Integration of 12-Hour Time-Restricted Feeding with Exercise Training Potentiates Weight Loss and Attenuates MASLD in Diet-Induced Obese Mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Integration of 12-Hour Time-Restricted Feeding with Exercise Training Potentiates Weight Loss and Attenuates MASLD in Diet-Induced Obese Mice Guilherme Correia Ferri Antonio, Ana Paula Azevêdo Macêdo, Gabriel Calheiros Antunes, and 11 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8071932/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 10 Jan, 2026 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Metabolic dysfunction-associated steatotic liver disease (MASLD) is the most prevalent liver disease worldwide, particularly among individuals with overweight and obesity. Non-pharmacological strategies such as time-restricted feeding (TRF) and exercise training can effectively mitigate obesity and metabolic disorders associated with MASLD. However, the specific effects of TRF combined with aerobic training (AT), resistance training (RT), or combined training (CT) on weight loss and MASLD remain unclear. This study investigated the effects of 12h-TRF and exercise training (AT, RT, and CT), applied alone or in combination with TRF, for 10 weeks in diet-induced obese male Swiss mice. Individually, TRF and all exercise protocols reduced weight gain and adiposity, improved glycemic homeostasis, and decreased hepatic fat accumulation. Combining TRF with exercise resulted in more pronounced improvements, suggesting complementary mechanisms. Among the interventions, TRF+AT was the most effective in reducing body weight, fat mass, and hepatic saturated fatty acid accumulation. TRF+CT induced similar effects but with a less marked reduction in hepatic steatosis. Moreover, TRF+AT downregulated lipogenic and inflammatory genes while upregulating genes related to hepatic fatty acid oxidation. TRF+RT was particularly effective in improving glucose homeostasis and insulin sensitivity. In conclusion, combining TRF with AT, RT, or CT significantly improved metabolic and hepatic parameters compared to TRF or training alone in obese mice. These findings highlight the synergistic potential of TRF and exercise and emphasize their specific outcomes, providing new perspectives for personalized interventions against obesity and MASLD. Health sciences/Diseases Health sciences/Endocrinology Health sciences/Gastroenterology Biological sciences/Physiology High-fat diet metabolic associated fatty liver disease (MAFLD) time-restricted eating aerobic training resistance training combined training Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Key Points • Combining 12-hour time-restricted feeding (TRF) with aerobic (AT), resistance (RT), or combined training (CT) produced stronger metabolic and hepatic benefits than either intervention alone in diet-induced obese mice. • TRF + AT most effectively reduced body weight, adiposity, hepatic lipid accumulation, and saturated fatty acids, while TRF + RT markedly improved glucose homeostasis and insulin sensitivity. • The combination of TRF with training decreased hepatic expression of inflammatory and lipogenic genes and increased markers of fatty acid oxidation. • TRF + RT and TRF + AT improved hepatic mitochondrial function, with specific enhancements in oxidative phosphorylation and complex I activity, respectively. • These findings demonstrate that integrating TRF with distinct exercise modalities leads to synergistic and complementary adaptations, offering new perspectives for tailored interventions against obesity and MASLD. Introduction Obesity is a major public health problem linked to an increased risk in mortality 1 . Estimates suggest that over the past four decades, the total number of adults with obesity worldwide has increased more than sixfold 2 – 4 . The pathophysiology of obesity is complex and involves genetic, behavioral, and environmental factors. Among those, lifestyle habits such as irregular eating patterns and physical inactivity contribute to the increased prevalence of the disease 5 , 6 . Obesity is often accompanied by metabolic disorders such as insulin resistance, dyslipidemia, glucose intolerance, and elevated blood pressure, all of which play a central role in the development of highly prevalent chronic diseases such as cardiovascular diseases, type 2 diabetes, and metabolic dysfunction-associated steatotic liver disease (MASLD) 7 , 8 . Among the metabolic epidemics associated with obesity, MASLD has become the most prevalent worldwide 9 . Therefore, strategies to prevent weight gain or promote weight loss are essential for preventing and treating obesity and MASLD. Time-restricted feeding (TRF) is a form of intermittent fasting in which daily food consumption is restricted to between 4 and 16 hours daily wihtout overt attempt to change food quality or to reduce caloric intake 10 – 12 . Studies suggest that TRF can be more easily implemented into the daily routine and maintained with greater adherence 13 . Whereas some studies suggest that the TRF can alleviate the impact of obesity and MASLD 14 – 16 , the effectiveness of TRF may depend on the specific protocol used and individual metabolic conditions. In particular, TRF alone may not be sufficient in the context of pre-established obesity and fatty liver disease, highlighting the potential benefits of combining it with other interventions such as physical exercise 11 . A limited number of studies have evaluated the effects of combined TRF plus exercise 17 – 19 , with no studies to our knowledge specifically interrogating the effect of different types of physical exercise. This is important since the efficacy of different exercise modalities also depend on factors such as intensity, duration, and adherence 20 . This study aimed to test which type of exercise combined with TRF can produce maximal metabolic benefits 20 . Specifically, in this work, we tested the effects of TRF (12-hour fasting period) combined with different exercise modalities (aerobic training (AT), resistance training (RT), or combined training (CT)) on obesity and hepatic metabolism in obese mice. A side-by-side comparison allowed us to establish the distinct physiological adaptations and specific effects that each intervention produces alone and when combined with TRF. In addition, we sought to investigate the profile and quantity of fatty acids in the liver, because changes in the composition of these lipids and their quantity are directly associated with the progression and severity of the disease. We speculate that TRF, especially when combined with physical training, effectively alleviates MASLD in diet-induced obese (DIO) mice models. Furthermore, combining TRF with different types of exercise (aerobic, resistance, or the combination of both) may induce distinct physiological adaptations, potentially generating superior benefits compared to TRF or physical training alone. These integrated approaches may represent promising strategies in the fight against obesity and MASLD. Methods Animals and Ethical Procedures: All animals used in this study were obtained from the Multidisciplinary Center for Biological Research in Laboratory Animal Science (CEMIB) – University of Campinas (UNICAMP). Swiss Albinus mice were selected as an experimental model for this study due to their spontaneous genetic susceptibility to increased body adiposity 21 , which develops after an 8-week exposure to a high-fat diet, resembling clinical results observed in humans 22 . The 3-week-old mice were housed individually in polypropylene cages on a ventilated shelf (Alesco®). As environmental enrichment for the animals, a polyvinyl chloride tube cut in half was inserted, forming a shelter simulating a dark tunnel to reduce the animals' stress. For the entire experimental period, photoperiod control defined as light/dark every 12 hours, ambient temperature of 21°C to 22°C, and humidity between 40% and 60% was adopted. The rats remained in the vivarium until they were 12 weeks old, then the experiment began. Each experimental group was composed of 8 animals. Some animals were excluded from specific analyses due to sample loss, technical issues, or unrelated health complications, leading to variable sample sizes across analyses, as indicated in figure legends. All procedures and experiments involving animals were carried out following Brazilian legislation on the scientific use of animals (Law No. 11.794, of October 8, 2008). All experimental protocols were approved by the Ethics Committee on Animal Use (CEUA/Process Number 6318-1/2023) of the Institute of Biological Sciences, UNICAMP – Campinas-SP, and were also aligned with the National Council for the Control of Animal Experimentation (CONCEA). This study is reported in accordance with the ARRIVE guidelines. Access to water and food was free for some experimental groups, with the standard food (Nuvilab® CR1; Sogorb Ind. & Com. Ltda, São Paulo, Brazil) or a high-fat diet (HFD) according to the American Institute of Nutrition (AIN39-G) 14 . The macronutrient composition of the HFD consists of 20% protein, 35% fat, and 40% carbohydrates. Its formulation includes 11.55% corn starch, 20% casein, 10% sucrose, 13.2% dextrinized starch, 4% soybean oil, 31.2% lard, 5% cellulose, 3.5% mineral mix, 1% vitamin mix, 0.3% L-cystine, and 0.25% choline bitartrate 23 . The diet was offered for 8 weeks. After this period, the mice that received the HFD were distributed into different experimental groups as described below, remaining on the HFD for an additional 10 weeks. Throughout all stages, the animals were weighed weekly, and food intake was monitored by recording the weight of the food offered and the remaining food. Experimental Groups Mice at 12 weeks-old were distributed into six experimental groups: 1 - Control group (CTL), mice that received standard chow ad libitum ; 2 - Obese group (OB), mice fed HFD ad libitum ; 3 - Obese + TRF group (OB + TRF), mice subjected to HFD offered for 12 hours followed by 12 hours of food restriction; 4 - Obese + TRF + AT group (OB + TRF + AT), mice subjected to TRF combined with aerobic training (AT), fed HFD offered for 12 hours followed by 12 hours of food restriction; 5 - Obese + TRF + RT group (OB + TRF + RT), mice subjected to TRF combined with resistance training (RT), fed HFD offered for 12 hours followed by 12 hours of food restriction; 6 - Obese + TRF + CT group (OB + TRF + CT), mice subjected to TRF combined with combined training (CT), fed HFD offered for 12 hours followed by 12 hours of food restriction. The protocols started after 8 weeks of obesity induction by HFD and were carried out over 10 weeks, totaling 18 weeks of the experiment. In addition to the six groups mentioned above, three other groups of mice fed HFD and subjected only to the three physical training protocols (AT, RT, or CT) were included in the study. The results of these last experimental groups can be found in the supplementary material. These experimental groups allowed the comparison of the effects of TRF or its combination with the training protocols to physical training alone on the metabolic parameters in the mice, providing a broad overview of the different strategies applied either in isolation or in combination. Figure 1 A-B summarizes the study design and depicts six main experimental groups out of the nine, for simplicity. Time-Restricted Feeding (TRF) Protocol Mice from the TRF, TRF + AT, TRF + RT, and TRF + CT groups were subjected to a TRF protocol, in which Zeitgeber Time (ZT) 0 was defined as the beginning of the light (inactive) cycle and ZT12 as the end of the light cycle and the beginning of the dark (active) cycle. Therefore, animals subjected to TRF had access to the diet from ZT12 until the end of ZT24, totaling 12 hours of free access (from 6:00 p.m. to 6:00 a.m.) and 12 hours of fasting 24 . TRF was conducted 5 days per week (from Monday to Friday), and the animals had free access to food on Saturday and Sunday. Feeding access was regulated by the daily transfer of the mice between a cage with free access to food and water and another with access to water only. Incremental Treadmill Running Test Initially, the mice were adapted to the treadmill (AVS projetos – São Carlos, São Paulo, Brazil) for 5 days, 10 min/day at a speed of 3 m/min, as standardized by Ferreira et al . (2007) and previously used in our laboratory 17 , 25 . Afterwards, the incremental test was performed. The initial speed of the test was 6 m/min, with 0% inclination and increments of 3 m/min every 3 minutes until voluntary exhaustion of the mice, which occurred when the animals touched the rear end of the treadmill 5 times within a 1-minute interval. The exhaustion velocity (EV), defined as the speed (m/min) at which the animal reached exhaustion, was used to prescribe intensity in the physical training protocol (60% of EV). The animals were evaluated using the incremental treadmill test before the beginning of aerobic training (week 1 of the protocol) and after the physical training period in weeks 6 and 10, for load adjustment and performance analysis. The animals underwent a 48-hour rest after the incremental load test before the next physical exercise session. Aerobic Training Protocol Aerobic training (AT) was performed for 10 weeks at an intensity of 60% of the exhaustion velocity (EV) obtained in the incremental treadmill running test. In the first week, the physical training protocol lasted 30 minutes, consisting of a 5-minute warm-up (6 m/min), followed by 20 minutes at 60% of EV, and ending with 5 minutes of cool-down (6 m/min). This structure, which included warm-up, main exercise phase, and cool-down, was maintained throughout all training sessions. In the second week, the animals exercised for 40 minutes; in the third week, 50 minutes; and in the fourth week, 60 minutes of exercise, which was maintained until the end of the experiment. AT was performed 4 times per week (Monday-Tuesday and Thursday-Friday) during the active cycle (6:00–7:00 a.m.), corresponding to the interval from ZT0 to ZT1, immediately after the food access period. Wednesdays and weekends (Saturdays and Sundays) were reserved for rest. Description and Adaptation to Resistance Training Apparatus and Determination of Maximal Voluntary Carrying Capacity (MVCC) A rodent ladder from AVS Projetos (São Carlos-SP) was used for resistance training (RT), as described in a previous study from our laboratory 18 . The ladder is 50 cm high, angled at 80º relative to the floor. At the top of the ladder is a 30 cm² chamber used for rest between climbing attempts during the adaptation period. A plastic conical tube approximately 7.5 cm in height and 2.5 cm in diameter was used to attach the load to the animal's tail, as described by Minuzzi et al . (2020) 26 . Animals were adapted for 5 days, as Santos et al . (2024) suggested 27 . During adaptation, animals remained inside the chamber at the top of the ladder for 60 seconds with the empty loading apparatus attached to their tail. For the first climbing attempt, animals were placed 15 cm from the chamber entrance; for the second attempt, 25 cm; and from the third attempt onward, animals started from the ladder's base, 50 cm from the chamber. When necessary, manual stimuli were applied to encourage the animals to start climbing. A 60-second rest period was established between attempts. Attempts from the base continued until the animal completed three successful climbs without the need for stimuli. After adaptation, animals rested for 48 hours before starting the maximal voluntary carrying capacity (MVCC) test, described by Minuzzi et al . (2020) 26 . During the test, animals were placed at the ladder's base (50 cm) with an initial load of 75% of their body weight, with increments of 3 g after each successful climb until failure. After each successful trial, the animal was removed from the ladder and placed in an individual cage for a 5-minute rest before the next trial. The highest load carried was recorded as MVCC and normalized by the animal's body weight, expressed as a percentage [(MVCC / body weight) × 100]. This value was subsequently used to prescribe individual loads in the experiment (60% of MVCC). Animals were evaluated in the MVCC test before starting RT (week 1 of protocol) and after the resistance training period at weeks 6 and 10, allowing for workload adjustment and performance analysis 28 , 29 . Resistance Training Protocol After 48 hours of determining the MVCC, the animals began the resistance training (RT) protocol. Training sessions were conducted daily from 6:00–7:00 a.m. (ZT0–ZT1), coinciding with the end of the animals' wake cycle and their access to food. In the first week, mice performed 20 sets, each consisting of a single climb with a load of 60% of MVCC, followed by 45 seconds of rest between sets. However, animals always performed five unloaded climbs for warm-up and cool-down, totalizing 30 climbs. In the second week, animals performed 40 climbs; in the third week, 50 climbs; from the fourth week onwards, 60 climbs were performed and maintained until the end of the experiment. Considering the average climbing time ranged from 8 to 15 seconds per mouse and the recovery time was 45 seconds, each exercise set lasted approximately 1 minute, totaling 60 minutes of physical training. Each experimental week consisted of 4 training days (Monday-Tuesday and Thursday-Friday), with rest on Wednesdays and weekends (Saturday-Sunday). This protocol has been adapted from previous studies conducted by our laboratory 18 , 26 , 29 . Combined Physical Training Protocol The initial procedures for determining exercise intensity for aerobic and resistance training were performed for this group of mice subjected to combined physical training (aerobic + resistance) on alternate days. The animals underwent the previously described resistance training protocol on Mondays and Thursdays. On Tuesdays and Fridays, the animals performed the aerobic training protocol as previously described. All training sessions were conducted daily from 6:00–7:00 a.m. (ZT0–ZT1), coinciding with the end of the animals' wake cycle and their access to food. Animals were assessed by the incremental test (IT) and the maximum voluntary carrying capacity test (MVCC) before starting the combined training (week 1 of the protocol) and at the end of weeks 6 and 10 of the experiment. The animals did not perform physical training protocols on Wednesdays and weekends (Saturdays and Sundays). Grip Strength Test To characterize and measure muscle strength in the resistance-training (RT) model, we performed the grip-strength test using the Grip Strength System (Avs Projetos®, São Carlos, São Paulo, Brazil), as detailed below. Each trial consisted of pulling the animal by the tail so that both forepaws and hind paws grasped all the grid wires until the rodent completely released its grip. With the grid flat (not inclined), three adaptation attempts were made using both forepaws and hind paws, followed by three valid attempts. The average tension values applied were recorded in Newtons (N) and used as a performance parameter 30 , 31 . Glucose Tolerance Test (GTT), Fasting and Postprandial Blood Glucose After 24 hours from the last exercise session and following a 4-hour fast, a distal tail snip was performed on the animals to collect the first blood sample for basal glucose measurement, corresponding to time zero (t0) of the test, which refers to basal glycemia. Bleeding was controlled using a compression bandage (Johnson & Johnson). Immediately after, a 25% glucose solution (2 g/kg body weight) was administered intraperitoneally (i.p.), with subsequent blood samples collected at 30, 60, 90, and 120 minutes for glucose measurement. The area under the curve (AUC) was then calculated for each experimental group. The Accu-Check Active® device measured blood glucose levels during the GTT (Roche, Switzerland). Additionally, on a separate day, after a 12-hour fast and a tail tip cut, blood was collected to analyze fasting glucose levels using the Accu-Check Active® device (Roche, Switzerland). Subsequently, a new blood sample was collected two hours after refeeding to evaluate postprandial glucose. Animals were monitored for 3 hours after the test. Insulin Tolerance Test (ITT) After a prior 4-hour fast and 24 hours following the last exercise session, the mice were subjected to the insulin tolerance test (ITT). For this, the mice received an intraperitoneal injection of recombinant human insulin (Humulin R, Eli Lilly, Indianapolis, IN, USA) at a dose of 1.5 U/kg body weight. Blood samples were collected from the tail at 0, 10, 15, 20, 25, and 30 minutes to determine blood glucose levels using a glucometer (Accu-Chek; Roche, Switzerland). Time zero represents the initial blood collection before insulin injection. The area under the curve (AUC) was calculated individually for each group. Blood samples were obtained by tail snip using surgical scissors, and bleeding was controlled with a compression bandage (Johnson & Johnson). Animals were monitored for 3 hours after the test 32 . Body Weight Analysis, Food Intake, Lee Index, and Relative Liver Weight The mice were weighed twice weekly using an analytical balance (model L3102I, BEL) to monitor changes in body weight over time (18 weeks). Weight gain was calculated using the formula: Weight gain (g) = Final weight (g) – Initial weight (g). Food intake was measured with the same frequency by weighing the remaining food, and cumulative caloric intake was calculated by summing the total energy value (kcal) of the food consumed during the experimental period. The Lee index was calculated using the cube root of the body weight divided by the naso-anal length of the animals [(∛Weight (g)/Length (cm)] 33 , 34 . The relative liver weight was obtained by the ratio between the liver tissue weight (g) and body weight (g), multiplied by 100 35 . Animal Euthanasia, Tissue Collection, and Homogenization Twenty-four hours after the last exercise session (6:00 a.m.), the animals were fasted for 4 hours before tissue collection procedures. Before the surgical and tissue extraction procedures, the mice received an intraperitoneal (i.p.) injection of ketamine chlorohydrate (90 mg/kg; Ketalar®; Parke-Davis, Ann Arbor, MI) and xylazine (10 mg/kg; Rompun®; Bayer®, Leverkusen). Euthanasia was then performed by decapitation. Liver and adipose tissue samples were placed in Eppendorf tubes and frozen in liquid nitrogen. Subsequently, the samples were stored in a Biofreezer at -80°C. Part of these samples was used for quantitative real-time PCR (RT-qPCR) analysis. As described below, liver and adipose tissue fragments were also used for histological studies. Perigonadal, epididymal, retroperitoneal, and mesenteric adipose tissues were collected and weighed using an analytical balance (Gehaka®, BK3000) to compare groups. Blood Biochemical Markers After euthanasia, blood samples were collected and centrifuged at 1,000 × g for 10 minutes at 4°C to separate the serum. The obtained serum was stored at -80°C until biochemical analyses were performed. Concentrations of alanine aminotransferase (ALT) #895214000/01 and aspartate aminotransferase (AST) #895215000/00 were determined using commercial kits (Laborlab®, São Paulo, SP, Brazil), utilizing the serum collected at the time of euthanasia, which occurred 24 hours after the last exercise session and following a 4-hour fasting period. Hepatic Lipid Quantification Hepatic lipid extraction was performed following the method of Folch et al. (1957)58. Approximately 50 mg of liver tissue was homogenized in 2 mL of chloroform:methanol (2:1, v/v). The homogenate was then filtered or centrifuged to remove debris, and 0.2 volumes of 0.9% NaCl solution was added to induce phase separation. After thoroughly mixing and centrifuging at 3,000 rpm for 10 minutes, the mixture separated into a lower organic phase containing lipids and an upper aqueous phase. The lower phase was carefully collected and dried under nitrogen or in a vacuum concentrator, and the lipid residue was resuspended in isopropanol. Triglyceride (kit 1770290) and cholesterol (kit 1770080) levels were measured using colorimetric kits, following the manufacturer's instructions (Laborlab®, São Paulo, Brazil). Histological Analysis of Liver and Adipose Tissue (H&E and Oil Red O) A liver and epididymal white adipose tissue fragment were collected for histological analysis and placed in a conical tube containing 4% paraformaldehyde. After 24 hours of immersion in 4% paraformaldehyde, the samples were washed under running water and stored in 70% ethanol. The tissues were then dehydrated for one hour in a graded ethanol series (80%, 95%, and 100%), cleared in xylene, and embedded in paraffin. The paraffin-embedded tissues were sectioned (microtome, Leica®, RM2145) at a thickness of 4.0 µm and mounted on microscope slides. Hematoxylin and eosin (H&E) staining was used to assess the microscopic structure of the tissues. Images were acquired using a light microscope (LAB2000, LABORANA®, São Paulo, Brazil) equipped with a Moticam Pro 282B 5.0-megapixel camera (Motic®, Hong Kong, China) at 10× and 40× magnification. In addition, another fragment of liver tissue was gradually frozen with isopentane and stored at -80°C. These fragments were sectioned (7 µm) using a cryostat (Leica®, CM1850) and mounted on glass slides. The sections were stained with Oil Red O (ORO, Sigma Aldrich®, St. Louis, MO) for 25 minutes, followed by hematoxylin for 2 minutes, and washed with distilled water for 30 minutes. The slides were then rinsed and mounted with a gelatin:glycerin solution. Images were captured using the Leica Application Suite software, and the red-stained area was quantified using ImageJ software (NIH, Bethesda, MD, USA). The MASLD Activity Score was evaluated under blinded conditions to characterize liver damage induced by the diet. Steatosis was scored from 0 to 3 based on the percentage of hepatocytes affected ( 66%). Hepatocellular ballooning was scored from 0 to 2, and lobular inflammation from 0 to 3, according to the number of foci per field. The total score ranged from 0 to 8 36,37 . Steatosis was assessed at 400× magnification, and inflammation was evaluated in 10 fields, considering foci with ≥ 5 inflammatory cells not arranged in a row 38 . Mitochondrial Respiration Mitochondrial oxygen consumption (pmol s⁻¹.mL⁻¹) was measured using the Oroboros O2k high-resolution respirometer (Oroboros® Instruments, Innsbruck, Austria) and analyzed with the DatLab 7 software. After calibration, 20 µL of the tissue homogenate was added to the chamber. The analyses were conducted at 37°C in MiR05 buffer, with a final volume of 2 mL per chamber. To evaluate complex, I-dependent mitochondrial respiration, malate (0.1 mM) and glutamate (10 mM) were supplemented into the chambers. The addition of ADP (2.5 mM) evaluated respiratory stimulation of the ATP production pathway, whereas complex II-dependent respiration was assessed following the addition of succinate (10 mM). Inhibition of ATP synthesis was subsequently induced with oligomycin (2.5 µM) 39 . Lipid Extraction and Analysis by Mass Spectrometry Lipid extraction was performed according to Folch et al . (1957), and fatty acid methylation was carried out following Shirai et al . (2005) 40 , 41 . Chromatographic analysis was conducted using a gas chromatography system coupled with mass spectrometry (GC-MS; model QP2010 Ultra, Shimadzu® ), equipped with an automatic injector (AOC-20i®). A fused silica capillary column (Rt-2560, Restek®) was used for compound separation, measuring 100 meters in length, 0.25 mm in internal diameter, and 0.20 µm film thickness. The carrier gas used was ultrapure helium, maintained at a constant flow rate of 1.4 mL/min. Injections were performed with a volume of 1 µL in split mode at a ratio of 1:20. The injector temperature was set to 215°C. The oven temperature program started at 80°C and was held for 5 minutes, followed by a temperature increase of 5°C/min up to 175°C, and then a ramp of 1°C/min until reaching 215°C, which was maintained for 26 minutes. The mass spectrometer operated in full scan mode, with an ionization energy of 70 eV, ion source temperature at 215°C, ion detection ranging from 35 to 500 m/z, and a scan speed of 0.2 seconds per cycle. For the identification of fatty acid peaks, a Supelco 37-component FAME mix standard (Sigma-Aldrich®) was used. Quantitative Real-Time PCR (RT-qPCR) The extracted liver tissue was homogenized in 1 mL of Trizol® (Thermo Fisher Scientific), and total RNA was extracted according to the manufacturer's instructions. A total of 2 µg of RNA was used for complementary DNA (cDNA) synthesis using High-Capacity cDNA Reverse Transcription Kits (Thermo Fisher Scientific). The cDNA samples were subjected to quantitative real-time polymerase chain reaction (RT-qPCR) using the SYBR Green detection system (iTaq™ Universal SYBR Green Supermix, Bio-Rad), with 50 ng of cDNA and 0.3 µM of each primer. Gene expression was normalized using Gapdh as the endogenous control, and relative quantification was performed using the 2^−ΔΔCt method. The primers used were specific for target genes related to lipogenesis, lipid oxidation, and inflammation in the liver, as described in Table 1 . Table 1 Primer sequences used for the RT-qPCR technique Gene Forward (5' – 3') Reverse (5' – 3') Pparα ACCACTACGGAGTTCACGCATG GAATCTTGCAGCTCCGATCACAC Cpt1α AAAGATCAATCGGACCCTAGACA CAGCGAGTAGCGCATAGTCA Acsl1 ACACTTCCTTGAAGCGATGG GGCTCGACTGTATCTTGTGG Acox GGGAGTGCTACGGGTTACATG CCGATATCCCCAACAGTGATG Acadl TCCATGGCAAAATACTGGGC GCATCCACGTAAGCTTTTGC Chrebpα GCCTCCGCCAGACCTCACTG AGTGCTGAGTTGGCGAAGGG Acc GTTCTGTTGGACAACGCCTTCAC GGAGTCACAGAAGCAGCCCATT Cd36 TGGAGCTGTTATTGGTGCAG TGGGTTTTGCACATCAAAGA Fatp4 GACTTCTCCAGCCGTTTCCACA CAAAGGACAGGATGCGGCTATTG Srebp1c GAGCCATGGATTGCACATTT GGGAAGTCACTGTCTTGGTTG Il1β TGGACCTTCCAGGATGAGGACA GTTCATCTCGGAGCCTGTAGTG Il6 ACCACTTCACAAGTCGGAGGC CTGCAAGTGCATCATCGTTGTTC Tnfα CAGGCGGTGCCTATGTCTC CGATCACCCCGAAGTTCAGTAG Nfkb GATTCCGGGCAGTGACG GATGAGGGGAAACAGATCGTCC Tlr4 GTTCTCTCATGGCCTCCACT GGAACTACCTCTATGCAGGGAT Gapdh CATCACTGCCACCCAGAAGACTG ATGCCAGTGAGCTTCCCGTTCAG Statistical Analysis All results are expressed as mean ± standard deviation (SD). Data normality was assessed using the Shapiro–Wilk W test. Student's t-test (parametric) or Mann–Whitney test (non-parametric) was used to compare two groups simultaneously. For comparisons of more than two groups simultaneously, one-way ANOVA followed by Tukey's post hoc test (parametric) or Kruskal–Wallis test (non-parametric) was applied. Statistical significance was set at p < 0.05. The GraphPad Prism 8.0 software was used to analyze and generate the graphs. Results All types of physical training elicit performance improvements without adverse effects of TRF. Physical performance improved in all exercised groups. Mice under TRF combined with aerobic or combined training (TRF + AT and TRF + CT) showed a higher speed at exhaustion in a treadmill incremental test (Figs. 2 A–B), without differences between groups (Fig. 2 C) or compared to groups subjected only to aerobic training or combined training (AT and CT) (Figures S1 A–B). Similar results were observed in the groups subjected to TRF combined with resistance training (TRF + RT and TRF + CT), with improved performance (Figs. 2 D–E), but no difference between groups (Fig. 2 F). TRF + RT and TRF + CT were more effective in improving post-intervention performance than isolated resistance training (RT and CT) (Figures S1 C–D). Last, all groups showed increased grip strength after the intreventions (Fig. 2 G), with no significant difference compared to the individual training groups (Figures S1 E–G). AT, RT, and CT combined with TRF have greater effects on weight loss, reduction in adiposity, and improvement in glycemic control compared to TRF alone. Mice fed a high-fat diet weighed 35.9 ± 3.0 g at the beginning of the induction protocol, whereas mice fed a standard diet weighed 37.5 ± 3.6 g. Mice fed a high-fat diet gained significantly more weight than mice fed a standard diet during the 8-week obesity induction (Fig. 3 A). A significant reduction in body weight was observed in the TRF + AT, TRF + RT, and TRF + CT groups compared to the control group from the 1st week of interventions until the end of the experimental protocol (Figs. 3 A-B). The TRF + AT and TRF + CT groups showed greater weight loss than the TRF-only group, and the TRF + CT group more than the CT-only group (Figure S2 A). This reduction occurred without differences in food intake among the groups over the 10-week intervention period (Figs. 3 C-D). To assess the effects of the various weight loss (WL) interventions on adiposity, we weighed the different fat depots at collection. The weights of the retroperitoneal and inguinal fat pads were higher in the control group than in all intervention groups (Fig. 3 E). The weight of the retroperitoneal fat was significantly lower in the TRF + AT group compared to the isolated AT group (Figure S2 B). For the inguinal fat depots, the TRF-only group showed higher weight than the TRF groups combined with training, with the TRF + CT group presenting lower weight than the TRF + RT group (Fig. 3 E). The total weight of the adipose depots was significantly greater in the control group compared to all TRF groups combined with exercise training. The total amount of fat was significantly lower in the TRF + AT and TRF + CT groups compared to the TRF-only group, with the TRF + CT group having less fat than the TRF + RT group (Fig. 3 F). The Lee index was also significantly higher in the control group than in all intervention groups (Fig. 3 G). In order to evaluate the effects of the different weight loss (WL) interventions on glycemic control, we assessed fasting and postprandial blood glucose levels, as well as glucose and insulin tolerance tests. Fasting and postprandial glucose levels were significantly lower in the intervention groups compared to the obese (OB) group (Figs. 3 H–I). Specifically, fasting glucose was lower in the TRF + AT and TRF + CT groups than in the isolated AT and CT groups (Figures S2 C–D). Similarly, postprandial glucose was also reduced in the TRF + AT and TRF + RT groups compared to the isolated AT and RT groups (Figures S2 E–F). The glucose tolerance test (GTT) revealed a significant improvement in glycemic regulation in all intervention groups compared to the OB group. Furthermore, the TRF groups combined with training presented a reduced glycemic curve compared to the isolated TRF group (Figs. 3 J–K). Similarly, the insulin tolerance test (ITT; Figs. 3 L–M) indicated a better glycemic response to insulin in all groups subjected to fasting and training interventions compared to the OB and isolated TRF groups. Additionally, blood glucose in the TRF + AT group was significantly lower compared to the isolated AT group (Figures S2 G–H). The statistical analyses were based on the area under the curve (AUC; Figs. 3 K–M and S2H) to facilitate interpretation. TRF combined with physical training attenuates hepatic lipids, serum biomarkers, and optimizes mitochondrial respiration in the liver Images obtained from hematoxylin-eosin (H&E) and Oil Red O (ORO) staining revealed an absence of lipids in the CTL group and lipid accumulation in the OB group. In the groups subjected to interventions, the lipid droplets appeared smaller and less numerous (Fig. 4A and Fig. 3SA). Quantification of Oil Red O staining confirmed these observations. The groups fed with HFD showed greater hepatic fat accumulation compared to the control group (CTL). However, all intervention groups significantly reduced hepatic fat compared to the OB group. Furthermore, the TRF + AT and TRF + RT groups exhibited substantially lower fat accumulation than the TRF group alone, with the TRF + AT group being even more effective than TRF + CT in this parameter (Fig. 4B). Finally, the TRF + AT and TRF + RT groups were more efficient in reducing hepatic fat content than AT and RT alone (Figure S3B-C). Additionally, the relative liver weight in the OB group was higher compared to the groups subjected to the combination of TRF with physical training (Fig. 4C). Hepatic cholesterol levels quantified by biochemical analysis revealed lower content in the intervention groups compared to the OB group (Fig. 4D). It is worth noting that the TRF + RT combination presented even lower cholesterol levels than RT alone (Figure S3D). Similarly, hepatic triglyceride (TG) levels were higher in the OB group than in other groups. The TRF + RT and TRF + CT groups also showed lower hepatic triglyceride amounts than the TRF group alone (Fig. 4E). Furthermore, TRF + AT was more efficient than AT alone in reducing serum triglyceride levels (Figure S3E). Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were quantified in mice (Figs. 4F–G). In line with previous findings, ALT levels were significantly higher in the OB group than in other groups (Fig. 4F). A similar result was observed for AST, highlighting the groups subjected to TRF combined with training, which presented reduced levels compared to the isolated TRF group (Fig. 4G). Additionally, the TRF + RT group also showed lower ALT and AST levels when compared to the isolated TRF group (Figures S3F–G). The evaluation of the steatosis score reinforces the histological and biochemical findings (Fig. 4H). Confirming previous findings, steatosis indicators were higher in the OB group than in the other groups, while the groups subjected to TRF combined with training showed lower levels than the isolated TRF group. Additionally, the OB group exhibited more hepatocellular ballooning than all interventions, combining TRF with physical training. It was also noted that the TRF + CT group significantly reduced this parameter compared to isolated TRF. A similar pattern was observed in hepatic inflammation, where levels were higher in the OB group, while TRF + AT and TRF + RT presented lower inflammatory scores than isolated TRF. Consequently, MASLD activity was more pronounced in the OB group, but fasting combined with physical training resulted in more pronounced reductions than TRF alone (Fig. 4H). Next, we investigated the influence of interventions on mitochondrial respiratory activity in the liver. The efficiency of mitochondrial respiratory chain complex I was higher in the TRF + RT group when compared to the OB, TRF + AT, and TRF + CT groups (Fig. 4I). Additionally, complex II efficiency in the OB group was lower compared to the CTL, TRF + AT, and TRF + RT groups (Fig. 4J). Corroborating these results, oxidative phosphorylation (OXPHOS) showed greater efficiency in the TRF + RT group compared to the OB, TRF, and TRF + CT groups (Fig. 4K). Finally, respiration linked to ATP synthesis was significantly higher in the TRF + RT group than in the OB, TRF, and TRF + CT groups (Fig. 4L). TRF + RT induced the most consistent mitochondrial benefits, TRF + AT showed the greatest reduction in hepatic fat, and TRF + CT also promoted specific benefits compared to isolated TRF, though with a distinct pattern from the other combined interventions. Figure 4. Effects of time-restricted feeding combined with aerobic, resistance, and combined training on liver fat accumulation, lipid metabolism, and mitochondrial function. A, Histological plate of liver tissue stained with hematoxylin-eosin (H&E) and Oil Red O (ORO). B, Quantification of the area stained with Oil Red O (n = 6). C, Relative liver weight (%) (n = 7). D, Hepatic cholesterol (n = 5). E, Hepatic triglycerides (n = 5). F, Serum alanine aminotransferase (ALT) (n = 5). G, Serum aspartate aminotransferase (AST) (n = 5). H, Steatosis score (n = 6). I, Mitochondrial complex I (CI) (n = 4). J, Mitochondrial complex II (CII) (n = 4). K, Oxidative phosphorylation (OXPHOS) (n = 4). L, Respiration linked to ATP synthesis (n = 4). Bars represent the mean and standard deviation. Statistical significance was as follows: *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.001. Note ALT and AST levels are expressed in µkat/L (micromoles of substrate converted per second per liter). TRF combined with physical training enhances the reduction of adipocyte diameter To complement the analyses of body weight and fat, hematoxylin and eosin (H&E) staining was performed on epididymal adipose tissue to qualitatively assess adipocyte morphology and observe possible changes in their size. Representative images of the mice visually illustrate greater body fat accumulation in the obese group compared to the groups subjected to TRF interventions combined with physical training interventions (Fig. 5 A). Furthermore, histological images revealed adipocytes with reduced diameter in the control group and in the intervention groups compared to the obese group, qualitatively corroborating the previous findings (Fig. 5 B). TRF combined with physical training alters the profile and content of hepatic fatty acids in obese mice We carried out chromatography and mass spectrometry to evaluate the profile and quantity of hepatic fatty acids. Our analysis revealed alterations in fatty acids previously linked to inflammatory processes, with higher levels observed in the obese group than in others. The total amount of fatty acids was significantly reduced only in the TRF interventions combined with physical training, compared to the OB group (Fig. 6 A). The total amount of saturated fatty acids was significantly higher in the OB group compared to the groups subjected to TRF combined with physical training. Furthermore, the TRF + AT and TRF + CT groups showed even lower levels of saturated fatty acids when compared to isolated TRF (Fig. 6 B). Specifically, levels of lauric acid (C12:0) were increased in the OB group compared to the CTL group, and only the TRF + AT group could significantly reduce these levels (Fig. 6 C). For myristic acid (C14:0), all intervention groups effectively reduced its levels compared to the obese group. Moreover, the TRF + AT group showed an even more pronounced reduction than the group subjected only to isolated TRF (Fig. 6 D). Palmitic acid (C16:0) levels were also assessed and found to be reduced in the intervention groups compared to the obese group, reinforcing the effectiveness of intermittent fasting, whether applied alone or combined with physical training, in lowering saturated fatty acids associated with inflammation (Fig. 6 E). The total amount of monounsaturated fatty acids (MUFA) revealed that the groups subjected to TRF combined with physical training showed consistent reductions compared to the obese group (Fig. 6 F). Levels of palmitoleic acid (16:1 ω7) were reduced in all interventions compared to the OB group (Fig. 6 G). Furthermore, all groups subjected to TRF combined with training were effective in lowering oleic acid (18:1 ω9) levels compared to the OB group, with the TRF + CT group demonstrating greater efficiency in reducing these levels compared to the isolated TRF group (Fig. 6 H). Among the combined interventions, the TRF + CT group exhibited the most pronounced reduction in oleic acid levels, followed by TRF + AT and TRF + CT. Hepatic content of ω6 and ω3 fatty acids is altered after TRF intervention combined with training To investigate the effects of the different interventions on hepatic polyunsaturated fatty acid (PUFA) composition, we quantified the profile and abundance of ω6 and ω3 fatty acid families and their respective members. Mice fed a high-fat diet (HFD) and subjected to time-restricted feeding (TRF) combined with aerobic training (TRF + AT) or combined training (TRF + CT) showed reduced total levels of PUFAs and ω6 fatty acids compared to the obese (OB) group (Figs. 7 A–B). For total ω3 fatty acids, their levels were significantly lower in the TRF + RT and TRF + CT groups compared to the OB group (Fig. 7 C). Levels of linoleic acid (C18:2 ω6) were reduced only in the TRF + AT and TRF + CT groups (Fig. 7 D). Despite this, the C18:2 to C20:4 bioconversion remained unchanged in both TRF + AT and TRF + CT groups (Fig. 7 E). All groups subjected to TRF combined with training showed reduced levels of alpha-linolenic acid (C18:3 ω3) and eicosapentaenoic acid (C20:5 ω3) compared to the OB group (Figs. 7 F–G). In contrast, levels of docosahexaenoic acid (C22:6 ω3) showed no significant differences between groups (Fig. 7 H). Finally, the ω6:ω3 ratio did not differ significantly among the experimental groups (Fig. 7 I). TRF combined with physical training reduces inflammatory and lipogenic genes and stimulates genes involved in lipid oxidation To explore the molecular mechanisms underlying the effects of the interventions, we evaluated hepatic mRNA expression of genes involved in inflammation, lipogenesis, and lipid oxidation. For inflammatory genes, the OB group showed higher Tlr4 , Tnfα , and Il1β mRNA levels than all other groups. In contrast, only the TRF, TRF + RT, and TRF + CT groups exhibited reduced Nfkb mRNA levels. Additionally, only the TRF and TRF + AT groups were able to reduce Il6 mRNA levels compared to the OB group (Fig. 8A). For lipogenic genes, only the TRF + CT group reduced the mRNA expression of Srebp1c and Fatp4 compared to the OB group. Moreover, Fatp4 mRNA levels were also lower in the TRF + CT group than in the isolated TRF group. The mRNA expression of Cd36 was reduced in all groups compared to the OB group. In contrast, only the groups combining TRF with exercise significantly reduced Acc expression, particularly the TRF + AT group, which showed even lower levels than the isolated TRF group. Notably, the OB group exhibited elevated Chrebpα mRNA levels compared to all other groups (Fig. 8B). For genes associated with lipid oxidation, Pparα mRNA levels were lower in the OB group compared to the control (CTL) and TRF + AT groups, whereas Acox1 mRNA expression was reduced in the TRF + RT group compared to both the OB group and all other interventions. Additionally, the TRF + AT group showed higher expression of Acadl and Acsl1 than the isolated TRF group, which also exhibited higher levels of these genes than the OB and TRF + RT groups. Lastly, Cpt1α mRNA levels were higher in the groups combining TRF with aerobic training (TRF + AT and TRF + CT) compared to the TRF + RT group (Fig. 8C). Figure 8. Effects of time-restricted feeding combined with aerobic, resistance, or combined training on the expression of inflammatory, lipogenic, and oxidative genes. A, mRNA levels of inflammatory genes; B, mRNA levels of lipogenic genes; C, mRNA levels of genes involved in lipid oxidation (n = 4–5). Bars represent the mean and standard deviation. Statistical significance was as follows: *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.001. The combined interventions involving TRF and physical training led to distinct outcomes depending on the type of exercise performed. However, all combinations resulted in more favorable effects when compared to TRF alone. A graphical summary of the main outcomes associated with each combined protocol is presented in Fig. 9 . Discussion By investigating the effects of time-restricted feeding (TRF) combined with different modalities of physical training (AT, RT, and CT) in HFD-induced obese mice, we observed that the combination of these interventions promoted a more pronounced reduction in body weight and adiposity, as well as improvements in glycemic homeostasis and physical performance, compared to isolated TRF or training. There was also a reduction in hepatic lipid accumulation and hepatic fatty acid profile alterations. Hepatic gene expression indicated decreased levels of inflammatory and lipogenic mRNAs, with increased fatty acid oxidation. These findings indicate synergistic and complementary metabolic adaptations from the combination of TRF with different physical training protocols, resulting in favorable outcomes for treating obesity and MASLD in mice, which may serve as a basis for future translational investigations. Furthermore, the effects varied according to the exercise modality, indicating that different types of training promote distinct metabolic benefits. These findings are consistent with previous studies reporting positive effects of TRF and physical training on hepatic metabolism and body composition 17 – 19 , 42 . However, most existing literature investigates these interventions in isolation or employs a single type of exercise. In contrast, our study expands upon this by directly comparing distinct physical training modalities in combination with TRF. This design allowed us to show that the type of exercise distinctly influenced the metabolic adaptations to TRF, particularly in pathways related to hepatic lipid handling and inflammation, thus providing a more detailed understanding of how these strategies interact. In the present study, the TRF protocol with a 12-hour feeding window (during the dark cycle) was ineffective in reducing body weight and total body fat compared to the obese group. However, its combination with physical training resulted in a significant decrease in these parameters, despite no difference in caloric intake between groups, suggesting that the effects were due to the combination of interventions. It is worth noting that, although CT alone already promoted relevant benefits, the addition of TRF further potentiated weight loss, confirming the complementary effect between the strategies. This observation reinforces the idea that TRF may act as an additional resource to enhance the impact of physical training on obesity control in animal models 17 , 18 , a hypothesis that requires validation in clinical studies. These findings align with previous reviews summarizing evidence on intermittent fasting strategies, including TRF, and their interaction with exercise on body composition and metabolic health 43 . Previous studies in experimental models 44 , 45 and humans 46 have shown that TRF protocols employing shorter feeding windows effectively reduce body weight. Chaix et al . (2014), for example, observed that only C57BL/6 male mice subjected to a 15-hour fasting period showed a significant reduction in body weight. In contrast, a daily fasting period of less than 12 hours was insufficient to induce protective metabolic responses against obesity 47 . In another study, Hatori et al . (2012) reported weight loss with 16-hour TRF, even without changes in food intake, suggesting that the duration of the feeding window may influence weight loss independently of caloric consumption, in obese C57BL/6 mice 14 . Thus, our results indicate that 12-hour TRF alone may be insufficient to promote weight and body fat loss without caloric reduction in DIO Swiss mice. However, TRF combined with physical training potentiated the effects, especially when TRF is combined with aerobic or combined training, with the latter (TRF + CT) being more effective than the combined training performed alone. These findings suggest that the combination of TRF and physical training produces synergistic effects, although distinct depending on the type of intervention, with the potential to optimize body weight control. We demonstrated that mice fed a high-fat diet for 8 weeks exhibit excessive weight gain, body fat accumulation, and impairments in glycemic homeostasis and insulin sensitivity. These findings are consistent with previous studies that employed comparable high-fat diet protocols in mice 48 – 50 . However, robust evidence from preclinical and clinical studies shows that TRF effectively restores glycemic homeostasis and insulin sensitivity compromised by HFD 51 – 53 . Moreover, physical exercise modalities, such as aerobic and resistance training, have also been widely associated with improved glycemic homeostasis in obese mice 54 – 57 . Our results indicate that TRF alone already exerts beneficial effects on glycemic control; however, its combination with physical training potentiates these effects. Overall, these combinations yielded the most consistent results, surpassing isolated training interventions in fasting and postprandial glycemia as well as in insulin tolerance tests. These findings reinforce that the type of exercise influences outcomes and that integrating these approaches provided additional benefits in regulating glycemic homeostasis in the animals studied, suggesting a potential that should be tested in clinical research 58 . The limited capacity of adipose tissue expansion during weight gain favors the ectopic accumulation of lipids. In this context, the liver becomes one of the main targets, receiving free fatty acids released by adipose tissue through the portal circulation. This contributes to hepatic fat accumulation, impairing metabolic function 59 – 61 . In line with this mechanism, our results showed higher hepatic lipid accumulation in the OB group compared to the CTL group, as evidenced by histological analyses as well as hepatic triglyceride and cholesterol measurements. Elevated serum levels of ALT and AST enzymes, classical markers of hepatic health, accompanied this accumulation 62 , 63 . Notably, all applied interventions were able to reduce these parameters, indicating attenuation of hepatic steatosis, accompanied by improvements in biochemical indicators and MASLD score. Similar results were observed in previous studies in which mice subjected to HFD followed by TRF reduced hepatic lipid accumulation 14 , 51 , 64 . Likewise, investigations in rodents using different modalities of physical exercise (aerobic, resistance, and combined training), whether applied alone or combined with TRF, also reported results comparable to ours 17 , 18 , 26 , 28 , 54 , 65 , but did not compare their combined effects directly. Our study fills this gap by contrasting the physiological responses of each modality combined with TRF. Nikroo et al . (2020), when comparing the effects of aerobic, resistance, and combined training on MASLD in HFD-induced obese mice, observed that AT and RT promoted the most favorable changes for disease improvement 28 . Similarly, our results indicate that although AT and RT protocols were effective in the murine model employed, the reduction in hepatic lipids and liver enzymes was more pronounced when combined with TRF, suggesting a potential synergism that merits further investigation in other models and clinical trials 18 . Given this, we investigated whether these improvements were associated with changes in mitochondrial function, as mitochondrial dysfunction is a hallmark of MASLD, characterized by morphological alterations, impaired activity of respiratory complexes, and increased reactive oxygen species production, which triggers oxidative stress and contributes to liver disease progression 66 . Compared to the control group, the obese group showed reduced activity of complex I and oxidative phosphorylation (OXPHOS) capacity, indicating hepatic mitochondrial dysfunction. Although the liver initially attempts to compensate for the energy overload by increasing OXPHOS capacity, this mechanism raises the production of reactive oxygen species (ROS) and oxidative stress 67 . Probably due to the chronic HFD exposure adopted in our 18-week protocol, there is a loss of this plasticity, which may have resulted in the reduction of complex I activity and OXPHOS capacity, thus contributing to lipid accumulation and liver damage. However, the literature remains unclear on which factors trigger this loss of plasticity 68 . Additionally, we observed that 12 hours of isolated TRF did not result in relevant changes in hepatic mitochondrial respiration. On the other hand, TRF + RT consistently improved overall mitochondrial function. The combination of TRF + AT promoted a specific increase in complex I activity. These findings suggest that, under the tested conditions, isolated TRF was insufficient to induce hepatic mitochondrial respiration adaptations. Still, its association with training, specifically resistance training, may potentiate targeted effects. The impacts of TRF on hepatic mitochondrial respiration are still not very clear. Damasceno et al . (2023) 18 demonstrated that mice on HFD, subjected to a 16-hour TRF or RT, showed improved mitochondrial respiratory function in hepatocytes. As in our findings, the combination of TRF + RT was more effective than isolated TRF. However, unlike our results, the 16-hour isolated TRF in Damasceno et al . 18 was sufficient to promote benefits in mitochondrial function, indicating that a longer fasting period may be necessary to enhance mitochondrial adaptations. It is important to highlight that, unlike our model, the animals in the cited study were not previously induced to obesity 18 . Furthermore, our intervention used a shorter fasting window. These two factors may have independently limited the benefits of isolated TRF on mitochondrial respiration 18 . Regarding the effects of physical training on hepatic mitochondrial parameters in MASLD, some evidence indicates that different types of training can increase mitochondrial metabolic activity in the liver, even without changes in total mitochondrial content 69 – 71 . These findings support our results, which show positive effects of TRF when combined with resistance training. The hepatic lipid profile showed no significant differences in total fatty acids (saturated, MUFA, PUFA) after 12 h of TRF compared to the OB group, regardless of training combinations. In MASLD, excess liver fat is preferentially stored as saturated lipids 72 , which appear particularly sensitive to TRF combined with physical training. Isolated TRF reduced pro-inflammatory fatty acids 14:0 and 16:0 73,74 , while its association with training intensified this effect, indicating synergistic metabolic action. TRF + AT was most effective, reducing 12:0, 14:0, and 16:0, possibly via enhanced oxidative pathways or hepatic lipid remodeling from aerobic training during fasting 75 , 76 . This reduction is relevant since elevated levels of these SFAs promote hepatic inflammation and metabolic dysfunction, contributing to liver disease progression 73 , 74 . TRF + CT also decreased total SFAs, though less than TRF + AT. MUFAs 16:1 (ω7) and 18:1 (ω9) declined with TRF plus training, whereas isolated TRF reduced only 16:1 (ω7); 18:1 (ω9) is directly involved in in de novo lipogenesis (DNL) 75 . These findings align with Jackson et al . (2011), who reported that lower SCD-1 expression correlated with reduced hepatic MUFA accumulation in ovariectomized mice undergoing aerobic training 77 , 78 . Although their model involved ovariectomized female mice and ours used males, the data support a link between reduced SCD-1 activity and lower hepatic MUFA content. Fasting induces a marked activation of fatty acid oxidation in the liver 79 – 81 . Our results showed that the OB group had more PUFAs (ω6 and ω3) than the CTL group. When fasting was combined with physical training, especially in the protocols that included aerobic training (AT and CT), the amount of hepatic PUFAs was significantly reduced; however, fasting alone did not show changes compared to the OB group. This reduction can be explained by the increased rate of total fatty acid oxidation in the liver during fasting, which was enhanced by physical training, particularly aerobic exercise, known to more strongly stimulate the use of fatty acids as an energy source 17 , 82 , 83 . A previous study with short-term fasting (~ 16 h in a single day) in mice fed a standard diet reported increased hepatic PUFAs, especially from the ω3 family, such as EPA and DHA (Marks et al ., 2016) 84 . In contrast, we observed that the groups subjected to TRF combined with physical training reduced hepatic PUFAs compared to the obese group. This difference may be attributed to the combination of a chronic high-fat diet, prolonged fasting protocol (10 weeks), and the additional stimulus of physical training, which may have promoted increased PUFA oxidation or even changes in their mobilization and hepatic retention. Although ω3 PUFAs are generally associated with health benefits, in the context of obesity, this reduction likely reflects decreased liver fat accumulation and improved lipid utilization, representing a favorable metabolic adaptation that may even affect classes of fatty acids usually considered less oxidizable, such as PUFAs 84 . Molecular analyses showed that OB mice had higher mRNA levels of inflammatory ( Tlr4 , Tnfα , Nfkb , Il1β , Il6 ) and lipogenic genes ( Srebp1c , Cd36 , Fatp4 , Acc , and Chrebpα ) compared to CTL. TRF, especially when combined with physical training, reduced the expression of these genes. TRF + CT and TRF + AT were particularly effective in lowering Fatp4 and Acc , respectively, compared to TRF alone, indicating greater potential to suppress hepatic lipogenesis. These results are consistent with Paiva et al. (2022) 85 , who reported that obese mice under 24-h intermittent fasting plus treadmill running showed greater reductions in lipogenic genes and increased β-oxidation gene expression versus fasting alone. Similarly, we found higher expression of lipid oxidation genes ( Pparα , Acsl1 , Cpt1α , and Acadl ), especially in TRF + AT, reinforcing the synergistic potential of aerobic training with fasting in modulating hepatic fatty acid metabolism. Prior studies also show aerobic training reduces hepatic lipogenic genes and increases β-oxidation-related genes 17 , 86 , 87 . This upregulation likely contributes to reduced hepatic fatty acid accumulation, suggesting a key mechanism by which aerobic training with TRF may alleviate liver lipid overload. By directly comparing TRF alone and its combination with distinct training protocols, our study more clearly highlights the specific and complementary effects of each approach on hepatic gene expression. The observed metabolic effects may be related to the interventions, especially the impact of physical training on skeletal muscle. Thus, improving glycemic homeostasis and insulin sensitivity may reflect skeletal muscle adaptations. However, as skeletal muscle parameters were not directly assessed, this remains a limitation of the present study that will be addressed in future research. Considering the pleiotropic and multisystemic effects of exercise, it is important to highlight that training adaptations are not limited to hepatic tissue 88 , 89 . Moreover, although this is a preclinical study, it was not designed to elucidate the underlying mechanisms of the observed improvements, which require further investigation in future studies. Another noteworthy point is that our combined training alternated between aerobic (two days/week) and resistance (two days/week) exercises. It remains to be determined whether performing resistance exercise followed by aerobic exercise in the same session would produce different outcomes. Furthermore, assessing muscle cross-sectional area and hypertrophy could provide a better understanding of the adaptations induced by combining TRF with varying exercise modalities, helping explain these interventions' effects on body mass. In conclusion, we demonstrated that combining TRF with AT, RT, and the combination of both caused some important improvements in physical health status relative to TRF or training alone in DIO mice. Furthermore, our results showed that TRF + AT was effective and superior to other combinations in reducing weight and body fat mass, fat content and the accumulation of saturated fatty acids in the liver. Although TRF + CT showed similar results, its impact on hepatic steatosis was less pronounced. Meanwhile, TRF + RT was particularly effective in improving glucose homeostasis and insulin sensitivity compared with TRF alone. These findings reinforce the potential of combining these approaches, highlighting their differences and expanding the possibilities for refining and personalizing actions against obesity and MASLD. Declarations Conflict of Interest The author of this study has no competing interests to declare. Funding This work was supported by The National Council for Scientific and Technological Development (CNPq; process number 309268/2023-0). This project cooperates with proven international articulation (CNPq; process number 441725/2023-6) and São Paulo Research Foundation (FAPESP; case numbers 2023/03677-3; 2024/16630-8). Author Contribution GCFA performed all the experiments. GCFA and JRP analyzed the data. GCFA prepared the figures. GCFA and JRP drafted the manuscript. GCFR, APAM and GCA performed the training with mice. APAM, GCA, LMD and GDB participated in the tissue collection, TSR performed the chromatography. GCFA, RDL and BSP performed the RT-qPCR. ASRS, RAM, DEC, ERR, AC and JRP edited and revised the manuscript. GCFA and JRP conceived and designed the research. All authors approved the submitted version. Data Availability All data generated and/or analysed during this study are included in this published article and its supplementary information files. References Safaei, M., Sundararajan, E. A., Driss, M. & Boulila, W. Shapi’i, A. A systematic literature review on obesity: Understanding the causes & consequences of obesity and reviewing various machine learning approaches used to predict obesity. Comput. Biol. Med. 136 , 104754 (2021). Kadouh, H. C. & Acosta, A. Current paradigms in the etiology of obesity. Tech. Gastrointest. Endosc . 19 , 2–11 (2017). Zhang, C., Zhang, J., Liu, Z. & Zhou, Z. More than an Anti-diabetic Bariatric Surgery, Metabolic Surgery Alleviates Systemic and Local Inflammation in Obesity. Obes. Surg. 28 , 3658–3668 (2018). Phelps, N. H. et al. Worldwide trends in underweight and obesity from 1990 to 2022: a pooled analysis of 3663 population-representative studies with 222 million children, adolescents, and adults. Lancet 403 , 1027–1050 (2024). Factors, O. H. R. et al. Prevalence of Obesity, Diabetes, and Obesity-Related Health Risk Factors, 289, 2001–2004 (2003). (2001). Kang, J. H. et al. Interaction of genetic and environmental factors for body fat mass control: observational study for lifestyle modification and genotyping. Sci. Rep. 11 , 1–9 (2021). Despres, J. P., Lemieux, I., B D Om I, N a L O B E S I T & Y a N D M E T a B O L I C S Y N D R Om E. Nature 444 , 881–887 (2006). Younossi, Z. et al. Global burden of NAFLD and NASH: Trends, predictions, risk factors and prevention. Nat. Rev. Gastroenterol. Hepatol. 15 , 11–20 (2018). Hagström, H., Shang, Y., Hegmar, H. & Nasr, P. Natural history and progression of metabolic dysfunction-associated steatotic liver disease. Lancet Gastroenterol. Hepatol. 9 , 944–956 (2024). Sherman, H. et al. Timed high-fat diet resets circadian metabolism and prevents obesity. FASEB J. 26 , 3493–3502 (2012). Črešnovar, T. et al. Early time-restricted eating with energy restriction has a better effect on body fat mass, diastolic blood pressure, metabolic age and fasting glucose compared to late time-restricted eating with energy restriction and/or energy restriction alone: A 3-mon. Clin. Nutr. 49 , 57–68 (2025). Chow, L. S. et al. Time-Restricted Eating Effects on Body Composition and Metabolic Measures in Humans who are Overweight: A Feasibility Study. Obesity 28 , 860–869 (2020). Regmi, P. & Heilbronn, L. K. Time-Restricted Eating: Benefits, Mechanisms, and Challenges in Translation. iScience 23, 101161 (2020). Hatori, M. et al. Time-restricted feeding without reducing caloric intake prevents metabolic diseases in mice fed a high-fat diet. Cell. Metab. 15 , 848–860 (2012). Peng, X. et al. Time-restricted feeding rescues circadian disruption-aggravated progression of Alzheimer’s disease in diabetic mice. J. Nutr. Biochem. 110 , 109128 (2022). Chaix, A., Lin, T., Le, H. D., Chang, M. W. & Panda, S. Time-Restricted Feeding Prevents Obesity and Metabolic Syndrome in Mice Lacking a Circadian Clock. Cell. Metab. 29 , 303–319e4 (2019). Vieira, R. F. L. et al. Time-restricted feeding combined with aerobic exercise training can prevent weight gain and improve metabolic disorders in mice fed a high-fat diet. J. Physiol. 600 , 797–813 (2022). de Lima, R. D. et al. Time-restricted feeding combined with resistance exercise prevents obesity and improves lipid metabolism in the liver of mice fed a high-fat diet. Am. J. Physiol. - Endocrinol. Metab. 325 , E513–E528 (2023). Antunes, G. C. et al. Time-restricted feeding combined with exercise improves hepatic and glycaemic metabolism in obese mice: A sex-dependent study. 0 , 1–21 (2025). van Baak, M. A. et al. Effect of different types of regular exercise on physical fitness in adults with overweight or obesity: Systematic review and meta-analyses. Obes. Rev. 22 , 1–11 (2021). Marei, W. F. A. et al. Differential effects of high fat diet-induced obesity on oocyte mitochondrial functions in inbred and outbred mice. Sci. Rep. 10 , 1–14 (2020). Goossens, G. H. The Metabolic Phenotype in Obesity: Fat Mass, Body Fat Distribution, and Adipose Tissue Function. Obes. Facts . 10 , 207–215 (2017). Cintra, D. E. et al. Unsaturated fatty acids revert diet-induced hypothalamic inflammation in obesity. PLoS One 7 , (2012). Vieira, I. et al. Time-restricted feeding reduces in fl ammatory markers and downregulates JAG1 and NICD protein levels in the liver of aged mice ^ do Mac e. 133 , (2025). Ferreira, J. C. B. et al. Maximal lactate steady state in running mice: Effect of exercise training. Clin. Exp. Pharmacol. Physiol. 34 , 760–765 (2007). Minuzzi, L. G. et al. Short-term Resistance Training Increases APPL1 Content in the Liver and the Insulin Sensitivity of Mice Fed a Long-term High-fat Diet. Exp. Clin. Endocrinol. Diabetes . 128 , 30–37 (2020). Santos, J. D. M. et al. Strength Training Protects High-Fat-Fed Ovariectomized Mice against Insulin Resistance and Hepatic Steatosis. Int J. Mol. Sci 25 , (2024). Nikroo, H., Hosseini, S. R. A., Fathi, M., Sardar, M. A. & Khazaei, M. The effect of aerobic, resistance, and combined training on PPAR-α, SIRT1 gene expression, and insulin resistance in high-fat diet-induced NAFLD male rats. Physiol. Behav. 227 , 113149 (2020). Pereira, R. M. et al. FOXO1 is downregulated in obese mice subjected to short-term strength training. J. Cell. Physiol. 237 , 4262–4274 (2022). da Rocha, A. L. et al. Downhill Running Excessive Training Inhibits Hypertrophy in Mice Skeletal Muscles with Different Fiber Type Composition. J. Cell. Physiol. 231 , 1045–1056 (2016). Pereira, B. C. et al. Excessive training impairs the insulin signal transduction in mice skeletal muscles. J. Endocrinol. 230 , 93–104 (2016). Bonora, E. et al. Estimates of in vivo insulin action in man: Comparison of insulin tolerance tests with euglycemic and hyperglycemic glucose clamp studies. J. Clin. Endocrinol. Metab. 68 , 374–378 (1989). Jagot, S. A., Webb, G. P., Rogers, P. D. & Dickerson, J. W. T. Estimation of body fat content in normal, chemically-obese and obese hyperglycaemic mice. IRCS Med. Sci. 8 , 93–94 (1980). Novelli, E. L. B. et al. Anthropometrical parameters and markers of obesity in rats. Lab. Anim. 41 , 111–119 (2007). Bernardes, D. et al. Metabolic Alterations in Experimental Autoimmune Encephalomyelitis in Mice: Effects of Prior Physical Exercise. Neurophysiology 48 , 117–121 (2016). Kleiner, D. E. et al. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 41 , 1313–1321 (2005). Power Guerra, N. et al. The effect of different weight loss strategies to treat non-alcoholic fatty liver disease focusing on fibroblast growth factor 21. Front. Nutr. 9 , 1–14 (2022). Liebig, M. et al. Microcirculatory disturbances and cellular changes during progression of hepatic steatosis to liver tumors. Exp. Biol. Med. 243 , 1–12 (2018). Braga, R. R. et al. Exercise alters the mitochondrial proteostasis and induces the mitonuclear imbalance and UPRmt in the hypothalamus of mice. Sci. Rep. 11 , 3813 (2021). FOLCH, J. & LEES, M. SLOANE STANLEY, G. H. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 226 , 497–509 (1957). Shirai, N., Suzuki, H. & Wada, S. Direct methylation from mouse plasma and from liver and brain homogenates. Anal. Biochem. 343 , 48–53 (2005). Domingos Brisque, G. et al. Combination of time-restricted feeding with resistance exercise ameliorates MAFLD and improves glycemic homeostasis in obese mice. Life Metab. 4 , 4–8 (2025). Tinsley, G. M. & La Bounty, P. M. Effects of intermittent fasting on body composition and clinical health markers in humans. Nutr. Rev. 73 , 661–674 (2015). Wipt, P. & George, K. M. 基因的改变NIH Public. Access. Bone 23 , 1–7 (2008). Aouichat, S. et al. Time-Restricted Feeding Improves Body Weight Gain, Lipid Profiles, and Atherogenic Indices in Cafeteria-Diet-Fed Rats: Role of Browning of Inguinal White Adipose Tissue. Nutrients 12, 2185 (2020). Moro, T. et al. Effects of eight weeks of time-restricted feeding (16/8) on basal metabolism, maximal strength, body composition, inflammation, and cardiovascular risk factors in resistance-trained males. J. Transl Med. 14 , 1–10 (2016). Chaix, A., Zarrinpar, A., Miu, P. & Panda, S. Time-restricted feeding is a preventative and therapeutic intervention against diverse nutritional challenges. Cell. Metab. 20 , 991–1005 (2014). Marchesini, G. et al. Association of nonalcoholic fatty liver disease with insulin resistance. Am. J. Med. 107 , 450–455 (1999). Li, J., Wu, H., Liu, Y. & Yang, L. High fat diet induced obesity model using four strains of mice: kunming, c57bl/6, balb/c and icr. Exp. Anim. 69 , 326–335 (2020). Álvarez-Amor, L. et al. Extra virgin olive oil improved body weight and insulin sensitivity in high fat diet-induced obese LDLr–/–.Leiden mice without attenuation of steatohepatitis. Sci. Rep. 11 , 1–16 (2021). Chung, H. et al. Time-restricted feeding improves insulin resistance and hepatic steatosis in a mouse model of postmenopausal obesity. Metabolism 65 , 1743–1754 (2016). Jamshed, H. et al. Effectiveness of Early Time-Restricted Eating for Weight Loss, Fat Loss, and Cardiometabolic Health in Adults With Obesity: A Randomized Clinical Trial. JAMA Intern. Med. 182 , 953–962 (2022). Wilkinson, M. J. et al. Ten-Hour Time-Restricted Eating Reduces Weight, Blood Pressure, and Atherogenic Lipids in Patients with Metabolic Syndrome. Cell. Metab. 31 , 92–104e5 (2020). Botezelli, J. D. et al. Strength Training Prevents Hyperinsulinemia, Insulin Resistance, and Inflammation Independent of Weight Loss in Fructose-Fed Animals. Sci. Rep. 6 , 1–13 (2016). Pereira, R. M. et al. Short-term combined training reduces hepatic steatosis and improves hepatic insulin signaling. Life Sci. 287 , 1–9 (2021). Chou, T. J. et al. Effects of aerobic, resistance, and high-intensity interval training on thermogenic gene expression in white adipose tissue in high fat diet induced obese mice. Obes. Res. Clin. Pract. 18 , 64–72 (2024). Marinho, R. et al. Endurance exercise training increases APPL1 expression and improves insulin signaling in the hepatic tissue of diet-induced obese mice, independently of weight loss. J. Cell. Physiol. 227 , 2917–2926 (2012). Schübel, R. et al. Effects of intermittent and continuous calorie restriction on body weight and metabolism over 50 wk: A randomized controlled trial. Am. J. Clin. Nutr. 108 , 933–945 (2018). Bosy-Westphal, A., Braun, W., Albrecht, V. & Müller, M. J. Determinants of ectopic liver fat in metabolic disease. Eur. J. Clin. Nutr. 73 , 209–214 (2019). Meneses, M. J. et al. Distinct impacts of fat and fructose on the liver, muscle, and adipose tissue metabolome: An integrated view. Front. Endocrinol. (Lausanne) . 13 , 1–16 (2022). Rosqvist, F. et al. Overfeeding polyunsaturated and saturated fat causes distinct effects on liver and visceral fat accumulation in humans. Diabetes 63 , 2356–2368 (2014). Lin, Y. C., Chang, P. F. & Ni, Y. H. Updated upper limits of normal serum alanine aminotrasferase levels for screening metabolic dysfunction-associated fatty liver disease in obese children. J. Formos. Med. Assoc. 121 , 2548–2555 (2022). Xu, Z. & Xu, B. Nonlinear association between AST/ALT ratio and 28-day all-cause mortality following ICU admission in critically ill cirrhotic patients: a retrospective cohort study. BMC Gastroenterol 25 , (2025). Regmi, P. et al. Early or delayed time-restricted feeding prevents metabolic impact of obesity in mice. J. Endocrinol. 248 , 75–86 (2021). Muñoz, V. R. et al. Exercise decreases CLK2 in the liver of obese mice and prevents hepatic fat accumulation. J. Cell. Biochem. 119 , 5885–5892 (2018). Pessayre, D. Role of mitochondria in non-alcoholic fatty liver disease. J Gastroenterol. Hepatol 22 , (2007). Kahl, S. et al. Dysglycemia and liver lipid content determine the relationship of insulin resistance with hepatic OXPHOS capacity in obesity Authors Dysglycemia and liver lipid content determine the relationship of insulin resistance with hepatic OXPHOS capacity in obesi. 417–426 (2025). 10.1016/j.jhep.2024.08.012 Fromenty, B. & Roden, M. Mitochondrial alterations in fatty liver diseases. J. Hepatol. 78 , 415–429 (2023). Gonçalves, I. O. et al. Exercise alters liver mitochondria phospholipidomic profile and mitochondrial activity in non-alcoholic steatohepatitis. Int. J. Biochem. Cell. Biol. 54 , 163–173 (2014). Fletcher, J. A. et al. Impact of various exercise modalities on hepatic mitochondrial function. Med. Sci. Sports Exerc. 46 , 1089–1097 (2014). Gonçalves, I. O., Oliveira, P. J., Ascensão, A. & Magalhães, J. Exercise as a therapeutic tool to prevent mitochondrial degeneration in nonalcoholic steatohepatitis. Eur. J. Clin. Invest. 43 , 1184–1194 (2013). Erickson, M. L. et al. Non-invasive assessment of hepatic lipid subspecies matched with non-alcoholic fatty liver disease phenotype. Nutr. Metab. Cardiovasc. Dis. 29 , 1197–1204 (2019). Saraswathi, V. et al. Myristic Acid Supplementation Aggravates High Fat Diet-Induced Adipose Inflammation and Systemic Insulin Resistance in Mice. Biomolecules 12 , 1–15 (2022). Korbecki, J. & Bajdak-Rusinek, K. The effect of palmitic acid on inflammatory response in macrophages: an overview of molecular mechanisms. Inflamm. Res. 68 , 915–932 (2019). Lamaziere, A., Wolf, C., Barbe, U., Bausero, P. & Visioli, F. Lipidomics of hepatic lipogenesis inhibition by omega 3 fatty acids. Prostaglandins Leukot. Essent. Fat. Acids . 88 , 149–154 (2013). Ezpeleta, M. et al. Effect of alternate day fasting combined with aerobic exercise on non-alcoholic fatty liver disease: A randomized controlled trial. Cell. Metab. 35 , 56–70e3 (2023). Jackson, K. C. et al. Wheel running prevents the accumulation of monounsaturated fatty acids in the liver of ovariectomized mice by attenuating changes in SCD-1 content. Appl. Physiol. Nutr. Metab. 36 , 798–810 (2011). Paton, C. M. & Ntambi, J. M. Biochemical and physiological function of stearoyl-CoA desaturase. Am. J. Physiol. - Endocrinol. Metab. 297 , 28–37 (2009). Kersten, S. et al. Peroxisome proliferator-activated receptor α mediates the adaptive response to fasting. J. Clin. Invest. 103 , 1489–1498 (1999). Defour, M., Hooiveld, G. J. E. J., Van Weeghel, M. & Kersten, S. Probing metabolic memory in the hepatic response to fasting. Physiol. Genomics . 52 , 602–617 (2020). Ruppert, P. M. M. & Kersten, S. Mechanisms of hepatic fatty acid oxidation and ketogenesis during fasting. Trends Endocrinol. Metab. 35 , 107–124 (2024). Purdom, T., Kravitz, L., Dokladny, K. & Mermier, C. Understanding the factors that effect maximal fat oxidation. J Int. Soc. Sports Nutr 15 , (2018). Muscella, A., Stefàno, E., Lunetti, P., Capobianco, L. & Marsigliante, S. The regulation of fat metabolism during aerobic exercise. Biomolecules 10 , 1–29 (2020). Marks, K. A. et al. Fasting enriches liver triacylglycerol with n-3 polyunsaturated fatty acids: implications for understanding the adipose–liver axis in serum docosahexaenoic acid regulation. Genes Nutr. 10 , 1–14 (2015). de Castro-de-Paiva, P., Marinho, T. S., Mandarim-de-Lacerda, C. A. & Aguila, M. B. Intermittent fasting, high-intensity interval training, or a combination of both have beneficial effects in obese mice with nonalcoholic fatty liver disease. J Nutr. Biochem 104 , (2022). Gil-Cosano, J. J. et al. Effects of combined aerobic and resistance training on the inflammatory profile of children with overweight/obesity: A randomized clinical trial. Pediatr. Obes. 1–14. 10.1111/ijpo.13152 (2024). Diniz, T. A. et al. Aerobic training improves NAFLD markers and insulin resistance through AMPK-PPAR-α signaling in obese mice. Life Sci 266 , (2021). Pedersen, B. K. & Febbraio, M. A. Muscles, exercise and obesity: Skeletal muscle as a secretory organ. Nat. Rev. Endocrinol. 8 , 457–465 (2012). Chen, Y. et al. Benign adaptation for exercise and benefits for non-alcoholic fatty liver disease. Biochem. Biophys. Res. Commun. 726 , 150305 (2024). Additional Declarations No competing interests reported. Supplementary Files SupplementaryDataGuilhermeCorreia.pdf SupplementaryFile.pdf Cite Share Download PDF Status: Published Journal Publication published 10 Jan, 2026 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 09 Dec, 2025 Reviews received at journal 07 Dec, 2025 Reviewers agreed at journal 01 Dec, 2025 Reviews received at journal 25 Nov, 2025 Reviewers agreed at journal 25 Nov, 2025 Reviewers invited by journal 25 Nov, 2025 Editor assigned by journal 25 Nov, 2025 Editor invited by journal 20 Nov, 2025 Submission checks completed at journal 18 Nov, 2025 First submitted to journal 18 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8071932","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":553041387,"identity":"4d2068b2-4ef4-4751-b02c-37833bb28d5c","order_by":0,"name":"Guilherme Correia Ferri Antonio","email":"","orcid":"","institution":"State University of Campinas","correspondingAuthor":false,"prefix":"","firstName":"Guilherme","middleName":"Correia Ferri","lastName":"Antonio","suffix":""},{"id":553041388,"identity":"28013ac5-8164-44cd-8102-6fd07a28e871","order_by":1,"name":"Ana Paula Azevêdo Macêdo","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"prefix":"","firstName":"Ana","middleName":"Paula Azevêdo","lastName":"Macêdo","suffix":""},{"id":553041389,"identity":"4bb6f2fc-13ee-46d8-a836-2397e4f212b5","order_by":2,"name":"Gabriel Calheiros Antunes","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"prefix":"","firstName":"Gabriel","middleName":"Calheiros","lastName":"Antunes","suffix":""},{"id":553041390,"identity":"f36ac1db-995e-4671-87a9-2f98e5c30e80","order_by":3,"name":"Robson Damasceno de Lima","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"prefix":"","firstName":"Robson","middleName":"Damasceno","lastName":"de Lima","suffix":""},{"id":553041391,"identity":"da292aae-780f-4e78-bcca-aadfba9b6d78","order_by":4,"name":"Thaiane da Silva Rios","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"prefix":"","firstName":"Thaiane","middleName":"da Silva","lastName":"Rios","suffix":""},{"id":553041392,"identity":"dded6337-d9c0-4b65-bef6-a6b53ef6a025","order_by":5,"name":"Beatriz de Souza Pitoli","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"prefix":"","firstName":"Beatriz","middleName":"de Souza","lastName":"Pitoli","suffix":""},{"id":553041393,"identity":"35b5656b-6c20-457d-8e11-0d8a9c73f54f","order_by":6,"name":"Guilherme Domingos Brisque","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"prefix":"","firstName":"Guilherme","middleName":"Domingos","lastName":"Brisque","suffix":""},{"id":553041394,"identity":"9df49249-1e56-4bd0-9e6c-239c6b92434e","order_by":7,"name":"Larissa Moreira Dias","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"prefix":"","firstName":"Larissa","middleName":"Moreira","lastName":"Dias","suffix":""},{"id":553041395,"identity":"5f08ec97-6cd5-41f5-b9ab-60036b9050c0","order_by":8,"name":"Adelino Sanchez Ramos Silva","email":"","orcid":"","institution":"Ribeirão Preto Medical School, University of São Paulo (USP)","correspondingAuthor":false,"prefix":"","firstName":"Adelino","middleName":"Sanchez Ramos","lastName":"Silva","suffix":""},{"id":553041396,"identity":"36ef2bf3-8a8c-4395-91ea-eaf4b3cb11d0","order_by":9,"name":"Dennys Esper Cintra","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"prefix":"","firstName":"Dennys","middleName":"Esper","lastName":"Cintra","suffix":""},{"id":553041397,"identity":"32bc1ed7-0427-46e5-b97c-ad20cf525ba1","order_by":10,"name":"Rania A. Mekary","email":"","orcid":"","institution":"Massachusetts College of Pharmacy and Health Sciences","correspondingAuthor":false,"prefix":"","firstName":"Rania","middleName":"A.","lastName":"Mekary","suffix":""},{"id":553041398,"identity":"ae612c56-9f8e-40d0-9114-9b3c2c60bd5b","order_by":11,"name":"Eduardo Rochete Ropelle","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"prefix":"","firstName":"Eduardo","middleName":"Rochete","lastName":"Ropelle","suffix":""},{"id":553041399,"identity":"58877804-79a2-4fa1-8441-cfe4ba9d4552","order_by":12,"name":"Amandine Chaix","email":"","orcid":"","institution":"University of Utah","correspondingAuthor":false,"prefix":"","firstName":"Amandine","middleName":"","lastName":"Chaix","suffix":""},{"id":553041400,"identity":"e1ddaeb5-3e17-4b8c-9335-28170f160805","order_by":13,"name":"José Rodrigo Pauli","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBklEQVRIiWNgGAWjYHACA4YEMM3ccKCCgUEOxDzwgDgtjA0HzjAwGIO1JBDSwgDVwgDUktgAYuPTYt7evO3Dg182efwzEhsPHKixS58fdvgh0BY7Od0G7FpkzhwrnpHYl1YscSOx4cCBY8m5G2+nGQC1JBubHcCuRUIix5ghsedwYgNQy+GPDcy5G2cngLQcSNxGSMt8kC0HG+rTDWenfyCsJeHH4cQNEC2HE+SlcwjYwnOsGBhKacWGZx6C/HLccIN0TsGBBAM8fmFv3sz4449Nntzx5MMfDtRUy8vPTt/84UOFnRwuLWDA2IYUEQZglQY4lMLBHyQt8g2EVI+CUTAKRsFIAwD5TG9uOlsF1QAAAABJRU5ErkJggg==","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":true,"prefix":"","firstName":"José","middleName":"Rodrigo","lastName":"Pauli","suffix":""}],"badges":[],"createdAt":"2025-11-10 02:23:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8071932/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8071932/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-33139-8","type":"published","date":"2026-01-10T15:57:24+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":97108651,"identity":"f20daf9a-56b9-429f-ac73-d62e16b8623c","added_by":"auto","created_at":"2025-12-01 05:46:55","extension":"jpg","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":244461,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/ba802f693d2b1ae4630e7b52.jpg"},{"id":97141246,"identity":"572cb5eb-d792-4195-ab45-1ab55f36e464","added_by":"auto","created_at":"2025-12-01 10:06:28","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16898513,"visible":true,"origin":"","legend":"","description":"","filename":"ManuscriptGuilhermeCorreia.docx","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/9581567f4beea6afaf7109b1.docx"},{"id":97108660,"identity":"ce37a814-a51c-4080-bf7d-2cf79c95fa1a","added_by":"auto","created_at":"2025-12-01 05:46:55","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":166528,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/663aea84b1eded11d48e5a9a.jpg"},{"id":97108670,"identity":"016e1908-8bdd-434e-b1a2-0f09e814af78","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":309490,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/f489b6c738d8d85f7010827e.jpg"},{"id":97108656,"identity":"f619119b-e87a-4d0a-964b-1558a69df7db","added_by":"auto","created_at":"2025-12-01 05:46:55","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1823168,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/f1b818fbec66deef18128d79.png"},{"id":97142187,"identity":"5d93f527-30cd-47e6-807f-5b6ce8b528c1","added_by":"auto","created_at":"2025-12-01 10:07:23","extension":"jpg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":640642,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/919c997db19fa545b54e5377.jpg"},{"id":97139847,"identity":"2463ada4-c15c-4f53-b9fc-1c1aad403ac7","added_by":"auto","created_at":"2025-12-01 10:02:44","extension":"jpg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":165889,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/34e83590232f2a6e66ae4973.jpg"},{"id":97141622,"identity":"14743ec6-de9f-43d6-8a7e-b0521a52f7df","added_by":"auto","created_at":"2025-12-01 10:06:51","extension":"jpg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":163448,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/c95d3da2402f22fb2ca2c1c5.jpg"},{"id":97141597,"identity":"0ec93751-4ac6-44d6-9da8-e7930f6efbad","added_by":"auto","created_at":"2025-12-01 10:06:50","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":196474,"visible":true,"origin":"","legend":"","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/9587f4e85cc816288b427b2f.png"},{"id":97142678,"identity":"41623427-b490-4adb-879b-b09e233a9e21","added_by":"auto","created_at":"2025-12-01 10:07:49","extension":"jpg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":201453,"visible":true,"origin":"","legend":"","description":"","filename":"Figure9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/80d38fa57df03548504ed750.jpg"},{"id":97108678,"identity":"7bb18f66-13d1-4a7a-bf59-e243aea040db","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"jpg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":195005,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/d2b2fbf19dc34cf9cec239a5.jpg"},{"id":97108672,"identity":"90b929c3-c8dd-46ea-aec9-ae11968d81bf","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"jpg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":195453,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/75568d9ded1db16b38165b55.jpg"},{"id":97140292,"identity":"b7c69632-c1f3-46fb-a392-ddccb6c48f8e","added_by":"auto","created_at":"2025-12-01 10:04:30","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1602692,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS3.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/9a26a96974315e3b88a26f9e.png"},{"id":97108675,"identity":"d9684ef0-2023-4c34-ac5c-f33fc0722ea7","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"json","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13935,"visible":true,"origin":"","legend":"","description":"","filename":"27b00bc9b8374c95808b7f728ab2e77e.json","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/dde4bf835b4c7809a5b8048f.json"},{"id":97140213,"identity":"14a55b85-0e07-435f-be48-cb6d0711a4b8","added_by":"auto","created_at":"2025-12-01 10:04:09","extension":"pdf","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":511244,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryDataGuilhermeCorreia.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/d2cf1138e6a721bc427f750a.pdf"},{"id":97142733,"identity":"7544e0d5-cff4-4337-b4ce-cdc67407d51a","added_by":"auto","created_at":"2025-12-01 10:07:55","extension":"pdf","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2792222,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/6348e38311ac4ec71be41352.pdf"},{"id":97108685,"identity":"eb24106e-c665-4cdb-b667-57724e053ef6","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"xml","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":223443,"visible":true,"origin":"","legend":"","description":"","filename":"27b00bc9b8374c95808b7f728ab2e77e1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/eecd59a6cf45018062f72c45.xml"},{"id":97141824,"identity":"99a53224-a2be-477a-9d2b-a660d5c91b6d","added_by":"auto","created_at":"2025-12-01 10:07:04","extension":"jpg","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":244461,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/e75bb9369ff12f294f541c0b.jpg"},{"id":97108690,"identity":"a25aca96-0585-445a-937b-2e881df6f472","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"jpg","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":166528,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/84af82d0db26a851c39ed7a6.jpg"},{"id":97140545,"identity":"86fbbf8d-ef56-4767-9469-9beb3eab1c9c","added_by":"auto","created_at":"2025-12-01 10:05:13","extension":"jpg","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":309490,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/438adeb34f1b76ef75485bc9.jpg"},{"id":97140206,"identity":"d2ce52c2-d0e6-4f74-9721-fdcf5153d6f8","added_by":"auto","created_at":"2025-12-01 10:04:08","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1823168,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/90009bf7b93eb2c95739d9ef.png"},{"id":97108680,"identity":"525d76f6-e6f2-461c-bd75-2a058332f8a3","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"jpg","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":640642,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/0b6d51e7a846d90c02a1d7bb.jpg"},{"id":97108674,"identity":"1d685f16-e138-4572-92fe-a9255b3f97ed","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"jpg","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":165889,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/0408dcf4cea2c84740626da8.jpg"},{"id":97108688,"identity":"c5a67c62-780b-4072-aa34-5a5057476922","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"jpg","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":163448,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/1e0bc7a65693924542999e54.jpg"},{"id":97108687,"identity":"2f190d07-5ab8-41d3-9562-b713ce25ad54","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":196474,"visible":true,"origin":"","legend":"","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/37e1e51e8e1c76da7064e247.png"},{"id":97108683,"identity":"4b12b27a-f529-4b7f-8689-7f666b5d6ff7","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"jpg","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":201453,"visible":true,"origin":"","legend":"","description":"","filename":"Figure9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/144e8fe3e19d16a17ccffe76.jpg"},{"id":97108676,"identity":"164f25f4-693f-446f-99c7-1dc4834c9680","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"jpg","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":195005,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/732867963586031732a813fa.jpg"},{"id":97140215,"identity":"23296283-8eef-4f26-955d-f963aabe3de9","added_by":"auto","created_at":"2025-12-01 10:04:09","extension":"jpg","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":195453,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/976824044ce20fa7dbb88946.jpg"},{"id":97141046,"identity":"ac80d0fa-9554-4113-9452-b1952eb6db67","added_by":"auto","created_at":"2025-12-01 10:06:09","extension":"png","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1602692,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS3.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/5a662f3cd07b8f4cc5706f7c.png"},{"id":97108681,"identity":"6561ca23-65c6-4e4f-a572-6c98d31ef07d","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"png","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":371968,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/1d9e5c646a262e83db44742a.png"},{"id":97108716,"identity":"3fb0a5f9-4ac3-45e6-bc41-a3e1e17a45e7","added_by":"auto","created_at":"2025-12-01 05:46:57","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":111632,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/54d42cb5b32bae7c3aae38ca.png"},{"id":97108713,"identity":"07031495-6aa6-40cf-a273-dc6bc8ae2236","added_by":"auto","created_at":"2025-12-01 05:46:57","extension":"png","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":339819,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/6eb79794c61246cce8200844.png"},{"id":97141626,"identity":"640469c6-26df-45ac-b648-ef23de42ad30","added_by":"auto","created_at":"2025-12-01 10:06:51","extension":"png","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6442283,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/d82557987a9d4a33c352ba7e.png"},{"id":97141429,"identity":"85beddca-7a00-4313-b7fb-f416783d1e02","added_by":"auto","created_at":"2025-12-01 10:06:42","extension":"png","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8103444,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/d70b20fa391a3407ec0f8d6b.png"},{"id":97108692,"identity":"7e820a56-47a5-4281-a430-ae709bd6838a","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"png","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":107936,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/1f93b26123c5f33ee4ce03cb.png"},{"id":97108721,"identity":"fdb0a4ca-89ba-422c-b50d-d597dbb1e386","added_by":"auto","created_at":"2025-12-01 05:46:57","extension":"png","order_by":35,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":123661,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/ad9662f20af092eff81a56da.png"},{"id":97140419,"identity":"21f4d5cb-c984-4fd2-addc-fdd235f004b9","added_by":"auto","created_at":"2025-12-01 10:04:58","extension":"png","order_by":36,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":105760,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/e046ff2ef4d5c25fe7a391b3.png"},{"id":97140363,"identity":"d14519ec-7749-45f5-8e33-27e6d04fc53d","added_by":"auto","created_at":"2025-12-01 10:04:42","extension":"png","order_by":37,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":985314,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/39291f315e64f1f8cbd074d7.png"},{"id":97108677,"identity":"04da216e-f54c-4486-bfde-29652732cc21","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"png","order_by":38,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":141049,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/1cc192791386e29c0f989e93.png"},{"id":97108695,"identity":"f2cbccb8-4b69-4ec5-8d13-afa6270c12cb","added_by":"auto","created_at":"2025-12-01 05:46:57","extension":"png","order_by":39,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":50949,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/0cbed9851d798b69ded992f6.png"},{"id":97141343,"identity":"05645d38-811b-414d-b3f8-f5a00bc4c9f5","added_by":"auto","created_at":"2025-12-01 10:06:36","extension":"png","order_by":40,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":121672,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/f76ecd7e4893ef514ad53c40.png"},{"id":97108701,"identity":"251f85fc-2e67-44dd-bb46-16d9153367e5","added_by":"auto","created_at":"2025-12-01 05:46:57","extension":"png","order_by":41,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":347965,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/352176f858cf67295fe717dd.png"},{"id":97108705,"identity":"2b1fcb0f-ebd5-42c8-8686-7611bb5039d2","added_by":"auto","created_at":"2025-12-01 05:46:57","extension":"png","order_by":42,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":573667,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/8cbf06ff7d5e30b77680a50a.png"},{"id":97140398,"identity":"542afc5e-1d4b-4e45-aeb4-30a9cb119efa","added_by":"auto","created_at":"2025-12-01 10:04:54","extension":"png","order_by":43,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":59871,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/337561b6a911c20cecd40083.png"},{"id":97139871,"identity":"d6aade93-cec8-4c32-8a5e-9e79e2f37012","added_by":"auto","created_at":"2025-12-01 10:02:52","extension":"png","order_by":44,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":59902,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure7.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/f7692891f2521bb162f83dd3.png"},{"id":97108718,"identity":"346f41c6-038b-4f15-8fba-9ba1a6d0df8d","added_by":"auto","created_at":"2025-12-01 05:46:57","extension":"png","order_by":45,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":36912,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure8.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/5323ae0240f01e3fa9c5ebaf.png"},{"id":97141540,"identity":"6ceb8f41-075f-4aa7-ad90-7f8195b6b493","added_by":"auto","created_at":"2025-12-01 10:06:47","extension":"png","order_by":46,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":121674,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure9.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/e4e0a5c21d090d39aab64b47.png"},{"id":97141279,"identity":"e83ea633-9b81-406c-9f02-86e64fe8efb5","added_by":"auto","created_at":"2025-12-01 10:06:31","extension":"png","order_by":47,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":59769,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigureS1.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/d72fa7ffdba37930e63c63fa.png"},{"id":97108717,"identity":"36b7583d-b2a8-446f-a9f4-9f3bad851308","added_by":"auto","created_at":"2025-12-01 05:46:57","extension":"png","order_by":48,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":57452,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigureS2.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/108102dea3fa069ca0c6bd7a.png"},{"id":97108708,"identity":"bc6ec9db-6b12-4430-9e94-c73a4f872dbc","added_by":"auto","created_at":"2025-12-01 05:46:57","extension":"png","order_by":49,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":304931,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigureS3.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/453b8bf0c57962a7b32144df.png"},{"id":97108693,"identity":"ac20ed3a-463b-48a0-9bdf-00db968cef87","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"png","order_by":50,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":71802,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/f76422acce767c956d6e4356.png"},{"id":97108697,"identity":"584b0992-bcc8-4c45-a127-600763449f83","added_by":"auto","created_at":"2025-12-01 05:46:57","extension":"png","order_by":51,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":33889,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/3a507cab60c313c032c0a949.png"},{"id":97140539,"identity":"f983282d-a786-44b2-a852-94396d008317","added_by":"auto","created_at":"2025-12-01 10:05:13","extension":"png","order_by":52,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":91430,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/4896bcf2e37fa63cf8c34227.png"},{"id":97141423,"identity":"9700355e-3e5b-4e64-ae0b-bfa11e03ab49","added_by":"auto","created_at":"2025-12-01 10:06:41","extension":"png","order_by":53,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":985374,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/09aa964b4dab131d9565aaf5.png"},{"id":97141580,"identity":"9a1b9b7d-b795-4c91-9cc0-e5d109a633f4","added_by":"auto","created_at":"2025-12-01 10:06:50","extension":"png","order_by":54,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1079163,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/60b7d727f4fd33f88961b2ee.png"},{"id":97141701,"identity":"b4a856e6-60a0-477f-b900-8eee751c513c","added_by":"auto","created_at":"2025-12-01 10:06:53","extension":"png","order_by":55,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":34244,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/112d2977c0330e42e45844cf.png"},{"id":97140375,"identity":"e1342013-d5bd-4b1b-9641-eb39d5d52c60","added_by":"auto","created_at":"2025-12-01 10:04:44","extension":"png","order_by":56,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":35710,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/5c3815b47db7b6a916c8c2db.png"},{"id":97108719,"identity":"f5bcf2be-7113-4ca6-9a96-a56abb1a7564","added_by":"auto","created_at":"2025-12-01 05:46:57","extension":"png","order_by":57,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":30821,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/5a0981a169205e04a4d383b1.png"},{"id":97108707,"identity":"0292e37c-5e7b-4311-8e11-3b38b63c9989","added_by":"auto","created_at":"2025-12-01 05:46:57","extension":"png","order_by":58,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":157214,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/a9bab5bcf2af4a2e99b0e1fa.png"},{"id":97108723,"identity":"708f00c2-ec4f-4742-aead-fdf392cd6303","added_by":"auto","created_at":"2025-12-01 05:46:57","extension":"xml","order_by":59,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":219481,"visible":true,"origin":"","legend":"","description":"","filename":"27b00bc9b8374c95808b7f728ab2e77e1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/d2f21c74fd06123777b9dfb6.xml"},{"id":97108702,"identity":"76f65804-0ef5-44ee-82aa-32e839082d21","added_by":"auto","created_at":"2025-12-01 05:46:57","extension":"html","order_by":60,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":240616,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/dc774a6a35d2a5c26a81aa93.html"},{"id":97108655,"identity":"ddcaffeb-dcdd-440f-931b-1f7ec8fed9f0","added_by":"auto","created_at":"2025-12-01 05:46:55","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":244461,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExperimental design.\u003c/strong\u003e A, Experimental outline. Mice were subjected to a standard or high-fat diet for 8 weeks, followed by 10 weeks of experimental protocol. The HFD groups underwent TRF and performed aerobic, resistance, and combined training protocols. In the 1st, 6th, and 10th week of the protocol, an incremental test (IT) and a maximal voluntary carrying capacity test (MVCC) were performed for load/speed adjustment and performance analysis. In the 10th week, a glucose tolerance test (GTT) and an insulin tolerance test (ITT) were performed. B, Representation of the control group (CTL), obese group (OB), OB + time-restricted feeding (TRF), OB + TRF + aerobic training (OB+TRF+AT), OB + TRF + resistance training (OB+TRF+RT), and OB + TRF + combined training (OB+TRF+CT). The TRF protocol was applied from Zeitgeber Time 0 (ZT0) to Zeitgeber Time 12 (ZT12). Physical training sessions were performed between ZT0 and ZT1. The three other experimental groups (OB+AT, OB+RT, OB+CT) are shown in the supplementary material.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/bdab214b172fc885b7becb0b.jpg"},{"id":97108663,"identity":"cc147190-a4f7-45f7-8ea7-729b9ea7692a","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":166528,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhysical training increased aerobic performance and strength in animals subjected to aerobic, resistance, and combined training.\u003c/strong\u003e A, Speed at Exhaustion in the TRF+AT group (n=7). B, Exhaustion speed of the TRF+CT group (n=7). C, Exhaustion speed of the TRF+AT (n=7) vs TRF+CT (n=7) groups. D, Maximal voluntary carrying capacity (MVCC) of the TRF+RT group (n=7). E, MVCC of the TRF+CT group (n=7). F, MVCC of the TRF+RT (n=7) vs TRF+CT (n=7) groups. G, Grip strength pre and post intervention of fasting and training in the TRF+AT, TRF+RT, and TRF+CT groups (n=7). Bars represent the mean and standard deviation. Statistical significance was as follows: **P \u0026lt; 0.01, ***P \u0026lt; 0.001, and **P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/7f1a0a04714ffe0f9ad7ee0a.jpg"},{"id":97141388,"identity":"63963baa-2bbe-42e5-8a96-de3d68bab7a1","added_by":"auto","created_at":"2025-12-01 10:06:39","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":309490,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTime-restricted feeding combined with aerobic, resistance, and combined training impacts body weight, adiposity, and glycemic homeostasis without changes in food intake. \u003c/strong\u003eA, 18-week body weight curve (n=7–10). B, Weight change (final – weight at 8 weeks) (n=6). C, Food intake progression (n=5). D, Cumulative food intake (n=5). E, Adipose tissues (n=6). F, Total fat (sum of all adipose tissues) (n=6). G, Lee index (body weight divided by the cube root of the naso-anal length) (n=6). H, Fasting blood glucose (n=6). I, Postprandial blood glucose (n=6). J, Glucose tolerance test (n=6). K, area under the GTT curve (n=6). L, Insulin tolerance test (n=6). M, area under the ITT curve (n=6). Bars represent the mean and standard deviation. Statistical significance was as follows: *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001, and ****P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/ecd48e208d0c078fd0981899.jpg"},{"id":97140853,"identity":"1edfcea2-654a-43ce-bf09-dd86b1aca2e1","added_by":"auto","created_at":"2025-12-01 10:05:53","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1823168,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of time-restricted feeding combined with aerobic, resistance, and combined training on liver fat accumulation, lipid metabolism, and mitochondrial function. \u003c/strong\u003eA, Histological plate of liver tissue stained with hematoxylin-eosin (H\u0026amp;E) and Oil Red O (ORO). B, Quantification of the area stained with Oil Red O (n=6). C, Relative liver weight (%) (n=7). D, Hepatic cholesterol (n=5).E, Hepatic triglycerides (n=5). F, Serum alanine aminotransferase (ALT) (n=5). G, Serum aspartate aminotransferase (AST) (n=5). H, Steatosis score (n=6). I, Mitochondrial complex I (CI) (n=4). J, Mitochondrial complex II (CII) (n=4). K, Oxidative phosphorylation (OXPHOS) (n=4). L, Respiration linked to ATP synthesis (n=4). Bars represent the mean and standard deviation. Statistical significance was as follows: *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001, and ****P \u0026lt; 0.001.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eNote\u003c/em\u003e: ALT and AST levels are expressed in μkat/L (micromoles of substrate converted per second per liter).\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/a3d3ef8e85d276ea4ec86b1a.png"},{"id":97108652,"identity":"34cee18d-e163-4ff6-bb9d-d3d1554ffb48","added_by":"auto","created_at":"2025-12-01 05:46:55","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":640642,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCombining TRF with different types of physical training reduces adipocyte size in obese mice. \u003c/strong\u003eA, Representative image of the mice at the end of the experimental protocol. B, Histological plate of epididymal adipose tissue stained with hematoxylin and eosin (H\u0026amp;E).\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/2231f66f2ddb4eb8c0534e75.jpg"},{"id":97108657,"identity":"16c89492-84aa-4282-90fe-e406a0546690","added_by":"auto","created_at":"2025-12-01 05:46:55","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":165889,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of time-restricted feeding combined with aerobic, resistance, and combined training on hepatic fatty acid content\u003c/strong\u003e. A, Total fatty acids (n=6). B, Saturated fatty acids (n=6). C, Lauric acid (C12:0) (n=5-6). D, Myristic acid (C14:0) (n=6). E, Palmitic acid (C16:0) (n=6). F, Monounsaturated fatty acids (n=6). G, Palmitoleic acid (16:1 ω7) (n=6). H, Oleic acid (18:1 ω9) (n=6). Bars represent the mean and standard deviation. Statistical significance was as follows: *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001, and ****P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/24c1b13f059357ecb6f8d608.jpg"},{"id":97140677,"identity":"fe6113b5-d1c3-4011-8615-bd1fb981c17e","added_by":"auto","created_at":"2025-12-01 10:05:34","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":163448,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of time-restricted feeding combined with aerobic, resistance, and combined training on ω6 and ω3 content. \u003c/strong\u003eA, Polyunsaturated fatty acids (n=6). B, Total omega-6 (ω6) fatty acids (n=6). C, Total omega-3 (ω3) fatty acids (n=4-6). D, Linoleic acid (18:2 ω6) (n=6). E, Arachidonic acid (20:4 ω6) (n=6). F, Alpha-linolenic acid (C18:3 ω3) (n=4-6). G, Eicosapentaenoic acid (C20:5 ω3) (n=3-6). H, Docosahexaenoic acid (C22:6 ω3) (n=5-6). I, ω6:ω3 ratio (n=6). Bars represent the mean and standard deviation. Statistical significance was as follows: *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001, and ****P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/1a2a85204f6eb87de17382b0.jpg"},{"id":97108665,"identity":"2325533b-dff7-4bd9-b40c-1bdf44b207fa","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":196474,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of time-restricted feeding combined with aerobic, resistance, or combined training on the expression of inflammatory, lipogenic, and oxidative genes.\u003c/strong\u003eA, mRNA levels of inflammatory genes; B, mRNA levels of lipogenic genes; C, mRNA levels of genes involved in lipid oxidation (n = 4–5). Bars represent the mean and standard deviation. Statistical significance was as follows: *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001, and ****P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/80d557237ce8577c7d477435.png"},{"id":97140621,"identity":"c4f31683-fb88-4c1a-8710-acc0ddd39414","added_by":"auto","created_at":"2025-12-01 10:05:25","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":201453,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSummary of the main metabolic effects of combined TRF interventions with different physical training modalities. \u003c/strong\u003eTRF + aerobic training (TRF+AT), TRF + resistance training (TRF+RT), and TRF + combined training (TRF+CT).\u003cstrong\u003e \u003c/strong\u003eSingle upward arrows (↑) indicate an increase compared to the obese group; double upward arrows (↑↑) indicate a more robust increase compared to the TRF-only group; the symbol (–) indicates no significant change.\u003c/p\u003e","description":"","filename":"Figure9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/b56d324ed363e799816f733c.jpg"},{"id":100069119,"identity":"a77b846a-30c3-48a9-832e-e79895beb61a","added_by":"auto","created_at":"2026-01-12 16:09:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6247974,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/29f2b07b-6091-4d2c-afcc-8a5f7a46ce92.pdf"},{"id":97108653,"identity":"cd533cd6-9ae6-4ed5-8056-65afa328e871","added_by":"auto","created_at":"2025-12-01 05:46:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":511244,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryDataGuilhermeCorreia.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/a40f55a5c3484e4d57891b87.pdf"},{"id":97108682,"identity":"186159b9-7eea-478f-9d51-2de4c5a5b791","added_by":"auto","created_at":"2025-12-01 05:46:56","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2792222,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8071932/v1/8d1caa19f9f9c18a3e539a4e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Integration of 12-Hour Time-Restricted Feeding with Exercise Training Potentiates Weight Loss and Attenuates MASLD in Diet-Induced Obese Mice","fulltext":[{"header":"Key Points","content":"\u003cp\u003e\u0026bull; Combining 12-hour time-restricted feeding (TRF) with aerobic (AT), resistance (RT), or combined training (CT) produced stronger metabolic and hepatic benefits than either intervention alone in diet-induced obese mice.\u003c/p\u003e\u003cp\u003e\u0026bull; TRF\u0026thinsp;+\u0026thinsp;AT most effectively reduced body weight, adiposity, hepatic lipid accumulation, and saturated fatty acids, while TRF\u0026thinsp;+\u0026thinsp;RT markedly improved glucose homeostasis and insulin sensitivity.\u003c/p\u003e\u003cp\u003e\u0026bull; The combination of TRF with training decreased hepatic expression of inflammatory and lipogenic genes and increased markers of fatty acid oxidation.\u003c/p\u003e\u003cp\u003e\u0026bull; TRF\u0026thinsp;+\u0026thinsp;RT and TRF\u0026thinsp;+\u0026thinsp;AT improved hepatic mitochondrial function, with specific enhancements in oxidative phosphorylation and complex I activity, respectively.\u003c/p\u003e\u003cp\u003e\u0026bull; These findings demonstrate that integrating TRF with distinct exercise modalities leads to synergistic and complementary adaptations, offering new perspectives for tailored interventions against obesity and MASLD.\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003eObesity is a major public health problem linked to an increased risk in mortality\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Estimates suggest that over the past four decades, the total number of adults with obesity worldwide has increased more than sixfold\u003csup\u003e\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. The pathophysiology of obesity is complex and involves genetic, behavioral, and environmental factors. Among those, lifestyle habits such as irregular eating patterns and physical inactivity contribute to the increased prevalence of the disease\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eObesity is often accompanied by metabolic disorders such as insulin resistance, dyslipidemia, glucose intolerance, and elevated blood pressure, all of which play a central role in the development of highly prevalent chronic diseases such as cardiovascular diseases, type 2 diabetes, and metabolic dysfunction-associated steatotic liver disease (MASLD)\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Among the metabolic epidemics associated with obesity, MASLD has become the most prevalent worldwide\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Therefore, strategies to prevent weight gain or promote weight loss are essential for preventing and treating obesity and MASLD.\u003c/p\u003e\u003cp\u003eTime-restricted feeding (TRF) is a form of intermittent fasting in which daily food consumption is restricted to between 4 and 16 hours daily wihtout overt attempt to change food quality or to reduce caloric intake\u003csup\u003e\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Studies suggest that TRF can be more easily implemented into the daily routine and maintained with greater adherence\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Whereas some studies suggest that the TRF can alleviate the impact of obesity and MASLD\u003csup\u003e\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e, the effectiveness of TRF may depend on the specific protocol used and individual metabolic conditions. In particular, TRF alone may not be sufficient in the context of pre-established obesity and fatty liver disease, highlighting the potential benefits of combining it with other interventions such as physical exercise\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eA limited number of studies have evaluated the effects of combined TRF plus exercise\u003csup\u003e\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e, with no studies to our knowledge specifically interrogating the effect of different types of physical exercise. This is important since the efficacy of different exercise modalities also depend on factors such as intensity, duration, and adherence\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. This study aimed to test which type of exercise combined with TRF can produce maximal metabolic benefits\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Specifically, in this work, we tested the effects of TRF (12-hour fasting period) combined with different exercise modalities (aerobic training (AT), resistance training (RT), or combined training (CT)) on obesity and hepatic metabolism in obese mice. A side-by-side comparison allowed us to establish the distinct physiological adaptations and specific effects that each intervention produces alone and when combined with TRF. In addition, we sought to investigate the profile and quantity of fatty acids in the liver, because changes in the composition of these lipids and their quantity are directly associated with the progression and severity of the disease.\u003c/p\u003e\u003cp\u003eWe speculate that TRF, especially when combined with physical training, effectively alleviates MASLD in diet-induced obese (DIO) mice models. Furthermore, combining TRF with different types of exercise (aerobic, resistance, or the combination of both) may induce distinct physiological adaptations, potentially generating superior benefits compared to TRF or physical training alone. These integrated approaches may represent promising strategies in the fight against obesity and MASLD.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eAnimals and Ethical Procedures:\u003c/h2\u003e\u003cp\u003eAll animals used in this study were obtained from the Multidisciplinary Center for Biological Research in Laboratory Animal Science (CEMIB) \u0026ndash; University of Campinas (UNICAMP). Swiss Albinus mice were selected as an experimental model for this study due to their spontaneous genetic susceptibility to increased body adiposity\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e, which develops after an 8-week exposure to a high-fat diet, resembling clinical results observed in humans\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. The 3-week-old mice were housed individually in polypropylene cages on a ventilated shelf (Alesco\u0026reg;). As environmental enrichment for the animals, a polyvinyl chloride tube cut in half was inserted, forming a shelter simulating a dark tunnel to reduce the animals' stress. For the entire experimental period, photoperiod control defined as light/dark every 12 hours, ambient temperature of 21\u0026deg;C to 22\u0026deg;C, and humidity between 40% and 60% was adopted. The rats remained in the vivarium until they were 12 weeks old, then the experiment began. Each experimental group was composed of 8 animals. Some animals were excluded from specific analyses due to sample loss, technical issues, or unrelated health complications, leading to variable sample sizes across analyses, as indicated in figure legends.\u003c/p\u003e\u003cp\u003e All procedures and experiments involving animals were carried out following Brazilian legislation on the scientific use of animals (Law No. 11.794, of October 8, 2008). All experimental protocols were approved by the Ethics Committee on Animal Use (CEUA/Process Number 6318-1/2023) of the Institute of Biological Sciences, UNICAMP \u0026ndash; Campinas-SP, and were also aligned with the National Council for the Control of Animal Experimentation (CONCEA). This study is reported in accordance with the ARRIVE guidelines. Access to water and food was free for some experimental groups, with the standard food (Nuvilab\u0026reg; CR1; Sogorb Ind. \u0026amp; Com. Ltda, S\u0026atilde;o Paulo, Brazil) or a high-fat diet (HFD) according to the American Institute of Nutrition (AIN39-G)\u003csup\u003e14\u003c/sup\u003e. The macronutrient composition of the HFD consists of 20% protein, 35% fat, and 40% carbohydrates. Its formulation includes 11.55% corn starch, 20% casein, 10% sucrose, 13.2% dextrinized starch, 4% soybean oil, 31.2% lard, 5% cellulose, 3.5% mineral mix, 1% vitamin mix, 0.3% L-cystine, and 0.25% choline bitartrate\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. The diet was offered for 8 weeks. After this period, the mice that received the HFD were distributed into different experimental groups as described below, remaining on the HFD for an additional 10 weeks. Throughout all stages, the animals were weighed weekly, and food intake was monitored by recording the weight of the food offered and the remaining food.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eExperimental Groups\u003c/h3\u003e\n\u003cp\u003eMice at 12 weeks-old were distributed into six experimental groups: 1 - Control group (CTL), mice that received standard chow \u003cem\u003ead libitum\u003c/em\u003e; 2 - Obese group (OB), mice fed HFD \u003cem\u003ead libitum\u003c/em\u003e; 3 - Obese\u0026thinsp;+\u0026thinsp;TRF group (OB\u0026thinsp;+\u0026thinsp;TRF), mice subjected to HFD offered for 12 hours followed by 12 hours of food restriction; 4 - Obese\u0026thinsp;+\u0026thinsp;TRF\u0026thinsp;+\u0026thinsp;AT group (OB\u0026thinsp;+\u0026thinsp;TRF\u0026thinsp;+\u0026thinsp;AT), mice subjected to TRF combined with aerobic training (AT), fed HFD offered for 12 hours followed by 12 hours of food restriction; 5 - Obese\u0026thinsp;+\u0026thinsp;TRF\u0026thinsp;+\u0026thinsp;RT group (OB\u0026thinsp;+\u0026thinsp;TRF\u0026thinsp;+\u0026thinsp;RT), mice subjected to TRF combined with resistance training (RT), fed HFD offered for 12 hours followed by 12 hours of food restriction; 6 - Obese\u0026thinsp;+\u0026thinsp;TRF\u0026thinsp;+\u0026thinsp;CT group (OB\u0026thinsp;+\u0026thinsp;TRF\u0026thinsp;+\u0026thinsp;CT), mice subjected to TRF combined with combined training (CT), fed HFD offered for 12 hours followed by 12 hours of food restriction. The protocols started after 8 weeks of obesity induction by HFD and were carried out over 10 weeks, totaling 18 weeks of the experiment. In addition to the six groups mentioned above, three other groups of mice fed HFD and subjected only to the three physical training protocols (AT, RT, or CT) were included in the study. The results of these last experimental groups can be found in the supplementary material. These experimental groups allowed the comparison of the effects of TRF or its combination with the training protocols to physical training alone on the metabolic parameters in the mice, providing a broad overview of the different strategies applied either in isolation or in combination. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-B summarizes the study design and depicts six main experimental groups out of the nine, for simplicity.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eTime-Restricted Feeding (TRF) Protocol\u003c/h3\u003e\n\u003cp\u003eMice from the TRF, TRF\u0026thinsp;+\u0026thinsp;AT, TRF\u0026thinsp;+\u0026thinsp;RT, and TRF\u0026thinsp;+\u0026thinsp;CT groups were subjected to a TRF protocol, in which Zeitgeber Time (ZT) 0 was defined as the beginning of the light (inactive) cycle and ZT12 as the end of the light cycle and the beginning of the dark (active) cycle. Therefore, animals subjected to TRF had access to the diet from ZT12 until the end of ZT24, totaling 12 hours of free access (from 6:00 p.m. to 6:00 a.m.) and 12 hours of fasting\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. TRF was conducted 5 days per week (from Monday to Friday), and the animals had free access to food on Saturday and Sunday. Feeding access was regulated by the daily transfer of the mice between a cage with free access to food and water and another with access to water only.\u003c/p\u003e\n\u003ch3\u003eIncremental Treadmill Running Test\u003c/h3\u003e\n\u003cp\u003eInitially, the mice were adapted to the treadmill (AVS projetos \u0026ndash; S\u0026atilde;o Carlos, S\u0026atilde;o Paulo, Brazil) for 5 days, 10 min/day at a speed of 3 m/min, as standardized by Ferreira \u003cem\u003eet al\u003c/em\u003e. (2007) and previously used in our laboratory\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Afterwards, the incremental test was performed. The initial speed of the test was 6 m/min, with 0% inclination and increments of 3 m/min every 3 minutes until voluntary exhaustion of the mice, which occurred when the animals touched the rear end of the treadmill 5 times within a 1-minute interval. The exhaustion velocity (EV), defined as the speed (m/min) at which the animal reached exhaustion, was used to prescribe intensity in the physical training protocol (60% of EV). The animals were evaluated using the incremental treadmill test before the beginning of aerobic training (week 1 of the protocol) and after the physical training period in weeks 6 and 10, for load adjustment and performance analysis. The animals underwent a 48-hour rest after the incremental load test before the next physical exercise session.\u003c/p\u003e\n\u003ch3\u003eAerobic Training Protocol\u003c/h3\u003e\n\u003cp\u003eAerobic training (AT) was performed for 10 weeks at an intensity of 60% of the exhaustion velocity (EV) obtained in the incremental treadmill running test. In the first week, the physical training protocol lasted 30 minutes, consisting of a 5-minute warm-up (6 m/min), followed by 20 minutes at 60% of EV, and ending with 5 minutes of cool-down (6 m/min). This structure, which included warm-up, main exercise phase, and cool-down, was maintained throughout all training sessions. In the second week, the animals exercised for 40 minutes; in the third week, 50 minutes; and in the fourth week, 60 minutes of exercise, which was maintained until the end of the experiment. AT was performed 4 times per week (Monday-Tuesday and Thursday-Friday) during the active cycle (6:00\u0026ndash;7:00 a.m.), corresponding to the interval from ZT0 to ZT1, immediately after the food access period. Wednesdays and weekends (Saturdays and Sundays) were reserved for rest.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eDescription and Adaptation to Resistance Training Apparatus and Determination of Maximal Voluntary Carrying Capacity (MVCC)\u003c/h2\u003e\u003cp\u003eA rodent ladder from AVS Projetos (S\u0026atilde;o Carlos-SP) was used for resistance training (RT), as described in a previous study from our laboratory\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. The ladder is 50 cm high, angled at 80\u0026ordm; relative to the floor. At the top of the ladder is a 30 cm\u0026sup2; chamber used for rest between climbing attempts during the adaptation period. A plastic conical tube approximately 7.5 cm in height and 2.5 cm in diameter was used to attach the load to the animal's tail, as described by Minuzzi \u003cem\u003eet al\u003c/em\u003e. (2020)\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eAnimals were adapted for 5 days, as Santos \u003cem\u003eet al\u003c/em\u003e. (2024) suggested\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. During adaptation, animals remained inside the chamber at the top of the ladder for 60 seconds with the empty loading apparatus attached to their tail. For the first climbing attempt, animals were placed 15 cm from the chamber entrance; for the second attempt, 25 cm; and from the third attempt onward, animals started from the ladder's base, 50 cm from the chamber. When necessary, manual stimuli were applied to encourage the animals to start climbing. A 60-second rest period was established between attempts. Attempts from the base continued until the animal completed three successful climbs without the need for stimuli.\u003c/p\u003e\u003cp\u003eAfter adaptation, animals rested for 48 hours before starting the maximal voluntary carrying capacity (MVCC) test, described by Minuzzi \u003cem\u003eet al\u003c/em\u003e. (2020)\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. During the test, animals were placed at the ladder's base (50 cm) with an initial load of 75% of their body weight, with increments of 3 g after each successful climb until failure. After each successful trial, the animal was removed from the ladder and placed in an individual cage for a 5-minute rest before the next trial. The highest load carried was recorded as MVCC and normalized by the animal's body weight, expressed as a percentage [(MVCC / body weight) \u0026times; 100]. This value was subsequently used to prescribe individual loads in the experiment (60% of MVCC). Animals were evaluated in the MVCC test before starting RT (week 1 of protocol) and after the resistance training period at weeks 6 and 10, allowing for workload adjustment and performance analysis\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e,\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eResistance Training Protocol\u003c/h3\u003e\n\u003cp\u003eAfter 48 hours of determining the MVCC, the animals began the resistance training (RT) protocol. Training sessions were conducted daily from 6:00\u0026ndash;7:00 a.m. (ZT0\u0026ndash;ZT1), coinciding with the end of the animals' wake cycle and their access to food. In the first week, mice performed 20 sets, each consisting of a single climb with a load of 60% of MVCC, followed by 45 seconds of rest between sets. However, animals always performed five unloaded climbs for warm-up and cool-down, totalizing 30 climbs. In the second week, animals performed 40 climbs; in the third week, 50 climbs; from the fourth week onwards, 60 climbs were performed and maintained until the end of the experiment. Considering the average climbing time ranged from 8 to 15 seconds per mouse and the recovery time was 45 seconds, each exercise set lasted approximately 1 minute, totaling 60 minutes of physical training. Each experimental week consisted of 4 training days (Monday-Tuesday and Thursday-Friday), with rest on Wednesdays and weekends (Saturday-Sunday). This protocol has been adapted from previous studies conducted by our laboratory\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e,\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003ch3\u003eCombined Physical Training Protocol\u003c/h3\u003e\n\u003cp\u003eThe initial procedures for determining exercise intensity for aerobic and resistance training were performed for this group of mice subjected to combined physical training (aerobic\u0026thinsp;+\u0026thinsp;resistance) on alternate days. The animals underwent the previously described resistance training protocol on Mondays and Thursdays. On Tuesdays and Fridays, the animals performed the aerobic training protocol as previously described. All training sessions were conducted daily from 6:00\u0026ndash;7:00 a.m. (ZT0\u0026ndash;ZT1), coinciding with the end of the animals' wake cycle and their access to food. Animals were assessed by the incremental test (IT) and the maximum voluntary carrying capacity test (MVCC) before starting the combined training (week 1 of the protocol) and at the end of weeks 6 and 10 of the experiment. The animals did not perform physical training protocols on Wednesdays and weekends (Saturdays and Sundays).\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eGrip Strength Test\u003c/h2\u003e\u003cp\u003eTo characterize and measure muscle strength in the resistance-training (RT) model, we performed the grip-strength test using the Grip Strength System (Avs Projetos\u0026reg;, S\u0026atilde;o Carlos, S\u0026atilde;o Paulo, Brazil), as detailed below. Each trial consisted of pulling the animal by the tail so that both forepaws and hind paws grasped all the grid wires until the rodent completely released its grip. With the grid flat (not inclined), three adaptation attempts were made using both forepaws and hind paws, followed by three valid attempts. The average tension values applied were recorded in Newtons (N) and used as a performance parameter\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e,\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eGlucose Tolerance Test (GTT), Fasting and Postprandial Blood Glucose\u003c/h2\u003e\u003cp\u003eAfter 24 hours from the last exercise session and following a 4-hour fast, a distal tail snip was performed on the animals to collect the first blood sample for basal glucose measurement, corresponding to time zero (t0) of the test, which refers to basal glycemia. Bleeding was controlled using a compression bandage (Johnson \u0026amp; Johnson). Immediately after, a 25% glucose solution (2 g/kg body weight) was administered intraperitoneally (i.p.), with subsequent blood samples collected at 30, 60, 90, and 120 minutes for glucose measurement. The area under the curve (AUC) was then calculated for each experimental group. The Accu-Check Active\u0026reg; device measured blood glucose levels during the GTT (Roche, Switzerland).\u003c/p\u003e\u003cp\u003eAdditionally, on a separate day, after a 12-hour fast and a tail tip cut, blood was collected to analyze fasting glucose levels using the Accu-Check Active\u0026reg; device (Roche, Switzerland). Subsequently, a new blood sample was collected two hours after refeeding to evaluate postprandial glucose. Animals were monitored for 3 hours after the test.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eInsulin Tolerance Test (ITT)\u003c/h2\u003e\u003cp\u003eAfter a prior 4-hour fast and 24 hours following the last exercise session, the mice were subjected to the insulin tolerance test (ITT). For this, the mice received an intraperitoneal injection of recombinant human insulin (Humulin R, Eli Lilly, Indianapolis, IN, USA) at a dose of 1.5 U/kg body weight. Blood samples were collected from the tail at 0, 10, 15, 20, 25, and 30 minutes to determine blood glucose levels using a glucometer (Accu-Chek; Roche, Switzerland). Time zero represents the initial blood collection before insulin injection. The area under the curve (AUC) was calculated individually for each group. Blood samples were obtained by tail snip using surgical scissors, and bleeding was controlled with a compression bandage (Johnson \u0026amp; Johnson). Animals were monitored for 3 hours after the test\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eBody Weight Analysis, Food Intake, Lee Index, and Relative Liver Weight\u003c/h2\u003e\u003cp\u003eThe mice were weighed twice weekly using an analytical balance (model L3102I, BEL) to monitor changes in body weight over time (18 weeks). Weight gain was calculated using the formula: Weight gain (g)\u0026thinsp;=\u0026thinsp;Final weight (g) \u0026ndash; Initial weight (g). Food intake was measured with the same frequency by weighing the remaining food, and cumulative caloric intake was calculated by summing the total energy value (kcal) of the food consumed during the experimental period. The Lee index was calculated using the cube root of the body weight divided by the naso-anal length of the animals [(∛Weight (g)/Length (cm)]\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e,\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. The relative liver weight was obtained by the ratio between the liver tissue weight (g) and body weight (g), multiplied by 100\u003csup\u003e35\u003c/sup\u003e.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eAnimal Euthanasia, Tissue Collection, and Homogenization\u003c/h2\u003e\u003cp\u003eTwenty-four hours after the last exercise session (6:00 a.m.), the animals were fasted for 4 hours before tissue collection procedures. Before the surgical and tissue extraction procedures, the mice received an intraperitoneal (i.p.) injection of ketamine chlorohydrate (90 mg/kg; Ketalar\u0026reg;; Parke-Davis, Ann Arbor, MI) and xylazine (10 mg/kg; Rompun\u0026reg;; Bayer\u0026reg;, Leverkusen). Euthanasia was then performed by decapitation. Liver and adipose tissue samples were placed in Eppendorf tubes and frozen in liquid nitrogen. Subsequently, the samples were stored in a Biofreezer at -80\u0026deg;C. Part of these samples was used for quantitative real-time PCR (RT-qPCR) analysis. As described below, liver and adipose tissue fragments were also used for histological studies. Perigonadal, epididymal, retroperitoneal, and mesenteric adipose tissues were collected and weighed using an analytical balance (Gehaka\u0026reg;, BK3000) to compare groups.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eBlood Biochemical Markers\u003c/h2\u003e\u003cp\u003eAfter euthanasia, blood samples were collected and centrifuged at 1,000 \u0026times; \u003cem\u003eg\u003c/em\u003e for 10 minutes at 4\u0026deg;C to separate the serum. The obtained serum was stored at -80\u0026deg;C until biochemical analyses were performed. Concentrations of alanine aminotransferase (ALT) #895214000/01 and aspartate aminotransferase (AST) #895215000/00 were determined using commercial kits (Laborlab\u0026reg;, S\u0026atilde;o Paulo, SP, Brazil), utilizing the serum collected at the time of euthanasia, which occurred 24 hours after the last exercise session and following a 4-hour fasting period.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eHepatic Lipid Quantification\u003c/h2\u003e\u003cp\u003eHepatic lipid extraction was performed following the method of Folch et al. (1957)58. Approximately 50 mg of liver tissue was homogenized in 2 mL of chloroform:methanol (2:1, v/v). The homogenate was then filtered or centrifuged to remove debris, and 0.2 volumes of 0.9% NaCl solution was added to induce phase separation. After thoroughly mixing and centrifuging at 3,000 rpm for 10 minutes, the mixture separated into a lower organic phase containing lipids and an upper aqueous phase. The lower phase was carefully collected and dried under nitrogen or in a vacuum concentrator, and the lipid residue was resuspended in isopropanol. Triglyceride (kit 1770290) and cholesterol (kit 1770080) levels were measured using colorimetric kits, following the manufacturer's instructions (Laborlab\u0026reg;, S\u0026atilde;o Paulo, Brazil).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eHistological Analysis of Liver and Adipose Tissue (H\u0026amp;E and Oil Red O)\u003c/h2\u003e\u003cp\u003eA liver and epididymal white adipose tissue fragment were collected for histological analysis and placed in a conical tube containing 4% paraformaldehyde. After 24 hours of immersion in 4% paraformaldehyde, the samples were washed under running water and stored in 70% ethanol. The tissues were then dehydrated for one hour in a graded ethanol series (80%, 95%, and 100%), cleared in xylene, and embedded in paraffin. The paraffin-embedded tissues were sectioned (microtome, Leica\u0026reg;, RM2145) at a thickness of 4.0 \u0026micro;m and mounted on microscope slides. Hematoxylin and eosin (H\u0026amp;E) staining was used to assess the microscopic structure of the tissues. Images were acquired using a light microscope (LAB2000, LABORANA\u0026reg;, S\u0026atilde;o Paulo, Brazil) equipped with a Moticam Pro 282B 5.0-megapixel camera (Motic\u0026reg;, Hong Kong, China) at 10\u0026times; and 40\u0026times; magnification.\u003c/p\u003e\u003cp\u003eIn addition, another fragment of liver tissue was gradually frozen with isopentane and stored at -80\u0026deg;C. These fragments were sectioned (7 \u0026micro;m) using a cryostat (Leica\u0026reg;, CM1850) and mounted on glass slides. The sections were stained with Oil Red O (ORO, Sigma Aldrich\u0026reg;, St. Louis, MO) for 25 minutes, followed by hematoxylin for 2 minutes, and washed with distilled water for 30 minutes. The slides were then rinsed and mounted with a gelatin:glycerin solution. Images were captured using the Leica Application Suite software, and the red-stained area was quantified using ImageJ software (NIH, Bethesda, MD, USA).\u003c/p\u003e\u003cp\u003eThe MASLD Activity Score was evaluated under blinded conditions to characterize liver damage induced by the diet. Steatosis was scored from 0 to 3 based on the percentage of hepatocytes affected (\u0026lt;\u0026thinsp;5%, 5\u0026ndash;33%, 34\u0026ndash;66%, \u0026gt;\u0026thinsp;66%). Hepatocellular ballooning was scored from 0 to 2, and lobular inflammation from 0 to 3, according to the number of foci per field. The total score ranged from 0 to 8\u003csup\u003e36,37\u003c/sup\u003e. Steatosis was assessed at 400\u0026times; magnification, and inflammation was evaluated in 10 fields, considering foci with \u0026ge;\u0026thinsp;5 inflammatory cells not arranged in a row\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eMitochondrial Respiration\u003c/h2\u003e\u003cp\u003eMitochondrial oxygen consumption (pmol s⁻\u0026sup1;.mL⁻\u0026sup1;) was measured using the Oroboros O2k high-resolution respirometer (Oroboros\u0026reg; Instruments, Innsbruck, Austria) and analyzed with the DatLab 7 software. After calibration, 20 \u0026micro;L of the tissue homogenate was added to the chamber. The analyses were conducted at 37\u0026deg;C in MiR05 buffer, with a final volume of 2 mL per chamber. To evaluate complex, I-dependent mitochondrial respiration, malate (0.1 mM) and glutamate (10 mM) were supplemented into the chambers. The addition of ADP (2.5 mM) evaluated respiratory stimulation of the ATP production pathway, whereas complex II-dependent respiration was assessed following the addition of succinate (10 mM). Inhibition of ATP synthesis was subsequently induced with oligomycin (2.5 \u0026micro;M)\u003csup\u003e39\u003c/sup\u003e.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eLipid Extraction and Analysis by Mass Spectrometry\u003c/h2\u003e\u003cp\u003eLipid extraction was performed according to Folch \u003cem\u003eet al\u003c/em\u003e. (1957), and fatty acid methylation was carried out following Shirai \u003cem\u003eet al\u003c/em\u003e. (2005)\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e,\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. Chromatographic analysis was conducted using a gas chromatography system coupled with mass spectrometry (GC-MS; model QP2010 Ultra, Shimadzu\u0026reg;\u003csup\u003e),\u003c/sup\u003e equipped with an automatic injector (AOC-20i\u0026reg;). A fused silica capillary column (Rt-2560, Restek\u0026reg;) was used for compound separation, measuring 100 meters in length, 0.25 mm in internal diameter, and 0.20 \u0026micro;m film thickness. The carrier gas used was ultrapure helium, maintained at a constant flow rate of 1.4 mL/min. Injections were performed with a volume of 1 \u0026micro;L in split mode at a ratio of 1:20. The injector temperature was set to 215\u0026deg;C. The oven temperature program started at 80\u0026deg;C and was held for 5 minutes, followed by a temperature increase of 5\u0026deg;C/min up to 175\u0026deg;C, and then a ramp of 1\u0026deg;C/min until reaching 215\u0026deg;C, which was maintained for 26 minutes. The mass spectrometer operated in full scan mode, with an ionization energy of 70 eV, ion source temperature at 215\u0026deg;C, ion detection ranging from 35 to 500 m/z, and a scan speed of 0.2 seconds per cycle. For the identification of fatty acid peaks, a Supelco 37-component FAME mix standard (Sigma-Aldrich\u0026reg;) was used.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eQuantitative Real-Time PCR (RT-qPCR)\u003c/h2\u003e\u003cp\u003eThe extracted liver tissue was homogenized in 1 mL of Trizol\u0026reg; (Thermo Fisher Scientific), and total RNA was extracted according to the manufacturer's instructions. A total of 2 \u0026micro;g of RNA was used for complementary DNA (cDNA) synthesis using High-Capacity cDNA Reverse Transcription Kits (Thermo Fisher Scientific). The cDNA samples were subjected to quantitative real-time polymerase chain reaction (RT-qPCR) using the SYBR Green detection system (iTaq\u0026trade; Universal SYBR Green Supermix, Bio-Rad), with 50 ng of cDNA and 0.3 \u0026micro;M of each primer. Gene expression was normalized using Gapdh as the endogenous control, and relative quantification was performed using the 2^\u0026minus;ΔΔCt method. The primers used were specific for target genes related to lipogenesis, lipid oxidation, and inflammation in the liver, as described in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences used for the RT-qPCR technique\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward (5' \u0026ndash; 3')\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse (5' \u0026ndash; 3')\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ePparα\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACCACTACGGAGTTCACGCATG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGAATCTTGCAGCTCCGATCACAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eCpt1α\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAAAGATCAATCGGACCCTAGACA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAGCGAGTAGCGCATAGTCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eAcsl1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACACTTCCTTGAAGCGATGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCTCGACTGTATCTTGTGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eAcox\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGGAGTGCTACGGGTTACATG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCGATATCCCCAACAGTGATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eAcadl\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCCATGGCAAAATACTGGGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCATCCACGTAAGCTTTTGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eChrebpα\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCCTCCGCCAGACCTCACTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGTGCTGAGTTGGCGAAGGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eAcc\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTTCTGTTGGACAACGCCTTCAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGAGTCACAGAAGCAGCCCATT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eCd36\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGGAGCTGTTATTGGTGCAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGGGTTTTGCACATCAAAGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eFatp4\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGACTTCTCCAGCCGTTTCCACA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAAAGGACAGGATGCGGCTATTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eSrebp1c\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAGCCATGGATTGCACATTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGGAAGTCACTGTCTTGGTTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eIl1β\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGGACCTTCCAGGATGAGGACA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGTTCATCTCGGAGCCTGTAGTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eIl6\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACCACTTCACAAGTCGGAGGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGCAAGTGCATCATCGTTGTTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eTnfα\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGGCGGTGCCTATGTCTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGATCACCCCGAAGTTCAGTAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eNfkb\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGATTCCGGGCAGTGACG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGATGAGGGGAAACAGATCGTCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eTlr4\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTTCTCTCATGGCCTCCACT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGAACTACCTCTATGCAGGGAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eGapdh\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCATCACTGCCACCCAGAAGACTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATGCCAGTGAGCTTCCCGTTCAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eAll results are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Data normality was assessed using the Shapiro\u0026ndash;Wilk W test. Student's t-test (parametric) or Mann\u0026ndash;Whitney test (non-parametric) was used to compare two groups simultaneously. For comparisons of more than two groups simultaneously, one-way ANOVA followed by Tukey's \u003cem\u003epost hoc\u003c/em\u003e test (parametric) or Kruskal\u0026ndash;Wallis test (non-parametric) was applied. Statistical significance was set at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. The GraphPad Prism 8.0 software was used to analyze and generate the graphs.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eAll types of physical training elicit performance improvements without adverse effects of TRF.\u003c/b\u003e\u003c/p\u003e\u003cp\u003ePhysical performance improved in all exercised groups. Mice under TRF combined with aerobic or combined training (TRF\u0026thinsp;+\u0026thinsp;AT and TRF\u0026thinsp;+\u0026thinsp;CT) showed a higher speed at exhaustion in a treadmill incremental test (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA\u0026ndash;B), without differences between groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC) or compared to groups subjected only to aerobic training or combined training (AT and CT) (Figures \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA\u0026ndash;B). Similar results were observed in the groups subjected to TRF combined with resistance training (TRF\u0026thinsp;+\u0026thinsp;RT and TRF\u0026thinsp;+\u0026thinsp;CT), with improved performance (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD\u0026ndash;E), but no difference between groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). TRF\u0026thinsp;+\u0026thinsp;RT and TRF\u0026thinsp;+\u0026thinsp;CT were more effective in improving post-intervention performance than isolated resistance training (RT and CT) (Figures \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC\u0026ndash;D). Last, all groups showed increased grip strength after the intreventions (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG), with no significant difference compared to the individual training groups (Figures \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eE\u0026ndash;G).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eAT, RT, and CT combined with TRF have greater effects on weight loss, reduction in adiposity, and improvement in glycemic control compared to TRF alone.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eMice fed a high-fat diet weighed 35.9\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0 g at the beginning of the induction protocol, whereas mice fed a standard diet weighed 37.5\u0026thinsp;\u0026plusmn;\u0026thinsp;3.6 g. Mice fed a high-fat diet gained significantly more weight than mice fed a standard diet during the 8-week obesity induction (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). A significant reduction in body weight was observed in the TRF\u0026thinsp;+\u0026thinsp;AT, TRF\u0026thinsp;+\u0026thinsp;RT, and TRF\u0026thinsp;+\u0026thinsp;CT groups compared to the control group from the 1st week of interventions until the end of the experimental protocol (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B). The TRF\u0026thinsp;+\u0026thinsp;AT and TRF\u0026thinsp;+\u0026thinsp;CT groups showed greater weight loss than the TRF-only group, and the TRF\u0026thinsp;+\u0026thinsp;CT group more than the CT-only group (Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eA). This reduction occurred without differences in food intake among the groups over the 10-week intervention period (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-D).\u003c/p\u003e\u003cp\u003eTo assess the effects of the various weight loss (WL) interventions on adiposity, we weighed the different fat depots at collection. The weights of the retroperitoneal and inguinal fat pads were higher in the control group than in all intervention groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). The weight of the retroperitoneal fat was significantly lower in the TRF\u0026thinsp;+\u0026thinsp;AT group compared to the isolated AT group (Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eB). For the inguinal fat depots, the TRF-only group showed higher weight than the TRF groups combined with training, with the TRF\u0026thinsp;+\u0026thinsp;CT group presenting lower weight than the TRF\u0026thinsp;+\u0026thinsp;RT group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). The total weight of the adipose depots was significantly greater in the control group compared to all TRF groups combined with exercise training. The total amount of fat was significantly lower in the TRF\u0026thinsp;+\u0026thinsp;AT and TRF\u0026thinsp;+\u0026thinsp;CT groups compared to the TRF-only group, with the TRF\u0026thinsp;+\u0026thinsp;CT group having less fat than the TRF\u0026thinsp;+\u0026thinsp;RT group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). The Lee index was also significantly higher in the control group than in all intervention groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG).\u003c/p\u003e\u003cp\u003eIn order to evaluate the effects of the different weight loss (WL) interventions on glycemic control, we assessed fasting and postprandial blood glucose levels, as well as glucose and insulin tolerance tests. Fasting and postprandial glucose levels were significantly lower in the intervention groups compared to the obese (OB) group (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH\u0026ndash;I). Specifically, fasting glucose was lower in the TRF\u0026thinsp;+\u0026thinsp;AT and TRF\u0026thinsp;+\u0026thinsp;CT groups than in the isolated AT and CT groups (Figures \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eC\u0026ndash;D). Similarly, postprandial glucose was also reduced in the TRF\u0026thinsp;+\u0026thinsp;AT and TRF\u0026thinsp;+\u0026thinsp;RT groups compared to the isolated AT and RT groups (Figures \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eE\u0026ndash;F). The glucose tolerance test (GTT) revealed a significant improvement in glycemic regulation in all intervention groups compared to the OB group. Furthermore, the TRF groups combined with training presented a reduced glycemic curve compared to the isolated TRF group (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ\u0026ndash;K). Similarly, the insulin tolerance test (ITT; Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eL\u0026ndash;M) indicated a better glycemic response to insulin in all groups subjected to fasting and training interventions compared to the OB and isolated TRF groups. Additionally, blood glucose in the TRF\u0026thinsp;+\u0026thinsp;AT group was significantly lower compared to the isolated AT group (Figures \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eG\u0026ndash;H). The statistical analyses were based on the area under the curve (AUC; Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eK\u0026ndash;M and S2H) to facilitate interpretation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTRF combined with physical training attenuates hepatic lipids, serum biomarkers, and optimizes mitochondrial respiration in the liver\u003c/b\u003e\u003c/p\u003e\u003cp\u003eImages obtained from hematoxylin-eosin (H\u0026amp;E) and Oil Red O (ORO) staining revealed an absence of lipids in the CTL group and lipid accumulation in the OB group. In the groups subjected to interventions, the lipid droplets appeared smaller and less numerous (Fig.\u0026nbsp;4A and Fig.\u0026nbsp;3SA).\u003c/p\u003e\u003cp\u003eQuantification of Oil Red O staining confirmed these observations. The groups fed with HFD showed greater hepatic fat accumulation compared to the control group (CTL). However, all intervention groups significantly reduced hepatic fat compared to the OB group. Furthermore, the TRF\u0026thinsp;+\u0026thinsp;AT and TRF\u0026thinsp;+\u0026thinsp;RT groups exhibited substantially lower fat accumulation than the TRF group alone, with the TRF\u0026thinsp;+\u0026thinsp;AT group being even more effective than TRF\u0026thinsp;+\u0026thinsp;CT in this parameter (Fig.\u0026nbsp;4B). Finally, the TRF\u0026thinsp;+\u0026thinsp;AT and TRF\u0026thinsp;+\u0026thinsp;RT groups were more efficient in reducing hepatic fat content than AT and RT alone (Figure S3B-C). Additionally, the relative liver weight in the OB group was higher compared to the groups subjected to the combination of TRF with physical training (Fig.\u0026nbsp;4C).\u003c/p\u003e\u003cp\u003eHepatic cholesterol levels quantified by biochemical analysis revealed lower content in the intervention groups compared to the OB group (Fig.\u0026nbsp;4D). It is worth noting that the TRF\u0026thinsp;+\u0026thinsp;RT combination presented even lower cholesterol levels than RT alone (Figure S3D). Similarly, hepatic triglyceride (TG) levels were higher in the OB group than in other groups. The TRF\u0026thinsp;+\u0026thinsp;RT and TRF\u0026thinsp;+\u0026thinsp;CT groups also showed lower hepatic triglyceride amounts than the TRF group alone (Fig.\u0026nbsp;4E). Furthermore, TRF\u0026thinsp;+\u0026thinsp;AT was more efficient than AT alone in reducing serum triglyceride levels (Figure S3E).\u003c/p\u003e\u003cp\u003eSerum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were quantified in mice (Figs.\u0026nbsp;4F\u0026ndash;G). In line with previous findings, ALT levels were significantly higher in the OB group than in other groups (Fig.\u0026nbsp;4F). A similar result was observed for AST, highlighting the groups subjected to TRF combined with training, which presented reduced levels compared to the isolated TRF group (Fig.\u0026nbsp;4G). Additionally, the TRF\u0026thinsp;+\u0026thinsp;RT group also showed lower ALT and AST levels when compared to the isolated TRF group (Figures S3F\u0026ndash;G).\u003c/p\u003e\u003cp\u003eThe evaluation of the steatosis score reinforces the histological and biochemical findings (Fig.\u0026nbsp;4H). Confirming previous findings, steatosis indicators were higher in the OB group than in the other groups, while the groups subjected to TRF combined with training showed lower levels than the isolated TRF group. Additionally, the OB group exhibited more hepatocellular ballooning than all interventions, combining TRF with physical training. It was also noted that the TRF\u0026thinsp;+\u0026thinsp;CT group significantly reduced this parameter compared to isolated TRF. A similar pattern was observed in hepatic inflammation, where levels were higher in the OB group, while TRF\u0026thinsp;+\u0026thinsp;AT and TRF\u0026thinsp;+\u0026thinsp;RT presented lower inflammatory scores than isolated TRF. Consequently, MASLD activity was more pronounced in the OB group, but fasting combined with physical training resulted in more pronounced reductions than TRF alone (Fig.\u0026nbsp;4H).\u003c/p\u003e\u003cp\u003eNext, we investigated the influence of interventions on mitochondrial respiratory activity in the liver. The efficiency of mitochondrial respiratory chain complex I was higher in the TRF\u0026thinsp;+\u0026thinsp;RT group when compared to the OB, TRF\u0026thinsp;+\u0026thinsp;AT, and TRF\u0026thinsp;+\u0026thinsp;CT groups (Fig.\u0026nbsp;4I). Additionally, complex II efficiency in the OB group was lower compared to the CTL, TRF\u0026thinsp;+\u0026thinsp;AT, and TRF\u0026thinsp;+\u0026thinsp;RT groups (Fig.\u0026nbsp;4J). Corroborating these results, oxidative phosphorylation (OXPHOS) showed greater efficiency in the TRF\u0026thinsp;+\u0026thinsp;RT group compared to the OB, TRF, and TRF\u0026thinsp;+\u0026thinsp;CT groups (Fig.\u0026nbsp;4K). Finally, respiration linked to ATP synthesis was significantly higher in the TRF\u0026thinsp;+\u0026thinsp;RT group than in the OB, TRF, and TRF\u0026thinsp;+\u0026thinsp;CT groups (Fig.\u0026nbsp;4L). TRF\u0026thinsp;+\u0026thinsp;RT induced the most consistent mitochondrial benefits, TRF\u0026thinsp;+\u0026thinsp;AT showed the greatest reduction in hepatic fat, and TRF\u0026thinsp;+\u0026thinsp;CT also promoted specific benefits compared to isolated TRF, though with a distinct pattern from the other combined interventions. \u003c/p\u003e\u003cp\u003e\u003cb\u003eFigure 4. Effects of time-restricted feeding combined with aerobic, resistance, and combined training on liver fat accumulation, lipid metabolism, and mitochondrial function.\u003c/b\u003e A, Histological plate of liver tissue stained with hematoxylin-eosin (H\u0026amp;E) and Oil Red O (ORO). B, Quantification of the area stained with Oil Red O (n\u0026thinsp;=\u0026thinsp;6). C, Relative liver weight (%) (n\u0026thinsp;=\u0026thinsp;7). D, Hepatic cholesterol (n\u0026thinsp;=\u0026thinsp;5). E, Hepatic triglycerides (n\u0026thinsp;=\u0026thinsp;5). F, Serum alanine aminotransferase (ALT) (n\u0026thinsp;=\u0026thinsp;5). G, Serum aspartate aminotransferase (AST) (n\u0026thinsp;=\u0026thinsp;5). H, Steatosis score (n\u0026thinsp;=\u0026thinsp;6). I, Mitochondrial complex I (CI) (n\u0026thinsp;=\u0026thinsp;4). J, Mitochondrial complex II (CII) (n\u0026thinsp;=\u0026thinsp;4). K, Oxidative phosphorylation (OXPHOS) (n\u0026thinsp;=\u0026thinsp;4). L, Respiration linked to ATP synthesis (n\u0026thinsp;=\u0026thinsp;4). Bars represent the mean and standard deviation. Statistical significance was as follows: *P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, and ****P\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eNote\u003c/strong\u003e\u003cp\u003eALT and AST levels are expressed in \u0026micro;kat/L (micromoles of substrate converted per second per liter).\u003c/p\u003e\u003c/p\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003eTRF combined with physical training enhances the reduction of adipocyte diameter\u003c/h2\u003e\u003cp\u003eTo complement the analyses of body weight and fat, hematoxylin and eosin (H\u0026amp;E) staining was performed on epididymal adipose tissue to qualitatively assess adipocyte morphology and observe possible changes in their size.\u003c/p\u003e\u003cp\u003eRepresentative images of the mice visually illustrate greater body fat accumulation in the obese group compared to the groups subjected to TRF interventions combined with physical training interventions (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Furthermore, histological images revealed adipocytes with reduced diameter in the control group and in the intervention groups compared to the obese group, qualitatively corroborating the previous findings (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTRF combined with physical training alters the profile and content of hepatic fatty acids in obese mice\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe carried out chromatography and mass spectrometry to evaluate the profile and quantity of hepatic fatty acids. Our analysis revealed alterations in fatty acids previously linked to inflammatory processes, with higher levels observed in the obese group than in others.\u003c/p\u003e\u003cp\u003eThe total amount of fatty acids was significantly reduced only in the TRF interventions combined with physical training, compared to the OB group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). The total amount of saturated fatty acids was significantly higher in the OB group compared to the groups subjected to TRF combined with physical training. Furthermore, the TRF\u0026thinsp;+\u0026thinsp;AT and TRF\u0026thinsp;+\u0026thinsp;CT groups showed even lower levels of saturated fatty acids when compared to isolated TRF (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Specifically, levels of lauric acid (C12:0) were increased in the OB group compared to the CTL group, and only the TRF\u0026thinsp;+\u0026thinsp;AT group could significantly reduce these levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). For myristic acid (C14:0), all intervention groups effectively reduced its levels compared to the obese group. Moreover, the TRF\u0026thinsp;+\u0026thinsp;AT group showed an even more pronounced reduction than the group subjected only to isolated TRF (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). Palmitic acid (C16:0) levels were also assessed and found to be reduced in the intervention groups compared to the obese group, reinforcing the effectiveness of intermittent fasting, whether applied alone or combined with physical training, in lowering saturated fatty acids associated with inflammation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eE).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe total amount of monounsaturated fatty acids (MUFA) revealed that the groups subjected to TRF combined with physical training showed consistent reductions compared to the obese group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). Levels of palmitoleic acid (16:1 ω7) were reduced in all interventions compared to the OB group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). Furthermore, all groups subjected to TRF combined with training were effective in lowering oleic acid (18:1 ω9) levels compared to the OB group, with the TRF\u0026thinsp;+\u0026thinsp;CT group demonstrating greater efficiency in reducing these levels compared to the isolated TRF group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eH). Among the combined interventions, the TRF\u0026thinsp;+\u0026thinsp;CT group exhibited the most pronounced reduction in oleic acid levels, followed by TRF\u0026thinsp;+\u0026thinsp;AT and TRF\u0026thinsp;+\u0026thinsp;CT.\u003c/p\u003e\u003cp\u003e\u003cb\u003eHepatic content of ω6 and ω3 fatty acids is altered after TRF intervention combined with training\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo investigate the effects of the different interventions on hepatic polyunsaturated fatty acid (PUFA) composition, we quantified the profile and abundance of ω6 and ω3 fatty acid families and their respective members. Mice fed a high-fat diet (HFD) and subjected to time-restricted feeding (TRF) combined with aerobic training (TRF\u0026thinsp;+\u0026thinsp;AT) or combined training (TRF\u0026thinsp;+\u0026thinsp;CT) showed reduced total levels of PUFAs and ω6 fatty acids compared to the obese (OB) group (Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eA\u0026ndash;B). For total ω3 fatty acids, their levels were significantly lower in the TRF\u0026thinsp;+\u0026thinsp;RT and TRF\u0026thinsp;+\u0026thinsp;CT groups compared to the OB group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). Levels of linoleic acid (C18:2 ω6) were reduced only in the TRF\u0026thinsp;+\u0026thinsp;AT and TRF\u0026thinsp;+\u0026thinsp;CT groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eD). Despite this, the C18:2 to C20:4 bioconversion remained unchanged in both TRF\u0026thinsp;+\u0026thinsp;AT and TRF\u0026thinsp;+\u0026thinsp;CT groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eE). All groups subjected to TRF combined with training showed reduced levels of alpha-linolenic acid (C18:3 ω3) and eicosapentaenoic acid (C20:5 ω3) compared to the OB group (Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eF\u0026ndash;G). In contrast, levels of docosahexaenoic acid (C22:6 ω3) showed no significant differences between groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eH). Finally, the ω6:ω3 ratio did not differ significantly among the experimental groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003eI).\u003c/p\u003e\u003cp\u003e\u003cb\u003eTRF combined with physical training reduces inflammatory and lipogenic genes and stimulates genes involved in lipid oxidation\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo explore the molecular mechanisms underlying the effects of the interventions, we evaluated hepatic mRNA expression of genes involved in inflammation, lipogenesis, and lipid oxidation.\u003c/p\u003e\u003cp\u003eFor inflammatory genes, the OB group showed higher \u003cem\u003eTlr4\u003c/em\u003e, \u003cem\u003eTnfα\u003c/em\u003e, and \u003cem\u003eIl1β\u003c/em\u003e mRNA levels than all other groups. In contrast, only the TRF, TRF\u0026thinsp;+\u0026thinsp;RT, and TRF\u0026thinsp;+\u0026thinsp;CT groups exhibited reduced \u003cem\u003eNfkb\u003c/em\u003e mRNA levels. Additionally, only the TRF and TRF\u0026thinsp;+\u0026thinsp;AT groups were able to reduce \u003cem\u003eIl6\u003c/em\u003e mRNA levels compared to the OB group (Fig.\u0026nbsp;8A). For lipogenic genes, only the TRF\u0026thinsp;+\u0026thinsp;CT group reduced the mRNA expression of \u003cem\u003eSrebp1c\u003c/em\u003e and \u003cem\u003eFatp4\u003c/em\u003e compared to the OB group. Moreover, \u003cem\u003eFatp4\u003c/em\u003e mRNA levels were also lower in the TRF\u0026thinsp;+\u0026thinsp;CT group than in the isolated TRF group. The mRNA expression of \u003cem\u003eCd36\u003c/em\u003e was reduced in all groups compared to the OB group. In contrast, only the groups combining TRF with exercise significantly reduced \u003cem\u003eAcc\u003c/em\u003e expression, particularly the TRF\u0026thinsp;+\u0026thinsp;AT group, which showed even lower levels than the isolated TRF group. Notably, the OB group exhibited elevated \u003cem\u003eChrebpα\u003c/em\u003e mRNA levels compared to all other groups (Fig.\u0026nbsp;8B).\u003c/p\u003e\u003cp\u003eFor genes associated with lipid oxidation, \u003cem\u003ePparα\u003c/em\u003e mRNA levels were lower in the OB group compared to the control (CTL) and TRF\u0026thinsp;+\u0026thinsp;AT groups, whereas \u003cem\u003eAcox1\u003c/em\u003e mRNA expression was reduced in the TRF\u0026thinsp;+\u0026thinsp;RT group compared to both the OB group and all other interventions. Additionally, the TRF\u0026thinsp;+\u0026thinsp;AT group showed higher expression of \u003cem\u003eAcadl\u003c/em\u003e and \u003cem\u003eAcsl1\u003c/em\u003e than the isolated TRF group, which also exhibited higher levels of these genes than the OB and TRF\u0026thinsp;+\u0026thinsp;RT groups. Lastly, \u003cem\u003eCpt1α\u003c/em\u003e mRNA levels were higher in the groups combining TRF with aerobic training (TRF\u0026thinsp;+\u0026thinsp;AT and TRF\u0026thinsp;+\u0026thinsp;CT) compared to the TRF\u0026thinsp;+\u0026thinsp;RT group (Fig.\u0026nbsp;8C). \u003c/p\u003e\u003cp\u003e\u003cb\u003eFigure 8. Effects of time-restricted feeding combined with aerobic, resistance, or combined training on the expression of inflammatory, lipogenic, and oxidative genes.\u003c/b\u003e A, mRNA levels of inflammatory genes; B, mRNA levels of lipogenic genes; C, mRNA levels of genes involved in lipid oxidation (n\u0026thinsp;=\u0026thinsp;4\u0026ndash;5). Bars represent the mean and standard deviation. Statistical significance was as follows: *P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, and ****P\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/p\u003e\u003cp\u003eThe combined interventions involving TRF and physical training led to distinct outcomes depending on the type of exercise performed. However, all combinations resulted in more favorable effects when compared to TRF alone. A graphical summary of the main outcomes associated with each combined protocol is presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e9\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eBy investigating the effects of time-restricted feeding (TRF) combined with different modalities of physical training (AT, RT, and CT) in HFD-induced obese mice, we observed that the combination of these interventions promoted a more pronounced reduction in body weight and adiposity, as well as improvements in glycemic homeostasis and physical performance, compared to isolated TRF or training. There was also a reduction in hepatic lipid accumulation and hepatic fatty acid profile alterations. Hepatic gene expression indicated decreased levels of inflammatory and lipogenic mRNAs, with increased fatty acid oxidation. These findings indicate synergistic and complementary metabolic adaptations from the combination of TRF with different physical training protocols, resulting in favorable outcomes for treating obesity and MASLD in mice, which may serve as a basis for future translational investigations.\u003c/p\u003e\u003cp\u003eFurthermore, the effects varied according to the exercise modality, indicating that different types of training promote distinct metabolic benefits. These findings are consistent with previous studies reporting positive effects of TRF and physical training on hepatic metabolism and body composition\u003csup\u003e\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. However, most existing literature investigates these interventions in isolation or employs a single type of exercise. In contrast, our study expands upon this by directly comparing distinct physical training modalities in combination with TRF. This design allowed us to show that the type of exercise distinctly influenced the metabolic adaptations to TRF, particularly in pathways related to hepatic lipid handling and inflammation, thus providing a more detailed understanding of how these strategies interact.\u003c/p\u003e\u003cp\u003eIn the present study, the TRF protocol with a 12-hour feeding window (during the dark cycle) was ineffective in reducing body weight and total body fat compared to the obese group. However, its combination with physical training resulted in a significant decrease in these parameters, despite no difference in caloric intake between groups, suggesting that the effects were due to the combination of interventions. It is worth noting that, although CT alone already promoted relevant benefits, the addition of TRF further potentiated weight loss, confirming the complementary effect between the strategies. This observation reinforces the idea that TRF may act as an additional resource to enhance the impact of physical training on obesity control in animal models\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e, a hypothesis that requires validation in clinical studies. These findings align with previous reviews summarizing evidence on intermittent fasting strategies, including TRF, and their interaction with exercise on body composition and metabolic health\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003ePrevious studies in experimental models\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e,\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e and humans\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e have shown that TRF protocols employing shorter feeding windows effectively reduce body weight. Chaix \u003cem\u003eet al\u003c/em\u003e. (2014), for example, observed that only C57BL/6 male mice subjected to a 15-hour fasting period showed a significant reduction in body weight. In contrast, a daily fasting period of less than 12 hours was insufficient to induce protective metabolic responses against obesity\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. In another study, Hatori \u003cem\u003eet al\u003c/em\u003e. (2012) reported weight loss with 16-hour TRF, even without changes in food intake, suggesting that the duration of the feeding window may influence weight loss independently of caloric consumption, in obese C57BL/6 mice\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eThus, our results indicate that 12-hour TRF alone may be insufficient to promote weight and body fat loss without caloric reduction in DIO Swiss mice. However, TRF combined with physical training potentiated the effects, especially when TRF is combined with aerobic or combined training, with the latter (TRF\u0026thinsp;+\u0026thinsp;CT) being more effective than the combined training performed alone. These findings suggest that the combination of TRF and physical training produces synergistic effects, although distinct depending on the type of intervention, with the potential to optimize body weight control.\u003c/p\u003e\u003cp\u003eWe demonstrated that mice fed a high-fat diet for 8 weeks exhibit excessive weight gain, body fat accumulation, and impairments in glycemic homeostasis and insulin sensitivity. These findings are consistent with previous studies that employed comparable high-fat diet protocols in mice\u003csup\u003e\u003cspan additionalcitationids=\"CR49\" citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e. However, robust evidence from preclinical and clinical studies shows that TRF effectively restores glycemic homeostasis and insulin sensitivity compromised by HFD\u003csup\u003e\u003cspan additionalcitationids=\"CR52\" citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. Moreover, physical exercise modalities, such as aerobic and resistance training, have also been widely associated with improved glycemic homeostasis in obese mice\u003csup\u003e\u003cspan additionalcitationids=\"CR55 CR56\" citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. Our results indicate that TRF alone already exerts beneficial effects on glycemic control; however, its combination with physical training potentiates these effects. Overall, these combinations yielded the most consistent results, surpassing isolated training interventions in fasting and postprandial glycemia as well as in insulin tolerance tests. These findings reinforce that the type of exercise influences outcomes and that integrating these approaches provided additional benefits in regulating glycemic homeostasis in the animals studied, suggesting a potential that should be tested in clinical research\u003csup\u003e\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eThe limited capacity of adipose tissue expansion during weight gain favors the ectopic accumulation of lipids. In this context, the liver becomes one of the main targets, receiving free fatty acids released by adipose tissue through the portal circulation. This contributes to hepatic fat accumulation, impairing metabolic function\u003csup\u003e\u003cspan additionalcitationids=\"CR60\" citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u003c/sup\u003e. In line with this mechanism, our results showed higher hepatic lipid accumulation in the OB group compared to the CTL group, as evidenced by histological analyses as well as hepatic triglyceride and cholesterol measurements. Elevated serum levels of ALT and AST enzymes, classical markers of hepatic health, accompanied this accumulation\u003csup\u003e\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e,\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eNotably, all applied interventions were able to reduce these parameters, indicating attenuation of hepatic steatosis, accompanied by improvements in biochemical indicators and MASLD score. Similar results were observed in previous studies in which mice subjected to HFD followed by TRF reduced hepatic lipid accumulation\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e,\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e\u003c/sup\u003e. Likewise, investigations in rodents using different modalities of physical exercise (aerobic, resistance, and combined training), whether applied alone or combined with TRF, also reported results comparable to ours\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e,\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e,\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e,\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e\u003c/sup\u003e, but did not compare their combined effects directly. Our study fills this gap by contrasting the physiological responses of each modality combined with TRF. Nikroo \u003cem\u003eet al\u003c/em\u003e. (2020), when comparing the effects of aerobic, resistance, and combined training on MASLD in HFD-induced obese mice, observed that AT and RT promoted the most favorable changes for disease improvement\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Similarly, our results indicate that although AT and RT protocols were effective in the murine model employed, the reduction in hepatic lipids and liver enzymes was more pronounced when combined with TRF, suggesting a potential synergism that merits further investigation in other models and clinical trials\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eGiven this, we investigated whether these improvements were associated with changes in mitochondrial function, as mitochondrial dysfunction is a hallmark of MASLD, characterized by morphological alterations, impaired activity of respiratory complexes, and increased reactive oxygen species production, which triggers oxidative stress and contributes to liver disease progression\u003csup\u003e\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e\u003c/sup\u003e. Compared to the control group, the obese group showed reduced activity of complex I and oxidative phosphorylation (OXPHOS) capacity, indicating hepatic mitochondrial dysfunction. Although the liver initially attempts to compensate for the energy overload by increasing OXPHOS capacity, this mechanism raises the production of reactive oxygen species (ROS) and oxidative stress\u003csup\u003e\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e\u003c/sup\u003e. Probably due to the chronic HFD exposure adopted in our 18-week protocol, there is a loss of this plasticity, which may have resulted in the reduction of complex I activity and OXPHOS capacity, thus contributing to lipid accumulation and liver damage.\u003c/p\u003e\u003cp\u003eHowever, the literature remains unclear on which factors trigger this loss of plasticity\u003csup\u003e\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e\u003c/sup\u003e. Additionally, we observed that 12 hours of isolated TRF did not result in relevant changes in hepatic mitochondrial respiration. On the other hand, TRF\u0026thinsp;+\u0026thinsp;RT consistently improved overall mitochondrial function. The combination of TRF\u0026thinsp;+\u0026thinsp;AT promoted a specific increase in complex I activity. These findings suggest that, under the tested conditions, isolated TRF was insufficient to induce hepatic mitochondrial respiration adaptations. Still, its association with training, specifically resistance training, may potentiate targeted effects.\u003c/p\u003e\u003cp\u003eThe impacts of TRF on hepatic mitochondrial respiration are still not very clear. Damasceno \u003cem\u003eet al\u003c/em\u003e. (2023)\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e demonstrated that mice on HFD, subjected to a 16-hour TRF or RT, showed improved mitochondrial respiratory function in hepatocytes. As in our findings, the combination of TRF\u0026thinsp;+\u0026thinsp;RT was more effective than isolated TRF. However, unlike our results, the 16-hour isolated TRF in Damasceno \u003cem\u003eet al\u003c/em\u003e.\u003csup\u003e18\u003c/sup\u003e was sufficient to promote benefits in mitochondrial function, indicating that a longer fasting period may be necessary to enhance mitochondrial adaptations. It is important to highlight that, unlike our model, the animals in the cited study were not previously induced to obesity\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eFurthermore, our intervention used a shorter fasting window. These two factors may have independently limited the benefits of isolated TRF on mitochondrial respiration\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Regarding the effects of physical training on hepatic mitochondrial parameters in MASLD, some evidence indicates that different types of training can increase mitochondrial metabolic activity in the liver, even without changes in total mitochondrial content\u003csup\u003e\u003cspan additionalcitationids=\"CR70\" citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e\u003c/sup\u003e. These findings support our results, which show positive effects of TRF when combined with resistance training.\u003c/p\u003e\u003cp\u003eThe hepatic lipid profile showed no significant differences in total fatty acids (saturated, MUFA, PUFA) after 12 h of TRF compared to the OB group, regardless of training combinations. In MASLD, excess liver fat is preferentially stored as saturated lipids\u003csup\u003e\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e\u003c/sup\u003e, which appear particularly sensitive to TRF combined with physical training. Isolated TRF reduced pro-inflammatory fatty acids 14:0 and 16:0\u003csup\u003e73,74\u003c/sup\u003e, while its association with training intensified this effect, indicating synergistic metabolic action. TRF\u0026thinsp;+\u0026thinsp;AT was most effective, reducing 12:0, 14:0, and 16:0, possibly via enhanced oxidative pathways or hepatic lipid remodeling from aerobic training during fasting\u003csup\u003e\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e,\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e\u003c/sup\u003e. This reduction is relevant since elevated levels of these SFAs promote hepatic inflammation and metabolic dysfunction, contributing to liver disease progression\u003csup\u003e\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e,\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e\u003c/sup\u003e. TRF\u0026thinsp;+\u0026thinsp;CT also decreased total SFAs, though less than TRF\u0026thinsp;+\u0026thinsp;AT. MUFAs 16:1 (ω7) and 18:1 (ω9) declined with TRF plus training, whereas isolated TRF reduced only 16:1 (ω7); 18:1 (ω9) is directly involved in in \u003cem\u003ede novo\u003c/em\u003e lipogenesis (DNL)\u003csup\u003e\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e\u003c/sup\u003e. These findings align with Jackson \u003cem\u003eet al\u003c/em\u003e. (2011), who reported that lower SCD-1 expression correlated with reduced hepatic MUFA accumulation in ovariectomized mice undergoing aerobic training\u003csup\u003e\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e,\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e\u003c/sup\u003e. Although their model involved ovariectomized female mice and ours used males, the data support a link between reduced SCD-1 activity and lower hepatic MUFA content.\u003c/p\u003e\u003cp\u003eFasting induces a marked activation of fatty acid oxidation in the liver\u003csup\u003e\u003cspan additionalcitationids=\"CR80\" citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e\u003c/sup\u003e. Our results showed that the OB group had more PUFAs (ω6 and ω3) than the CTL group. When fasting was combined with physical training, especially in the protocols that included aerobic training (AT and CT), the amount of hepatic PUFAs was significantly reduced; however, fasting alone did not show changes compared to the OB group. This reduction can be explained by the increased rate of total fatty acid oxidation in the liver during fasting, which was enhanced by physical training, particularly aerobic exercise, known to more strongly stimulate the use of fatty acids as an energy source\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e,\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eA previous study with short-term fasting (~\u0026thinsp;16 h in a single day) in mice fed a standard diet reported increased hepatic PUFAs, especially from the ω3 family, such as EPA and DHA (Marks \u003cem\u003eet al\u003c/em\u003e., 2016)\u003csup\u003e\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e\u003c/sup\u003e. In contrast, we observed that the groups subjected to TRF combined with physical training reduced hepatic PUFAs compared to the obese group. This difference may be attributed to the combination of a chronic high-fat diet, prolonged fasting protocol (10 weeks), and the additional stimulus of physical training, which may have promoted increased PUFA oxidation or even changes in their mobilization and hepatic retention. Although ω3 PUFAs are generally associated with health benefits, in the context of obesity, this reduction likely reflects decreased liver fat accumulation and improved lipid utilization, representing a favorable metabolic adaptation that may even affect classes of fatty acids usually considered less oxidizable, such as PUFAs\u003csup\u003e\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eMolecular analyses showed that OB mice had higher mRNA levels of inflammatory (\u003cem\u003eTlr4\u003c/em\u003e, \u003cem\u003eTnfα\u003c/em\u003e, \u003cem\u003eNfkb\u003c/em\u003e, \u003cem\u003eIl1β\u003c/em\u003e, \u003cem\u003eIl6\u003c/em\u003e) and lipogenic genes (\u003cem\u003eSrebp1c\u003c/em\u003e, \u003cem\u003eCd36\u003c/em\u003e, \u003cem\u003eFatp4\u003c/em\u003e, \u003cem\u003eAcc\u003c/em\u003e, and \u003cem\u003eChrebpα\u003c/em\u003e) compared to CTL. TRF, especially when combined with physical training, reduced the expression of these genes. TRF\u0026thinsp;+\u0026thinsp;CT and TRF\u0026thinsp;+\u0026thinsp;AT were particularly effective in lowering \u003cem\u003eFatp4\u003c/em\u003e and \u003cem\u003eAcc\u003c/em\u003e, respectively, compared to TRF alone, indicating greater potential to suppress hepatic lipogenesis. These results are consistent with Paiva et al. (2022)\u003csup\u003e\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e\u003c/sup\u003e, who reported that obese mice under 24-h intermittent fasting plus treadmill running showed greater reductions in lipogenic genes and increased β-oxidation gene expression versus fasting alone. Similarly, we found higher expression of lipid oxidation genes (\u003cem\u003ePparα\u003c/em\u003e, \u003cem\u003eAcsl1\u003c/em\u003e, \u003cem\u003eCpt1α\u003c/em\u003e, and \u003cem\u003eAcadl\u003c/em\u003e), especially in TRF\u0026thinsp;+\u0026thinsp;AT, reinforcing the synergistic potential of aerobic training with fasting in modulating hepatic fatty acid metabolism. Prior studies also show aerobic training reduces hepatic lipogenic genes and increases β-oxidation-related genes\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e,\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e\u003c/sup\u003e. This upregulation likely contributes to reduced hepatic fatty acid accumulation, suggesting a key mechanism by which aerobic training with TRF may alleviate liver lipid overload. By directly comparing TRF alone and its combination with distinct training protocols, our study more clearly highlights the specific and complementary effects of each approach on hepatic gene expression.\u003c/p\u003e\u003cp\u003eThe observed metabolic effects may be related to the interventions, especially the impact of physical training on skeletal muscle. Thus, improving glycemic homeostasis and insulin sensitivity may reflect skeletal muscle adaptations. However, as skeletal muscle parameters were not directly assessed, this remains a limitation of the present study that will be addressed in future research. Considering the pleiotropic and multisystemic effects of exercise, it is important to highlight that training adaptations are not limited to hepatic tissue\u003csup\u003e\u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e,\u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e89\u003c/span\u003e\u003c/sup\u003e. Moreover, although this is a preclinical study, it was not designed to elucidate the underlying mechanisms of the observed improvements, which require further investigation in future studies.\u003c/p\u003e\u003cp\u003eAnother noteworthy point is that our combined training alternated between aerobic (two days/week) and resistance (two days/week) exercises. It remains to be determined whether performing resistance exercise followed by aerobic exercise in the same session would produce different outcomes. Furthermore, assessing muscle cross-sectional area and hypertrophy could provide a better understanding of the adaptations induced by combining TRF with varying exercise modalities, helping explain these interventions' effects on body mass.\u003c/p\u003e\u003cp\u003eIn conclusion, we demonstrated that combining TRF with AT, RT, and the combination of both caused some important improvements in physical health status relative to TRF or training alone in DIO mice. Furthermore, our results showed that TRF\u0026thinsp;+\u0026thinsp;AT was effective and superior to other combinations in reducing weight and body fat mass, fat content and the accumulation of saturated fatty acids in the liver. Although TRF\u0026thinsp;+\u0026thinsp;CT showed similar results, its impact on hepatic steatosis was less pronounced. Meanwhile, TRF\u0026thinsp;+\u0026thinsp;RT was particularly effective in improving glucose homeostasis and insulin sensitivity compared with TRF alone. These findings reinforce the potential of combining these approaches, highlighting their differences and expanding the possibilities for refining and personalizing actions against obesity and MASLD.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eConflict of Interest\u003c/h2\u003e\u003cp\u003eThe author of this study has no competing interests to declare.\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThis work was supported by The National Council for Scientific and Technological Development (CNPq; process number 309268/2023-0). This project cooperates with proven international articulation (CNPq; process number 441725/2023-6) and S\u0026atilde;o Paulo Research Foundation (FAPESP; case numbers 2023/03677-3; 2024/16630-8).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eGCFA performed all the experiments. GCFA and JRP analyzed the data. GCFA prepared the figures. GCFA and JRP drafted the manuscript. GCFR, APAM and GCA performed the training with mice. APAM, GCA, LMD and GDB participated in the tissue collection, TSR performed the chromatography. GCFA, RDL and BSP performed the RT-qPCR. ASRS, RAM, DEC, ERR, AC and JRP edited and revised the manuscript. GCFA and JRP conceived and designed the research. All authors approved the submitted version.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eAll data generated and/or analysed during this study are included in this published article and its supplementary information files.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSafaei, M., Sundararajan, E. A., Driss, M. \u0026amp; Boulila, W. Shapi\u0026rsquo;i, A. A systematic literature review on obesity: Understanding the causes \u0026amp; consequences of obesity and reviewing various machine learning approaches used to predict obesity. \u003cem\u003eComput. Biol. Med.\u003c/em\u003e \u003cb\u003e136\u003c/b\u003e, 104754 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKadouh, H. C. \u0026amp; Acosta, A. Current paradigms in the etiology of obesity. \u003cem\u003eTech. Gastrointest. Endosc\u003c/em\u003e. \u003cb\u003e19\u003c/b\u003e, 2\u0026ndash;11 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang, C., Zhang, J., Liu, Z. \u0026amp; Zhou, Z. More than an Anti-diabetic Bariatric Surgery, Metabolic Surgery Alleviates Systemic and Local Inflammation in Obesity. \u003cem\u003eObes. Surg.\u003c/em\u003e \u003cb\u003e28\u003c/b\u003e, 3658\u0026ndash;3668 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePhelps, N. H. et al. Worldwide trends in underweight and obesity from 1990 to 2022: a pooled analysis of 3663 population-representative studies with 222 million children, adolescents, and adults. \u003cem\u003eLancet\u003c/em\u003e \u003cb\u003e403\u003c/b\u003e, 1027\u0026ndash;1050 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFactors, O. H. R. et al. Prevalence of Obesity, Diabetes, and Obesity-Related Health Risk Factors, 289, 2001\u0026ndash;2004 (2003). (2001).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKang, J. H. et al. Interaction of genetic and environmental factors for body fat mass control: observational study for lifestyle modification and genotyping. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 1\u0026ndash;9 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDespres, J. P., Lemieux, I., B D Om I, N a L O B E S I T \u0026amp; Y a N D M E T a B O L I C S Y N D R Om E. \u003cem\u003eNature\u003c/em\u003e \u003cb\u003e444\u003c/b\u003e, 881\u0026ndash;887 (2006).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYounossi, Z. et al. Global burden of NAFLD and NASH: Trends, predictions, risk factors and prevention. \u003cem\u003eNat. Rev. Gastroenterol. Hepatol.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, 11\u0026ndash;20 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHagstr\u0026ouml;m, H., Shang, Y., Hegmar, H. \u0026amp; Nasr, P. Natural history and progression of metabolic dysfunction-associated steatotic liver disease. \u003cem\u003eLancet Gastroenterol. Hepatol.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 944\u0026ndash;956 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSherman, H. et al. Timed high-fat diet resets circadian metabolism and prevents obesity. \u003cem\u003eFASEB J.\u003c/em\u003e \u003cb\u003e26\u003c/b\u003e, 3493\u0026ndash;3502 (2012).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eČrešnovar, T. et al. Early time-restricted eating with energy restriction has a better effect on body fat mass, diastolic blood pressure, metabolic age and fasting glucose compared to late time-restricted eating with energy restriction and/or energy restriction alone: A 3-mon. \u003cem\u003eClin. Nutr.\u003c/em\u003e \u003cb\u003e49\u003c/b\u003e, 57\u0026ndash;68 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChow, L. S. et al. Time-Restricted Eating Effects on Body Composition and Metabolic Measures in Humans who are Overweight: A Feasibility Study. \u003cem\u003eObesity\u003c/em\u003e \u003cb\u003e28\u003c/b\u003e, 860\u0026ndash;869 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRegmi, P. \u0026amp; Heilbronn, L. K. Time-Restricted Eating: Benefits, Mechanisms, and Challenges in Translation. \u003cem\u003eiScience\u003c/em\u003e 23, 101161 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHatori, M. et al. Time-restricted feeding without reducing caloric intake prevents metabolic diseases in mice fed a high-fat diet. \u003cem\u003eCell. Metab.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, 848\u0026ndash;860 (2012).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePeng, X. et al. Time-restricted feeding rescues circadian disruption-aggravated progression of Alzheimer\u0026rsquo;s disease in diabetic mice. \u003cem\u003eJ. Nutr. Biochem.\u003c/em\u003e \u003cb\u003e110\u003c/b\u003e, 109128 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChaix, A., Lin, T., Le, H. D., Chang, M. W. \u0026amp; Panda, S. Time-Restricted Feeding Prevents Obesity and Metabolic Syndrome in Mice Lacking a Circadian Clock. \u003cem\u003eCell. Metab.\u003c/em\u003e \u003cb\u003e29\u003c/b\u003e, 303\u0026ndash;319e4 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVieira, R. F. L. et al. Time-restricted feeding combined with aerobic exercise training can prevent weight gain and improve metabolic disorders in mice fed a high-fat diet. \u003cem\u003eJ. Physiol.\u003c/em\u003e \u003cb\u003e600\u003c/b\u003e, 797\u0026ndash;813 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ede Lima, R. D. et al. Time-restricted feeding combined with resistance exercise prevents obesity and improves lipid metabolism in the liver of mice fed a high-fat diet. \u003cem\u003eAm. J. Physiol. - Endocrinol. Metab.\u003c/em\u003e \u003cb\u003e325\u003c/b\u003e, E513\u0026ndash;E528 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAntunes, G. C. et al. Time-restricted feeding combined with exercise improves hepatic and glycaemic metabolism in obese mice: A sex-dependent study. \u003cb\u003e0\u003c/b\u003e, 1\u0026ndash;21 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003evan Baak, M. A. et al. Effect of different types of regular exercise on physical fitness in adults with overweight or obesity: Systematic review and meta-analyses. \u003cem\u003eObes. Rev.\u003c/em\u003e \u003cb\u003e22\u003c/b\u003e, 1\u0026ndash;11 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarei, W. F. A. et al. Differential effects of high fat diet-induced obesity on oocyte mitochondrial functions in inbred and outbred mice. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, 1\u0026ndash;14 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGoossens, G. H. The Metabolic Phenotype in Obesity: Fat Mass, Body Fat Distribution, and Adipose Tissue Function. \u003cem\u003eObes. Facts\u003c/em\u003e. \u003cb\u003e10\u003c/b\u003e, 207\u0026ndash;215 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCintra, D. E. et al. Unsaturated fatty acids revert diet-induced hypothalamic inflammation in obesity. \u003cem\u003ePLoS One\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e, (2012).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVieira, I. et al. Time-restricted feeding reduces in fl ammatory markers and downregulates JAG1 and NICD protein levels in the liver of aged mice ^ do Mac e. \u003cb\u003e133\u003c/b\u003e, (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFerreira, J. C. B. et al. Maximal lactate steady state in running mice: Effect of exercise training. \u003cem\u003eClin. Exp. Pharmacol. Physiol.\u003c/em\u003e \u003cb\u003e34\u003c/b\u003e, 760\u0026ndash;765 (2007).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMinuzzi, L. G. et al. Short-term Resistance Training Increases APPL1 Content in the Liver and the Insulin Sensitivity of Mice Fed a Long-term High-fat Diet. \u003cem\u003eExp. Clin. Endocrinol. Diabetes\u003c/em\u003e. \u003cb\u003e128\u003c/b\u003e, 30\u0026ndash;37 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSantos, J. D. M. et al. Strength Training Protects High-Fat-Fed Ovariectomized Mice against Insulin Resistance and Hepatic Steatosis. \u003cem\u003eInt J. Mol. Sci\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNikroo, H., Hosseini, S. R. A., Fathi, M., Sardar, M. A. \u0026amp; Khazaei, M. The effect of aerobic, resistance, and combined training on PPAR-α, SIRT1 gene expression, and insulin resistance in high-fat diet-induced NAFLD male rats. \u003cem\u003ePhysiol. Behav.\u003c/em\u003e \u003cb\u003e227\u003c/b\u003e, 113149 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePereira, R. M. et al. FOXO1 is downregulated in obese mice subjected to short-term strength training. \u003cem\u003eJ. Cell. Physiol.\u003c/em\u003e \u003cb\u003e237\u003c/b\u003e, 4262\u0026ndash;4274 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eda Rocha, A. L. et al. Downhill Running Excessive Training Inhibits Hypertrophy in Mice Skeletal Muscles with Different Fiber Type Composition. \u003cem\u003eJ. Cell. Physiol.\u003c/em\u003e \u003cb\u003e231\u003c/b\u003e, 1045\u0026ndash;1056 (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePereira, B. C. et al. Excessive training impairs the insulin signal transduction in mice skeletal muscles. \u003cem\u003eJ. Endocrinol.\u003c/em\u003e \u003cb\u003e230\u003c/b\u003e, 93\u0026ndash;104 (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBonora, E. et al. Estimates of in vivo insulin action in man: Comparison of insulin tolerance tests with euglycemic and hyperglycemic glucose clamp studies. \u003cem\u003eJ. Clin. Endocrinol. Metab.\u003c/em\u003e \u003cb\u003e68\u003c/b\u003e, 374\u0026ndash;378 (1989).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJagot, S. A., Webb, G. P., Rogers, P. D. \u0026amp; Dickerson, J. W. T. Estimation of body fat content in normal, chemically-obese and obese hyperglycaemic mice. \u003cem\u003eIRCS Med. Sci.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e, 93\u0026ndash;94 (1980).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNovelli, E. L. B. et al. Anthropometrical parameters and markers of obesity in rats. \u003cem\u003eLab. Anim.\u003c/em\u003e \u003cb\u003e41\u003c/b\u003e, 111\u0026ndash;119 (2007).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBernardes, D. et al. Metabolic Alterations in Experimental Autoimmune Encephalomyelitis in Mice: Effects of Prior Physical Exercise. \u003cem\u003eNeurophysiology\u003c/em\u003e \u003cb\u003e48\u003c/b\u003e, 117\u0026ndash;121 (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKleiner, D. E. et al. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. \u003cem\u003eHepatology\u003c/em\u003e \u003cb\u003e41\u003c/b\u003e, 1313\u0026ndash;1321 (2005).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePower Guerra, N. et al. The effect of different weight loss strategies to treat non-alcoholic fatty liver disease focusing on fibroblast growth factor 21. \u003cem\u003eFront. Nutr.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 1\u0026ndash;14 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiebig, M. et al. Microcirculatory disturbances and cellular changes during progression of hepatic steatosis to liver tumors. \u003cem\u003eExp. Biol. Med.\u003c/em\u003e \u003cb\u003e243\u003c/b\u003e, 1\u0026ndash;12 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBraga, R. R. et al. Exercise alters the mitochondrial proteostasis and induces the mitonuclear imbalance and UPRmt in the hypothalamus of mice. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 3813 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFOLCH, J. \u0026amp; LEES, M. SLOANE STANLEY, G. H. A simple method for the isolation and purification of total lipides from animal tissues. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cb\u003e226\u003c/b\u003e, 497\u0026ndash;509 (1957).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShirai, N., Suzuki, H. \u0026amp; Wada, S. Direct methylation from mouse plasma and from liver and brain homogenates. \u003cem\u003eAnal. Biochem.\u003c/em\u003e \u003cb\u003e343\u003c/b\u003e, 48\u0026ndash;53 (2005).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDomingos Brisque, G. et al. Combination of time-restricted feeding with resistance exercise ameliorates MAFLD and improves glycemic homeostasis in obese mice. \u003cem\u003eLife Metab.\u003c/em\u003e \u003cb\u003e4\u003c/b\u003e, 4\u0026ndash;8 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTinsley, G. M. \u0026amp; La Bounty, P. M. Effects of intermittent fasting on body composition and clinical health markers in humans. \u003cem\u003eNutr. Rev.\u003c/em\u003e \u003cb\u003e73\u003c/b\u003e, 661\u0026ndash;674 (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWipt, P. \u0026amp; George, K. M. \u003cem\u003e基因的改变NIH Public. Access. Bone\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e, 1\u0026ndash;7 (2008).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAouichat, S. et al. Time-Restricted Feeding Improves Body Weight Gain, Lipid Profiles, and Atherogenic Indices in Cafeteria-Diet-Fed Rats: Role of Browning of Inguinal White Adipose Tissue. \u003cem\u003eNutrients\u003c/em\u003e 12, 2185 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMoro, T. et al. Effects of eight weeks of time-restricted feeding (16/8) on basal metabolism, maximal strength, body composition, inflammation, and cardiovascular risk factors in resistance-trained males. \u003cem\u003eJ. Transl Med.\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 1\u0026ndash;10 (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChaix, A., Zarrinpar, A., Miu, P. \u0026amp; Panda, S. Time-restricted feeding is a preventative and therapeutic intervention against diverse nutritional challenges. \u003cem\u003eCell. Metab.\u003c/em\u003e \u003cb\u003e20\u003c/b\u003e, 991\u0026ndash;1005 (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarchesini, G. et al. Association of nonalcoholic fatty liver disease with insulin resistance. \u003cem\u003eAm. J. Med.\u003c/em\u003e \u003cb\u003e107\u003c/b\u003e, 450\u0026ndash;455 (1999).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi, J., Wu, H., Liu, Y. \u0026amp; Yang, L. High fat diet induced obesity model using four strains of mice: kunming, c57bl/6, balb/c and icr. \u003cem\u003eExp. Anim.\u003c/em\u003e \u003cb\u003e69\u003c/b\u003e, 326\u0026ndash;335 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e\u0026Aacute;lvarez-Amor, L. et al. Extra virgin olive oil improved body weight and insulin sensitivity in high fat diet-induced obese LDLr\u0026ndash;/\u0026ndash;.Leiden mice without attenuation of steatohepatitis. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 1\u0026ndash;16 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChung, H. et al. Time-restricted feeding improves insulin resistance and hepatic steatosis in a mouse model of postmenopausal obesity. \u003cem\u003eMetabolism\u003c/em\u003e \u003cb\u003e65\u003c/b\u003e, 1743\u0026ndash;1754 (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJamshed, H. et al. Effectiveness of Early Time-Restricted Eating for Weight Loss, Fat Loss, and Cardiometabolic Health in Adults With Obesity: A Randomized Clinical Trial. \u003cem\u003eJAMA Intern. Med.\u003c/em\u003e \u003cb\u003e182\u003c/b\u003e, 953\u0026ndash;962 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWilkinson, M. J. et al. Ten-Hour Time-Restricted Eating Reduces Weight, Blood Pressure, and Atherogenic Lipids in Patients with Metabolic Syndrome. \u003cem\u003eCell. Metab.\u003c/em\u003e \u003cb\u003e31\u003c/b\u003e, 92\u0026ndash;104e5 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBotezelli, J. D. et al. Strength Training Prevents Hyperinsulinemia, Insulin Resistance, and Inflammation Independent of Weight Loss in Fructose-Fed Animals. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e6\u003c/b\u003e, 1\u0026ndash;13 (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePereira, R. M. et al. Short-term combined training reduces hepatic steatosis and improves hepatic insulin signaling. \u003cem\u003eLife Sci.\u003c/em\u003e \u003cb\u003e287\u003c/b\u003e, 1\u0026ndash;9 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChou, T. J. et al. Effects of aerobic, resistance, and high-intensity interval training on thermogenic gene expression in white adipose tissue in high fat diet induced obese mice. \u003cem\u003eObes. Res. Clin. Pract.\u003c/em\u003e \u003cb\u003e18\u003c/b\u003e, 64\u0026ndash;72 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarinho, R. et al. Endurance exercise training increases APPL1 expression and improves insulin signaling in the hepatic tissue of diet-induced obese mice, independently of weight loss. \u003cem\u003eJ. Cell. Physiol.\u003c/em\u003e \u003cb\u003e227\u003c/b\u003e, 2917\u0026ndash;2926 (2012).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSch\u0026uuml;bel, R. et al. Effects of intermittent and continuous calorie restriction on body weight and metabolism over 50 wk: A randomized controlled trial. \u003cem\u003eAm. J. Clin. Nutr.\u003c/em\u003e \u003cb\u003e108\u003c/b\u003e, 933\u0026ndash;945 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBosy-Westphal, A., Braun, W., Albrecht, V. \u0026amp; M\u0026uuml;ller, M. J. Determinants of ectopic liver fat in metabolic disease. \u003cem\u003eEur. J. Clin. Nutr.\u003c/em\u003e \u003cb\u003e73\u003c/b\u003e, 209\u0026ndash;214 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMeneses, M. J. et al. Distinct impacts of fat and fructose on the liver, muscle, and adipose tissue metabolome: An integrated view. \u003cem\u003eFront. Endocrinol. (Lausanne)\u003c/em\u003e. \u003cb\u003e13\u003c/b\u003e, 1\u0026ndash;16 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRosqvist, F. et al. Overfeeding polyunsaturated and saturated fat causes distinct effects on liver and visceral fat accumulation in humans. \u003cem\u003eDiabetes\u003c/em\u003e \u003cb\u003e63\u003c/b\u003e, 2356\u0026ndash;2368 (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLin, Y. C., Chang, P. F. \u0026amp; Ni, Y. H. Updated upper limits of normal serum alanine aminotrasferase levels for screening metabolic dysfunction-associated fatty liver disease in obese children. \u003cem\u003eJ. Formos. Med. Assoc.\u003c/em\u003e \u003cb\u003e121\u003c/b\u003e, 2548\u0026ndash;2555 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu, Z. \u0026amp; Xu, B. Nonlinear association between AST/ALT ratio and 28-day all-cause mortality following ICU admission in critically ill cirrhotic patients: a retrospective cohort study. \u003cem\u003eBMC Gastroenterol\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRegmi, P. et al. Early or delayed time-restricted feeding prevents metabolic impact of obesity in mice. \u003cem\u003eJ. Endocrinol.\u003c/em\u003e \u003cb\u003e248\u003c/b\u003e, 75\u0026ndash;86 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMu\u0026ntilde;oz, V. R. et al. Exercise decreases CLK2 in the liver of obese mice and prevents hepatic fat accumulation. \u003cem\u003eJ. Cell. Biochem.\u003c/em\u003e \u003cb\u003e119\u003c/b\u003e, 5885\u0026ndash;5892 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePessayre, D. Role of mitochondria in non-alcoholic fatty liver disease. \u003cem\u003eJ Gastroenterol. Hepatol\u003c/em\u003e \u003cb\u003e22\u003c/b\u003e, (2007).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKahl, S. et al. Dysglycemia and liver lipid content determine the relationship of insulin resistance with hepatic OXPHOS capacity in obesity Authors Dysglycemia and liver lipid content determine the relationship of insulin resistance with hepatic OXPHOS capacity in obesi. 417\u0026ndash;426 (2025). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jhep.2024.08.012\u003c/span\u003e\u003cspan address=\"10.1016/j.jhep.2024.08.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFromenty, B. \u0026amp; Roden, M. Mitochondrial alterations in fatty liver diseases. \u003cem\u003eJ. Hepatol.\u003c/em\u003e \u003cb\u003e78\u003c/b\u003e, 415\u0026ndash;429 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGon\u0026ccedil;alves, I. O. et al. Exercise alters liver mitochondria phospholipidomic profile and mitochondrial activity in non-alcoholic steatohepatitis. \u003cem\u003eInt. J. Biochem. Cell. Biol.\u003c/em\u003e \u003cb\u003e54\u003c/b\u003e, 163\u0026ndash;173 (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFletcher, J. A. et al. Impact of various exercise modalities on hepatic mitochondrial function. \u003cem\u003eMed. Sci. Sports Exerc.\u003c/em\u003e \u003cb\u003e46\u003c/b\u003e, 1089\u0026ndash;1097 (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGon\u0026ccedil;alves, I. O., Oliveira, P. J., Ascens\u0026atilde;o, A. \u0026amp; Magalh\u0026atilde;es, J. Exercise as a therapeutic tool to prevent mitochondrial degeneration in nonalcoholic steatohepatitis. \u003cem\u003eEur. J. Clin. Invest.\u003c/em\u003e \u003cb\u003e43\u003c/b\u003e, 1184\u0026ndash;1194 (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eErickson, M. L. et al. Non-invasive assessment of hepatic lipid subspecies matched with non-alcoholic fatty liver disease phenotype. \u003cem\u003eNutr. Metab. Cardiovasc. Dis.\u003c/em\u003e \u003cb\u003e29\u003c/b\u003e, 1197\u0026ndash;1204 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSaraswathi, V. et al. Myristic Acid Supplementation Aggravates High Fat Diet-Induced Adipose Inflammation and Systemic Insulin Resistance in Mice. \u003cem\u003eBiomolecules\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 1\u0026ndash;15 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKorbecki, J. \u0026amp; Bajdak-Rusinek, K. The effect of palmitic acid on inflammatory response in macrophages: an overview of molecular mechanisms. \u003cem\u003eInflamm. Res.\u003c/em\u003e \u003cb\u003e68\u003c/b\u003e, 915\u0026ndash;932 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLamaziere, A., Wolf, C., Barbe, U., Bausero, P. \u0026amp; Visioli, F. Lipidomics of hepatic lipogenesis inhibition by omega 3 fatty acids. \u003cem\u003eProstaglandins Leukot. Essent. Fat. Acids\u003c/em\u003e. \u003cb\u003e88\u003c/b\u003e, 149\u0026ndash;154 (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEzpeleta, M. et al. Effect of alternate day fasting combined with aerobic exercise on non-alcoholic fatty liver disease: A randomized controlled trial. \u003cem\u003eCell. Metab.\u003c/em\u003e \u003cb\u003e35\u003c/b\u003e, 56\u0026ndash;70e3 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJackson, K. C. et al. Wheel running prevents the accumulation of monounsaturated fatty acids in the liver of ovariectomized mice by attenuating changes in SCD-1 content. \u003cem\u003eAppl. Physiol. Nutr. Metab.\u003c/em\u003e \u003cb\u003e36\u003c/b\u003e, 798\u0026ndash;810 (2011).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePaton, C. M. \u0026amp; Ntambi, J. M. Biochemical and physiological function of stearoyl-CoA desaturase. \u003cem\u003eAm. J. Physiol. - Endocrinol. Metab.\u003c/em\u003e \u003cb\u003e297\u003c/b\u003e, 28\u0026ndash;37 (2009).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKersten, S. et al. Peroxisome proliferator-activated receptor α mediates the adaptive response to fasting. \u003cem\u003eJ. Clin. Invest.\u003c/em\u003e \u003cb\u003e103\u003c/b\u003e, 1489\u0026ndash;1498 (1999).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDefour, M., Hooiveld, G. J. E. J., Van Weeghel, M. \u0026amp; Kersten, S. Probing metabolic memory in the hepatic response to fasting. \u003cem\u003ePhysiol. Genomics\u003c/em\u003e. \u003cb\u003e52\u003c/b\u003e, 602\u0026ndash;617 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRuppert, P. M. M. \u0026amp; Kersten, S. Mechanisms of hepatic fatty acid oxidation and ketogenesis during fasting. \u003cem\u003eTrends Endocrinol. Metab.\u003c/em\u003e \u003cb\u003e35\u003c/b\u003e, 107\u0026ndash;124 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePurdom, T., Kravitz, L., Dokladny, K. \u0026amp; Mermier, C. Understanding the factors that effect maximal fat oxidation. \u003cem\u003eJ Int. Soc. Sports Nutr\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMuscella, A., Stef\u0026agrave;no, E., Lunetti, P., Capobianco, L. \u0026amp; Marsigliante, S. The regulation of fat metabolism during aerobic exercise. \u003cem\u003eBiomolecules\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, 1\u0026ndash;29 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarks, K. A. et al. Fasting enriches liver triacylglycerol with n-3 polyunsaturated fatty acids: implications for understanding the adipose\u0026ndash;liver axis in serum docosahexaenoic acid regulation. \u003cem\u003eGenes Nutr.\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, 1\u0026ndash;14 (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ede Castro-de-Paiva, P., Marinho, T. S., Mandarim-de-Lacerda, C. A. \u0026amp; Aguila, M. B. Intermittent fasting, high-intensity interval training, or a combination of both have beneficial effects in obese mice with nonalcoholic fatty liver disease. \u003cem\u003eJ Nutr. Biochem\u003c/em\u003e \u003cb\u003e104\u003c/b\u003e, (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGil-Cosano, J. J. et al. Effects of combined aerobic and resistance training on the inflammatory profile of children with overweight/obesity: A randomized clinical trial. \u003cem\u003ePediatr. Obes.\u003c/em\u003e 1\u0026ndash;14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/ijpo.13152\u003c/span\u003e\u003cspan address=\"10.1111/ijpo.13152\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDiniz, T. A. et al. Aerobic training improves NAFLD markers and insulin resistance through AMPK-PPAR-α signaling in obese mice. \u003cem\u003eLife Sci\u003c/em\u003e \u003cb\u003e266\u003c/b\u003e, (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePedersen, B. K. \u0026amp; Febbraio, M. A. Muscles, exercise and obesity: Skeletal muscle as a secretory organ. \u003cem\u003eNat. Rev. Endocrinol.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e, 457\u0026ndash;465 (2012).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, Y. et al. Benign adaptation for exercise and benefits for non-alcoholic fatty liver disease. \u003cem\u003eBiochem. Biophys. Res. Commun.\u003c/em\u003e \u003cb\u003e726\u003c/b\u003e, 150305 (2024).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"High-fat diet, metabolic associated fatty liver disease (MAFLD), time-restricted eating, aerobic training, resistance training, combined training","lastPublishedDoi":"10.21203/rs.3.rs-8071932/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8071932/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMetabolic dysfunction-associated steatotic liver disease (MASLD) is the most prevalent liver disease worldwide, particularly among individuals with overweight and obesity. Non-pharmacological strategies such as time-restricted feeding (TRF) and exercise training can effectively mitigate obesity and metabolic disorders associated with MASLD. However, the specific effects of TRF combined with aerobic training (AT), resistance training (RT), or combined training (CT) on weight loss and MASLD remain unclear. This study investigated the effects of 12h-TRF and exercise training (AT, RT, and CT), applied alone or in combination with TRF, for 10 weeks in diet-induced obese male Swiss mice. Individually, TRF and all exercise protocols reduced weight gain and adiposity, improved glycemic homeostasis, and decreased hepatic fat accumulation. Combining TRF with exercise resulted in more pronounced improvements, suggesting complementary mechanisms. Among the interventions, TRF+AT was the most effective in reducing body weight, fat mass, and hepatic saturated fatty acid accumulation. TRF+CT induced similar effects but with a less marked reduction in hepatic steatosis. Moreover, TRF+AT downregulated lipogenic and inflammatory genes while upregulating genes related to hepatic fatty acid oxidation. TRF+RT was particularly effective in improving glucose homeostasis and insulin sensitivity. In conclusion, combining TRF with AT, RT, or CT significantly improved metabolic and hepatic parameters compared to TRF or training alone in obese mice. These findings highlight the synergistic potential of TRF and exercise and emphasize their specific outcomes, providing new perspectives for personalized interventions against obesity and MASLD.\u003c/p\u003e","manuscriptTitle":"Integration of 12-Hour Time-Restricted Feeding with Exercise Training Potentiates Weight Loss and Attenuates MASLD in Diet-Induced Obese Mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-01 05:46:50","doi":"10.21203/rs.3.rs-8071932/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-12-09T06:19:29+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-08T03:48:27+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"68464221779236236965175372343331950931","date":"2025-12-01T14:23:34+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-26T04:17:57+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"50496642947635035255796956765922167093","date":"2025-11-26T00:05:31+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-11-25T22:09:10+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-11-25T19:58:08+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-11-20T18:53:53+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-18T19:29:10+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-11-18T19:24:07+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9f4f83ee-c80f-41a0-95ae-80728e6b1b74","owner":[],"postedDate":"December 1st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":58847007,"name":"Health sciences/Diseases"},{"id":58847008,"name":"Health sciences/Endocrinology"},{"id":58847009,"name":"Health sciences/Gastroenterology"},{"id":58847010,"name":"Biological sciences/Physiology"}],"tags":[],"updatedAt":"2026-01-12T16:01:10+00:00","versionOfRecord":{"articleIdentity":"rs-8071932","link":"https://doi.org/10.1038/s41598-025-33139-8","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2026-01-10 15:57:24","publishedOnDateReadable":"January 10th, 2026"},"versionCreatedAt":"2025-12-01 05:46:50","video":"","vorDoi":"10.1038/s41598-025-33139-8","vorDoiUrl":"https://doi.org/10.1038/s41598-025-33139-8","workflowStages":[]},"version":"v1","identity":"rs-8071932","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8071932","identity":"rs-8071932","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.