0000000000000444. PubMed PMID: 27647451; PubMed Central PMCID: PMC5567876.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWalls SM, Jr., Attle SJ, Brulte GB, Walls ML, Finley KD, Chatfield DA, et al. Identification of sphingolipid metabolites that induce obesity via misregulation of appetite, caloric intake and fat storage in Drosophila. PLoS Genet. 2013;9(12):e1003970. Epub 20131205. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pgen.1003970\u003c/span\u003e\u003cspan address=\"10.1371/journal.pgen.1003970\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 24339790; PubMed Central PMCID: PMC3854795.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVillanueva JE, Livelo C, Trujillo AS, Chandran S, Woodworth B, Andrade L, et al. Time-restricted feeding restores muscle function in Drosophila models of obesity and circadian-rhythm disruption. Nat Commun. 2019;10(1):2700. Epub 20190620. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-019-10563-9\u003c/span\u003e\u003cspan address=\"10.1038/s41467-019-10563-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 31221967; PubMed Central PMCID: PMC6586848.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivelo C, Guo Y, Abou Daya F, Rajasekaran V, Varshney S, Le HD, et al. Time-restricted feeding promotes muscle function through purine cycle and AMPK signaling in Drosophila obesity models. Nat Commun. 2023;14(1):949. Epub 20230221. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-023-36474-4\u003c/span\u003e\u003cspan address=\"10.1038/s41467-023-36474-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 36810287; PubMed Central PMCID: PMC9944249.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRavichandran S, Finlin BS, Kern PA, Ozcan S. Sphk2(-/-) mice are protected from obesity and insulin resistance. Biochim Biophys Acta Mol Basis Dis. 2019;1865(3):570\u0026ndash;6. Epub 20181226. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbadis.2018.12.012\u003c/span\u003e\u003cspan address=\"10.1016/j.bbadis.2018.12.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 30593892; PubMed Central PMCID: PMC6368224.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVanherle L, Skoug C, Porschen LT, Gimeno-Ferrer F, Matthes F, JM ND, et al. Sphingosine Kinase 2 Inhibition Ameliorates Neuroinflammation in Diet-Induced Obese Mice. Aging Dis. 2025. Epub 20251014. doi: 10.14336/AD.2025.0636. PubMed PMID: 41135095.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOttensmann L, Tabassum R, Ruotsalainen SE, Gerl MJ, Klose C, Widen E, et al. Genome-wide association analysis of plasma lipidome identifies 495 genetic associations. Nat Commun. 2023;14(1):6934. Epub 20231031. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-023-42532-8\u003c/span\u003e\u003cspan address=\"10.1038/s41467-023-42532-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 37907536; PubMed Central PMCID: PMC10618167.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFitzpatrick AL, Kuller LH, Lopez OL, Diehr P, O'Meara ES, Longstreth WT, Jr., et al. Midlife and late-life obesity and the risk of dementia: cardiovascular health study. Arch Neurol. 2009;66(3):336\u0026ndash;42. doi: 10.1001/archneurol.2008.582. PubMed PMID: 19273752; PubMed Central PMCID: PMC3513375.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGe X, Zheng M, Hu M, Fang X, Geng D, Liu S, et al. Butyrate ameliorates quinolinic acid-induced cognitive decline in obesity models. J Clin Invest. 2023;133(4). Epub 20230215. doi: 10.1172/JCI154612. PubMed PMID: 36787221; PubMed Central PMCID: PMC9927952.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Joshi P, Ang TFA, Liu C, Auerbach S, Devine S, et al. Mid- to Late-Life Body Mass Index and Dementia Risk: 38 Years of Follow-up of the Framingham Study. Am J Epidemiol. 2021;190(12):2503\u0026ndash;10. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/aje/kwab096\u003c/span\u003e\u003cspan address=\"10.1093/aje/kwab096\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 33831181; PubMed Central PMCID: PMC8796797.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDhurandhar Y, Tomar S, Das A, Prajapati JL, Singh AP, Bodake SH, et al. Chronic inflammation in obesity and neurodegenerative diseases: exploring the link in disease onset and progression. Mol Biol Rep. 2025;52(1):424. Epub 20250425. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11033-025-10509-z\u003c/span\u003e\u003cspan address=\"10.1007/s11033-025-10509-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 40274681.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLe Thuc O, Garcia-Caceres C. Obesity-induced inflammation: connecting the periphery to the brain. Nat Metab. 2024;6(7):1237\u0026ndash;52. Epub 20240712. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s42255-024-01079-8\u003c/span\u003e\u003cspan address=\"10.1038/s42255-024-01079-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 38997442.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchmitt LO, Gaspar JM. Obesity-Induced Brain Neuroinflammatory and Mitochondrial Changes. Metabolites. 2023;13(1). Epub 20230105. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/metabo13010086\u003c/span\u003e\u003cspan address=\"10.3390/metabo13010086\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 36677011; PubMed Central PMCID: PMC9865135.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHawley JA, Hargreaves M, Joyner MJ, Zierath JR. Integrative biology of exercise. Cell. 2014;159(4):738\u0026ndash;49. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2014.10.029\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2014.10.029\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 25417152.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFlatt T, Partridge L. Horizons in the evolution of aging. BMC Biol. 2018;16(1):93. Epub 20180820. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12915-018-0562-z\u003c/span\u003e\u003cspan address=\"10.1186/s12915-018-0562-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 30124168; PubMed Central PMCID: PMC6100731.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePiazza N, Gosangi B, Devilla S, Arking R, Wessells R. Exercise-training in young Drosophila melanogaster reduces age-related decline in mobility and cardiac performance. PLoS One. 2009;4(6):e5886. Epub 20090611. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0005886\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0005886\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 19517023; PubMed Central PMCID: PMC2691613.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeo JW, No MH, Park DH, Kang JH, Seo DY, Han J, et al. Effects of exercise on obesity-induced mitochondrial dysfunction in skeletal muscle. Korean J Physiol Pharmacol. 2017;21(6):567\u0026ndash;77. Epub 20171030. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4196/kjpp.2017.21.6.567\u003c/span\u003e\u003cspan address=\"10.4196/kjpp.2017.21.6.567\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 29200899; PubMed Central PMCID: PMC5709473.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSujkowski A, Ramesh D, Brockmann A, Wessells R. Octopamine Drives Endurance Exercise Adaptations in Drosophila. Cell Rep. 2017;21(7):1809\u0026ndash;23. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2017.10.065\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2017.10.065\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 29141215; PubMed Central PMCID: PMC5693351.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng T, Ding M, Yan H, Zhang P, Tian R, Guo Y, et al. Endurance exercise upregulates mtp expression in aged Drosophila to ameliorate age-related diastolic dysfunction and extend lifespan. Physiol Rep. 2024;12(3):e15929. doi: 10.14814/phy2.15929. PubMed PMID: 38307709; PubMed Central PMCID: PMC10837045.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWen DT, Wang WQ, Hou WQ, Cai SX, Zhai SS. Endurance exercise protects aging Drosophila from high-salt diet (HSD)-induced climbing capacity decline and lifespan decrease by enhancing antioxidant capacity. Biol Open. 2020;9(5). Epub 20200529. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1242/bio.045260\u003c/span\u003e\u003cspan address=\"10.1242/bio.045260\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 32414766; PubMed Central PMCID: PMC7272356.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePiper MDW, Partridge L. Drosophila as a model for ageing. Biochim Biophys Acta Mol Basis Dis. 2018;1864(9 Pt A):2707\u0026ndash;17. Epub 20170928. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbadis.2017.09\u003c/span\u003e\u003cspan address=\"10.1016/j.bbadis.2017.09\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.016. PubMed PMID: 28964875.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eProtasiewicz J, Snider S, Khan M, Tao L, Wessells RJ, Sujkowski A. A new Drosophila model of prolonged inactivity shortens lifespan and impairs muscle function. Sci Rep. 2025;15(1):27908. Epub 20250731. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-025-13446-w\u003c/span\u003e\u003cspan address=\"10.1038/s41598-025-13446-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 40745192; PubMed Central PMCID: PMC12314096.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivelo C, Guo Y, Madhanagopal J, Morrow C, Melkani GC. Time-restricted feeding mediated modulation of microbiota leads to changes in muscle physiology in Drosophila obesity models. Aging Cell. 2025;24(2):e14382. Epub 20241024. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/acel.14382\u003c/span\u003e\u003cspan address=\"10.1111/acel.14382\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 39446089; PubMed Central PMCID: PMC11822661.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChocron ES, Munkacsy E, Kim HS, Karpowicz P, Jiang N, Van Skike CE, et al. Genetic and pharmacologic proteasome augmentation ameliorates Alzheimer's-like pathology in mouse and fly APP overexpression models. Sci Adv. 2022;8(23):eabk2252. Epub 20220608. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/sciadv.abk2252\u003c/span\u003e\u003cspan address=\"10.1126/sciadv.abk2252\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 35675410; PubMed Central PMCID: PMC9177073.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeschi E, Duquenoy L, Otto N, Dempsey G, Waddell S. Compensatory enhancement of input maintains aversive dopaminergic reinforcement in hungry Drosophila. Neuron. 2024;112(14):2315\u0026ndash;32 e8. Epub 20240524. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.neuron.2024.04.035\u003c/span\u003e\u003cspan address=\"10.1016/j.neuron.2024.04.035\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 38795709.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMunkacsy E, Chocron ES, Quintanilla L, Gendron CM, Pletcher SD, Pickering AM. Neuronal-specific proteasome augmentation via Prosbeta5 overexpression extends lifespan and reduces age-related cognitive decline. Aging Cell. 2019;18(5):e13005. Epub 20190723. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/acel.13005\u003c/span\u003e\u003cspan address=\"10.1111/acel.13005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 31334599; PubMed Central PMCID: PMC6718538.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoraes RCM, Roth JR, Mao H, Crawley SR, Xu BP, Watson JC, et al. Apolipoprotein E Induces Lipid Accumulation Through Dgat2 That Is Prevented with Time-Restricted Feeding in Drosophila. Genes (Basel). 2024;15(11). Epub 20241025. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/genes15111376\u003c/span\u003e\u003cspan address=\"10.3390/genes15111376\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 39596576; PubMed Central PMCID: PMC11594465.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoth JR, de Moraes RCM, Xu BP, Crawley SR, Khan MA, Melkani GC. Rapamycin reduces neuronal mutant huntingtin aggregation and ameliorates locomotor performance in Drosophila. Front Aging Neurosci. 2023;15:1223911. Epub 20230926. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fnagi.2023.1223911\u003c/span\u003e\u003cspan address=\"10.3389/fnagi.2023.1223911\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 37823007; PubMed Central PMCID: PMC10562706.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWatson J, Roth JR, Melkani GC. Direct Cryosectioning of Drosophila Heads for Enhanced Brain Fluorescence Staining and Immunostaining. J Vis Exp. 2025(216). Epub 20250207. doi: 10.3791/67791. PubMed PMID: 39995173.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Q, Wang L, Cao Y, Wang X, Tang C, Zheng L. Stable Expression of dmiR-283 in the Brain Promises Positive Effects in Endurance Exercise on Sleep-Wake Behavior in Aging Drosophila. Int J Mol Sci. 2023;24(4). Epub 20230220. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms24044180\u003c/span\u003e\u003cspan address=\"10.3390/ijms24044180\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 36835595; PubMed Central PMCID: PMC9966282.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWoodling N. Sex- and strain-dependent effects of ageing on sleep and activity patterns in Drosophila. PLoS One. 2024;19(8):e0308652. Epub 20240816. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0308652\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0308652\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 39150918; PubMed Central PMCID: PMC11329114.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChou VT, Johnson SA, Van Vactor D. Synapse development and maturation at the drosophila neuromuscular junction. Neural Dev. 2020;15(1):11. Epub 20200802. doi: 10.1186/s13064-020-00147-5. PubMed PMID: 32741370; PubMed Central PMCID: PMC7397595.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiguel-Aliaga I, Jasper H, Lemaitre B. Anatomy and Physiology of the Digestive Tract of Drosophila melanogaster. Genetics. 2018;210(2):357\u0026ndash;96. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1534/genetics.118.300224\u003c/span\u003e\u003cspan address=\"10.1534/genetics.118.300224\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 30287514; PubMed Central PMCID: PMC6216580.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Chouhan NS, Zhang SL, Moore RS, Noya SB, Shon J, et al. Modulation of RNA processing genes during sleep-dependent memory. Elife. 2024;12. Epub 20241206. doi: 10.7554/eLife.89023. PubMed PMID: 39642051; PubMed Central PMCID: PMC11623928.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarquand K, Roselli C, Cervantes-Sandoval I, Boto T. Sleep benefits different stages of memory in Drosophila. Front Physiol. 2023;14:1087025. Epub 20230119. doi: 10.3389/fphys.2023.1087025. PubMed PMID: 36744027; PubMed Central PMCID: PMC9892949.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi QF, Wang H, Zheng L, Yang F, Li HZ, Li JX, et al. Effects of Modest Hypoxia and Exercise on Cardiac Function, Sleep-Activity, Negative Geotaxis Behavior of Aged Female Drosophila. Front Physiol. 2019;10:1610. Epub 20200121. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fphys.2019.01610\u003c/span\u003e\u003cspan address=\"10.3389/fphys.2019.01610\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 32038290; PubMed Central PMCID: PMC6985434.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin JCP, Cui E, Hardin PE, Zhou H. Circadian disruption of memory consolidation in Drosophila. Front Syst Neurosci. 2023;17:1129152. Epub 20230322. doi: 10.3389/fnsys.2023.1129152. PubMed PMID: 37034015; PubMed Central PMCID: PMC10073699.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoomgarden AC, Sagewalker GD, Shah AC, Haider SD, Patel P, Wheeler HE, et al. Chronic circadian misalignment results in reduced longevity and large-scale changes in gene expression in Drosophila. BMC Genomics. 2019;20(1):14. Epub 20190107. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12864-018-5401-7\u003c/span\u003e\u003cspan address=\"10.1186/s12864-018-5401-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 30616504; PubMed Central PMCID: PMC6323780.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuarte T, Loreto JS, Michelotti P, Rieder GS, Senger LR, Dos Santos EL, et al. Sex shapes the systemic response to light-induced sleep disruption in Drosophila melanogaster. J Exp Biol. 2025;228(17). Epub 20250902. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1242/jeb.250079\u003c/span\u003e\u003cspan address=\"10.1242/jeb.250079\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PubMed PMID: 40771107.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"international-journal-of-obesity","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"ijo","sideBox":"Learn more about [International Journal of Obesity](http://www.nature.com/ijo/)","snPcode":"41366","submissionUrl":"https://mts-ijo.nature.com/cgi-bin/main.plex","title":"International Journal of Obesity","twitterHandle":"@intjobesity","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Genetic obesity, cognitive dysfunction, sleep/circadian activity, neuroinflammation, exercise","lastPublishedDoi":"10.21203/rs.3.rs-8563103/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8563103/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eGenetic obesity is an escalating health challenge with profound consequences for brain function, yet the mechanisms linking metabolic dysfunction to disrupted brain aging remain poorly understood. Although sphingolipid dysmetabolism is strongly associated with the obesity\u0026ndash;neuronal axis, its mechanistic basis has not been fully explored. To address this gap, our study identifies a loss-of-function mutation in sphingosine kinase 2 (\u003cem\u003eSk2\u003c/em\u003e), the \u003cem\u003eDrosophila\u003c/em\u003e ortholog of human sphingosine kinase 2 (SPHK2), as a key driver of obesity-associated neural dysfunction and evaluates the ability of exercise to mitigate these effects. We demonstrate that Sk2-driven obesity results in cognitive decline characterized by impaired memory, lipid dysregulation, chronic neuroinflammation, and disrupted sleep\u0026ndash;circadian rhythms in a sex- and tissue-specific manner. Importantly, we show that exercise acts as a robust therapeutic intervention, reversing memory deficits, restoring brain lipid homeostasis, and normalizing sleep\u0026ndash;circadian activity. Mechanistically, our findings identify the JAK/STAT signaling pathway as a critical mediator of exercise-induced neuroprotection, linking reduced neuroinflammation with enhanced cognitive resilience. Notably, we uncover distinct sex- and age-dependent differences in both obesity-induced impairments and responsiveness to exercise, indicating divergent regulatory mechanisms between males and females. Together, these findings establish a novel link between genetic obesity, brain dysfunction, and lifestyle-based interventions, highlighting exercise as a promising non-pharmacological strategy to counteract obesity-associated neurocognitive and circadian disturbances.\u003c/p\u003e","manuscriptTitle":"Exercise Attenuates Obesity-Related Cognitive and Sleep-Circadian Dysfunctions by Attenuating Neuroinflammation via JAK/STAT in Sex and Age Specific Manner","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-16 19:44:25","doi":"10.21203/rs.3.rs-8563103/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2026-02-06T15:06:40+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-02-05T04:38:42+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-02-05T00:57:28+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-01-22T15:09:00+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-01-13T15:44:24+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2026-01-13T10:36:16+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-12T16:21:17+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-09T16:53:22+00:00","index":"","fulltext":""},{"type":"submitted","content":"International Journal of Obesity","date":"2026-01-09T16:53:22+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"international-journal-of-obesity","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"ijo","sideBox":"Learn more about [International Journal of Obesity](http://www.nature.com/ijo/)","snPcode":"41366","submissionUrl":"https://mts-ijo.nature.com/cgi-bin/main.plex","title":"International Journal of Obesity","twitterHandle":"@intjobesity","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"d43639d3-a68c-4838-99fc-402e32beaf9f","owner":[],"postedDate":"January 16th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":61057540,"name":"Biological sciences/Physiology/Metabolism/Metabolic diseases/Obesity"},{"id":61057541,"name":"Biological sciences/Neuroscience/Cognitive neuroscience/Cognitive control"}],"tags":[],"updatedAt":"2026-05-01T23:30:42+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-16 19:44:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8563103","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8563103","identity":"rs-8563103","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}