Knockdown of LOX-1 ameliorates cardiac hypertrophy in alcoholic cardiomyopathy via inactivating the p38MAPK pathway

Knockdown of LOX-1 ameliorates cardiac hypertrophy in alcoholic cardiomyopathy via inactivating the p38MAPK pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Knockdown of LOX-1 ameliorates cardiac hypertrophy in alcoholic cardiomyopathy via inactivating the p38MAPK pathway Yifan Zhang, Bo Yuan, Yue Xu, Na Zhou, Xin Wang, Xiaoyan Lv, Zhanbin Feng This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4733824/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background One of the characteristics of alcoholic cardiomyopathy (ACM) is cardiac hypertrophy, which was reported to be related to lectin-like oxidized low-density lipoprotein receptor 1 (LOX-1), but the mechanism needs to be explored. Here, we explored how LOX-1 facilitated ACM induced cardiac hypertrophy and its molecular mechanisms. Methods H9C2 cells and rats were treated with alcohol to establish ACM models in vitro and in vivo , and before alcohol treatment, H9C2 cells were transfected with sh/oe-LOX-1 and oe-P38MAPK adenovirus vector to knockdown or overexpression LOX-1 and P38MAPK. Hematoxylin-eosin staining (HE) and transmission electron microscopy (TEM) were used to quantify cardiomyocyte area and observe autophagosomes, respectively. RT-qPCR and western blot were used to detect the mRNA and protein expression of LOX-1, P38MAPK, p-P38MAPK, markers of cardiac hypertrophy, autophagy and apoptosis in H9C2 cells and rats, respectively. Furthermore, ACM rats were injected with of sh-LOX-1 to test whether LOX-1 knockdown could alleviate alcohol-induced heart injury by inhibiting the P38MAPK signaling pathway. Results Alcohol induced H9C2 cells hypertrophy, obvious autophagy as well as apoptosis, and increased the expression of LOX-1 and P38MAPK. LOX-1 overexpression enhanced the deleterious effects of alcohol, whereas sh-LOX-1 relatively counteracted. The rescure experiment showed that P38MAPK overexpression partially counteracted the protective effect of LOX-1 knockdown by promoting hypertrophy, autophagy and apoptosis in H9C2 cells. In addition, sh-LOX-1 ameliorated alcohol-induced cardiac injury in rats. Conclusion LOX-1 knockdown could inhibit P38MAPK signaling pathway to exert anti-hypertrophy, anti-autophagy and anti-apoptosis effects in ACM. LOX-1 is expected to be a potential target for the treatment of ACM. LOX-1 alcoholic cardiomyopathy P38MAPK signaling pathway cardiac hypertrophy autophagy apoptosis ACM Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction The most prevalent form of ethanol-induced heart damage is alcoholic cardiomyopathy (ACM), which arises from chronic and excessive alcohol abuse. The typical presentation of ACM includes cardiac hypertrophy, ventricular dilatation, disorganization of myofibrils, and impaired cardiac function [ 1 , 2 ]. Cardiac hypertrophy, characterized by an increase in the size of cardiomyocytes, was a prevalent pathological process observed in various cardiovascular diseases and was considered to be an independent risk factor for elevated morbidity and mortality associated with cardiovascular disorders [ 3 ]. Therefore, exploring the underlying mechanism of myocardial hypertrophy was conducive to providing a potential therapeutic target for ACM patients, which may provide an important reference for reducing patient mortality and improving long-term prognosis. LOX-1 was the major receptor of oxidized low-density lipoprotein (oxLDL), which could be activated by oxidative stress and pro-inflammatory cytokines, then stimulated its downstream inflammatory reaction and signaling pathways (P38MAPK, NF-κB) to response to cellular inflammation and oxidative stress, exerting important roles in cardiovascular diseases [ 4 – 7 ]. After alcohol treatment, the up-regulated expression of LOX-1 was reported to enhance collagen deposition and hypertrophy of cardiac fibroblasts, however knockdown of LOX-1 or the use of LOX-1 inhibitors showed the opposite results [ 4 ]. Moreover, knockdown of LOX-1 ameliorated alcohol-induced damages and improved cardiac function in rats [ 4 , 8 ]. It was showed that LOX-1 was upregulated in rats with ACM [ 4 ]. However, the underlying mechanism of how LOX-1 promotes cardiac hypertrophy remained to be further explored. P38MAPK was a group of kinases activated by inflammation and stress and the differential expression of P38MAPK could cause myocardial hypertrophy, fibrosis, cardiac remodeling, cardiac function damage, which eventually likely to develop heart failure [ 9 – 13 ]. Blocking the P38MAPK pathway could improve cardiac function and inhibit hypertrophy and fibrosis [ 14 , 15 ]. Moreover, P38MAPK could be activated by ethanol and involved in the pathogenesis of alcoholic cardiomyopathy [ 10 , 16 ]. In addition, it has been reported that LOX-1 could regulate endothelial cell apoptosis and inflammatory activation of microglia by affecting the expression of P38MAPK [ 17 , 18 ]. However, whether the LOX-1 regulation of P38MAPK could play a role in ACM needs to be explored. Cardiomyocyte hypertrophy was an important pathological change of cardiac hypertrophy, which mainly characterized as the increase in cardiomyocyte size accompanied by the up-regulation of hypertrophy markers such as ANP and BNP, as well as the conversion of contractile α-myosin heavy chain (α-MHC) to embryonic β-myosin heavy chain (β-MHC) [ 19 , 20 ]. MYH6 and MYH7 genes encode α-MHC and β-MHC, respectively [ 21 ]. MEF2 was a key transcription factor in cardiac hypertrophy, and the expression of MEF2C was up-regulated during cardiomyocyte hypertrophy [ 22 , 23 ]. MEF2C was an important downstream gene of P38MAPK. Activation of P38MAPK could enhance the expression of MEF2C, which subsequently induced the re-expression of embryonic genes, such as MYH7, and resulted in cardiomyocyte hypertrophy [ 22 , 24 ]. However, whether P38MAPK/MEF2C axis is involved in the regulation of LOX-1 on cardiomyocyte hypertrophy in ACM still needs further investigation. Autophagy was an important process regulating the survival of organisms in stress and nutrient deprivation circumstance, and it was activated in many cardiac pathological diseases, including septic heart malformations, heart failure, cardiomyopathy, and cardiac hypertrophy [ 25 , 26 ]. Autophagy was closely related to ACM, and the levels of autophagy markers Beclin-1 and LC3-II were increased in the hearts of rats treated with long-term alcohol [ 1 , 27 ]. Besides, the inhibition of autophagy could reduce cardiac hypertrophy [ 28 ]. In addition, alcohol-induced apoptosis was also caused by the up-regulation of autophagy, and inhibiting excessive autophagy could improve cardiac abnormalities and cardiomyocyte apoptosis caused by alcohol challenge [ 2 , 29 ]. It has been reported that P38MAPK signaling pathway was positively involved in the regulation of autophagy [ 30 ]. P38MAPK could induce apoptosis through autophagy [ 31 ]. Therefore, we speculated that LOX-1 induced autophagy through P38MAPK signaling pathway, thereby affecting hypertrophy and apoptosis in ACM. In this study, we aimed to investigate the effect of LOX-1 on cardiac hypertrophy using in vitro and in vivo ACM models to provide therapeutic target selection and theoretical basis for the treatment of ACM. Material and methods Cells and rats H9C2 rat myofibroblasts (Procell, China) were inoculated in medium composed of DMEM + 10% FBS + 1% antibiotics (Procell, China). The cells were divided into 6 groups (Blank, ACM, ACM + oe-LOX-1, ACM + sh-NC, ACM + sh-LOX-1, and ACM + sh-LOX-1 + oe-P38MAPK). Except for the blank group, H9C2 cells in other groups were incubated with 200 mmol/L alcohol for 24 h to trigger ACM in vitro . To knock down or overexpress LOX-1/P38MAPK in H9C2 cells, before alcohol treatment the specific sequences were connected to the pIRES2-EGFP vector (GenScript, Piscataway, NJ, USA), which were then instantaneously transfected into H9C2 cells with Lipofectamine 3000 reagent (ThermoFisher, USA), and the cells were then collected for the subsequent experiments. This study followed the National Institutes of Health (NIH) laboratory guidelines and was approved by the Animal Care Committee and Ethics Committee of Xi'an Ninth Hospital. Thirty healthy adult male Sprague-Dawley (SD) rats (Limibio, China) were selected and randomly divided into 3 groups (Blank, ACM, ACM + sh-LOX-1), fed in an environment of 24˚C and 50% humidity, with a 12-h light-dark cycle to supply food and water for two weeks. To knock down LOX-1 expression in rats, the adenovirus vectors containing shRNA (Genepharma, China) were applied by tail vein injection. Different from the normal feeding in the blank group, the rats in ACM and ACM + sh-LOX-1 group were given 52% alcohol 10 ml/kg twice per day for 16 weeks to induce ACM. Ultrasonic cardiogram was performed on the day before the rats were sacrificed. Finally, the rats were sacrificed by euthanasia using CO 2 , the blood and myocardial tissues were collected for subsequent analysis [ 4 ]. Hematoxylin-eosin staining (HE) H9C2 cells and myocardial tissue of rats in each group were fixed with 4% paraformaldehyde, washed and stained with HE staining kit (Solarbio, China). The morphological changes of cardiomyocytes were observed by microscope and statistics using Graphpad Prism 8.3.0 (Graphpad, USA) [ 32 ]. Transmission electron microscopy (TEM) After fixation (4 h) with glutaraldehyde (2.5%), H9C2 cells in each group were pre-embedded in agar, rinsed three times with the rinsing solution, and then fixed in osmium acid (1%, 4°C) for 2 h. Next, the cells were dehydrated in an ethanol gradient, transitioned to propylene oxide, and embedded after resin infiltration, and polymerized at 60°C. The embedded blocks were ultrasonically sectioned with a UC7 ultrathin sectioning machine (Leica, Germany), followed by double-stained using uranyl acetate and lead citrate, and eventually observed the ultrastructure under HT7700 microscopy (Hitachi, Japan). Flow cytometry Cells of each group were collected and suspended in 1 × Annexin V Bingding Buffer. Then, cells were stained with Annexin V-FITC and propidium iodide (PI) using a cell apoptosis detection kit (Procell Life Scinece & Technology Co., Ltd, China). After incubating for 20 min, cell apoptosis was analyzed by flow cytometry (BD Biosciences, NJ, USA). The percentage of apoptotic cells was analyzed using FlowJo software (Becton–Dickinson-San Jose, CA, USA). Echocardiogram The cardiac function of rats was checked using the Vevo 3100 Preclinical Imaging System (Fuji, Japan) and MX probe at 15 MHz. After the rats were paralyzed using 3% isoflurane the left ventricular diameter (LVID-d) value, ejection fraction (EF) value, fractional shortening (FS) value as well as the left ventricle mass (LVM) value were obtained via the Vevo Anesthesia System (Fuji, Japan). Determination of biochemical parameters The supernatant was collected from rat serum. LDH activity was determined using a commercial kit (Jiancheng, Nanjing, China), and cTnI and CK-MB were detected using the corresponding ELISA kits (Jiancheng, Nanjing, China). TUNEL staining Apoptosis rates in mouse heart tissue sections were analyzed using TUNEL staining (Roche Applied Science, Upper Bavaria, Germany) according to the manufacturer’s protocol. In summary, the slides were incubated with 500 µl TUNEL reaction mixture (50 µl TdT and 450 µl fluorescein-labeled dUTP) at 37°C for 1 h, and the total number of cells was determined by DAPI staining. The slides were viewed under microscope, and the apoptosis rate was calculated as the percentage of TUNEL-positive cells in the total number of DAPI-stained cells. RT-qPCR RNA in cells was extracted using Trizol (ABI, USA) and the concentrations of RNA samples were detected by Qubit fluorometer (ThermoFisher, USA), RNA purity was detected by A260/A280 ratio, ratio range 1.8 ~ 2.1, RNA concentration calculation formula: A260*40 ng/µl. The reverse transcription process was executed with SuperScript III RT Kit (ABI, USA), a 20 uL reaction system was constructed and the cDNA was synthesized under the reaction conditions of 65℃, 5 min; 42℃, 60 min; 85℃, 10 min. The SYBR qPCR Mix (ABI, USA) reaction conditions (95℃ for 5 min; 95℃ for 10 s, 58℃ for 20 s, 72℃ for 20 s, total 40 cycles) were selected, and the RT-qPCR was performed with the QuantStudio 7 Pro System (ABI, USA). The primer sequences were shown in Table 1 . Relative mRNA expression was normalized by the 2 −ΔΔCt method using β-actin. Table 1 Primer sequences for RT-qPCR. Target Name Primer β-actin Forward CTGAACGTGAAATTGTCCGAGA Reverse TTGCCAATGGTGATGACCTG LOX-1 Forward AGAGGGAACTGAAGGAACAG Reverse ACACTTGCGAAGTCTCCTCA P38MAPK Forward CCCCGAGATTATGCTGAATTGGA Reverse ACAACGTTCTTCCGGTCAACA ANP Forward TGGGACCCCTCCGATAGATCTGC Reverse CGCTCTGGGCTCCAATCCTG BNP Forward CTCTCAAAGGACCAAGGCCCTA Reverse GCAGCTTGAACTATGTGCCATC MEF2C Forward CCAAATCTCCTCCCCCTATG Reverse ATCCTCCCATTCCCTGTCCT MYH6 Forward GCTGGAGAAGAACAAGGACCCTC Reverse CCTTTGCCTTTCCCACTGTCAC MYH7 Forward ATCTTCTCCATCTCTGACAACGC Reverse CCTCTTGGTGTTGACGGTCT Beclin-1 Forward GAATGAGGGCGACAGTGAAC Reverse CCTGGACCTTCTCCAGGTTT ATG5 Forward CTGGATGGGACTGCAGAATGATTT Reverse GAAAGGCCGTTCAGTTGTGG LC3 Forward AGTGGAAGATGTCCGGCTCAT Reverse GCTGCTTCTCACCCTTGTATCG P62 Forward CAGCTGCTGTCCGTAGAAATTG Reverse CAGGGATCAGTACCCGCTCT LAMP1 Forward CCACAGGATCAACCTTCCCC Reverse ATGCTCTGGTCACAGTCGTG Bax Forward AGGGTTTCATCCAGGATCGAGCA Reverse AGTTCATCGCCAATTCGCCTGAG Cleaved caspase-3 Forward TGTGGACCTGAAAAAAC Reverse GCCTGAATGATGAAGAG Western blot Protein was extracted with Protein Extraction Kit (Abcam, USA) and its concentration was measured with BCA assay Kit (ThermoFisher, USA). After separation by SDS-PAGE and transferred to the PVDF membrane (Merck, Germany). The samples were blocked and treated with primary antibodies against β-actin (ab6276), LOX-1 (ab60178), α-MHC (ab185967), β-MHC (ab172967), P-P38MAPK (ab4822), ANP (ab189921), BNP (ab19645), P38MAPK (ab170099), MEF2C (ab211493), Bax (ab32503), Beclin-1 (ab207612), Cleaved caspase-3 (#9661, CST, USA), LC3-II/LC3-I (ab192890), ATG5 (ab108327), p62 (ab109012) and LAMP1 (ab13523) at 4°C for 12 h. Then secondary HRP-conjugated antibody (Abcam, USA) was applied for 1 h. Next, the diamine benzidine kit (ThermoFisher, USA) was used to visualize the bands, and the relative protein expression was analyzed by Image J 1.53 software (NIH, USA). Statistical analysis The experiments were repeated three times, and the data were expressed as mean ± standard deviation (mean ± SD). SPSS 26.0 (IBM, USA) and Graphpad Prism 8.3.0 (Graphpad, USA) were executed for data analyses and graph drawing, respectively. Student’s t-test and one-way analysis of variance (ANOVA) were used for inter-group and multi-group statistically significant differences analyses, respectively. P < 0.05 was considered statistically significant. Results Knockdown of LOX-1 inhibited cardiomyocyte hypertrophy in alcohol-treated H9C2 cells via inactivating P38MAPK signaling pathway in vitro After treating H9C2 cells with alcohol for 24 h, the results of RT-qPCR showed that the expression of cardiomyocyte hypertrophy markers including ANP, BNP, MEF2C, and MYH7 were up-regulated in ACM group than that in the Blank group while the expression of MYH6 was the opposite, suggesting modeling success (Fig. 1 B). And western blot results showed the same as RT-qPCR (Fig. 1 C, 1 D). In addition, the expression levels of LOX-1 and P38MAPK as well as p-P38MAPK were significantly higher in ACM group than that in the Blank group, which suggested that LOX-1 and P38MAPK pathway may be involved in cardiomyocyte hypertrophy in ACM (Fig. 1 C, 1 D). To further test whether LOX-1 plays a role in cardiomyocyte hypertrophy through the P38MAPK pathway, we did LOX-1overexpression/knockdown experiments and P38MAPK overexpression rescue experiment. We found that alcohol treatment could increase the expression of P38MAPK in ACM group, and its expression was down-regulated or up-regulated with the knockdown or overexpression of LOX-1 (Fig. 1 C, 1 D). Besides, LOX-1 not only changed the protein expression of P38MAPK, but also changed the phosphorylation level of P38MAPK (Fig. 1 C, 1 D). In addition, the expression levels of cardiomyocyte hypertrophy markers ANP, BNP, MEF2C, and β-MHC were up-regulated while α-MHC expression was down-regulated in the ACM model, suggesting that LOX-1 promoted the increase of cardiomyocyte hypertrophy related indicators (Fig. 1 C, 1 D). When LOX-1 was knocked down, the expression of cardiomyocyte hypertrophy markers the opposite. What’s more, when P38MAPK was overexpressed while LOX-1 was knocked down, the anti-hypertrophy impact of sh-LOX-1 was partially counteracted by overexpression of P38MAPK (Fig. 1 C, 1 D). The results of HE staining were the same as western blot in all groups. It was showed that the ACM group had a larger cell surface area than the blank group, showing cell hypertrophy (Fig. 1 E, 1 F). Upregulation of LOX-1 increased cell surface area to aggravate cell hypertrophy, while knockdown of LOX-1 was the opposite (Fig. 1 E, 1 F). Similarly, the ameliorate hypertrophy effect of sh-LOX-1 in H9C2 cells was partially rescued by overexpression of P38MAPK. Therefore, the results implied that knockdown of LOX-1 could alleviate cardiomyocyte hypertrophy in H9C2 cells by inhibiting the P38MAPK signaling pathway. Previous studies have reported that P38MAPK signaling pathway was positively involved in the regulation of autophagy, and LOX-1 was also related to autophagy [ 30 , 33 ]. In addition, the inhibition of autophagy could reduce cardiac hypertrophy [ 28 ]. To further test whether LOX-1 regulates cardiomyocyte hypertrophy by affecting autophagy through the P38MAPK pathway, TEM was used to detected the autophagy levels. The results showed that there was no significant autophagy observed in H9C2 cardiomyocytes in the blank group, and there were no autophagic vesicles or riboproteins detected. In contrast, the autophagic vesicles and riboproteins and terminal autophagic vacuoles could be observed in ACM group and the similar results were also observed in ACM + sh-NC group. However, overexpression of LOX-1 aggravated the autophagic changes in the cells because a large number of autophagic vesicles and riboproteins were observed in this group, as well as the forming autophagic vesicles, broken cristae and structurally disorganized mitochondria were detected. Besides, the number of autophagic vesicles and riboprotein expressions were reduced in the ACM + sh-LOX-1 group compared with the ACM + sh-NC group. Moreover, overexpression of P38MAPK neutralized the inhibitory effects of sh-LOX-1 on cell autophagy (Fig. 2 A). Alcohol could induce excessive autophagy to cause myocardial cell apoptosis, and P38MAPK was closely related to cell apoptosis [ 27 , 29 ]. To test whether LOX-1 affects apoptosis by regulating P38MAPK, we observe cardiomyocyte apoptosis by flow cytometry. And the results showed that the apoptotic cells in the ACM group was more than that of the Blank group. And on this basis, overexpression of LOX-1 made the situation worse while the situation was significantly improved after LOX-1 knockdown. In addition, the inhibitory effect of sh-LOX-1 on cell apoptosis was partially rescued by overexpression of P38MAPK (Fig. 2 B, 2 C). Besides, results of RT-qPCR and western blot showed that the changes in the expression levels of autophagy-related markers (Beclin-1, LC3-I, LC3-II ATG5, p62 and LAMP1) were consistent with the TEM schematic (Fig. 2 D, 2 E). This part of the results suggested that the knockdown of LOX-1 could inhibit the P38MAPK signaling pathway to reduce excessive autophagy and thus exert anti-hypertrophy effect on cardiomyocytes in H9C2 cells. In addition, the results of this study showed that the levels of apoptotic markers (Bax, Cleaved caspase-3) in ACM group were higher than those in blank group. Oe-LOX-1 could aggravate the alcohol-induced pro-apoptotic effect, which was partially counteracted by sh-LOX-1. In addition, the beneficial effects generated by sh-LOX-1 were partially destroyed by activation of the P38MAPK signaling pathway using oe-P38MAPK (Fig. 2 D, 2 E). These results suggested that LOX-1 knockdown might play an anti-apoptotic role in rat cardiomyocytes by inhibiting the P38MAPK signaling pathway. To sum up, we could draw the conclusion that alcohol treatment could induce autophagy of H9C2 cells and thereby promote cell hypertrophy and apoptosis, overexpression of LOX-1 escalated these harmful effects whereas knockdown of LOX-1 could delay these deleterious effects caused by alcohol treatment through inactivating the P38MAPK signaling pathway. Knockdown of LOX-1 alleviated alcohol-induced cardiac hypertrophy in ACM rat models The echocardiogram results showed that, compared with the Blank group, it showed an increase in mean diastolic LVID-d in ACM group (Fig. 3 B, 3 C). In addition, the global systolic function was decreased in ACM group, demonstrated by reduced ejection fraction and reduced fractional shortening, all of above changes were reversed by LOX-1 knockdown (Fig. 3 C). What’s more, heart weight to tibial length (HW/TL) and the ratio of left ventricular mass to tibial length (LVM/TL) assessed by echocardiography were significantly higher in the ACM group than those in the Blank group, indicating cardiac hypertrophy. However, compared with the ACM group, the HW/TL and LVM/TL in the ACM + sh-LOX-1 group were significantly decreased, indicating that LOX-1 knockdown could inhibit cardiac hypertrophy to some extent (Fig. 3 C). Moreover, the results showed that the expression of LDH, cTnI and CK-MB were significantly reduced in the ACM + sh-LOX-1 group compared with the ACM group, suggesting that knockdown of LOX-1 could alleviate alcohol-induced myocardial dysfunction (Fig. 3 D). Knockdown of LOX-1 mitigated cardiac hypertrophy, autophagy and apoptosis of cardiomyocytes in ACM rat models in vivo The cardiac muscle tissues of rats were collected and analyzed to determine the in vivo influences and mechanism of LOX-1 on cardiac hypertrophy in ACM rats. The results of western blot showed that the LOX-1 protein was highly expressed in ACM group, while it was successfully knocked down in ACM + sh-LOX-1 group. Compared with ACM group, P38MAPK and P38MAPK phosphorylation levels were decreased after LOX-1 knockdown (Fig. 4 A). In addition, alcohol treatment increased the protein levels of hypertrophy markers (ANP, BNP, MEF2C, and β-MHC), accompanied by a reduction in α-MHC, while knockdown of LOX-1 could reverse these changes (Fig. 4 A). What’s more, the HE staining showed that there were no obvious pathologic changes in myocardial tissue of rats in the Blank group, and the cells were arranged neatly. In the ACM group, the pathological changes of myocardial tissue were obvious, with disordered arrangement of muscle bundles. Besides, the maximum cardiomyocyte diameters were increased compared to the blank group, demonstrating cardiomyocyte hypertrophy (Fig. 4 B). In addition, results of TUNEL showed a significant increase of apoptotic cells in the ACM group compared to the Blank group, and this change could be rescued by sh-LOX-1 (Fig. 4 C). Furthermore, compared with the ACM group, the protein expression levels of autophagy markers (ATG5, LC3-I, LC3-II, p62 and LAMP1) and apoptosis markers (Bax and Cleaved caspase-3) were significantly decreased in the ACM + sh-LOX-1 group, indicating that knockdown of LOX-1 could partially counteract the pro-autophagy and pro-apoptosis effects of alcohol (Fig. 4 D). These findings suggested the knockdown of LOX-1 owned the anti-hypertrophic, restrain excessive autophagy and anti-apoptotic effects in the ACM rat models in vivo . Discussion Chronic alcohol abuse can lead to myocardial contractile dysfunction and myocardial remodeling, accompanied by disturbances in mitochondrial homeostasis, altered autophagic function and dysregulation of protein metabolism, and the main manifestations of ACM are cardiac hypertrophy, fibrosis, cardiomyocyte death and heart failure [ 1 ]. The metabolic process of ethanol in rats was similar to humans and the heart is the main organ being attacked by alcohol [ 34 ]. To date, the pathogenesis of ACM is thought to be related to various factors such as apoptosis, autophagy and ROS production, but many of these pathogenic mechanisms have not been fully theorized [ 1 ]. In this study, we have carried out the research of mechanisms focusing on hypertrophy, autophagy and apoptosis to improve the molecular healthcare and therapeutic method against ACM. We found that alcohol treatment could induce hypertrophy in H9C2 cells and rat myocardial tissue, and it also upregulated the expression levels of hypertrophy, autophagy and apoptotic marker proteins both in vitro and in vivo . Consistent with the report by Peng et al., our results also suggested that alcohol could induce hypertrophic changes both in vitro and in vivo [ 35 ]. As a transmembrane protein, LOX-1 has been reported to take part in the pathogenic process of many cardiovascular diseases. Its expression was maintained at a relatively low level in normal physiological states. However, under pathological conditions, some external chemicals, inflammatory mediators and cytokines could up-regulate LOX-1 expression and accelerate the occurrence of cardiovascular diseases, so it could be used as a diagnostic marker or even a therapeutic target [ 36 ]. In fact, there were few reports on the effect of LOX-1 expression on cardiac hypertrophy and autophagy in ACM. Our data presented that overexpression of LOX-1 enhanced the harmful effects of alcohol by increasing surface area and autophagy of rat cardiomyocytes, whereas LOX-1 knockdown showed the opposite effect. Besides, the knockdown of LOX-1 in vivo also diminished the upregulated expression levels of hypertrophy, autophagy and apoptotic markers caused by alcohol in the myocardial tissues of rats. Our results were consistent with the promoting role of LOX-1 in rats ventricular hypertrophy proposed by Zhu et al [ 37 ]. Recently, Lin’s research also pointed out that LOX-1 was a key molecule of cardiomyocyte hypertrophic responses [ 38 ]. Besides these, the knockdown of LOX-1 was also reported to relieve apoptosis and autophagic response as well as restored the morphology of cardiomyocytes in vitro [ 39 ]. Therefore, targeting LOX-1 should be a novel therapeutic method against ACM. In our last research, we demonstrated that the knockdown of LOX-1 could mitigate the fibrotic changes in the heart by blocking P38MAPK signaling [ 4 ]. Here, we further presented that the knockdown of LOX-1 could also lighten the hypertrophic changes in the heart as well as reduce the autophagy and apoptosis of cardiomyocytes. The mechanism of myocardial hypertrophy is complex and involves multiple signaling pathways. It has also been shown that the P38MAPK signaling pathway is significantly activated in hypertrophied cardiomyocytes. On the one hand, it was found that retardation of P38MAPK signaling showed alleviative influences on the hypertrophy and autophagy of cardiomyocytes, which was related to MEF2C [ 24 , 40 ]. Specifically, the P38MAPK signaling pathway was activated, leading to increased expression level of P38MAPK protein as well as increased levels of phosphorylation, which stimulated increased expression levels of downstream MEF2C protein, resulting the conversion of contractile α-MHC into embryonic β-MHC in cardiomyocytes, and then lead to cardiomyocyte hypertrophy [ 22 , 40 , 41 ]. In addition, Zhou et al presented that the expression of Beclin-1 in myocardial tissue of rats with long-term heavy alcohol consumption was significantly increased, resulting in the aggregation of autophagic vesicles and impaired autophagic flux, along with apoptosis of cardiomyocytes and impaired cardiac function [ 42 ]. Cardiomyocyte-specific autophagy activation could exacerbate hypertrophic remodeling and systolic dysfunction [ 25 , 43 ]. It was found that multiple ATG proteins such as ATG5 could catalyze the formation of phosphatidylethanolamine-conjugated LC3 (LC3-II) and promote the autophagosome formation process [ 44 ]. Besides, lysosomal-associated membrane proteins (LAMPs) were a group of highly glycosylated transmembrane proteins located on the Lysosome membrane, and it was essential for successful completion of phagosome maturation [ 45 ]. In addition, lysosomal-associated membrane protein 1 (LAMP1) was commonly used as a lysosomal marker [ 45 , 46 ]. What’s more, basal autophagy uses adaptor proteins, such as p62/SQSTM, that identify and deliver misfolded or aggregated proteins and damaged organelles to the autophagosome for degradation, and it was inversely proportional to the degradation of the autophagolysosome [ 44 , 47 ]. We also agreed with Zhao et al’s research conclusions which proposed that alcohol stimulated myocardial autophagy and strengthened the expressions of autophagy and apoptosis-associated proteins in cardiomyocytes [ 29 ]. On the other hand, the activated P38MAPK pathway was found to be closely related to cardiomyocyte apoptosis [ 48 ]. Apoptosis could lead to the reduction of the number of cardiomyocytes and the change of myocardial structure. Apoptosis was regulated by intracellular signaling and was followed by nucleoplasmic condensation, nucleolus cleavage, DNA degradation, and ultimately the formation of apoptotic vesicles. With heavy alcohol consumption, mast cells and macrophages could release TNF-α, which activates caspase-8, followed by caspase-3 and caspase-7 in cardiomyocytes, leading to protein degradation. In the mitochondria, alcohol-induced oxidative stress could lead to DNA damage and induce apoptosis, a process regulated by Bax and Bcl. During apoptosis, Bax was responsible for the formation of small pores in the mitochondrial membrane through which cytochrome C flowed out and recruited the apoptotic protein kinase factor APAF-1, leading to the formation of apoptotic vesicles that activated caspase-9, caspase-7, and caspase-3, causing apoptosis. [ 49 ]. And P38MAPK signaling pathway played an important role in this process [ 49 ]. Therefore, targeting upstream activators of the P38MAPK pathway was an alternative and effective therapeutic choice for the treatment of ACM. The present study investigated the effect of LOX-1 on ACM cardiac hypertrophy in both in vitro and in vivo models. The results showed that LOX-1 could significantly aggravate alcohol-induced cardiomyocyte hypertrophy, autophagy and apoptosis, but LOX-1 knockdown could protect H9C2 cardiomyocytes from alcohol-induced injury by blocking the P38MAPK signaling pathway in vitro . Furthermore, the protective roles of LOX-1 knockdown were verified in ACM rat models in vivo . We have investigated the molecular biological mechanism of ACM pathogenesis and made some further exploration of the potential and specific role of LOX-1 as an important intervention target in ACM treatment, thus providing experimental data reference and pointing out the future research direction for the prevention and treatment of ACM. After alcohol treatment, the up-regulated LOX-1 promoted P38MAPK expression, then P38MAPK induced β-MHC expression through MEF2C to promote alcoholic hypertrophy. In addition, P38MAPK could activate autophagy through phosphorylation of ULK1, and then promote alcoholic hypertrophy and apoptosis, causing cardiac dysfunction (Fig. 5 ). However, LOX-1 expression was regulated by a variety of pro-inflammatory cytokines, oxidative stress response and mechanical stimulation [ 4 – 7 ]. It was reported that alcohol could cause inflammation and oxidative stress [ 50 , 51 ]. Therefore, alcohol may induce LOX-1 expression through oxidative stress and the production of pro-inflammatory cytokines but this has not been specifically verified, which was a limitation of our study. Next, studies have shown that in addition to P38MAPK, LOX-1 and alcoholic cardiomyopathy may be related to other mechanisms, such as ROS or inflammation [ 4 , 8 , 37 , 52 – 58 ]. What’s more, P38MAPK was a group of kinases activated by inflammation and stress, which should also include oxidative stress. The interaction between LOX-1, P38MAPK, oxidative stress, and inflammation can be studied in the future. Alcohol increases the expression and phosphorylation of P38MAPK by up-regulating the expression of LOX-1. Phosphorylated P38MAPK then enters the nucleus to promote β-MHC expression via MEF2C, causing cardiac hypertrophy and leading to alcoholic cardiomyopathy. In addition, activated P38MAPK can phosphorylate ULK1, and then activate Beclin1, which can increase the expression of ATG5, LC3 and LAMP1 to induce autophagy, promoting cardiac hypertrophy and cardiomyocyte apoptosis, and ultimately lead to alcoholic cardiomyopathy. Conclusion This study confirmed that LOX-1 knockdown could exert anti-hypertrophy and anti-apoptosis effects by inhibiting P38MAPK from inhibiting excessive autophagy in ACM. The current findings provide insights into the molecular mechanisms of how LOX-1 facilitate cardiac hypertrophy in alcoholic cardiomyopathy. In addition, LOX-1 is expected to be a potential target for the treatment of alcoholic cardiomyopathy. Abbreviations ACM alcoholic cardiomyopathy LOX-1 lectin-like oxidized low-density lipoprotein receptor 1 HE Hematoxylin-eosin staining TEM Transmission electron microscopy oxLDL oxidized low-density lipoprotein α-MHC α-myosin heavy chain β-MHC β-myosin heavy chain PI propidium iodide LVID-d left ventricular diameter EF ejection fraction FS fractional shortening LVM left ventricle mass LDH lactate dehydrogenase isoenzyme cTnI myocardial troponin CK-MB creatine kinase isoenzyme HW/TL heart weight to tibial length LVM/TL left ventricular mass to tibial length LAMPs lysosomal-associated membrane proteins LAMP1 lysosomal-associated membrane protein 1. Declarations Author contributions All authors made substantial contributions to the conception and design, acquisition of data, or analysis and interpretation of data; took part in drafting the article or revising it critically for important intellectual content; agreed on the journal to which the article will be submitted; gave final approval of the version to be published; and agree to be accountable for all aspects of the work. Availability of data and materials The datasets used during the present study are available from the corresponding author upon reasonable request. Funding This work was supported by Xi’an Science and Technology Plan Projects (21YXYJ0066). Conflict of interest The authors declare no conflict of interest. Ethics approval This research was approved by the Animal Care Committee and the Ethical Committee of Ninth Hospital of Xi’an and obeyed the NIH laboratory guidelines. References Fernández-Solà J (2020) The Effects of Ethanol on the Heart: Alcoholic Cardiomyopathy. Nutrients 12 (2) Wang S, Ren J (2018) Role of autophagy and regulatory mechanisms in alcoholic cardiomyopathy. Biochim Biophys Acta Mol Basis Dis 1864(6 Pt A):2003–2009 He J, Luo Y, Song J et al (2020) Non-coding RNAs and Pathological Cardiac Hypertrophy. Adv Exp Med Biol 1229:231–245 Zhang Y, Zhang R, Lu L et al (2022) Knockdown of lectin-like oxidized low-density lipoprotein-1 ameliorates alcoholic cardiomyopathy via inactivating the p38 mitogen-activated protein kinase pathway. Bioengineered 13(4):8926–8936 Shibata Y, Kume N, Arai H et al (2007) Mulberry leaf aqueous fractions inhibit TNF-alpha-induced nuclear factor kappaB (NF-kappaB) activation and lectin-like oxidized LDL receptor-1 (LOX-1) expression in vascular endothelial cells. Atherosclerosis 193(1):20–27 Reiss AB, Anwar K, Wirkowski P (2009) Lectin-like oxidized low density lipoprotein receptor 1 (LOX-1) in atherogenesis: a brief review. Curr Med Chem 16(21):2641–2652 Sakurai K, Sawamura T (2003) Stress and vascular responses: endothelial dysfunction via lectin-like oxidized low-density lipoprotein receptor-1: close relationships with oxidative stress. J Pharmacol Sci 91(3):182–186 Lü J, Mehta JL (2011) LOX-1: a critical player in the genesis and progression of myocardial ischemia. Cardiovasc Drugs Ther 25(5):431–440 Vahtola E, Louhelainen M, Forstén H et al (2010) Sirtuin1-p53, forkhead box O3a, p38 and post-infarct cardiac remodeling in the spontaneously diabetic Goto-Kakizaki rat. Cardiovasc Diabetol 9:5 Yin H, Zhang J, Lin H et al (2008) p38 mitogen-activated protein kinase inhibition decreases TNFalpha secretion and protects against left ventricular remodeling in rats with myocardial ischemia. Inflammation 31(2):65–73 Li M, Georgakopoulos D, Lu G et al (2005) p38 MAP kinase mediates inflammatory cytokine induction in cardiomyocytes and extracellular matrix remodeling in heart. Circulation 111(19):2494–2502 Turner NA, Blythe NM (2019) Cardiac Fibroblast p38 MAPK: A Critical Regulator of Myocardial Remodeling. J Cardiovasc Dev Dis 6 (3) Ren J, Zhang S, Kovacs A et al (2005) Role of p38alpha MAPK in cardiac apoptosis and remodeling after myocardial infarction. J Mol Cell Cardiol 38(4):617–623 Kojonazarov B, Novoyatleva T, Boehm M et al (2017) p38 MAPK Inhibition Improves Heart Function in Pressure-Loaded Right Ventricular Hypertrophy. Am J Respir Cell Mol Biol 57(5):603–614 Zhao T, Kee HJ, Bai L et al (2021) Selective HDAC8 Inhibition Attenuates Isoproterenol-Induced Cardiac Hypertrophy and Fibrosis via p38 MAPK Pathway. Front Pharmacol 12:677757 Li S-Y, Li Q, Shen JJ et al (2006) Attenuation of acetaldehyde-induced cell injury by overexpression of aldehyde dehydrogenase-2 (ALDH2) transgene in human cardiac myocytes: role of MAP kinase signaling. J Mol Cell Cardiol 40(2):283–294 Aoki Y, Dai H, Furuta F et al (2023) LOX-1 mediates inflammatory activation of microglial cells through the p38-MAPK/NF-κB pathways under hypoxic-ischemic conditions. Cell Commun Signal 21(1):126 Bao MH, Zhang YW, Zhou HH (2013) Paeonol suppresses oxidized low-density lipoprotein induced endothelial cell apoptosis via activation of LOX-1/p38MAPK/NF-κB pathway. J Ethnopharmacol 146(2):543–551 Zhang C, Shan XL, Liao YL et al (2014) Effects of stachydrine on norepinephrine-induced neonatal rat cardiac myocytes hypertrophy and intracellular calcium transients. BMC Complement Altern Med 14:474 Mamidi R, Chandra M (2013) Divergent effects of α- and β-myosin heavy chain isoforms on the N terminus of rat cardiac troponin T. J Gen Physiol 142(4):413–423 Yamauchi-Takihara K, Sole MJ, Liew J et al (1989) Characterization of human cardiac myosin heavy chain genes. Proc Natl Acad Sci U S A 86(10):3504–3508 Muñoz JP, Collao A, Chiong M et al (2009) The transcription factor MEF2C mediates cardiomyocyte hypertrophy induced by IGF-1 signaling. Biochem Biophys Res Commun 388(1):155–160 Wei J, Joshi S, Speransky S et al (2017) Reversal of pathological cardiac hypertrophy via the MEF2-coregulator interface. JCI Insight 2:17 Han J, Molkentin JD (2000) Regulation of MEF2 by p38 MAPK and its implication in cardiomyocyte biology. Trends Cardiovasc Med 10(1):19–22 Delbridge LMD, Mellor KM, Taylor DJ et al (2017) Myocardial stress and autophagy: mechanisms and potential therapies. Nat Rev Cardiol 14(7):412–425 Galluzzi L, Bravo-San Pedro JM, Levine B et al (2017) Pharmacological modulation of autophagy: therapeutic potential and persisting obstacles. Nat Rev Drug Discov 16(7):487–511 Guo R, Hu N, Kandadi MR et al (2012) Facilitated ethanol metabolism promotes cardiomyocyte contractile dysfunction through autophagy in murine hearts. Autophagy 8(4):593–608 Ba L, Gao J, Chen Y et al (2019) Allicin attenuates pathological cardiac hypertrophy by inhibiting autophagy via activation of PI3K/Akt/mTOR and MAPK/ERK/mTOR signaling pathways. Phytomedicine 58:152765 Zhu Z, Huang Y, Lv L et al (2018) Acute ethanol exposure-induced autophagy-mediated cardiac injury via activation of the ROS-JNK-Bcl-2 pathway. J Cell Physiol 233(2):924–935 Li D, Hu J, Wang T et al (2016) Silymarin attenuates cigarette smoke extract-induced inflammation via simultaneous inhibition of autophagy and ERK/p38 MAPK pathway in human bronchial epithelial cells. Sci Rep 6:37751 Yuan L, Wei S, Wang J et al (2014) Isoorientin induces apoptosis and autophagy simultaneously by reactive oxygen species (ROS)-related p53, PI3K/Akt, JNK, and p38 signaling pathways in HepG2 cancer cells. J Agric Food Chem 62(23):5390–5400 Yuan M, Zhao B, Jia H et al (2021) Sinomenine ameliorates cardiac hypertrophy by activating Nrf2/ARE signaling pathway. Bioengineered 12(2):12778–12788 Duan Q, Si H, Tian L et al (2022) LOX-1 attenuates high glucose-induced autophagy via AMPK/HNF4α signaling in HLSECs. Heliyon 8(12):e12385 Lê AD, Kalant H (2017) Intravenous self-administration of alcohol in rats-problems with translation to humans. Addict Biol 22(6):1665–1681 Peng C, Zhang W, Zhao W et al (2015) Alcohol-induced histone H3K9 hyperacetylation and cardiac hypertrophy are reversed by a histone acetylases inhibitor anacardic acid in developing murine hearts. Biochimie 113:1–9 Sharma T, Romeo F, Mehta JL (2022) LOX-1: Implications in atherosclerosis and myocardial ischemia. Excli j 21:273–278 Zhu TT, Zhang WF, Luo P et al (2017) LOX-1 promotes right ventricular hypertrophy in hypoxia-exposed rats. Life Sci 174:35–42 Lin L, Zhou N, Kang L et al (2022) Oxidized LDL but not angiotensin II induces cardiomyocyte hypertrophic responses through the interaction between LOX-1 and AT(1) receptors. J Mol Cell Cardiol 162:110–118 Kore RA, Henson JC, Hamzah RN et al (2019) Molecular events in MSC exosome mediated cytoprotection in cardiomyocytes. Sci Rep 9(1):19276 Dionyssiou MG, Nowacki NB, Hashemi S et al (2013) Cross-talk between glycogen synthase kinase 3β (GSK3β) and p38MAPK regulates myocyte enhancer factor 2 (MEF2) activity in skeletal and cardiac muscle. J Mol Cell Cardiol 54:35–44 Lina L, Lu Y, Zhaowen L et al (2018) Effects of Leonurine on p38MAPK and Downstream Gene-expressionin Cardiomyocyte Hypertrophy. Chin Archives Traditional Chin Med 36(11):2614–2617 Zhou C, Huang J, Li Q et al (2018) CYP2J2-derived EETs attenuated ethanol-induced myocardial dysfunction through inducing autophagy and reducing apoptosis. Free Radic Biol Med 117:168–179 Zhu H, Tannous P, Johnstone JL et al (2007) Cardiac autophagy is a maladaptive response to hemodynamic stress. J Clin Invest 117(7):1782–1793 Cicchini M, Karantza V, Xia B (2015) Molecular pathways: autophagy in cancer–a matter of timing and context. Clin Cancer Res 21(3):498–504 Huynh KK, Eskelinen EL, Scott CC et al (2007) LAMP proteins are required for fusion of lysosomes with phagosomes. Embo j 26(2):313–324 Cheng XT, Xie YX, Zhou B et al (2018) Revisiting LAMP1 as a marker for degradative autophagy-lysosomal organelles in the nervous system. Autophagy 14(8):1472–1474 Pankiv S, Clausen TH, Lamark T et al (2007) p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. J Biol Chem 282(33):24131–24145 Zhou H, Sun Y, Zhang L et al (2018) The RhoA/ROCK pathway mediates high glucose-induced cardiomyocyte apoptosis via oxidative stress, JNK, and p38MAPK pathways. Diabetes Metab Res Rev 34(6):e3022 Yi C, Song M, Sun L et al (2022) Asiatic Acid Alleviates Myocardial Ischemia-Reperfusion Injury by Inhibiting the ROS-Mediated Mitochondria-Dependent Apoptosis Pathway. Oxid Med Cell Longev. 2022: 3267450 Chastain LG, Franklin T, Gangisetty O et al (2019) Early life alcohol exposure primes hypothalamic microglia to later-life hypersensitivity to immune stress: possible epigenetic mechanism. Neuropsychopharmacology 44(9):1579–1588 Mandrekar P, Catalano D, Jeliazkova V et al (2008) Alcohol exposure regulates heat shock transcription factor binding and heat shock proteins 70 and 90 in monocytes and macrophages: implication for TNF-alpha regulation. J Leukoc Biol 84(5):1335–1345 Tanaka K, Honda M, Takabatake T (2001) Redox regulation of MAPK pathways and cardiac hypertrophy in adult rat cardiac myocyte. J Am Coll Cardiol 37(2):676–685 Wang R, Ding G, Liang W et al (2010) Role of LOX-1 and ROS in oxidized low-density lipoprotein induced epithelial-mesenchymal transition of NRK52E. Lipids Health Dis 9:120 Zhou MS, Hernandez Schulman I, Pagano PJ et al (2006) Reduced NAD(P)H oxidase in low renin hypertension: link among angiotensin II, atherogenesis, and blood pressure. Hypertension 47(1):81–86 Maiuolo J, Maretta A, Gliozzi M et al (2018) Ethanol-induced cardiomyocyte toxicity implicit autophagy and NFkB transcription factor. Pharmacol Res 133:141–150 Kalishwaralal K, Jeyabharathi S, Sundar K et al (2015) Sodium selenite/selenium nanoparticles (SeNPs) protect cardiomyoblasts and zebrafish embryos against ethanol induced oxidative stress. J Trace Elem Med Biol 32:135–144 Mouton AJ, El Hajj EC, Ninh VK et al (2020) Inflammatory cardiac fibroblast phenotype underlies chronic alcohol-induced cardiac atrophy and dysfunction. Life Sci 245:117330 Pirillo A, Norata GD, Catapano AL (2013) LOX-1, OxLDL, and atherosclerosis. Mediators Inflamm. 2013: 152786 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4733824","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":327130169,"identity":"f0668cb5-84f6-4e4d-9dcd-ef35dba85017","order_by":0,"name":"Yifan Zhang","email":"","orcid":"","institution":"Ninth Hospital of Xi’an","correspondingAuthor":false,"prefix":"","firstName":"Yifan","middleName":"","lastName":"Zhang","suffix":""},{"id":327130170,"identity":"ccfef7c0-11c1-42c0-88df-f50f1fcb296c","order_by":1,"name":"Bo Yuan","email":"","orcid":"","institution":"Ninth Hospital of Xi’an","correspondingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Yuan","suffix":""},{"id":327130171,"identity":"bca92cea-783e-4776-9420-9e030ed65dc0","order_by":2,"name":"Yue Xu","email":"","orcid":"","institution":"Ninth Hospital of Xi’an","correspondingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Xu","suffix":""},{"id":327130172,"identity":"c18c09ec-893e-4df5-a5f4-43a08421c29c","order_by":3,"name":"Na Zhou","email":"","orcid":"","institution":"Ninth Hospital of Xi’an","correspondingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"Zhou","suffix":""},{"id":327130173,"identity":"191bdf2d-00be-41d3-a670-2735db6dae6d","order_by":4,"name":"Xin Wang","email":"","orcid":"","institution":"Ninth Hospital of Xi’an","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Wang","suffix":""},{"id":327130175,"identity":"98e141b2-1e2e-4071-9b0a-7baedf0dddd3","order_by":5,"name":"Xiaoyan Lv","email":"","orcid":"","institution":"Ninth Hospital of Xi’an","correspondingAuthor":false,"prefix":"","firstName":"Xiaoyan","middleName":"","lastName":"Lv","suffix":""},{"id":327130179,"identity":"3dc02c4f-cb92-4914-9836-8ba0e565bece","order_by":6,"name":"Zhanbin Feng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIiWNgGAWjYBAC9gYgwQgkDJgZGJgZKoAMQlp4DqBoOUOSFiDNzNhGjBb23sMvf+6wyzNn5z38uXBenZy5RALjh485eLTwnEuzkDyTXGzZzJcmPXPbYWPLGQnMkjO34dZiL5FjZmDYxpy44TCPGTPvtgOJG24ksAEZeGyRf2NmkNhWD9Ji/Jl3Th0RWiR4jB8cbDsM0mIgzdvATIQWnhwzxsa244k7m3nMpHmOHTY2OPOwGa9feNjPGH/82VaduJ3/jPFnnpo6OYPjyQc/fMSjBQjYJNAEQNGEHzB/IKRiFIyCUTAKRjgAAP25T8EKnBq3AAAAAElFTkSuQmCC","orcid":"","institution":"Ninth Hospital of Xi’an","correspondingAuthor":true,"prefix":"","firstName":"Zhanbin","middleName":"","lastName":"Feng","suffix":""}],"badges":[],"createdAt":"2024-07-13 06:39:02","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4733824/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4733824/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":62033516,"identity":"01cb1540-f47b-4f7f-83c6-244ce4708e41","added_by":"auto","created_at":"2024-08-08 12:45:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":613586,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of LOX-1 ameliorated cardiomyocyte hypertrophy in alcohol-treated H9C2 cells via inactivating P38MAPK signaling pathway\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e in vitro\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003e(A) Schematic illustration of \u003cem\u003ein vitro\u003c/em\u003e studies. (B) The expression levels of LOX-1, P38MAPK and cardiac hypertrophy markers in H9C2 cells by RT-qPCR. (C) The expression levels of LOX-1, P38MAPK and cardiac hypertrophy markers in H9C2 cells by western blot and the statistical graph (D). (E) HE staining of H9C2 cells (Scale bars: 100 μm and 25 μm) and the statistical graph of relative cell surface area (F). *: \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05, **: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 and ***: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-4733824/v1/459873ac6d7c5b5d9c531aa8.png"},{"id":62033101,"identity":"96e32d87-f406-488d-8c58-7313336264e6","added_by":"auto","created_at":"2024-08-08 12:37:03","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":795854,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of LOX-1 could inhibit P38MAPK to reduce autophagy and thus inhibit apoptosis\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e in vitro\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003e(A) The H9C2 cells were observed under TEM. Scale bars: 200 nm. White arrow: autophagic vesicles; yellow arrow: broken cristae and structurally disorganized mitochondria; blue arrow: riboproteins. (B) The apoptosis of H9C2 cells was detected by flow cytometry and the statistical graph of apoptosis cells (C). (D) The detection of autophagy and apoptosis markers in H9C2 cells by RT-qPCR. (E) The detection of autophagy and apoptosis markers in H9C2 cells by western blot. *: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 and ***: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-4733824/v1/1ea51677b7e4a2a80e8209df.png"},{"id":62033515,"identity":"259f6be7-185c-452c-9a88-3572c002b187","added_by":"auto","created_at":"2024-08-08 12:45:03","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":776513,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of LOX-1 alleviated alcohol-induced cardiac hypertrophy in ACM rat models. \u003c/strong\u003e(A) Schematic illustration of \u003cem\u003ein vivo\u003c/em\u003e studies. (B) Echocardiogram of three groups of rats. (C) The cardiac function index of rats was evaluated by echocardiogram, including left ventricular diameter (LVID-d), ejection fraction (EF), shortening fraction (FS), the ratio of left ventricular mass (LVM) to tibial length (LVM/TL) and heart weight to tibial length (HW/TL). (D) The detection of lactate dehydrogenase isoenzyme (LDH), myocardial troponin (cTnI), and creatine kinase isoenzyme (CK-MB). *: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 and ***: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-4733824/v1/76df8e2ab064a4f3e1b060aa.png"},{"id":62033103,"identity":"13e44fc9-9487-43ee-baf1-4f72b35d2b31","added_by":"auto","created_at":"2024-08-08 12:37:03","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":787058,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of LOX-1 could inhibit cardiac hypertrophy, autophagy and apoptosis of cardiomyocytes in ACM rat models \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003e(A) The detection of LOX-1, P38MAPK and cardiac hypertrophy markers in ACM rat models by western blot. (B) HE staining (×400) and the quantification of cross sections of cardiomyocytes. (C) Myocardial apoptosis was detected by TUNEL. (D) The detection of autophagy and apoptosis markers in ACM rat models by western blot. *: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 and ***: \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-4733824/v1/f85c75f09a8c6985b115238d.png"},{"id":62033104,"identity":"9ae1a964-5676-4c70-a6bd-6920a2317617","added_by":"auto","created_at":"2024-08-08 12:37:03","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":294263,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGraphical abstract shows that knockdown of LOX-1 ameliorates cardiac hypertrophy in alcoholic cardiomyopathy via inactivating the p38MAPK pathway.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-4733824/v1/9283ba8bd06d16b239bf5f78.png"},{"id":62627127,"identity":"e75dee89-873c-4a2b-a8db-f3c1eb587197","added_by":"auto","created_at":"2024-08-16 15:30:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4082757,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4733824/v1/382ef1c3-9488-495a-b487-dbeb7ae43892.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Knockdown of LOX-1 ameliorates cardiac hypertrophy in alcoholic cardiomyopathy via inactivating the p38MAPK pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe most prevalent form of ethanol-induced heart damage is alcoholic cardiomyopathy (ACM), which arises from chronic and excessive alcohol abuse. The typical presentation of ACM includes cardiac hypertrophy, ventricular dilatation, disorganization of myofibrils, and impaired cardiac function [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Cardiac hypertrophy, characterized by an increase in the size of cardiomyocytes, was a prevalent pathological process observed in various cardiovascular diseases and was considered to be an independent risk factor for elevated morbidity and mortality associated with cardiovascular disorders [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Therefore, exploring the underlying mechanism of myocardial hypertrophy was conducive to providing a potential therapeutic target for ACM patients, which may provide an important reference for reducing patient mortality and improving long-term prognosis.\u003c/p\u003e \u003cp\u003eLOX-1 was the major receptor of oxidized low-density lipoprotein (oxLDL), which could be activated by oxidative stress and pro-inflammatory cytokines, then stimulated its downstream inflammatory reaction and signaling pathways (P38MAPK, NF-κB) to response to cellular inflammation and oxidative stress, exerting important roles in cardiovascular diseases [\u003cspan additionalcitationids=\"CR5 CR6\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. After alcohol treatment, the up-regulated expression of LOX-1 was reported to enhance collagen deposition and hypertrophy of cardiac fibroblasts, however knockdown of LOX-1 or the use of LOX-1 inhibitors showed the opposite results [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Moreover, knockdown of LOX-1 ameliorated alcohol-induced damages and improved cardiac function in rats [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. It was showed that LOX-1 was upregulated in rats with ACM [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. However, the underlying mechanism of how LOX-1 promotes cardiac hypertrophy remained to be further explored.\u003c/p\u003e \u003cp\u003eP38MAPK was a group of kinases activated by inflammation and stress and the differential expression of P38MAPK could cause myocardial hypertrophy, fibrosis, cardiac remodeling, cardiac function damage, which eventually likely to develop heart failure [\u003cspan additionalcitationids=\"CR10 CR11 CR12\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Blocking the P38MAPK pathway could improve cardiac function and inhibit hypertrophy and fibrosis [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Moreover, P38MAPK could be activated by ethanol and involved in the pathogenesis of alcoholic cardiomyopathy [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. In addition, it has been reported that LOX-1 could regulate endothelial cell apoptosis and inflammatory activation of microglia by affecting the expression of P38MAPK [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. However, whether the LOX-1 regulation of P38MAPK could play a role in ACM needs to be explored.\u003c/p\u003e \u003cp\u003eCardiomyocyte hypertrophy was an important pathological change of cardiac hypertrophy, which mainly characterized as the increase in cardiomyocyte size accompanied by the up-regulation of hypertrophy markers such as ANP and BNP, as well as the conversion of contractile α-myosin heavy chain (α-MHC) to embryonic β-myosin heavy chain (β-MHC) [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. MYH6 and MYH7 genes encode α-MHC and β-MHC, respectively [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. MEF2 was a key transcription factor in cardiac hypertrophy, and the expression of MEF2C was up-regulated during cardiomyocyte hypertrophy [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. MEF2C was an important downstream gene of P38MAPK. Activation of P38MAPK could enhance the expression of MEF2C, which subsequently induced the re-expression of embryonic genes, such as MYH7, and resulted in cardiomyocyte hypertrophy [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. However, whether P38MAPK/MEF2C axis is involved in the regulation of LOX-1 on cardiomyocyte hypertrophy in ACM still needs further investigation.\u003c/p\u003e \u003cp\u003eAutophagy was an important process regulating the survival of organisms in stress and nutrient deprivation circumstance, and it was activated in many cardiac pathological diseases, including septic heart malformations, heart failure, cardiomyopathy, and cardiac hypertrophy [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Autophagy was closely related to ACM, and the levels of autophagy markers Beclin-1 and LC3-II were increased in the hearts of rats treated with long-term alcohol [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Besides, the inhibition of autophagy could reduce cardiac hypertrophy [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In addition, alcohol-induced apoptosis was also caused by the up-regulation of autophagy, and inhibiting excessive autophagy could improve cardiac abnormalities and cardiomyocyte apoptosis caused by alcohol challenge [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. It has been reported that P38MAPK signaling pathway was positively involved in the regulation of autophagy [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. P38MAPK could induce apoptosis through autophagy [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Therefore, we speculated that LOX-1 induced autophagy through P38MAPK signaling pathway, thereby affecting hypertrophy and apoptosis in ACM.\u003c/p\u003e \u003cp\u003eIn this study, we aimed to investigate the effect of LOX-1 on cardiac hypertrophy using \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e ACM models to provide therapeutic target selection and theoretical basis for the treatment of ACM.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCells and rats\u003c/h2\u003e \u003cp\u003eH9C2 rat myofibroblasts (Procell, China) were inoculated in medium composed of DMEM\u0026thinsp;+\u0026thinsp;10% FBS\u0026thinsp;+\u0026thinsp;1% antibiotics (Procell, China). The cells were divided into 6 groups (Blank, ACM, ACM\u0026thinsp;+\u0026thinsp;oe-LOX-1, ACM\u0026thinsp;+\u0026thinsp;sh-NC, ACM\u0026thinsp;+\u0026thinsp;sh-LOX-1, and ACM\u0026thinsp;+\u0026thinsp;sh-LOX-1\u0026thinsp;+\u0026thinsp;oe-P38MAPK). Except for the blank group, H9C2 cells in other groups were incubated with 200 mmol/L alcohol for 24 h to trigger ACM \u003cem\u003ein vitro\u003c/em\u003e. To knock down or overexpress LOX-1/P38MAPK in H9C2 cells, before alcohol treatment the specific sequences were connected to the pIRES2-EGFP vector (GenScript, Piscataway, NJ, USA), which were then instantaneously transfected into H9C2 cells with Lipofectamine 3000 reagent (ThermoFisher, USA), and the cells were then collected for the subsequent experiments.\u003c/p\u003e \u003cp\u003e This study followed the National Institutes of Health (NIH) laboratory guidelines and was approved by the Animal Care Committee and Ethics Committee of Xi'an Ninth Hospital. Thirty healthy adult male Sprague-Dawley (SD) rats (Limibio, China) were selected and randomly divided into 3 groups (Blank, ACM, ACM\u0026thinsp;+\u0026thinsp;sh-LOX-1), fed in an environment of 24˚C and 50% humidity, with a 12-h light-dark cycle to supply food and water for two weeks. To knock down LOX-1 expression in rats, the adenovirus vectors containing shRNA (Genepharma, China) were applied by tail vein injection. Different from the normal feeding in the blank group, the rats in ACM and ACM\u0026thinsp;+\u0026thinsp;sh-LOX-1 group were given 52% alcohol 10 ml/kg twice per day for 16 weeks to induce ACM. Ultrasonic cardiogram was performed on the day before the rats were sacrificed. Finally, the rats were sacrificed by euthanasia using CO\u003csub\u003e2\u003c/sub\u003e, the blood and myocardial tissues were collected for subsequent analysis [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eHematoxylin-eosin staining (HE)\u003c/h2\u003e \u003cp\u003eH9C2 cells and myocardial tissue of rats in each group were fixed with 4% paraformaldehyde, washed and stained with HE staining kit (Solarbio, China). The morphological changes of cardiomyocytes were observed by microscope and statistics using Graphpad Prism 8.3.0 (Graphpad, USA) [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eTransmission electron microscopy (TEM)\u003c/h2\u003e \u003cp\u003eAfter fixation (4 h) with glutaraldehyde (2.5%), H9C2 cells in each group were pre-embedded in agar, rinsed three times with the rinsing solution, and then fixed in osmium acid (1%, 4\u0026deg;C) for 2 h. Next, the cells were dehydrated in an ethanol gradient, transitioned to propylene oxide, and embedded after resin infiltration, and polymerized at 60\u0026deg;C. The embedded blocks were ultrasonically sectioned with a UC7 ultrathin sectioning machine (Leica, Germany), followed by double-stained using uranyl acetate and lead citrate, and eventually observed the ultrastructure under HT7700 microscopy (Hitachi, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry\u003c/h2\u003e \u003cp\u003eCells of each group were collected and suspended in 1 \u0026times; Annexin V Bingding Buffer. Then, cells were stained with Annexin V-FITC and propidium iodide (PI) using a cell apoptosis detection kit (Procell Life Scinece \u0026amp; Technology Co., Ltd, China). After incubating for 20 min, cell apoptosis was analyzed by flow cytometry (BD Biosciences, NJ, USA). The percentage of apoptotic cells was analyzed using FlowJo software (Becton\u0026ndash;Dickinson-San Jose, CA, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eEchocardiogram\u003c/h2\u003e \u003cp\u003eThe cardiac function of rats was checked using the Vevo 3100 Preclinical Imaging System (Fuji, Japan) and MX probe at 15 MHz. After the rats were paralyzed using 3% isoflurane the left ventricular diameter (LVID-d) value, ejection fraction (EF) value, fractional shortening (FS) value as well as the left ventricle mass (LVM) value were obtained via the Vevo Anesthesia System (Fuji, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of biochemical parameters\u003c/h2\u003e \u003cp\u003eThe supernatant was collected from rat serum. LDH activity was determined using a commercial kit (Jiancheng, Nanjing, China), and cTnI and CK-MB were detected using the corresponding ELISA kits (Jiancheng, Nanjing, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eTUNEL staining\u003c/h2\u003e \u003cp\u003eApoptosis rates in mouse heart tissue sections were analyzed using TUNEL staining (Roche Applied Science, Upper Bavaria, Germany) according to the manufacturer\u0026rsquo;s protocol. In summary, the slides were incubated with 500 \u0026micro;l TUNEL reaction mixture (50 \u0026micro;l TdT and 450 \u0026micro;l fluorescein-labeled dUTP) at 37\u0026deg;C for 1 h, and the total number of cells was determined by DAPI staining. The slides were viewed under microscope, and the apoptosis rate was calculated as the percentage of TUNEL-positive cells in the total number of DAPI-stained cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eRT-qPCR\u003c/h2\u003e \u003cp\u003eRNA in cells was extracted using Trizol (ABI, USA) and the concentrations of RNA samples were detected by Qubit fluorometer (ThermoFisher, USA), RNA purity was detected by A260/A280 ratio, ratio range 1.8\u0026thinsp;~\u0026thinsp;2.1, RNA concentration calculation formula: A260*40 ng/\u0026micro;l. The reverse transcription process was executed with SuperScript III RT Kit (ABI, USA), a 20 uL reaction system was constructed and the cDNA was synthesized under the reaction conditions of 65℃, 5 min; 42℃, 60 min; 85℃, 10 min. The SYBR qPCR Mix (ABI, USA) reaction conditions (95℃ for 5 min; 95℃ for 10 s, 58℃ for 20 s, 72℃ for 20 s, total 40 cycles) were selected, and the RT-qPCR was performed with the QuantStudio 7 Pro System (ABI, USA). The primer sequences were shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Relative mRNA expression was normalized by the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method using β-actin.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for RT-qPCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGAACGTGAAATTGTCCGAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGCCAATGGTGATGACCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eLOX-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGAGGGAACTGAAGGAACAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACACTTGCGAAGTCTCCTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP38MAPK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCCGAGATTATGCTGAATTGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACAACGTTCTTCCGGTCAACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eANP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGGACCCCTCCGATAGATCTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCTCTGGGCTCCAATCCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBNP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCTCAAAGGACCAAGGCCCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAGCTTGAACTATGTGCCATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMEF2C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAAATCTCCTCCCCCTATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCCTCCCATTCCCTGTCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMYH6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTGGAGAAGAACAAGGACCCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTTTGCCTTTCCCACTGTCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMYH7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCTTCTCCATCTCTGACAACGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTCTTGGTGTTGACGGTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBeclin-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAATGAGGGCGACAGTGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTGGACCTTCTCCAGGTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eATG5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGGATGGGACTGCAGAATGATTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAAAGGCCGTTCAGTTGTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eLC3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGTGGAAGATGTCCGGCTCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTGCTTCTCACCCTTGTATCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGCTGCTGTCCGTAGAAATTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGGGATCAGTACCCGCTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eLAMP1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCACAGGATCAACCTTCCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGCTCTGGTCACAGTCGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBax\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGGTTTCATCCAGGATCGAGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGTTCATCGCCAATTCGCCTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCleaved caspase-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTGGACCTGAAAAAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCTGAATGATGAAGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003eProtein was extracted with Protein Extraction Kit (Abcam, USA) and its concentration was measured with BCA assay Kit (ThermoFisher, USA). After separation by SDS-PAGE and transferred to the PVDF membrane (Merck, Germany). The samples were blocked and treated with primary antibodies against β-actin (ab6276), LOX-1 (ab60178), α-MHC (ab185967), β-MHC (ab172967), P-P38MAPK (ab4822), ANP (ab189921), BNP (ab19645), P38MAPK (ab170099), MEF2C (ab211493), Bax (ab32503), Beclin-1 (ab207612), Cleaved caspase-3 (#9661, CST, USA), LC3-II/LC3-I (ab192890), ATG5 (ab108327), p62 (ab109012) and LAMP1 (ab13523) at 4\u0026deg;C for 12 h. Then secondary HRP-conjugated antibody (Abcam, USA) was applied for 1 h. Next, the diamine benzidine kit (ThermoFisher, USA) was used to visualize the bands, and the relative protein expression was analyzed by Image J 1.53 software (NIH, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe experiments were repeated three times, and the data were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD). SPSS 26.0 (IBM, USA) and Graphpad Prism 8.3.0 (Graphpad, USA) were executed for data analyses and graph drawing, respectively. Student\u0026rsquo;s t-test and one-way analysis of variance (ANOVA) were used for inter-group and multi-group statistically significant differences analyses, respectively. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eKnockdown of LOX-1 inhibited cardiomyocyte hypertrophy in alcohol-treated H9C2 cells\u003c/b\u003e \u003cb\u003evia\u003c/b\u003e \u003cb\u003einactivating P38MAPK signaling pathway\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAfter treating H9C2 cells with alcohol for 24 h, the results of RT-qPCR showed that the expression of cardiomyocyte hypertrophy markers including ANP, BNP, MEF2C, and MYH7 were up-regulated in ACM group than that in the Blank group while the expression of MYH6 was the opposite, suggesting modeling success (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). And western blot results showed the same as RT-qPCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). In addition, the expression levels of LOX-1 and P38MAPK as well as p-P38MAPK were significantly higher in ACM group than that in the Blank group, which suggested that LOX-1 and P38MAPK pathway may be involved in cardiomyocyte hypertrophy in ACM (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). To further test whether LOX-1 plays a role in cardiomyocyte hypertrophy through the P38MAPK pathway, we did LOX-1overexpression/knockdown experiments and P38MAPK overexpression rescue experiment. We found that alcohol treatment could increase the expression of P38MAPK in ACM group, and its expression was down-regulated or up-regulated with the knockdown or overexpression of LOX-1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Besides, LOX-1 not only changed the protein expression of P38MAPK, but also changed the phosphorylation level of P38MAPK (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). In addition, the expression levels of cardiomyocyte hypertrophy markers ANP, BNP, MEF2C, and β-MHC were up-regulated while α-MHC expression was down-regulated in the ACM model, suggesting that LOX-1 promoted the increase of cardiomyocyte hypertrophy related indicators (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). When LOX-1 was knocked down, the expression of cardiomyocyte hypertrophy markers the opposite. What\u0026rsquo;s more, when P38MAPK was overexpressed while LOX-1 was knocked down, the anti-hypertrophy impact of sh-LOX-1 was partially counteracted by overexpression of P38MAPK (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). The results of HE staining were the same as western blot in all groups. It was showed that the ACM group had a larger cell surface area than the blank group, showing cell hypertrophy (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). Upregulation of LOX-1 increased cell surface area to aggravate cell hypertrophy, while knockdown of LOX-1 was the opposite (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). Similarly, the ameliorate hypertrophy effect of sh-LOX-1 in H9C2 cells was partially rescued by overexpression of P38MAPK. Therefore, the results implied that knockdown of LOX-1 could alleviate cardiomyocyte hypertrophy in H9C2 cells by inhibiting the P38MAPK signaling pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003ePrevious studies have reported that P38MAPK signaling pathway was positively involved in the regulation of autophagy, and LOX-1 was also related to autophagy [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In addition, the inhibition of autophagy could reduce cardiac hypertrophy [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. To further test whether LOX-1 regulates cardiomyocyte hypertrophy by affecting autophagy through the P38MAPK pathway, TEM was used to detected the autophagy levels. The results showed that there was no significant autophagy observed in H9C2 cardiomyocytes in the blank group, and there were no autophagic vesicles or riboproteins detected. In contrast, the autophagic vesicles and riboproteins and terminal autophagic vacuoles could be observed in ACM group and the similar results were also observed in ACM\u0026thinsp;+\u0026thinsp;sh-NC group. However, overexpression of LOX-1 aggravated the autophagic changes in the cells because a large number of autophagic vesicles and riboproteins were observed in this group, as well as the forming autophagic vesicles, broken cristae and structurally disorganized mitochondria were detected. Besides, the number of autophagic vesicles and riboprotein expressions were reduced in the ACM\u0026thinsp;+\u0026thinsp;sh-LOX-1 group compared with the ACM\u0026thinsp;+\u0026thinsp;sh-NC group. Moreover, overexpression of P38MAPK neutralized the inhibitory effects of sh-LOX-1 on cell autophagy (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eAlcohol could induce excessive autophagy to cause myocardial cell apoptosis, and P38MAPK was closely related to cell apoptosis [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. To test whether LOX-1 affects apoptosis by regulating P38MAPK, we observe cardiomyocyte apoptosis by flow cytometry. And the results showed that the apoptotic cells in the ACM group was more than that of the Blank group. And on this basis, overexpression of LOX-1 made the situation worse while the situation was significantly improved after LOX-1 knockdown. In addition, the inhibitory effect of sh-LOX-1 on cell apoptosis was partially rescued by overexpression of P38MAPK (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eBesides, results of RT-qPCR and western blot showed that the changes in the expression levels of autophagy-related markers (Beclin-1, LC3-I, LC3-II ATG5, p62 and LAMP1) were consistent with the TEM schematic (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). This part of the results suggested that the knockdown of LOX-1 could inhibit the P38MAPK signaling pathway to reduce excessive autophagy and thus exert anti-hypertrophy effect on cardiomyocytes in H9C2 cells. In addition, the results of this study showed that the levels of apoptotic markers (Bax, Cleaved caspase-3) in ACM group were higher than those in blank group. Oe-LOX-1 could aggravate the alcohol-induced pro-apoptotic effect, which was partially counteracted by sh-LOX-1. In addition, the beneficial effects generated by sh-LOX-1 were partially destroyed by activation of the P38MAPK signaling pathway using oe-P38MAPK (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). These results suggested that LOX-1 knockdown might play an anti-apoptotic role in rat cardiomyocytes by inhibiting the P38MAPK signaling pathway.\u003c/p\u003e \u003cp\u003eTo sum up, we could draw the conclusion that alcohol treatment could induce autophagy of H9C2 cells and thereby promote cell hypertrophy and apoptosis, overexpression of LOX-1 escalated these harmful effects whereas knockdown of LOX-1 could delay these deleterious effects caused by alcohol treatment through inactivating the P38MAPK signaling pathway.\u003c/p\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eKnockdown of LOX-1 alleviated alcohol-induced cardiac hypertrophy in ACM rat models\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe echocardiogram results showed that, compared with the Blank group, it showed an increase in mean diastolic LVID-d in ACM group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). In addition, the global systolic function was decreased in ACM group, demonstrated by reduced ejection fraction and reduced fractional shortening, all of above changes were reversed by LOX-1 knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). What\u0026rsquo;s more, heart weight to tibial length (HW/TL) and the ratio of left ventricular mass to tibial length (LVM/TL) assessed by echocardiography were significantly higher in the ACM group than those in the Blank group, indicating cardiac hypertrophy. However, compared with the ACM group, the HW/TL and LVM/TL in the ACM\u0026thinsp;+\u0026thinsp;sh-LOX-1 group were significantly decreased, indicating that LOX-1 knockdown could inhibit cardiac hypertrophy to some extent (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eMoreover, the results showed that the expression of LDH, cTnI and CK-MB were significantly reduced in the ACM\u0026thinsp;+\u0026thinsp;sh-LOX-1 group compared with the ACM group, suggesting that knockdown of LOX-1 could alleviate alcohol-induced myocardial dysfunction (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003cb\u003eKnockdown of LOX-1 mitigated cardiac hypertrophy, autophagy and apoptosis of cardiomyocytes in ACM rat models\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe cardiac muscle tissues of rats were collected and analyzed to determine the \u003cem\u003ein vivo\u003c/em\u003e influences and mechanism of LOX-1 on cardiac hypertrophy in ACM rats. The results of western blot showed that the LOX-1 protein was highly expressed in ACM group, while it was successfully knocked down in ACM\u0026thinsp;+\u0026thinsp;sh-LOX-1 group. Compared with ACM group, P38MAPK and P38MAPK phosphorylation levels were decreased after LOX-1 knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). In addition, alcohol treatment increased the protein levels of hypertrophy markers (ANP, BNP, MEF2C, and β-MHC), accompanied by a reduction in α-MHC, while knockdown of LOX-1 could reverse these changes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eWhat\u0026rsquo;s more, the HE staining showed that there were no obvious pathologic changes in myocardial tissue of rats in the Blank group, and the cells were arranged neatly. In the ACM group, the pathological changes of myocardial tissue were obvious, with disordered arrangement of muscle bundles. Besides, the maximum cardiomyocyte diameters were increased compared to the blank group, demonstrating cardiomyocyte hypertrophy (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). In addition, results of TUNEL showed a significant increase of apoptotic cells in the ACM group compared to the Blank group, and this change could be rescued by sh-LOX-1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eFurthermore, compared with the ACM group, the protein expression levels of autophagy markers (ATG5, LC3-I, LC3-II, p62 and LAMP1) and apoptosis markers (Bax and Cleaved caspase-3) were significantly decreased in the ACM\u0026thinsp;+\u0026thinsp;sh-LOX-1 group, indicating that knockdown of LOX-1 could partially counteract the pro-autophagy and pro-apoptosis effects of alcohol (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). These findings suggested the knockdown of LOX-1 owned the anti-hypertrophic, restrain excessive autophagy and anti-apoptotic effects in the ACM rat models \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eChronic alcohol abuse can lead to myocardial contractile dysfunction and myocardial remodeling, accompanied by disturbances in mitochondrial homeostasis, altered autophagic function and dysregulation of protein metabolism, and the main manifestations of ACM are cardiac hypertrophy, fibrosis, cardiomyocyte death and heart failure [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The metabolic process of ethanol in rats was similar to humans and the heart is the main organ being attacked by alcohol [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. To date, the pathogenesis of ACM is thought to be related to various factors such as apoptosis, autophagy and ROS production, but many of these pathogenic mechanisms have not been fully theorized [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In this study, we have carried out the research of mechanisms focusing on hypertrophy, autophagy and apoptosis to improve the molecular healthcare and therapeutic method against ACM. We found that alcohol treatment could induce hypertrophy in H9C2 cells and rat myocardial tissue, and it also upregulated the expression levels of hypertrophy, autophagy and apoptotic marker proteins both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. Consistent with the report by Peng et al., our results also suggested that alcohol could induce hypertrophic changes both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAs a transmembrane protein, LOX-1 has been reported to take part in the pathogenic process of many cardiovascular diseases. Its expression was maintained at a relatively low level in normal physiological states. However, under pathological conditions, some external chemicals, inflammatory mediators and cytokines could up-regulate LOX-1 expression and accelerate the occurrence of cardiovascular diseases, so it could be used as a diagnostic marker or even a therapeutic target [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In fact, there were few reports on the effect of LOX-1 expression on cardiac hypertrophy and autophagy in ACM. Our data presented that overexpression of LOX-1 enhanced the harmful effects of alcohol by increasing surface area and autophagy of rat cardiomyocytes, whereas LOX-1 knockdown showed the opposite effect. Besides, the knockdown of LOX-1 \u003cem\u003ein vivo\u003c/em\u003e also diminished the upregulated expression levels of hypertrophy, autophagy and apoptotic markers caused by alcohol in the myocardial tissues of rats. Our results were consistent with the promoting role of LOX-1 in rats ventricular hypertrophy proposed by Zhu et al [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Recently, Lin\u0026rsquo;s research also pointed out that LOX-1 was a key molecule of cardiomyocyte hypertrophic responses [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Besides these, the knockdown of LOX-1 was also reported to relieve apoptosis and autophagic response as well as restored the morphology of cardiomyocytes \u003cem\u003ein vitro\u003c/em\u003e [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Therefore, targeting LOX-1 should be a novel therapeutic method against ACM.\u003c/p\u003e \u003cp\u003eIn our last research, we demonstrated that the knockdown of LOX-1 could mitigate the fibrotic changes in the heart by blocking P38MAPK signaling [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Here, we further presented that the knockdown of LOX-1 could also lighten the hypertrophic changes in the heart as well as reduce the autophagy and apoptosis of cardiomyocytes. The mechanism of myocardial hypertrophy is complex and involves multiple signaling pathways. It has also been shown that the P38MAPK signaling pathway is significantly activated in hypertrophied cardiomyocytes. On the one hand, it was found that retardation of P38MAPK signaling showed alleviative influences on the hypertrophy and autophagy of cardiomyocytes, which was related to MEF2C [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Specifically, the P38MAPK signaling pathway was activated, leading to increased expression level of P38MAPK protein as well as increased levels of phosphorylation, which stimulated increased expression levels of downstream MEF2C protein, resulting the conversion of contractile α-MHC into embryonic β-MHC in cardiomyocytes, and then lead to cardiomyocyte hypertrophy [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn addition, Zhou et al presented that the expression of Beclin-1 in myocardial tissue of rats with long-term heavy alcohol consumption was significantly increased, resulting in the aggregation of autophagic vesicles and impaired autophagic flux, along with apoptosis of cardiomyocytes and impaired cardiac function [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Cardiomyocyte-specific autophagy activation could exacerbate hypertrophic remodeling and systolic dysfunction [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. It was found that multiple ATG proteins such as ATG5 could catalyze the formation of phosphatidylethanolamine-conjugated LC3 (LC3-II) and promote the autophagosome formation process [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Besides, lysosomal-associated membrane proteins (LAMPs) were a group of highly glycosylated transmembrane proteins located on the Lysosome membrane, and it was essential for successful completion of phagosome maturation [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. In addition, lysosomal-associated membrane protein 1 (LAMP1) was commonly used as a lysosomal marker [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. What\u0026rsquo;s more, basal autophagy uses adaptor proteins, such as p62/SQSTM, that identify and deliver misfolded or aggregated proteins and damaged organelles to the autophagosome for degradation, and it was inversely proportional to the degradation of the autophagolysosome [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. We also agreed with Zhao et al\u0026rsquo;s research conclusions which proposed that alcohol stimulated myocardial autophagy and strengthened the expressions of autophagy and apoptosis-associated proteins in cardiomyocytes [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. On the other hand, the activated P38MAPK pathway was found to be closely related to cardiomyocyte apoptosis [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Apoptosis could lead to the reduction of the number of cardiomyocytes and the change of myocardial structure. Apoptosis was regulated by intracellular signaling and was followed by nucleoplasmic condensation, nucleolus cleavage, DNA degradation, and ultimately the formation of apoptotic vesicles. With heavy alcohol consumption, mast cells and macrophages could release TNF-α, which activates caspase-8, followed by caspase-3 and caspase-7 in cardiomyocytes, leading to protein degradation. In the mitochondria, alcohol-induced oxidative stress could lead to DNA damage and induce apoptosis, a process regulated by Bax and Bcl. During apoptosis, Bax was responsible for the formation of small pores in the mitochondrial membrane through which cytochrome C flowed out and recruited the apoptotic protein kinase factor APAF-1, leading to the formation of apoptotic vesicles that activated caspase-9, caspase-7, and caspase-3, causing apoptosis. [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. And P38MAPK signaling pathway played an important role in this process [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Therefore, targeting upstream activators of the P38MAPK pathway was an alternative and effective therapeutic choice for the treatment of ACM.\u003c/p\u003e \u003cp\u003eThe present study investigated the effect of LOX-1 on ACM cardiac hypertrophy in both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e models. The results showed that LOX-1 could significantly aggravate alcohol-induced cardiomyocyte hypertrophy, autophagy and apoptosis, but LOX-1 knockdown could protect H9C2 cardiomyocytes from alcohol-induced injury by blocking the P38MAPK signaling pathway \u003cem\u003ein vitro\u003c/em\u003e. Furthermore, the protective roles of LOX-1 knockdown were verified in ACM rat models \u003cem\u003ein vivo\u003c/em\u003e. We have investigated the molecular biological mechanism of ACM pathogenesis and made some further exploration of the potential and specific role of LOX-1 as an important intervention target in ACM treatment, thus providing experimental data reference and pointing out the future research direction for the prevention and treatment of ACM.\u003c/p\u003e \u003cp\u003eAfter alcohol treatment, the up-regulated LOX-1 promoted P38MAPK expression, then P38MAPK induced β-MHC expression through MEF2C to promote alcoholic hypertrophy. In addition, P38MAPK could activate autophagy through phosphorylation of ULK1, and then promote alcoholic hypertrophy and apoptosis, causing cardiac dysfunction (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). However, LOX-1 expression was regulated by a variety of pro-inflammatory cytokines, oxidative stress response and mechanical stimulation [\u003cspan additionalcitationids=\"CR5 CR6\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. It was reported that alcohol could cause inflammation and oxidative stress [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Therefore, alcohol may induce LOX-1 expression through oxidative stress and the production of pro-inflammatory cytokines but this has not been specifically verified, which was a limitation of our study. Next, studies have shown that in addition to P38MAPK, LOX-1 and alcoholic cardiomyopathy may be related to other mechanisms, such as ROS or inflammation [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan additionalcitationids=\"CR53 CR54 CR55 CR56 CR57\" citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. What\u0026rsquo;s more, P38MAPK was a group of kinases activated by inflammation and stress, which should also include oxidative stress. The interaction between LOX-1, P38MAPK, oxidative stress, and inflammation can be studied in the future.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAlcohol increases the expression and phosphorylation of P38MAPK by up-regulating the expression of LOX-1. Phosphorylated P38MAPK then enters the nucleus to promote β-MHC expression via MEF2C, causing cardiac hypertrophy and leading to alcoholic cardiomyopathy. In addition, activated P38MAPK can phosphorylate ULK1, and then activate Beclin1, which can increase the expression of ATG5, LC3 and LAMP1 to induce autophagy, promoting cardiac hypertrophy and cardiomyocyte apoptosis, and ultimately lead to alcoholic cardiomyopathy.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study confirmed that LOX-1 knockdown could exert anti-hypertrophy and anti-apoptosis effects by inhibiting P38MAPK from inhibiting excessive autophagy in ACM. The current findings provide insights into the molecular mechanisms of how LOX-1 facilitate cardiac hypertrophy in alcoholic cardiomyopathy. In addition, LOX-1 is expected to be a potential target for the treatment of alcoholic cardiomyopathy.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eACM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ealcoholic cardiomyopathy\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLOX-1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003electin-like oxidized low-density lipoprotein receptor 1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHE\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHematoxylin-eosin staining\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTEM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTransmission electron microscopy\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eoxLDL\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eoxidized low-density lipoprotein\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eα-MHC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eα-myosin heavy chain\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eβ-MHC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eβ-myosin heavy chain\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003epropidium iodide\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLVID-d\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eleft ventricular diameter\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eEF\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eejection fraction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003efractional shortening\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLVM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eleft ventricle mass\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLDH\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003elactate dehydrogenase isoenzyme\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ecTnI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emyocardial troponin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCK-MB\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ecreatine kinase isoenzyme\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHW/TL\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eheart weight to tibial length\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLVM/TL\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eleft ventricular mass to tibial length\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLAMPs\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003elysosomal-associated membrane proteins\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLAMP1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003elysosomal-associated membrane protein 1.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors made substantial contributions to the conception and design, acquisition of data, or analysis and interpretation of data; took part in drafting the article or revising it critically for important intellectual content; agreed on the journal to which the article will be submitted; gave final approval of the version to be published; and agree to be accountable for all aspects of the work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used during the present study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Xi\u0026rsquo;an Science and Technology Plan Projects (21YXYJ0066).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was approved by the Animal Care Committee and the Ethical Committee of Ninth Hospital of Xi\u0026rsquo;an and obeyed the NIH laboratory guidelines.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eFern\u0026aacute;ndez-Sol\u0026agrave; J (2020) The Effects of Ethanol on the Heart: Alcoholic Cardiomyopathy. Nutrients 12 (2)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang S, Ren J (2018) Role of autophagy and regulatory mechanisms in alcoholic cardiomyopathy. Biochim Biophys Acta Mol Basis Dis 1864(6 Pt A):2003\u0026ndash;2009\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe J, Luo Y, Song J et al (2020) Non-coding RNAs and Pathological Cardiac Hypertrophy. Adv Exp Med Biol 1229:231\u0026ndash;245\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Zhang R, Lu L et al (2022) Knockdown of lectin-like oxidized low-density lipoprotein-1 ameliorates alcoholic cardiomyopathy via inactivating the p38 mitogen-activated protein kinase pathway. Bioengineered 13(4):8926\u0026ndash;8936\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShibata Y, Kume N, Arai H et al (2007) Mulberry leaf aqueous fractions inhibit TNF-alpha-induced nuclear factor kappaB (NF-kappaB) activation and lectin-like oxidized LDL receptor-1 (LOX-1) expression in vascular endothelial cells. Atherosclerosis 193(1):20\u0026ndash;27\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReiss AB, Anwar K, Wirkowski P (2009) Lectin-like oxidized low density lipoprotein receptor 1 (LOX-1) in atherogenesis: a brief review. Curr Med Chem 16(21):2641\u0026ndash;2652\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSakurai K, Sawamura T (2003) Stress and vascular responses: endothelial dysfunction via lectin-like oxidized low-density lipoprotein receptor-1: close relationships with oxidative stress. J Pharmacol Sci 91(3):182\u0026ndash;186\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL\u0026uuml; J, Mehta JL (2011) LOX-1: a critical player in the genesis and progression of myocardial ischemia. Cardiovasc Drugs Ther 25(5):431\u0026ndash;440\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVahtola E, Louhelainen M, Forst\u0026eacute;n H et al (2010) Sirtuin1-p53, forkhead box O3a, p38 and post-infarct cardiac remodeling in the spontaneously diabetic Goto-Kakizaki rat. Cardiovasc Diabetol 9:5\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin H, Zhang J, Lin H et al (2008) p38 mitogen-activated protein kinase inhibition decreases TNFalpha secretion and protects against left ventricular remodeling in rats with myocardial ischemia. Inflammation 31(2):65\u0026ndash;73\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi M, Georgakopoulos D, Lu G et al (2005) p38 MAP kinase mediates inflammatory cytokine induction in cardiomyocytes and extracellular matrix remodeling in heart. Circulation 111(19):2494\u0026ndash;2502\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurner NA, Blythe NM (2019) Cardiac Fibroblast p38 MAPK: A Critical Regulator of Myocardial Remodeling. J Cardiovasc Dev Dis 6 (3)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen J, Zhang S, Kovacs A et al (2005) Role of p38alpha MAPK in cardiac apoptosis and remodeling after myocardial infarction. J Mol Cell Cardiol 38(4):617\u0026ndash;623\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKojonazarov B, Novoyatleva T, Boehm M et al (2017) p38 MAPK Inhibition Improves Heart Function in Pressure-Loaded Right Ventricular Hypertrophy. Am J Respir Cell Mol Biol 57(5):603\u0026ndash;614\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao T, Kee HJ, Bai L et al (2021) Selective HDAC8 Inhibition Attenuates Isoproterenol-Induced Cardiac Hypertrophy and Fibrosis via p38 MAPK Pathway. Front Pharmacol 12:677757\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi S-Y, Li Q, Shen JJ et al (2006) Attenuation of acetaldehyde-induced cell injury by overexpression of aldehyde dehydrogenase-2 (ALDH2) transgene in human cardiac myocytes: role of MAP kinase signaling. J Mol Cell Cardiol 40(2):283\u0026ndash;294\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAoki Y, Dai H, Furuta F et al (2023) LOX-1 mediates inflammatory activation of microglial cells through the p38-MAPK/NF-κB pathways under hypoxic-ischemic conditions. Cell Commun Signal 21(1):126\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBao MH, Zhang YW, Zhou HH (2013) Paeonol suppresses oxidized low-density lipoprotein induced endothelial cell apoptosis via activation of LOX-1/p38MAPK/NF-κB pathway. J Ethnopharmacol 146(2):543\u0026ndash;551\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang C, Shan XL, Liao YL et al (2014) Effects of stachydrine on norepinephrine-induced neonatal rat cardiac myocytes hypertrophy and intracellular calcium transients. BMC Complement Altern Med 14:474\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMamidi R, Chandra M (2013) Divergent effects of α- and β-myosin heavy chain isoforms on the N terminus of rat cardiac troponin T. J Gen Physiol 142(4):413\u0026ndash;423\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamauchi-Takihara K, Sole MJ, Liew J et al (1989) Characterization of human cardiac myosin heavy chain genes. Proc Natl Acad Sci U S A 86(10):3504\u0026ndash;3508\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMu\u0026ntilde;oz JP, Collao A, Chiong M et al (2009) The transcription factor MEF2C mediates cardiomyocyte hypertrophy induced by IGF-1 signaling. Biochem Biophys Res Commun 388(1):155\u0026ndash;160\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei J, Joshi S, Speransky S et al (2017) Reversal of pathological cardiac hypertrophy via the MEF2-coregulator interface. JCI Insight 2:17\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan J, Molkentin JD (2000) Regulation of MEF2 by p38 MAPK and its implication in cardiomyocyte biology. Trends Cardiovasc Med 10(1):19\u0026ndash;22\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDelbridge LMD, Mellor KM, Taylor DJ et al (2017) Myocardial stress and autophagy: mechanisms and potential therapies. Nat Rev Cardiol 14(7):412\u0026ndash;425\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalluzzi L, Bravo-San Pedro JM, Levine B et al (2017) Pharmacological modulation of autophagy: therapeutic potential and persisting obstacles. Nat Rev Drug Discov 16(7):487\u0026ndash;511\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo R, Hu N, Kandadi MR et al (2012) Facilitated ethanol metabolism promotes cardiomyocyte contractile dysfunction through autophagy in murine hearts. Autophagy 8(4):593\u0026ndash;608\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBa L, Gao J, Chen Y et al (2019) Allicin attenuates pathological cardiac hypertrophy by inhibiting autophagy via activation of PI3K/Akt/mTOR and MAPK/ERK/mTOR signaling pathways. Phytomedicine 58:152765\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu Z, Huang Y, Lv L et al (2018) Acute ethanol exposure-induced autophagy-mediated cardiac injury via activation of the ROS-JNK-Bcl-2 pathway. J Cell Physiol 233(2):924\u0026ndash;935\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi D, Hu J, Wang T et al (2016) Silymarin attenuates cigarette smoke extract-induced inflammation via simultaneous inhibition of autophagy and ERK/p38 MAPK pathway in human bronchial epithelial cells. Sci Rep 6:37751\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan L, Wei S, Wang J et al (2014) Isoorientin induces apoptosis and autophagy simultaneously by reactive oxygen species (ROS)-related p53, PI3K/Akt, JNK, and p38 signaling pathways in HepG2 cancer cells. J Agric Food Chem 62(23):5390\u0026ndash;5400\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan M, Zhao B, Jia H et al (2021) Sinomenine ameliorates cardiac hypertrophy by activating Nrf2/ARE signaling pathway. Bioengineered 12(2):12778\u0026ndash;12788\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuan Q, Si H, Tian L et al (2022) LOX-1 attenuates high glucose-induced autophagy via AMPK/HNF4α signaling in HLSECs. Heliyon 8(12):e12385\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL\u0026ecirc; AD, Kalant H (2017) Intravenous self-administration of alcohol in rats-problems with translation to humans. Addict Biol 22(6):1665\u0026ndash;1681\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng C, Zhang W, Zhao W et al (2015) Alcohol-induced histone H3K9 hyperacetylation and cardiac hypertrophy are reversed by a histone acetylases inhibitor anacardic acid in developing murine hearts. Biochimie 113:1\u0026ndash;9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma T, Romeo F, Mehta JL (2022) LOX-1: Implications in atherosclerosis and myocardial ischemia. Excli j 21:273\u0026ndash;278\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu TT, Zhang WF, Luo P et al (2017) LOX-1 promotes right ventricular hypertrophy in hypoxia-exposed rats. Life Sci 174:35\u0026ndash;42\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin L, Zhou N, Kang L et al (2022) Oxidized LDL but not angiotensin II induces cardiomyocyte hypertrophic responses through the interaction between LOX-1 and AT(1) receptors. J Mol Cell Cardiol 162:110\u0026ndash;118\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKore RA, Henson JC, Hamzah RN et al (2019) Molecular events in MSC exosome mediated cytoprotection in cardiomyocytes. Sci Rep 9(1):19276\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDionyssiou MG, Nowacki NB, Hashemi S et al (2013) Cross-talk between glycogen synthase kinase 3β (GSK3β) and p38MAPK regulates myocyte enhancer factor 2 (MEF2) activity in skeletal and cardiac muscle. J Mol Cell Cardiol 54:35\u0026ndash;44\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLina L, Lu Y, Zhaowen L et al (2018) Effects of Leonurine on p38MAPK and Downstream Gene-expressionin Cardiomyocyte Hypertrophy. Chin Archives Traditional Chin Med 36(11):2614\u0026ndash;2617\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou C, Huang J, Li Q et al (2018) CYP2J2-derived EETs attenuated ethanol-induced myocardial dysfunction through inducing autophagy and reducing apoptosis. Free Radic Biol Med 117:168\u0026ndash;179\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu H, Tannous P, Johnstone JL et al (2007) Cardiac autophagy is a maladaptive response to hemodynamic stress. J Clin Invest 117(7):1782\u0026ndash;1793\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCicchini M, Karantza V, Xia B (2015) Molecular pathways: autophagy in cancer\u0026ndash;a matter of timing and context. Clin Cancer Res 21(3):498\u0026ndash;504\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuynh KK, Eskelinen EL, Scott CC et al (2007) LAMP proteins are required for fusion of lysosomes with phagosomes. Embo j 26(2):313\u0026ndash;324\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng XT, Xie YX, Zhou B et al (2018) Revisiting LAMP1 as a marker for degradative autophagy-lysosomal organelles in the nervous system. Autophagy 14(8):1472\u0026ndash;1474\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePankiv S, Clausen TH, Lamark T et al (2007) p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. J Biol Chem 282(33):24131\u0026ndash;24145\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou H, Sun Y, Zhang L et al (2018) The RhoA/ROCK pathway mediates high glucose-induced cardiomyocyte apoptosis via oxidative stress, JNK, and p38MAPK pathways. Diabetes Metab Res Rev 34(6):e3022\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYi C, Song M, Sun L et al (2022) Asiatic Acid Alleviates Myocardial Ischemia-Reperfusion Injury by Inhibiting the ROS-Mediated Mitochondria-Dependent Apoptosis Pathway. \u003cem\u003eOxid Med Cell Longev.\u003c/em\u003e 2022: 3267450\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChastain LG, Franklin T, Gangisetty O et al (2019) Early life alcohol exposure primes hypothalamic microglia to later-life hypersensitivity to immune stress: possible epigenetic mechanism. Neuropsychopharmacology 44(9):1579\u0026ndash;1588\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMandrekar P, Catalano D, Jeliazkova V et al (2008) Alcohol exposure regulates heat shock transcription factor binding and heat shock proteins 70 and 90 in monocytes and macrophages: implication for TNF-alpha regulation. J Leukoc Biol 84(5):1335\u0026ndash;1345\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTanaka K, Honda M, Takabatake T (2001) Redox regulation of MAPK pathways and cardiac hypertrophy in adult rat cardiac myocyte. J Am Coll Cardiol 37(2):676\u0026ndash;685\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang R, Ding G, Liang W et al (2010) Role of LOX-1 and ROS in oxidized low-density lipoprotein induced epithelial-mesenchymal transition of NRK52E. Lipids Health Dis 9:120\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou MS, Hernandez Schulman I, Pagano PJ et al (2006) Reduced NAD(P)H oxidase in low renin hypertension: link among angiotensin II, atherogenesis, and blood pressure. Hypertension 47(1):81\u0026ndash;86\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaiuolo J, Maretta A, Gliozzi M et al (2018) Ethanol-induced cardiomyocyte toxicity implicit autophagy and NFkB transcription factor. Pharmacol Res 133:141\u0026ndash;150\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKalishwaralal K, Jeyabharathi S, Sundar K et al (2015) Sodium selenite/selenium nanoparticles (SeNPs) protect cardiomyoblasts and zebrafish embryos against ethanol induced oxidative stress. J Trace Elem Med Biol 32:135\u0026ndash;144\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMouton AJ, El Hajj EC, Ninh VK et al (2020) Inflammatory cardiac fibroblast phenotype underlies chronic alcohol-induced cardiac atrophy and dysfunction. Life Sci 245:117330\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePirillo A, Norata GD, Catapano AL (2013) LOX-1, OxLDL, and atherosclerosis. \u003cem\u003eMediators Inflamm.\u003c/em\u003e 2013: 152786\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"LOX-1, alcoholic cardiomyopathy, P38MAPK signaling pathway, cardiac hypertrophy, autophagy, apoptosis, ACM","lastPublishedDoi":"10.21203/rs.3.rs-4733824/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4733824/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eOne of the characteristics of alcoholic cardiomyopathy (ACM) is cardiac hypertrophy, which was reported to be related to lectin-like oxidized low-density lipoprotein receptor 1 (LOX-1), but the mechanism needs to be explored. Here, we explored how LOX-1 facilitated ACM induced cardiac hypertrophy and its molecular mechanisms.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eH9C2 cells and rats were treated with alcohol to establish ACM models \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e, and before alcohol treatment, H9C2 cells were transfected with sh/oe-LOX-1 and oe-P38MAPK adenovirus vector to knockdown or overexpression LOX-1 and P38MAPK. Hematoxylin-eosin staining (HE) and transmission electron microscopy (TEM) were used to quantify cardiomyocyte area and observe autophagosomes, respectively. RT-qPCR and western blot were used to detect the mRNA and protein expression of LOX-1, P38MAPK, p-P38MAPK, markers of cardiac hypertrophy, autophagy and apoptosis in H9C2 cells and rats, respectively. Furthermore, ACM rats were injected with of sh-LOX-1 to test whether LOX-1 knockdown could alleviate alcohol-induced heart injury by inhibiting the P38MAPK signaling pathway.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eAlcohol induced H9C2 cells hypertrophy, obvious autophagy as well as apoptosis, and increased the expression of LOX-1 and P38MAPK. LOX-1 overexpression enhanced the deleterious effects of alcohol, whereas sh-LOX-1 relatively counteracted. The rescure experiment showed that P38MAPK overexpression partially counteracted the protective effect of LOX-1 knockdown by promoting hypertrophy, autophagy and apoptosis in H9C2 cells. In addition, sh-LOX-1 ameliorated alcohol-induced cardiac injury in rats.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eLOX-1 knockdown could inhibit P38MAPK signaling pathway to exert anti-hypertrophy, anti-autophagy and anti-apoptosis effects in ACM. LOX-1 is expected to be a potential target for the treatment of ACM.\u003c/p\u003e","manuscriptTitle":"Knockdown of LOX-1 ameliorates cardiac hypertrophy in alcoholic cardiomyopathy via inactivating the p38MAPK pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-08 12:36:58","doi":"10.21203/rs.3.rs-4733824/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ec986a7b-e0d5-46b2-bf1b-7dd8afa53239","owner":[],"postedDate":"August 8th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-08-16T15:22:02+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-08 12:36:58","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4733824","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4733824","identity":"rs-4733824","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}