High levels of Cdc42 GTPase underlie an all-or-none decision to fuse

High levels of Cdc42 GTPase underlie an all-or-none decision to fuse | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results High levels of Cdc42 GTPase underlie an all-or-none decision to fuse Sajjita Saha , Aiswarya Sajeevan , Laura Merlini , Vincent Vincenzetti , View ORCID Profile Sophie G Martin doi: https://doi.org/10.1101/2025.05.05.652171 Sajjita Saha 1 Department of Molecular and Cellular Biology, University of Geneva Find this author on Google Scholar Find this author on PubMed Search for this author on this site Aiswarya Sajeevan 1 Department of Molecular and Cellular Biology, University of Geneva Find this author on Google Scholar Find this author on PubMed Search for this author on this site Laura Merlini 1 Department of Molecular and Cellular Biology, University of Geneva Find this author on Google Scholar Find this author on PubMed Search for this author on this site Vincent Vincenzetti 2 Department of Fundamental Microbiology, University of Lausanne Find this author on Google Scholar Find this author on PubMed Search for this author on this site Sophie G Martin 1 Department of Molecular and Cellular Biology, University of Geneva 2 Department of Fundamental Microbiology, University of Lausanne Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Sophie G Martin For correspondence: Sophie.Martin{at}unige.ch Abstract Full Text Info/History Metrics Preview PDF Abstract Cdc42 is a Rho-family GTPase conserved across eukaryotes, where it plays essential roles in cell polarization. In single-celled yeast systems, Cdc42 is a key driver of symmetry breaking and polarized growth, forming zones of activity that locally recruit eRectors to organize the cytoskeleton and polarize secretion. Here we show that Cdc42 also functions in cell-cell fusion during Schizosaccharomyces pombe sexual reproduction but concentrates at the fusion site through mechanisms distinct from those proposed in Saccharomyces cerevisiae . Notably, the cdc42-mCherry SW allele (but not the cdc42-sfGFP SW allele), which is functional for cell polarization and has been used across organisms for dynamic studies, exhibits a strong fusion defect. These cells block fusion before cell wall digestion but after actin fusion focus formation, indicating that Cdc42 is required to translate the vesicle cluster into polarized cargo delivery. We trace the defect to instability of Cdc42-mCherry SW and demonstrate that cell fusion requires higher Cdc42 protein levels than mitotic polarized growth. Remarkably, by constructing an allelic series driving Cdc42 expression over a 5-fold range, we discover that polarized growth responds linearly to Cdc42 protein levels, whereas sexual reproduction exhibits a sharp switch-like response. Thus, the topology of the Cdc42 regulatory network is distinct for its polarization and mating functions. Introduction The small GTPase Cdc42 is a highly conserved Rho-family GTPase, which plays critical roles across eukaryotes. By coordinating multiple cellular processes and signaling pathways, Cdc42 is a key regulator of cell polarity ( Etienne-Manneville, 2004 ; Pichaud et al., 2019 ). It contributes to the organization of the actin cytoskeleton and vesicular traRicking ( Harris and Tepass, 2010 ), thus regulating cell migration, contractility, endocytosis and secretion. It also regulates a host of signaling cascades, thus impacting the physiology of most organisms and cell types ( Melendez et al., 2011 ). Even in simple single cell yeast organisms, Cdc42 plays multiple essential roles, in cell polarization ( Adams et al., 1990 ; Miller and Johnson, 1994 ), polarized secretion ( Adamo et al., 2001 ; Estravis et al., 2012 ), cell division ( Wei et al., 2016 ), cell fusion ( Barale et al., 2006 ; Ydenberg et al., 2012 ) and nuclear membrane repair ( Lu and Drubin, 2020 ). Regulation and functional output of Cdc42 GTPase are best understood for its essential role in polarity establishment during mitotic growth in both fission and budding yeasts. Cdc42 is active when bound to GTP, which is promoted by guanine nucleotide exchange factors, and returns to the basal state upon hydrolysis to GDP, promoted by GTPase activating proteins. For emergence of cell polarity, a local patch of Cdc42-GTP can form spontaneously thanks to a conserved scaRold-mediated positive-feedback that promotes symmetry breaking ( Lamas et al., 2020 ; Martin, 2015 ; Wu and Lew, 2013 ). In wildtype cells, this positive feedback is embedded in additional intrinsic cues that define where Cdc42 is activated. For instance, in fission yeast, microtubule-deposited factors help define the zones of Cdc42 activity at cell poles ( Kokkoris et al., 2014 ; Tay et al., 2018 ). Upon GTP binding, the Cdc42 switch domains undergo conformational changes, recruiting eRectors ( Cherfils and Zeghouf, 2013 ). Some Cdc42 eRectors are species-specific but many, including formins, the exocyst complex and p21 Activated Kinases (PAK), are conserved across species ( Johnson, 1999 ; Kuhn and Geyer, 2014 ). In S. pombe , Cdc42 relieves autoinhibition of the formin For3 that assembles cables for directional transport by the myosin V Myo52 ( Martin et al., 2007 ); activates the exocyst complex for vesicle tethering at the plasma membrane ( Bendezu and Martin, 2011 ; Estravis et al., 2011 ); and activates the essential PAK Pak1 ( Tu and Wigler, 1999 ), which also negatively feeds back to Cdc42 ( Das et al., 2012 ). Collectively, these eRectors promote the organization of a polarized actin cytoskeleton and vesicle secretion, converting the Cdc42-GTP patch into eRective polarized cell growth ( Chiou et al., 2017 ). Understanding of Cdc42 in vivo dynamics was allowed by the development of alleles tagged with either sfGFP or mCherry fluorophore at the edge of the Rho-insert domain ( Bendezu et al., 2015 ), a Rho GTPase-family specific alpha-helix ( Valencia et al., 1991 ). These alleles were extensively tested during mitotic polarized growth in fission yeast, with no reported phenotype ( Bendezu et al., 2015 ), and the same tagging strategy was subsequently used in species across fungi, plants and animals ( Cheng et al., 2020 ; Golding et al., 2019 ; Lu and Drubin, 2020 ). Notably, these alleles allowed to understand that Cdc42-GTP exhibits slower mobility than Cdc42-GDP, leading to its accumulation at sites of activation ( Bendezu et al., 2015 ). They also showed that the overall fast mobility of both forms is required for the GTPase to repopulate polarity sites ( Rutkowski et al., 2024 ), where polarized secretion induces membrane flows that displace slow-mobile proteins such as Cdc42 GAPs ( Gerganova et al., 2021 ). Cdc42 GTPase also plays important roles at several stages of sexual reproduction. For sexual reproduction, cell polarization is re-wired to pheromone perception, allowing yeast cells to polarize growth in the direction of a mating partner that secretes peptide pheromones ( Ghose et al., 2022 ). In fission yeast, pheromone perception relies on cognate G-protein coupled receptors and downstream Ras-MAPK signaling cascade, which triggers a transcriptional program that promotes expression of all pheromone-signaling components and locks cells in sexual diRerentiation ( Sieber et al., 2023 ). During early mating stages, Cdc42-GTP forms dynamic patches at the cell cortex, which recruit eRectors, sample pheromones around the cell periphery and stabilize where optimal pheromone concentration is reached ( Bendezu and Martin, 2013 ; Merlini et al., 2016 ). Cdc42 also promotes activation of the pheromone-MAPK signaling cascade, likely through the PAK Pak1 which promotes the activation of the MAPKKK ( Kelsall et al., 2025 ; Ottilie et al., 1995 ; Tu et al., 1997 ). A critical step during sexual reproduction is that of cell-cell fusion. In walled cells, such as yeasts, cell fusion requires two key steps: local digestion of the cell wall at the site of contact, followed by plasma membrane merging. Local cell wall digestion depends on the clustering of secretory vesicles containing cell wall hydrolytic enzymes at the site of cell-cell contact. This is mediated by the myosin V-based transport of the vesicles onto the actin fusion focus, a dedicated actin aster nucleated by formins ( Sieber et al., 2023 ). In S. pombe , the mating-specific formin Fus1 assembles the actin fusion focus ( Dudin et al., 2015 ). Consequently, deletion of fus1 blocks cell fusion before cell wall digestion ( Petersen et al., 1995 ). Cells are also blocked before cell wall digestion if condensation of the Fus1 focus fails ( Billault-Chaumartin et al., 2022 ; Dudin et al., 2017 ). Plasma membrane merging then relies on the 4-pass transmembrane domain protein Prm1. Its deletion blocks cell fusion after cell wall digestion, though active repair can rebuild the cell wall ( Curto et al., 2014 ). Interestingly, Cdc42 was shown to promote cell fusion in S. cerevisiae , functioning late in the fusion pathway after vesicle clustering but before cell wall digestion ( Barale et al., 2006 ; Ydenberg et al., 2012 ). For this function, the GTPase forms a focus at the fusion site through direct interaction with a BAR domain complex Fus2-Rvs161 proposed to recognize the flattening of the plasma membrane upon partner cell contact ( Brizzio et al., 1998 ; Smith et al., 2017 ; Stein et al., 2015 ; Ydenberg et al., 2012 ). In S. pombe , a possible role for Cdc42 GTPase in cell fusion has not been examined, although a function is likely given that deletion of the PAK Pak2 results in a partial fusion defect ( Vjestica et al., 2018 ). In this paper, we show that, in S. pombe , Cdc42 forms a focus at fusion site like in S. cerevisiae , but through distinct mechanism. We report a specific cell fusion defect before cell wall digestion but after actin focus formation in cells carrying the cdc42-mCherry SW allele. We trace the origin of the defect to reduced levels of Cdc42-mCherry SW protein and show through several alleles that higher levels of Cdc42 protein are required for its roles in sexual reproduction than for vegetative polarized growth. By constructing a series of alleles probing a 5-fold range of protein expression, we further demonstrate that regulation of Cdc42 is distinct for polarized growth, which responds linearly to Cdc42 levels, than mating, which exhibits a hyper-sensitive response. Results Cdc42 forms a focus and is active at the fusion focus To examine Cdc42’s role in cell fusion in S. pombe , we first looked at its localization. To detect total levels of Cdc42 by microscopy, we used Cdc42-sfGFP SW where the monomeric sfGFP is inserted at the edge of the Rho-insert domain after Q134. We previously reported that this sandwich fusion protein is fully functional during mitotic growth, in contrast to N- or C-terminally tagged alleles ( Bendezu et al., 2015 ). Cells carrying the cdc42-sfGFP SW allele are also largely mating and fusion proficient (see below and Fig 2A-B ). We labelled the fusion site with Myo52-mScarlet, which accumulates at the actin fusion focus, and expressed mtagBFP2 under control of a P-cell promoter ( p map3 ), whose entry in the M-cell defines the time of fusion pore opening. Cdc42-sfGFP SW accumulated at the site of polarity during mating, and concentrated at the fusion site, reaching maximal levels at fusion time ( Fig 1A ). A significant GFP signal was also visible in the cytosol and vacuoles (see below). Using the CRIB-3GFP reporter to visualize active Cdc42-GTP ( Tatebe et al., 2008 ), we similarly observed increase in local Cdc42-GTP amounts at the fusion site, which disappeared post-fusion ( Fig 1B ). The slope of the increase in both total Cdc42 and Cdc42-GTP levels mirrored that of Myo52. Thus, Cdc42 local activity and amounts increase in a concordant manner at the fusion site until pore opening. Download figure Open in new tab Figure 1: Cdc42 concentrates and is active at the fusion focus (A,B) Time lapse of Cdc42-sfGFP SW (A) and CRIB-3GFP (B) in h- cells crossed to h+ cells expressing p map3 -mtagBFP2 . Both cells also express Myo52-mScarlet-I. Arrows point to the fusion site. Graphs on the right show average and SD of normalized intensities at fusion site. n≥15. (C) Cdc42-sfGFP SW and Myo52-mScarlet-I localization at cell-cell contact site (arrows) in h90 (homothallic) WT, fus1 Δ and prm1 Δ strains. (D) Scheme depicting workflow of extracting FWHM and protein amounts (see methods). (E) FWHM and area under the curve values for WT (n≥29), fus1 Δ (n≥ 26) and prm1 Δ (n≥ 16). In the boxplot, boxes comprise 25 th to 75 th percentiles with indicated median; whiskers extend to minimum and maximum value. Mann-Whitney test p <0.0001: ****, p <0.01: **, p 0.05: non-significant (ns). Scale bars = 2 µm. Download figure Open in new tab Figure 2: Cdc42-mCherrySW is impaired for cell fusion (A) Representative images showing fusion eRiciency in h90 WT, cdc42-mCherry SW and cdc42-sfGFP SW strains. Arrows indicate failed fusion; arrowhead points to partial fusion with spores in only one partner. (B) Fusion eRiciency plotted with values separated for complete and partial fusion for strains as in (A), N=3, n≥139 cells per strain in each experiment. (C) Iodine staining of indicated h90 strains. Dark color indicates presence of spores. (D) Calcofluor staining shows undigested cell wall (arrows) in WT, cdc42-mCherry SW , pak2Δ and cdc42-mCherry SW pak2Δ paired cells mated for ∼24 h. (E) cdc42-mCherry SW to cdc42-sfGFP SW fluorophore swapped strains show WT like fusion eRiciency. (F ) Time lapse of h90 WT and cdc42-mCherry SW strains during cell fusion. The p map3 -mTagBFP2 expressed in P-cells indicates fusion time, as t0. In cdc42-mCherry SW cells with partial fusion, mTagBFP2 redistributes to the M-cell but the cell wall remains undigested. In the bottom example, which does not fuse, time is indicated from start of imaging. (G) Representative images showing fusion eRiciency in pak2 Δ background, combined with cdc42-mCherry SW and cdc42-sfGFP SW . (H) Fusion eRiciency plotted with values separated for complete and partial fusion for strains as in (G), N=3, n≥102 cells per strain in each experiment. Scale bars = 5 µm (A, G); 2 µm (D, F). The similar profiles of Cdc42 and Myo52 fluorescence suggest that Cdc42 localization may depend on the actin fusion focus. To test this hypothesis, we probed whether Cdc42 recruitment relies on Fus1. For this and most subsequent experiments, we used homothallic (self-fertile) h90 cells, in which both mating types are present in the population. In fus1Δ cells, Cdc42-sfGFP SW localized to the cell-cell contact site, but its distribution appeared wider than in WT, as shown by measurements of the full width at half maximum (FWHM) of its profile across the fusion axis ( Fig 1C-E ). By contrast, Cdc42 distribution remained narrower in prm1Δ , which blocks cell fusion after fusion focus assembly. Thus, the change in Cdc42 distribution in fus1Δ is not an indirect consequence of the fusion failure but is due to absence of the actin fusion focus. As a control for presence or absence of the fusion focus, we measured the width of Myo52 distribution in the same cells, which confirmed that fus1Δ strongly perturbs Myo52 compaction, while prm1Δ has minor eRects. Measurements of total Cdc42 levels showed a small reduction in both mutants ( Fig 1E ), perhaps because of the fusion block. We conclude that Cdc42 localizes to the fusion site independently of the actin fusion focus, which promotes its local concentration. Cdc42-mCherry SW is impaired for cell fusion The focal localization of Cdc42 at the fusion site is highly reminiscent of that described in S. cerevisiae , where Cdc42 forms a focus at the zone of cell contact before cell fusion ( Smith et al., 2017 ). In budding yeast, Cdc42 focus formation and function in cell fusion require its interaction with the amphiphysin-like protein Fus2 ( Smith et al., 2017 ; Ydenberg et al., 2012 ). This interaction and Cdc42 function in cell fusion are specifically blocked in the cdc42-137 and cdc42-138 alleles, carrying D121A and D122A point mutations, respectively ( Ydenberg et al., 2012 ). However, S. cerevisiae Fus2 does not exist in S. pombe . BLAST searches with S. cerevisiae Fus2 sequence only find homologs within the ascomycete Saccharomycotina and Pezizomycotina subphyla, but not the more basal Taphrinomycotina (the S. pombe subphylum) nor any non-ascomycete fungi. Furthermore, mutation of the Cdc42 interaction surface by introducing the homologous mutations cdc42 D121A and cdc42 D122A in S. pombe produced mutant cells that paired and fused like WT cells ( Fig S1A-B ). Thus, Cdc42, though forming a focus pre-fusion, does not promote cell fusion in S. pombe through the same mechanisms as in S. cerevisiae . Download figure Open in new tab Figure S1: Cdc42 regulates cell fusion through distinct mechanisms in S. pombe and S. cerevisiae (A) Representative images of h90 WT, cdc42 D121A , cdc42 D122A and cdc42-mCherry SW during mating. The cdc42 D121A and cdc42 D122A alleles are equivalent to the fusion-defective cdc42-137 and cdc42-138 alleles in S. cerevisiae ( Ydenberg et al., 2012 ). (B) Percentage of pairing and mating eRiciency in strains as in (A). (C) Alphafold predicted structure of Cdc42, with indicated switch domains binding eRectors (yellow), location of mCherry SW and sfGFP SW insertion between Q134 and H135 (blue) and residues mutated to alanine by CRISPR, including D121 and D122 (green; others in cyan). The Rho-insert domain is the alpha-helix between D122 and Q134. (D) Iodine test for fusion and sporulation eRiciency. Scale bar = 5 µm. Student t-test p-values; NS = non-significant ( p >0.05). In parallel experiments, we observed that the cdc42-mCherry SW allele, while fully functional for cell polarization ( Bendezu et al., 2015 ) and able to form cell pairs as eRiciently as WT, exhibited a substantial defect in cell-cell fusion ( Fig S1A-B , Fig 2A-B ). The low fusion eRiciency was also reflected in reduced iodine staining (which specifically stains spores) of h90 cdc42-mCherry SW cells ( Fig 2C ). Calcofluor staining revealed intact cell wall in unfused cdc42-mCherry SW pairs ( Fig 2D ), indicating that fusion fails prior to cell wall digestion. Surprisingly, cells carrying cdc42-sfGFP SW , in which we examined Cdc42 localization above, were largely fusion-proficient, although we observed a small defect ( Fig 2A-B ). The distinct phenotypes of the two tagged strains are surprising given the similar size of sfGFP and mCherry and their identical site of insertion in Cdc42. To verify that the cdc42-mCherry SW phenotype was linked to the fluorophore, and not to a mutation in an unlinked genomic locus, we replaced mCherry by sfGFP in the cdc42-mCherry SW strain. The strains with swapped fluorophore showed eRicient fusion, like the original cdc42-sfGFP SW strain ( Fig 2E ). We conclude that internal tagging of Cdc42, though functionally largely inconsequential for cell polarization ( Bendezu et al., 2015 ), sexual diRerentiation and cell pairing, specifically impairs cell-cell fusion before cell wall digestion. This phenotype is markedly enhanced with the mCherry fluorophore. In the cdc42 SW alleles, the fluorophores are inserted on the edge of the Rho-insert domain, distant from the eRector-binding switch domains. In an attempt to identify Cdc42 surface residues involved in interactions potentially masked by the fluorophores, we introduced a series of point mutations on the Cdc42 surface near the mCherry insertion. However, none of these point mutations exhibited reduced iodine staining (which stains spores that form upon successful cell-cell fusion), nor did D121A and D122A (positioned on the other side of the Rho-insert domain) ( Fig S1C ). We only observed a strong mating defect upon removing the entire Rho-insert domain, which led to a distinct phenotype of complete sterility. These experiments, as well as the significantly higher functionality of Cdc42-sfGFP SW , suggest that the strong fusion defect observed in cdc42-mCherry SW cells is not primarily due to steric hindrance for eRector binding. Upon close examination of the cdc42-mCherry SW fusion phenotype, we observed that a few cell pairs exhibited spores in only one of the mating partners and apparent cell wall between the two partner cells ( Fig 2A , arrowhead). This phenotype is reminiscent of cells lacking the Cdc42 eRector Pak2, which show a partial fusion defect and transient fusion events, where a fusion pore opens but subsequently reseals ( Vjestica et al., 2018 ). Live cell imaging of cdc42-mCherry SW strains expressing mTagBFP2 in the P-cell under control of the p map3 promoter indeed identified two types of fusion defects: a frequent instance of cells with complete fusion block, where mTagBFP2 remains in the P-cell, and rare cases of cells with partial fusion, where mTagBFP2 enters the M-cell, but the cell wall between the two partner cells appears intact in the DIC channel ( Fig 2F ). The similarity in cdc42-mCherry SW and pak2Δ phenotypes led us to test whether the fusion defects observed in the cdc42-mCherry SW mutant background arises from defective Pak2 activation. To test for this possibility, we conducted genetic epistasis experiments. If Cdc42-mCherry SW failed to activate Pak2, double mutants should show no more severe phenotype than single pak2Δ mutants. By contrast, we found that pak2 Δ cdc42-mCherry SW double mutants were completely unable to fuse, with undigested cell wall at the cell-cell interface ( Fig 2G-H, 2C-D ). We also constructed pak2 Δ cdc42-sfGFP SW double mutants, which revealed that Cdc42-sfGFP SW also has reduced functionality for fusion ( Fig 2G-H, 2C ). Thus, pak2 Δ exacerbates the fusion defect observed in cdc42 SW alleles. We conclude that the cdc42 SW fusion phenotype is not primarily due to impairment in Pak2 kinase activation. Cdc42-mCherry SW compromises fusion after actin fusion focus formation Because Cdc42 accumulates on the fusion focus and is required for cell fusion, we examined its role at the fusion site. Given Cdc42’s established roles in promoting actin cable assembly and exocyst activation during mitotic growth, we tested whether the Cdc42-mCherry SW fusion protein causes any issue with vesicle accumulation at the fusion focus. We probed the localization of the formin Fus1 and type V myosin Myo52, major constituents of the fusion focus, the Rab GTPase Ypt3, which marks secretory vesicles, two exocyst subunits Exo70 and Sec6, and Prm1, a cargo of secretory vesicles delivered at the plasma membrane and necessary for membrane merging, each tagged with GFP. In wildtype cells, the exocyst decorates secretory vesicles in the focus, with Sec6 likely also decorating the plasma membrane ( Thomas et al., 2025 ). We imaged each protein by time lapse microscopy in h90 strains. Since pak2 deletion exacerbated the fusion defect, we also imaged pak2Δ cdc42-mCherry SW double mutants. Each of these proteins localized correctly at the fusion site ( Fig 3A , S2A ), indicating that cdc42-mCherry SW and pak2Δ do not cause gross abnormalities in organization of the actin cytoskeleton or polarized secretion. Download figure Open in new tab Figure S2: Exocyst component localization and bilateral phenotype of cdc42-mCherry SW (A) Representative images of Exo70 and Sec6 tagged with GFP in h90 WT, cdc42-mCherry SW and cdc42-mCherry SW pak2 Δ backgrounds, frames selected from time-lapses. Examples of fused and unfused pairs are shown for cdc42-mCherry SW . (B) FWHM and area under the curve values plotted next to respective proteins. Each dot corresponds to measurement of a cell pair. In the boxplot, boxes comprise 25 th to 75 th percentiles with indicated median; whiskers extend to minimum and maximum value. For each protein: in WT background n≥14, cdc42-mCherry SW (fused) n≥7, cdc42-mCherry SW (unfused) n≥7, cdc42-mCherry SW pak2Δ (unfused) n≥17. (C) Time lapse images of indicated h90 myo52-GFP (grey) strains crossed to untagged WT h+ expressing mtagBFP2 (blue). FWHM values of Myo52-GFP in M-cells mating with untagged h+ WT cells. Mann-Whitney test p <0.0001: ****, p <0.001: ***, p <0.01: **, p 0.05: non-significant (ns). Scale bar = 2 µm. Download figure Open in new tab Figure 3: Cdc42-mCherry SW compromises fusion after actin fusion focus formation (A) Representative images of Myo52, Fus1, Ypt3 and Prm1 tagged with GFP in h90 WT, cdc42-mCherry SW and cdc42-mCherry SW pak2 Δ backgrounds, 10 min before fusion. Examples of fused and unfused pairs are shown for cdc42-mCherry SW . (B) Time lapse images showing persistence of Myo52 at the fusion focus in WT and cdc42-mCherry SW , fused and unfused cases. Time 0 = disappearance of the Myo52 signal post-fusion or as cells give up (unfused case). The graph on the right shows the duration of Myo52 signal at the fusion site. WT n≥33, cdc42-mCherry SW (fused) n≥16, cdc42-mCherry SW (unfused) n≥24, cdc42-mCherry SW pak2Δ (unfused) n≥24. (C) FWHM and area under the curve values plotted next to respective proteins from images as in (A). Each dot corresponds to measurement of a cell pair. In the boxplot, boxes comprise 25 th to 75 th percentiles with indicated median; whiskers extend to minimum and maximum value. For each protein: in WT background n≥27, cdc42-mCherry SW (fused) n≥10, cdc42-mCherry SW (unfused) n≥15, cdc42-mCherry SW pak2Δ (unfused) n≥17. One way ANOVA p <0.0001: ****, p <0.01: **, p 0.05: non-significant (ns). Scale bars = 2 µm. Because changes in the compaction of the fusion focus and vesicle cluster can lead to fusion defects ( Billault-Chaumartin et al., 2022 ; Dudin et al., 2017 ), we probed for more subtle changes by measuring the proteins’ FWHM across the fusion axis, as in Fig 1D . To separate direct from indirect eRects, we analyzed separately cell pairs that successfully fuse, which we measured 10 min before fusion, from those that failed. We note that those that managed to fuse took significantly longer time than WT to complete the fusion process, as indicated by a longer Myo52 persistence time ( Fig 3B ). Across all proteins, we generally found little significant diRerence between their distribution in WT and cdc42-mCherry SW mutants that successfully fused ( Fig 3C , S2B ; left graphs, first two lanes). Total protein amounts at the fusion site were also largely unchanged ( Fig 3C , S2B ; right graphs, first two lanes). Myo52 was also unchanged in mutant cdc42-mCherry SW or pak2Δ cdc42-mCherry SW cells mated with untagged WT ones, which successfully fuse ( Fig S2C ). By contrast, in cells that failed to fuse, whether single cdc42-mCherry SW or double pak2Δ cdc42-mCherry SW mutants, fusion focus and vesicle distribution was wider, with slightly reduced amounts of Fus1. We interpret this general wider distribution as a consequence of the fusion failure. The interesting exception to these general rules is the distribution of Prm1, which is significantly wider even in cdc42-mCherry SW single mutants that managed to fuse ( Fig 3A, C ). Because Prm1 is delivered to the plasma membrane, its wider distribution may reflect a defect in translating the polarized organization of vesicles on the focus into a polarized cargo delivery at the plasma membrane. We note that Sec6 showed a similar wider distribution as Prm1 ( Fig S2B ), which may be similarly explained by its partial residence at the plasma membrane. Overall, these quantifications show that the cdc42-mCherry SW mutant does not perturb the organization of the actin fusion focus but aRects a downstream step in polarized secretion of the clustered vesicles. The fusion defect of cdc42-mCherry SW cells is due to reduced Cdc42 protein levels We were intrigued by the strong phenotypic diRerence between fusion-deficient cdc42-mCherry SW and largely fusion-competent cdc42-sfGFP SW cells. We made an initial observation that suggested that the two fusion proteins are present at distinct levels in mating cells. While both Cdc42-mCherry SW and Cdc42-sfGFP SW decorate cellular membranes and accumulate at cell poles during mitotic growth, we observed additional substantial vacuolar fluorescence upon nitrogen starvation to induce mating ( Fig 4A ). This vacuolar signal is likely the consequence of autophagy activation ( Berard et al., 2024 ; Kohda et al., 2007 ). The vacuolar signal appeared stronger in the mCherry SW strain. While this may be due in part to diRerences in stability and fluorescence of mCherry and sfGFP in the low pH of the vacuole, we measured lower mCherry SW than sfGFP SW signal at cell poles in starving cells, suggesting that the mCherry SW allele is more degraded ( Fig 4B ). To probe Cdc42 levels more directly, we raised anti-Cdc42 antibodies and compared total Cdc42 WT , Cdc42-mCherry SW and Cdc42-sfGFP SW levels by western blotting in vegetative and mating conditions ( Fig 4C ). The up-shifted band in the tagged strains demonstrates specificity of the antibody. Cdc42 WT and Cdc42-sfGFP SW levels were unchanged in vegetative and mating samples (despite the observed sfGFP vacuolar fluorescence). By contrast, the full-length Cdc42-mCherry SW band was significantly reduced in mating extracts. Note that the Cdc42-mCherry SW strain also showed a strong degradation product in both growth conditions. The size of this fragment, which is also detected by anti-RFP antibodies (see Fig 4E ), is consistent with a proteolytic cleavage in/near the Rho-insert domain. These observations suggest that the diRerential phenotypes of cdc42-mCherry SW and cdc42-sfGFP SW may stem from the lower levels of full-length Cdc42-mCherry SW . Download figure Open in new tab Figure 4: The fusion defect of cdc42-mCherry SW cells correlates with reduced Cdc42 protein levels (A) Representative images of Cdc42-sfGFP SW and Cdc42-mCherry SW in cells during mitotic growth and nitrogen starvation (mating conditions). (B) Quantification of Cdc42 SW abundance at cell poles during starvation, normalized to total fluorescence during mitotic growth, n≥15. (C) Western blot of Cdc42 protein in indicated strains in mitotic and mating conditions. (D) Cdc42-mCherry SW over- and under-expression with p act1 and p pom1 promoters respectively. Graph shows intensity quantification of whole cells, n≥16. (E) Western blot of Cdc42-mCherry SW protein levels when expressed under indicated promoters, probed with both anti-Cdc42 and anti-RFP antibodies. (F) Fusion eRiciency of cdc42-mCherry SW strains as in (D), N=3, n≥90 cells for each experiment. Mann-Whitney test p <0.0001: ****, p <0.001: ***. Scale bars = 2 µm (A); 5 µm (D). We next asked whether increasing the amounts of Cdc42-mCherry SW would rescue the fusion defective phenotype by over-expressing cdc42-mCherry SW under the strong p act1 promoter, which led to about 3-fold increase in fluorescence ( Fig 4D ). We also under-expressed cdc42-mCherry SW under the weaker p pom1 promoter. We verified by western blotting that the amounts of full-length Cdc42-mCherry SW were indeed increased, respectively decreased, during mating ( Fig 4E ). Over-expression of Cdc42-mCherry SW rescued the fusion defect, while under-expression made it worse compared to WT promoter p cdc42 ( Fig 4F ). These results strongly suggest that the low levels of Cdc42-mCherry SW during mating compromise cell fusion. cdc42 intron mutants with low protein levels and fusion defects In a screen for cdc42 viable alleles exhibiting mating defects, we identified three alleles which had no change in the cdc42 coding sequence but point mutations in cdc42 introns ( Fig 5A ). These mutants failed to produce spore progenies and were iodine-negative ( Fig 5B ). Insertion of a cdc42 genomic rescue construct (which includes wildtype introns) rescued sexual reproduction, confirming that the defect is linked to the identified point mutations ( Fig 5B ). In each of these mutants, a point mutation maps to predicted intron acceptor site or branch point in either the first or second cdc42 intron, suggesting they impair splicing, with likely consequence on protein levels ( Fig 5A ). Indeed, while we did not directly probe splicing, Cdc42 protein levels were vastly reduced on western blots ( Fig 5C ). During vegetative growth, each of these mutants was viable at 30°C, but showed temperature-sensitive growth defects at 36°C ( Fig 5D ). At 25°C, these mutants exhibited short cell length and increased width, but retained a rod shape, with a reduced aspect ratio ( Fig 5F ). Thus, very low levels of Cdc42 are suRicient to sustain viability, division and some level of polarized growth during mitotic proliferation. Download figure Open in new tab Figure 5: c d c42 intron mutants with low protein levels and fusion defects (A) Scheme of cdc42 gene showing location of intron mutations. The cdc42 A210G mutant also has a deletion of T503 in the second intron. (B) Iodine staining of indicated h90 strains with or without cdc42 genomic rescue construct. Dark color indicates presence of spores. (C) Western blot of Cdc42 protein levels during mating in intron mutants compared to WT. Similarly low levels are observed during mitotic growth (see Fig S3 ). (D) 10-fold serial dilution of indicated strains on YE plates grown at 30°C and 36°C. (E) Representative images of fusion-defective paired cells of intron mutant strains; p act1 -cdc42 T195C shows fused pair with a narrow neck. (F) Cell length and width measurements, n≥43, each dot on boxplot corresponds to one cell. In the boxplot, boxes comprise 25 th to 75 th percentiles with indicated median; whiskers extend to minimum and maximum value. The average aspect ratio (length to width ratio) is shown on top. (G) Pairing and (H) Fusion eRiciency of cdc42 intron mutants. N = 3, n≥96 cells for each experiment. Mann-Whitney test p <0.0001: ****, Scale bar = 2 µm. Download figure Open in new tab Figure S3: Uncropped western blots Reference to main figure panels is made on the figure. Please refer to the corresponding legend. During sexual reproduction, each of the three intron alleles showed reduced pairing eRiciency, indicative of reduced pheromone signaling and/or polarized growth, and completely blocked cell-cell fusion ( Fig 5E, 5G-H ). We attempted to overexpress the Cdc42 T195C mutant protein under the strong p act1 promoter, which led to increased pairing and fusion eRiciencies ( Fig 5G-H ), although the fused cell pairs showed an abnormal thin fusion neck ( Fig 5E ). This also restored thinner cell width ( Fig 5F ), but the strain remained temperature-sensitive for growth ( Fig 5D ), and we were unable to detect an increase in Cdc42 protein levels on western blots ( Fig 5C ). This suggests that Cdc42 levels were only mildly increased, perhaps due to very low levels of correctly spliced mRNA. Together these data further correlate low Cdc42 protein amounts with defects during mating and fusion, suggesting that these processes are more sensitive to Cdc42 levels. Mitotic cell polarization, mating and cell fusion require distinct levels of Cdc42 protein To directly test the importance of Cdc42 protein levels for its various cellular functions, we replaced the endogenous cdc42 promoter with promoters of varied strengths to obtain diRerent levels of protein expression. We initially used three weak promoters – p rga3 , p ypt1 and p pom1 – and the strong promoter p act 1 . We also constructed a control strain replacing the native promoter with p cdc42 (and selection marker). To obtain intermediate levels of Cdc42 expression, we subsequently inserted WT cdc42 under control of the p pom1 promoter at a distinct genomic locus, yielding strains with two cdc42 genes ( 2x p pom1 and p pom1 + p rga3 ). Western blots showed that Cdc42 levels increased in strains in the order p ypt1 ≅ p rga3 < p pom1 < p pom1 + p rga3 < 2X p pom1 < p cdc42 ≅ p act1 ( Fig 6A ). Quantification of relative protein levels showed that the lowest expression was < 20% that of endogenous promoter, with p pom1 and 2X p pom1 at ∼ 30% and ∼ 60% of endogenous levels, respectively ( Fig 6B ). Download figure Open in new tab Figure 6: Mitotic cell polarization, mating and cell fusion require distinct levels of Cdc42 protein (A) Western blot of Cdc42 protein levels when expressed under indicated promoters. Colored dots serve as legend to the graphs. (B) Quantification of Cdc42 levels from western blots as in (A). (C) 10-fold serial dilution of strains expressing cdc42 under indicated promoters on YE plates grown at 30°C and 36°C. Note temperature sensitivity of p rga3 -cdc42 . (D) Cell length and width of strains with varied Cdc42 expression levels, n≥57. The average aspect ratio (length to width ratio) is shown on top. (E-F) Linear relationship between cell length (E) or cell width (F) and Cdc42 protein levels, fitted with a linear regression model with 95% confidence interval. R 2 =0.95 for cell length; 0.76 for cell width. Bars indicate standard deviations. (G) CRIB-3GFP in strains expressing cdc42 under indicated promoters. (H) Quantification of CRIB intensity at poles in strains as in (G), n=20, (I) Representative image of strains where cdc42 is expressed under control of p pom1 , p pom1 + p rga3 or 2X p pom1 during mating. The arrowhead points to the narrow fusion neck. (J-K) Pairing (J) and fusion (K) eRiciency of h90 strains with varied Cdc42 expression levels. N = 3, n ≥ 205 cells for each experiment. Note that the fusion eRiciency of alleles with low mating eRiciency is based on observation of very few cell pairs. (L-M) Non-linear sigmoidal fit of pairing (L) and fusion (M) eRiciency with Cdc42 levels (Hill coeRicient = 21.51( R 2 =0.99 ) for pairing eRiciency and 12.06 ( R 2 =0.99 ) for fusion eRiciency). Mann-Whitney test p <0.0001: ****, p <0.001: ***, p <0.01: **, p 0.05: non-significant (ns). Scale bars = 2 µm. All strains were viable and grew well at all temperatures, except p rga3 -cdc42 , which was temperature sensitive at 36°C ( Fig 6C ). To explore the consequence of changing Cdc42 protein levels, we measured the cellular dimensions. All strains formed rod-shaped cells with aspect ratio ranging from ∼ 2 to ∼ 3.5, but their length was progressively smaller and their width larger as Cdc42 protein levels were reduced ( Fig 6D ). Indeed, plotting cell length against Cdc42 levels showed a linear relationship, well approximated by a linear fit (R 2 = 0.95), indicating that the amount of Cdc42 determines cellular extension ( Fig 6E ). We observed a similar relationship between Cdc42 levels and cell width but with a negative slope (R 2 = 0.76) ( Fig 6F ). We further used CRIB to estimate Cdc42-GTP levels at cell poles in a subset of strains ( Fig 6G ). Average measurement of CRIB levels at the two cell poles showed reduced amounts of Cdc42-GTP in the 2X p pom1 -cdc42 strain relative to WT, and further reduction in the strains with lower Cdc42 levels ( Fig 6H ). We conclude that Cdc42 protein levels define the amounts of Cdc42-GTP and quantitatively define cellular dimensions. Notably, across 5-fold reduction in Cdc42 levels, the cells adopt a rod shape of decreasing aspect ratio. Thus, across this range, Cdc42 is limiting for polarized cell growth, but not for viability. During sexual reproduction, strains with Cdc42 expressed under p cdc42 or p act1 promoters at WT levels showed normal pairing and 100% fusion eRiciency, whereas weak promoters ( p rga3 , p ypt1 , p pom1 ) completely prevented sexual reproduction ( Fig 6J ). In those strains, the very rare cell pairs that formed failed to fuse ( Fig 6K ). Interestingly, we observed a sharp step change between Cdc42 expression under p pom1 and twice this level (2X p pom1 ), where the 2X p pom1 strain was fully mating and fusion proficient. Intermediate Cdc42 levels, obtained by combining p rga3 and p pom1 , yielded cells able to pair like WT but with a partial fusion defect ( Fig 6K ). In this strain, pairs that successfully fused exhibited an abnormally narrow fusion neck ( Fig 6I ). The relationship between Cdc42 protein levels and function during sexual reproduction was well modelled by a sigmoidal curve with high Hill coeRicient ( Fig 6L-M ). Thus, the functions of Cdc42 in sexual reproduction are exquisitely sensitive to protein levels, with cell-cell fusion requiring slightly higher levels than sexual diRerentiation. Small variations in protein levels lead to an all-or-none type of response, very distinct from the linear response observed for mitotic polarized cell growth. In summary, requirements for Cdc42 protein levels are distinct for its roles in viability, polarization, sexual diRerentiation and cell fusion. Notably, higher threshold levels are required for Cdc42 to promote cell-cell fusion. Discussion In this study, we describe a critical role for Cdc42 GTPase in cell-cell fusion, demonstrating that this role is conserved across organisms but its recruitment to the fusion site occurs through molecular connections that are evolutionarily divergent. In Schizosaccharomyces pombe , Cdc42 localizes in its active, GTP-loaded form at the fusion site, where it is concentrated by the actin fusion focus. Cdc42 is not required for actin fusion focus assembly but is critical at a late step for the consequent local cell wall digestion. We further trace the cause of the phenotype to a reduction in Cdc42 protein levels, providing three alternative genetic modifications of Cdc42 levels that all lead to cell fusion defects with minor eRect on its roles during mitotic growth. Higher protein levels are required for the roles of Cdc42 in cell fusion and sexual diRerentiation than in polarized cell growth and viability. Interestingly, Cdc42 protein levels produce a linear response for polarized cell growth but exhibit a step function during sexual reproduction, indicating distinct modes of regulation in these life stages. Role of Cdc42 GTPase for cell-cell fusion and specificity of cdc42 mutant alleles Cdc42 is a highly conserved small GTPase with a wide range of fundamental cellular functions. Previous work in S. cerevisiae had shown that functions of Cdc42 in cell-cell fusion are genetically separable from other functions ( Barale et al., 2006 ; Ydenberg et al., 2012 ). We now reach similar conclusions in S. pombe using distinct mutant alleles that strongly perturb or completely block cell-cell fusion but have no or minor eRects on the roles of Cdc42 for mitotic polarized growth. The cdc42 mutant alleles with fusion defects all have in common a reduction in protein levels but vary in the reason behind this reduction. The cdc42-mCherry SW allele provides the clearest separation of function, as these cells show no defect in cell polarization ( Bendezu et al., 2015 ) but are strongly fusion defective. The main cause of the fusion defect is the reduction in Cdc42-mCherry SW protein levels during mating, which can be compensated for by over-expression. The cdc42-sfGFP SW allele, tagged at the same location with a diRerent fluorophore, leads to normal protein levels and is largely fusion-competent. However, its minor phenotype indicates that the presence of the tag also likely causes a slight hypomorphic protein function. We suspect that the diRerence in protein stability between the two alleles is linked to the diRerence in folding rates between the two fluorophores ( Balleza et al., 2018 ). In the Cdc42-mCherry SW -expressing strains, we observe a degradation product, with a size corresponding to a proteolytic cleavage in the Cdc42 Rho-insert domain, just before the site of mCherry insertion. While this proteolytic cleavage is observed even during mitotic growth, the high rates of autophagy during sexual reproduction (triggered by nitrogen starvation ( Berard et al., 2024 ; Kohda et al., 2007 )) may enhance it, leading to reduction in full-length protein levels. The high folding rate of sfGFP and ability to improve solubility of some fusion proteins ( Pedelacq et al., 2006 ) likely promotes Cdc42-sfGFP SW folding, making it resistant to proteolytic cleavage. The clearest demonstration that reduction of Cdc42 protein levels causes cell fusion defects is provided by the promoter exchange alleles. Notably cells expressing Cdc42 at ∼ 50% of native levels ( p pom1 + p rga3 ) can grow as rods and eRiciently form pairs during mating but show a partial fusion defect. The phenotype of this allele, which also exhibits short cell length during mitotic growth, is distinct from the normal cell dimensions of cdc42-mCherry SW cells and is explained by the fact that Cdc42 levels are, in this case, also reduced during mitotic growth. This allele clearly shows that higher protein levels are required for cells to fuse than to grow. The intron alleles show a very severe fusion block but also exhibit more complex phenotypes. These cells have reduced mating eRiciency and exhibit a temperature-sensitive growth defect. In this case, low protein levels likely result from post-transcriptional issues in splicing and possibly mRNA stability. The improvement in mating and fusion eRiciencies upon expression under the stronger p act1 promoter suggests that low levels indeed contribute to the phenotype. However, as we were unable to detect higher levels by western blot and the strain remained temperature-sensitive for growth, we suspect that there are additional causes to the observed phenotypes. Together, these three types of cdc42 alleles demonstrate that Cdc42 plays a key role in promoting cell fusion, which can be genetically separated from its function in promoting polarized cell growth, division and viability. Evolutionary divergence in using Cdc42 GTPase for cell-cell fusion Cdc42 GTPase is required for cell fusion in both S. cerevisiae and S. pombe . Together with the related GTPase Rac1 (absent in yeasts), it is also required for the fusion of myoblasts in mice and Drosophila ( Charrasse et al., 2007 ; Haralalka et al., 2011 ; Vasyutina et al., 2009 ). Rac1 is further involved in the fusion of myeloid cells ( Gonzalo et al., 2010 ). While these observations may at first glance suggest a common evolutionary origin, we find that the modes of Cdc42 GTPase localization/activation at the fusion site diverged between the two yeast species. In S. cerevisiae , Cdc42’s function in cell fusion requires its interaction with Fus2, a GEF-BAR domain protein, which forms dimers with Rvs161 ( Brizzio et al., 1998 ; Stein et al., 2015 ; Ydenberg et al., 2012 ). The model proposed is that Fus2-Rvs161 recognizes the flattening of the membrane upon contact between partner cells, leading to formation of a Cdc42 focus at this location ( Smith et al., 2017 ). In fission yeast, we show that Cdc42 does not localize through similar interaction, as there is no Fus2 homologue in this species and the specific residues required for interaction in S. cerevisiae are dispensable for Cdc42 function in S. pombe . Instead, Cdc42 is concentrated at the fusion site by the actin fusion focus. Our previous work in mitotic cells showed that Cdc42 local accumulation results from its local activation, as the Cdc42-GTP form is less mobile than the inactive Cdc42-GDP form ( Bendezu et al., 2015 ). The coordinated increase of Cdc42 and CRIB signals at the fusion site suggests a similar mechanism may be at play during cell fusion. Future work should examine whether and how Cdc42 activators are concentrated by the actin fusion focus. How does Cdc42 act on cell-cell fusion? By studying the cdc42-mCherry SW phenotype, we show that cells fail to fuse before cell wall digestion but after formation of the actin fusion focus. Indeed, in cdc42-mCherry SW cells that successfully fuse and can therefore be measured at comparable time as WT cells, Fus1, Myo52 and secretory vesicles marked by Ypt3 all form a focus of normal dimensions. If we consider cdc42-mCherry SW mutants that fail to fuse, we measure a small increase in the width of Fus1, Myo52 and secretory vesicle signals. However, this increase is unlike the widely spread signal observed in fus1Δ cells, in which the focus does not form ( Dudin et al., 2015 ), and more similar to that in prm1Δ cells, which block cell fusion after the function of the focus has promoted cell wall digestion ( Curto et al., 2014 ). Furthermore, we see no significant change in the distribution of Myo52 when cdc42-mCherry SW or cdc42-mCherry SW pak2Δ mutant cells are mated to WT cells. Thus, the minor changes in the width of the fusion focus in cells that fail to fuse are likely indirect consequences of the fusion failure, rather than then primary cell-intrinsic cause for failure. We conclude that, like in S. cerevisiae ( Ydenberg et al., 2012 ), Cdc42 acts a late stage after fusion focus formation. The significantly wider distribution of Prm1 in cdc42-mCherry SW cells (whether fusing or not) suggests that Cdc42 promotes the final steps of polarized secretion, after the cytoskeleton-dependent concentration of vesicles, for instance promoting exocyst function, or perhaps enhances endocytic retrieval to achieve a highly polarized distribution of cargoes. At the molecular level, the observation that pak2Δ cdc42-mCherry SW double mutants are fully fusion defective when single mutants have only partial defects demonstrates that Cdc42 does not (solely) function through the Pak2 kinase. Identifying the Cdc42 eRectors for cell-cell fusion is an important target for the future. In summary, the phenotypes of cdc42 mutants suggest the GTPase exerts similar post vesicle clustering functions to promote cell-cell fusion in budding and fission yeast. However, its accumulation at the fusion site occurs through distinct mechanisms. Distinct regulation of Cdc42 for mitotic growth and sexual reproduction Two interesting observations stem from our series of Cdc42 alleles expressed at levels ranging from 20% to 100% of endogenous levels. The first is that diRerent Cdc42 amounts are required for diRerent functions. Cells are viable with 20% of Cdc42, except at high temperatures; these cells are also clearly polarized, even if shorter than WT; they can initiate sexual reproduction with 50%; they can only successfully complete fusion with 60%. This suggests that Cdc42 activity is under stronger negative control for sexual reproduction, for instance under direct influence of the Rga3 GTPase activating protein ( Gallo Castro and Martin, 2018 ). Because Cdc42 is embedded in the pheromone-MAPK signaling during sexual reproduction, the multiple negative regulations that keep this pathway in check may also indirectly act on Cdc42, such as the Ras1 GAP ( Merlini et al., 2018 ) or pheromone degradation or receptor turnover, better studied in S. cerevisiae ( Sieber et al., 2023 ). Thus, a higher threshold of Cdc42 protein is required for sexual reproduction than for mitotic proliferation. A second interesting finding is that the shape of the biological response to changes in Cdc42 levels is diRerent for diRerent Cdc42 functions. Notably, for sexual reproduction, we observe a sharp phenotypic change between cells expressing 30% and 60% of WT Cdc42 levels, with a slightly higher level required for cell fusion than cell pair formation. Thus, a ∼ 2-fold change in protein levels yields an all-or-none response in sexual reproduction. By contrast, over the same concentration range, the polarized growth output of Cdc42 is linearly determined by Cdc42 levels. These observations show that Cdc42 global levels limit the pool of the active form, as observed by CRIB measurements. They also indicate that the topology of the Cdc42 regulatory network is distinct during mitotic growth and sexual reproduction. Cell fate decisions, such as those to engage in sexual reproduction and fuse, are typically binary. The exquisite sensitivity of these decisions on Cdc42 levels and the sharpness of the transition suggest an important role for Cdc42 and an ultrasensitive response to Cdc42 activity. Ultra-sensitivity usually involves strong cooperativity or positive feedback. For symmetry-breaking, a well-described scaRold-mediated positive feedback enhances Cdc42 local activity ( Lamas et al., 2020 ). A second double-negative feedback enhances zones of Cdc42 activity by displacing inhibitors through membrane flows ( Gerganova et al., 2021 ). Although these feedbacks have been observed during polarized growth, the linear response to Cdc42 levels suggests a diRerent regulatory regime where positive feedback does not dominate. Perhaps linearity stems from control of Cdc42 activity by microtubule-delivered polarity factors ( Kokkoris et al., 2014 ; Tay et al., 2018 ). During sexual reproduction, though this has not been directly examined, the two mentioned feedback loops likely also occur, but we must evoke additional positive feedback or cooperative mechanisms to explain the observed ultra-sensitivity. Notably, Cdc42 is under control of Ras1 GTPase, whose activator during mating is expressed in response to pheromone signaling ( Chang et al., 1994 ; Hughes et al., 1994 ; Kelsall et al., 2025 ; Lamas et al., 2020 ). As Cdc42 is thought to promote pheromone-MAPK signaling in part through PAK kinase activation ( Kelsall et al., 2025 ; Tu et al., 1997 ), this would constitute a second positive feedback loop linked to pheromone perception ( Khalili et al., 2018 ). To sum up, our study on Cdc42 protein levels reveals the requirement of distinct minimal levels for distinct functions and a hyper-sensitive response of sexual reproduction to Cdc42 concentration, inviting future investigations of its diRerential regulation across the life cycle. Materials and Methods Strain construction Standard genetic manipulation methods were used for S. pombe strain construction, by either transformation or tetrad dissection. All strains can be found in table S1, and plasmids in table S2. Sandwich alleles of cdc42 are as described in ( Bendezu et al., 2015 ). Gene tagging (GFP tagging of fus1 , myo52 , prm1 , exo70 ) was performed at endogenous genomic locus following PCR based gene targeting at the 3′ end, yielding C-terminally tagged proteins, as described in ( Bähler et al., 1998 ). GFP-Ypt3 protein was ectopically expressed in addition to the endogenous gene by transforming single integration vector pSM2366 ( 3′UTR ade6 -pnmt41-GFP-Ypt3-hphMX-5′UTR ade6 ) targeting the ade6 locus. Sec6-GFP tagged strains were produced by transforming linearized plasmid pSM3410 (pFA6a-Sec6-sfGFP-kanMX) which tags the endogenous locus of sec6 . Deletion of fus1 was done by transformation of linearized plasmid pSM3134 ( pFA6a-5’UTR fus1 -hphmX-3’UTR fus1 ) which replaced fus1 sequence with hphMX cassette. Deletion of prm1 was obtained by PCR based deletion by transforming PCR product amplified from pSM693 (pFA6a-hphMX6) with primers osm5913 (5’-GTTCTTTCGAAAATGTC TAAACAAAGAAATGCAAAA CCGTC TAACAC ATTTATTACAAGGCAGAGATCGAACAGCCTGTA CGGATCCCCGGGTTAATTAA-3’) and osm1816 (5’-GTGGAGGCGCTCCAACTCATTAGA TTTATTAAGCAGTTAAATTATCC AAAATGAAAAATTTAGAATCT ATGTAGA CTTGAATTCGAGCTCGTTTAAAC-3’). pak2 Δ was obtained from transformation of linearized plasmid pAV0220 ( pFA6a-5’UTR pak2 -hphmX-3’UTR pak2 ) which replaced pak2 sequence with hphMX cassette. Fusion marker mTagBFP2 was introduced by transforming linearized plasmid pSM2955 ( 5′UTR Lys3 -p map3 -mtagBFP2-bsdMX-3′UTR Lys3 ) into homothallic strains which integrates at lys3 locus. The screen yielding the cdc42 intron mutants was based on the marker reconstitution strategy, essentially as described in ( Tang et al., 2011 ). Briefly, we transformed mutagenic PCR products amplified from pSM3024 (cdc42-his5c + ) with primers osm1374 (GACGAAGCTCTTTCTAGAAGCGTAGT) and osm8302 (CGACTGCCTCCATAACTTCTGCATC) into a strain containing the other half of his5 inserted after cdc42 . Integrants were selected on EMM-ALU plates and screened by iodine staining for negative colonies. The cdc42 gene was sequenced and the following point mutations identified: cdc42 A210G : A210G in 1 st intron and T503-in 2 nd intron; cdc42 A701G : A701G in 2 nd intron and T1241C in 3’UTR; cdc42 T195C : T195C in 1 st intron (numbering from start of ORF). Mutants in cdc42 coding sequence obtained in the screen will be described elsewhere. Rescue was performed by transformation of PmeI-linearized pSM3114, containing 2.7kb of cdc42 genomic DNA starting 935bp upstream of START to 609 bp downstream of STOP, leading to integration at ade6 locus. Overexpression of intron mutant cdc42 T195C was obtained by integration of plasmid pFA6a-5′UTR cdc42 -p act1 -cdc42 T195C -natMX-3′UTR cdc42 linearized by restriction enzyme MscI at the cdc42 locus, replacing the native promoter. The allelic series was obtained by first producing integrating plasmids containing cdc42 full gene expressed under promoters p ypt1 , p rga3 , p pom1 , p cdc42 and p act1 . Infusion cloning was used to combine promoter fragments with cdc42 gene and the backbone which can be described as 5′UTR cdc42 -p promoter -cdc42-natMX-3′UTR cdc42 . Plasmids were linearized with MscI and integrated at the endogenous cdc42 locus, replacing the native promoter. 2X p pom1 and p pom1 + p rga3 were obtained by integrating a second copy of p pom1 -cdc42 at the ade6 locus using plasmid pSM3578 ( 5′UTR ade6 -p pom1 -cdc42-hphMX-3′UTR ade6 ). Cdc42 point mutations To introduce the D121A and D122A mutations, as well as other point mutations in cdc42 , we used the SpEDIT CRISPR protocol, as described ( Torres-Garcia et al., 2020 ). Briefly, for each site, we constructed a pSLB-based plasmid for expression of a guide RNA, whose PAM sequence was chosen to be as close as possible to the targeted mutation and with good on-(>60) and oR-target (>95) scores, for which we used Benchling tools ( https://www.benchling.com/ ). This was co-transformed with a template for homologous repair obtained from annealing and polymerase filling-in of two overlapping 80-nucleotide oligonucleotides, carrying the desired mutation and mutagenizing the PAM site with a silent mutation. Transformants were sequenced to verify cdc42 mutation. Growth conditions for imaging For microscopy, fission yeast cells are grown in minimal sporulation medium with 15mM glutamate as main nitrogen source (MSL Glutamate ), supplemented with appropriate amino acids. To evaluate cells during the mating process, either liquid or agar minimal sporulation medium lacking nitrogen (MSL-N) was utilized. Live cell imaging for mitotic phase was done on MSL Glutamate agarose pads and for mating phase MSL-N agarose pads were used. All strains for imaging were grown at 30°C unless diRerently indicated. Agarose pads were prepared following the protocol described in ( Vjestica et al., 2016 ). Sample preparation for imaging The precultures of S. pombe strains were grown in MSL Glutamate at a temperature of 30°C with two overnight back dilutions ensuring they remain logarithmic. Subsequently on the third day in morning, the cells (OD600 around 0.5-1) were transferred to MSL-N medium and subjected to three washing cycles with MSL-N to remove excess media. After washing, the cells were resuspended in 1ml of MSL-N to achieve a final OD600 of 1.5 and incubated at 30°C for a duration of 3 to 4 hours, the exact length of which depended on the specific mating stage to be visualized. Following incubation, the cells were mounted onto MSL-N agarose pads containing 2% electrophoresis-grade agarose and covered with a coverslip sealed with VALAP (1:1:1 Vaseline/lanolin/paraRin). Samples were allowed to rest for about 30min before imaging for overnight movies on Nikon ECLIPSE Ti2 microscope at room temperature (controlled at ∼23°C). For imaging mitotic cells, growth medium is MSL Glutamate and cells are grown at 30°C with two overnight back dilutions maintaining exponential growth. Sample preparation followed the above-mentioned steps were except the agarose pads were made with MSL Glutamate to sustain cell growth and division. Mating and Fusion eLiciency test For assessing mating eRiciency, strains were grown with two back dilutions in MSL Glutamate and washed with MSL-N three times on the morning of the third day. For each strain the final OD600 value was adjusted to 1 in 1ml of MSL-N medium. For all measures in Fig 5 and 6 , cells were starved at 30°C in MSL-N for 2 hours and centrifuged at 3000rpm and the pellet was resuspended in 10µl MSL-N and spotted in MSL-N plates. Plates were incubated at 25°C for 48 hours. For imaging the mating pairs, a tip was used to scrape oR a small mass from the spot and mixed in 10µl of MSL-N in an Eppendorf tube. Tubes were lightly vortexed to avoid cell clumps. 2µl of that mixture was put on slide to capture diRerential interference contrast (DIC) images of mating pairs. For each mating eRiciency test, a positive control of WT cells was done for comparison and for each strain mating eRiciency was measured on three diRerent days. For fusion eRiciency calculations, both the total number of mating pairs and the number of fused mating pairs were quantified. Fused mating pairs were identified in DIC images as asci containing ascospores or as zygotes (mating pairs lacking a residual cell wall between them). The data collected were then used to calculate fusion eRiciency as follows: fusion eRiciency = (number of fused mating pairs / total number of mating pairs) × 100; pairing eRiciency = (number of mating pairs × 2 / total number of cells) × 100 for each cross. For measures in Fig 2 , 4 and S1 , cells were treated as above but mounted on MSL-N agarose pads as described for imaging, which leads to an overall lower pairing eRiciency. Time-lapse imaging by epifluorescence microscopy Live cell time lapse imaging was performed using agarose pads sealed with VALAP on Nikon ECLIPSE Ti2 inverted microscope operated by the NIS Elements software (Nikon). Images were acquired using a Plan Apochromat Lambda 100X 1.45 NA oil objective and recorded using Prime BSI express sCMOS camera from Teledyne Vision Solutions. Autofocusing was performed using the Nikon Perfect Focus System for long term movies with multipoint acquisition on single z-plane (xy pixel size 0.65 x 0.65 μm). Exposure time and laser intensity were kept constant for every set of tagged protein imaging and each set subjected to 3-color imaging using fluorescence excitation at 405/488/561nm with the Lumencor SpectraX light engine (Chroma) in addition to DIC imaging with transmitted light. Image acquisition on confocal microscope Cells were imaged on a airyscan enabled Zeiss LSM980 confocal microscope fitted on an inverted Axio Observer 7 Microscope with an Airyscan2 detector optimized for a 63x/1.40 NA oil objective and laser lines 405 ( Fig 2D ) or 488nm and 561nm ( Fig 4A ), with 1.5X digital zooming. Scanning was performed sequentially (x-y, 1024 pixels x 1024 pixels, where each pixel corresponds to approximately 0.048 μm), pinhole size was 1 AU, pixel depth was 16 bits, line averaging was set to 4, and scan speed of 8. ZEN Blue software was used for image acquisition and processing. Quantification of fluorescence intensity over time All image visualization and processing were done with ImageJ/Fiji software (NIH, Bethesda, USA). Fluorescence intensity over time is measured for figures 1A and 1B. Images were treated for background subtraction followed by alignment to correct for stage drift using an in-house ImageJ macro ( https://github.com/Valentine-Thomas/FusionFocus-Mapping ; Image_Processing/Centroid-detection_3channels ( Thomas et al., 2025 )). CRIB-3GFP and Cdc42-sfGFP SW intensity over time were measured using Myo52-mScarlet as a fiduciary marker in each cell pair where a 25pixel × 25pixel box was drawn on red channel displaying Myo52 signal and intensity values were recorded over time for both green and red channel until fusion pore opens. The time of fusion pore opening is identified by entry of the mTagBFP2 expressed in h+ cell into the h- mating pair, and denoted as t0 in the image panel and the graph plot. Intensity values for each cell pair is normalized from 0 to 1, and mean values with SD are plotted over time on the x-axis. Measurement of FWHM and area under curve at fusion focus Figures 1E , 3B and S2 show full w idth at h alf m aximum (FWHM) values and corresponding area under curve values which we use to indicate size of protein distribution and total protein amounts at the fusion focus. Time-lapse imaging was done using epifluorescence microscope Nikon ECLIPSE Ti2 for each strain for 12 hours to capture the entire fusion process and images were treated for background subtraction followed by alignment to correct for stage drift, as above. For cells that fused, quantifications were done two frames (frame rate is 5min) before t0 (i.e. 10 min before apparent fusion). For cells that did not fuse, we could not use fusion as reference time. As the protein signal at the fusion focus lasts for prolonged period and eventually disappears, we chose a frame when the signal is most prominent before its disappearance. The data fitting was done in semi-automated manner. After selection of the cell pairs, a 20-pixel wide straight line was drawn across the fusion focus (depicted in 1D) and the fluorescence profile extracted ( https://github.com/Valentine-Thomas/FusionFocus-Mapping ; Spot_Width_Measure/line-profile.ijm ( Thomas et al., 2025 )). A MATLAB program (Supplement 1) was used to fit the extracted profiles to a gaussian function: , where, A is Amplitude, µ is mean and σ is standard deviation. The area under the curve was calculated from: . FWHM was measured from σ values of each fit with the formula: FWHM = . Cell dimension quantification For Fig 5F and 6D , we used asynchronous, exponentially growing cells in MSL Glutamate and prepared agarose pads for imaging. We captured DIC images using Nikon Ti2-E microscope. An automated segmentation pipeline was used to produce cell masks, in which we detected perpendicular long (cell length) and short (cell width) axes. Sample sizes are indicated in the figure legend. CRIB-3GFP quantification at cell poles Asynchronous, exponentially growing CRIB-GFP-expressing cells in MSL Glutamate were used for imaging by epifluorescence in Fig 6G-H . Images were processed for background noise as above. ROIs were drawn manually with the segmented line tool in ImageJ, where the lines were 10pixels wide and covered the entire CRIB signal at the poles. Mean intensities were recorded from each cell pole and averaged for each cell. Sample size is indicated in the legend. Growth assay Growth assay to test viability of cdc42* strains was done by growing them in YE (yeast extract) rich medium with two back dilutions and ensuring they are logarithmic (OD600 0.5-1.0). For each strain OD was adjusted to 0.5 and 1:10 serially diluted in a 96 well plate. Strains were spotted on YE plates (5μl per spot) with a 96-pin replica plater. Plates were incubated at 18°C, 25°C, 30°C and 36°C for 48 hours before plates were scanned. Mutant cells grew well at 18°C and 25°C, and only 30°C and 36°C are shown in Fig 5B and 6C . Myo52 persistence time In Fig 3C , Myo52-GFP was imaged at 5 min interval by epifluorescence microscopy. The total time between first appearance of the Myo52 focus and its disappearance was recorded as persistence time for Myo52. For cell pairs that fused, this represents the length of the fusion process, from formation of the fusion focus until disappearance post-fusion. For cell pairs that did not fuse, this represents the lifetime of the focus before cells give up. Normalization of Cdc42-sfGFP SW and Cdc42-mCh SW levels at cell poles Cells were grown as described above for imaging in mitotic (+N) and mating phases (-N) and imaged by Airyscan microscopy. For quantification, intensities at the cell poles were measured during starvation as for CIRB-3GFP above. To normalize the fluorescence intensities of sfGFP and mCherry, we assumed that the total amount of tagged Cdc42 was the same in mitotic cells. We thus measured whole cell fluorescence intensities during mitotic growth and calculated mean values, which we used as normalization factor. Normalized Cdc42 fluorescence at cell pole = cell pole intensity value during mating/mean intensity value from whole cell during mitotic growth. Graph is shown in 4B. Statistical analyses Statistical analysis was conducted using GraphPad Prism version 10.0. The specific statistical tests applied for each analysis are detailed in the corresponding figure legends. Experimental conditions for cell culture and Protein extraction for Western Blotting Pre-cultures were incubated in 20 ml of MSL Glutamate or 20 ml of YE medium (for extracts from mating and vegetatively growing cells, respectively) at 25°C for 8 h with shaking at 180 rpm. In the evening, cultures were diluted to an [O.D.]600nm of 0.02–0.04 in 80 ml of the respective media. By the next morning, vegetatively growing cells reaching an [O.D.]600nm of 0.6–0.8 were used directly for extraction. The cells grown in MSL Glutamate upon reaching a similar [O.D.]600nm were washed three times in 10 ml of MSL-N, resuspended in 30 ml of MSL-N, and incubated at 25°C for 5–6 h of mating before protein extraction. For protein extraction, ice-cold 100% (w/v) trichloroacetic acid (TCA) was added to cell cultures, reaching a final concentration of 10% (w/v), essentially as described ( Berard et al., 2024 ). Cells were pelleted by centrifugation at 1,000 × g for 2 minutes at 4°C, followed by a wash with 5 mL of pre-chilled (−20°C) acetone. The pellet was then washed with 1 mL of lysis buRer (2% SDS, 10% glycerol, 50 mM Tris-HCl, 0.2 M EDTA, and complete protease inhibitor cocktail tablets (Roche, 11836145001)). After washing, cells were resuspended in 400 μL lysis buRer. Cell lysis was performed by adding acid-washed glass beads (Sigma, G8772) and disrupting cells using a MagNA Lyser bead beater (Roche) for four cycles of 45 seconds at 6,500 rpm, with 30-second intervals between cycles. Lysates were centrifuged at maximum speed for 5 minutes at 4°C, and the supernatant was collected as the protein fraction. Protein concentration was quantified using the Bradford assay (Bradford, 1976). For further processing, samples were rapidly thawed and heated at 65°C in 4X NuPAGE LDS sample buRer (Invitrogen, NP0007) for 15’. β-Mercaptoethanol (1 μL per 20 μL sample) was then added, and samples were incubated at room temperature for 10’ before either storage at −20°C or immediate use for SDS-PAGE. Western Blotting 30 μg of protein were loaded onto 4%–20% acrylamide gels (GenScript, M00656) and electrophoresed at 100 V for 2 hours using commercial Tris-MOPS-SDS running buRer (GenScript, M00138). Proteins were transferred onto a nitrocellulose membrane (Cytiva, 10600002) using a homemade transfer buRer (50 mM Tris base, 38 mM glycine, 1% SDS) supplemented with 20% ethanol at 100 V for 2 hours. Membranes were then blocked for 1 h in TBST containing 5% milk and incubated overnight in TBST with 5% milk and primary antibodies. Rabbit anti-Cdc42 antibody (raised against S. pombe Cdc42 peptides NH2-CARQHQHPLTHEQGER-CONH2 and NH2-CVAALDPPVPHKKKSK-COOH; Covalab) was used at a 1:2000 dilution. Mouse anti-RFP monoclonal antibody (Chromotek, mouse 6G6-100) was used at a 1:2000 dilution. Following primary antibody incubation, membranes were washed three times in TBST (15 minutes per wash) and incubated for 1 hour with HRP-conjugated anti-rabbit (Promega, W401B) or anti-mouse (Promega, W402B) secondary antibodies, diluted 1:3000 in TBST with 5% milk. Membranes were then washed three times in TBST (15 minutes per wash). For chemiluminescence detection, membranes were washed with equal volumes of Peroxide Solution (Thermo Fisher, 1859701) and Luminol Enhancer Solution (Thermo Fisher, 1859698). Chemiluminescent signals were captured using the Amersham™ ImageQuant™ 800 imaging system (Cytiva). All uncropped raw image files are available in Fig S3 . Image Analysis and Quantification for Western Blotting Quantification of signal intensities was performed using ImageJ. Raw TIFF images acquired from the Amersham imaging system were first converted to grayscale JPEG files. The processed images were then opened in ImageJ, to measure the Mean Gray Value of protein bands. The region of interest (ROI) was defined as the smallest area fitting the largest band in each row and was consistently applied to corresponding background measurements. To normalize intensity values, the recorded Mean Gray Values were inverted using the formula: 255 – X, where X represents the value obtained from ImageJ (with 255 being the maximum intensity in an 8-bit image). The net signal intensity for both protein bands and loading controls (Tubulin) was calculated by subtracting the inverted background intensity from the inverted band intensity. Normalized Cdc42 protein values were determined by first calculating the ratio of the net protein intensity to the net loading control intensity, and then normalizing all values to that of the wild-type control on the same blot. Author contributions The project was designed by SGM, who managed the project and provided supervision. SS did all experiments and quantifications, except for the following: AS did all western blots and contributed to the analysis of intron alleles, LM constructed the cdc42 allelic series, VV identified the intron mutants and constructed the mCherry to sfGFP swap strains and most CRISPR alleles, SGM did the experiments in Fig 2 , except 2D and 2F, and in Fig 4D and 4F . SS and SGM wrote the manuscript, which was reviewed by all authors. Conflict of interest declaration The authors declare that they have no conflict of interest. Acknowledgements We thank Wanlan Li and Valentine Thomas (UNIGE) for help with data analysis code, and Thomas Kozusnik (UNIL) for generating the cdc42 D121A mutant. This work was supported by an iGE3 PhD salary award to SS, a Swiss Government Excellence Scholarship to AS, and a Swiss National Science Foundation grant (310030_207909) and ERC Advanced Grant (SexYeast; 101019630) to SGM. References ↵ Adamo , J.E. , J.J. Moskow , A.S. Gladfelter , D. Viterbo , D.J. Lew , and P.J. Brennwald . 2001 . Yeast Cdc42 functions at a late step in exocytosis, specifically during polarized growth of the emerging bud . J Cell Biol . 155 : 581 – 592 . OpenUrl Abstract / FREE Full Text ↵ Adams , A.E. , D.I. Johnson , R.M. Longnecker , B.F. Sloat , and J.R. Pringle . 1990 . CDC42 and CDC43, two additional genes involved in budding and the establishment of cell polarity in the yeast Saccharomyces cerevisiae . J Cell Biol . 111 : 131 – 142 . OpenUrl Abstract / FREE Full Text ↵ Bähler , J. , J.Q. Wu , M.S. Longtine , N.G. Shah , A. McKenzie , 3rd . , A.B. Steever , A. Wach , P. Philippsen , and J.R. Pringle . 1998 . Heterologous modules for eRicient and versatile PCR-based gene targeting in Schizosaccharomyces pombe . Yeast . 14 : 943 – 951 . OpenUrl CrossRef PubMed Web of Science ↵ Balleza , E. , J.M. Kim , and P. Cluzel . 2018 . Systematic characterization of maturation time of fluorescent proteins in living cells . Nat Methods . 15 : 47 – 51 . OpenUrl CrossRef PubMed ↵ Barale , S. , D. McCusker , and R.A. Arkowitz . 2006 . Cdc42p GDP/GTP cycling is necessary for eRicient cell fusion during yeast mating . Mol Biol Cell . 17 : 2824 – 2838 . OpenUrl Abstract / FREE Full Text ↵ Bendezu , F.O. , and S.G. Martin . 2011 . Actin cables and the exocyst form two independent morphogenesis pathways in the fission yeast . Mol Biol Cell . 22 : 44 – 53 . OpenUrl Abstract / FREE Full Text ↵ Bendezu , F.O. , and S.G. Martin . 2013 . Cdc42 Explores the Cell Periphery for Mate Selection in Fission Yeast . Curr Biol . 23 : 42 – 47 . OpenUrl CrossRef PubMed ↵ Bendezu , F.O. , V. Vincenzetti , D. Vavylonis , R. Wyss , H. Vogel , and S.G. Martin . 2015 . Spontaneous Cdc42 polarization independent of GDI-mediated extraction and actin-based traRicking . PLoS Biol . 13 : e1002097 . OpenUrl CrossRef PubMed ↵ Berard , M. , L. Merlini , and S.G. Martin . 2024 . Proteomic and phosphoproteomic analyses reveal that TORC1 is reactivated by pheromone signaling during sexual reproduction in fission yeast . PLoS Biol . 22 : e3002963 . OpenUrl CrossRef PubMed ↵ Billault-Chaumartin , I. , O. Muriel , L. Michon , and S.G. Martin . 2022 . Condensation of the fusion focus by the intrinsically disordered region of the formin Fus1 is essential for cell-cell fusion . Curr Biol . 32 : 4752 – 4761 e4710. OpenUrl CrossRef PubMed ↵ Brizzio , V. , A.E. Gammie , and M.D. Rose . 1998 . Rvs161p interacts with Fus2p to promote cell fusion in Saccharomyces cerevisiae . J Cell Biol . 141 : 567 – 584 . OpenUrl Abstract / FREE Full Text ↵ Chang , E.C. , M. Barr , Y. Wang , V. Jung , H.P. Xu , and M.H. Wigler . 1994 . Cooperative interaction of S. pombe proteins required for mating and morphogenesis . Cell . 79 : 131 – 141 . OpenUrl CrossRef PubMed Web of Science ↵ Charrasse , S. , F. Comunale , M. Fortier , E. Portales-Casamar , A. Debant , and C. Gauthier-Rouviere . 2007 . M-cadherin activates Rac1 GTPase through the Rho-GEF trio during myoblast fusion . Mol Biol Cell . 18 : 1734 – 1743 . OpenUrl Abstract / FREE Full Text ↵ Cheng , X. , B.W. Mwaura , S.R. Chang StauRer , and M. Bezanilla . 2020 . A Fully Functional ROP Fluorescent Fusion Protein Reveals Roles for This GTPase in Subcellular and Tissue-Level Patterning . Plant Cell . 32 : 3436 – 3451 . OpenUrl Abstract / FREE Full Text ↵ Cherfils , J. , and M. Zeghouf . 2013 . Regulation of small GTPases by GEFs, GAPs, and GDIs . Physiol Rev . 93 : 269 – 309 . OpenUrl CrossRef PubMed ↵ Chiou , J.G. , M.K. Balasubramanian , and D.J. Lew . 2017 . Cell Polarity in Yeast . Annu Rev Cell Dev Biol . 33 : 77 – 101 . OpenUrl CrossRef PubMed ↵ Curto , M.A. , M.R. Sharifmoghadam , E. Calpena , N. De Leon , M. Hoya , C. Doncel , J. Leatherwood , and M.H. Valdivieso . 2014 . Membrane Organization and Cell Fusion During Mating in Fission Yeast Requires Multi-Pass Membrane Protein Prm1 . Genetics . ↵ Das , M. , T. Drake , D.J. Wiley , P. Buchwald , D. Vavylonis , and F. Verde . 2012 . Oscillatory Dynamics of Cdc42 GTPase in the Control of Polarized Growth . Science . 337 : 239 – 243 . OpenUrl Abstract / FREE Full Text ↵ Dudin , O. , F.O. Bendezu , R. Groux , T. Laroche , A. Seitz , and S.G. Martin . 2015 . A formin-nucleated actin aster concentrates cell wall hydrolases for cell fusion in fission yeast . J Cell Biol . 208 : 897 – 911 . OpenUrl Abstract / FREE Full Text ↵ Dudin , O. , L. Merlini , F.O. Bendezu , R. Groux , V. Vincenzetti , and S.G. Martin . 2017 . A systematic screen for morphological abnormalities during fission yeast sexual reproduction identifies a mechanism of actin aster formation for cell fusion . PLoS genetics . 13 : e1006721 . OpenUrl CrossRef ↵ Estravis , M. , S. Rincon , and P. Perez . 2012 . Cdc42 regulation of polarized traRic in fission yeast . Communicative & integrative biology . 5 : 370 – 373 . OpenUrl CrossRef PubMed ↵ Estravis , M. , S.A. Rincon , B. Santos , and P. Perez . 2011 . Cdc42 regulates multiple membrane traRic events in fission yeast . Tra\ic . 12 : 1744 – 1758 . OpenUrl ↵ Etienne-Manneville , S . 2004 . Cdc42--the centre of polarity . J Cell Sci . 117 : 1291 – 1300 . OpenUrl Abstract / FREE Full Text ↵ Gallo Castro , D. , and S.G. Martin . 2018 . DiRerential GAP requirement for Cdc42-GTP polarization during proliferation and sexual reproduction . J Cell Biol . 217 : 4215 – 4229 . OpenUrl Abstract / FREE Full Text ↵ Gerganova , V. , I. Lamas , D.M. Rutkowski , A. Vjestica , D.G. Castro , V. Vincenzetti , D. Vavylonis , and S.G. Martin . 2021 . Cell patterning by secretion-induced plasma membrane flows . Sci Adv . 7 : eabg6718 . OpenUrl CrossRef PubMed ↵ Ghose , D. , T. Elston , and D. Lew . 2022 . Orientation of Cell Polarity by Chemical Gradients . Annual review of biophysics . 51 : 431 – 451 . OpenUrl CrossRef PubMed ↵ Golding , A.E. , I. Visco , P. Bieling , and W.M. Bement . 2019 . Extraction of active RhoGTPases by RhoGDI regulates spatiotemporal patterning of RhoGTPases . eLife . 8 . ↵ Gonzalo , P. , M.C. Guadamillas , M.V. Hernandez-Riquer , A. Pollan , A. Grande-Garcia , R.A. Bartolome , A. Vasanji , C. Ambrogio , R. Chiarle , J. Teixido , J. Risteli , S.S. Apte , M.A. del Pozo , and A.G. Arroyo . 2010 . MT1-MMP is required for myeloid cell fusion via regulation of Rac1 signaling . Dev Cell . 18 : 77 – 89 . OpenUrl CrossRef PubMed ↵ Haralalka , S. , C. Shelton , H.N. Cartwright , E. Katzfey , E. Janzen , and S.M. Abmayr . 2011 . Asymmetric Mbc, active Rac1 and F-actin foci in the fusion-competent myoblasts during myoblast fusion in Drosophila . Development . 138 : 1551 – 1562 . OpenUrl Abstract / FREE Full Text ↵ Harris , K.P. , and U. Tepass . 2010 . Cdc42 and vesicle traRicking in polarized cells . Tra\ic . 11 : 1272 – 1279 . OpenUrl ↵ Hughes , D.A. , N. Yabana , and M. Yamamoto . 1994 . Transcriptional regulation of a Ras nucleotide-exchange factor gene by extracellular signals in fission yeast . J Cell Sci . 107 ( Pt 12 ): 3635 – 3642 . OpenUrl Abstract / FREE Full Text ↵ Johnson , D.I . 1999 . Cdc42: An essential Rho-type GTPase controlling eukaryotic cell polarity . Microbiol Mol Biol Rev . 63 : 54 – 105 . OpenUrl Abstract / FREE Full Text ↵ Kelsall , E.J. , A. Kimura , A. Vertesy , K. Straatman , M. Tariq , R. Gadea , C. Parmar , G. Schreiber , S. Randhawa , T.Y. Ida , C. Dominguez , E. Klipp , and K. Tanaka . 2025 . Constitutively active RAS prolongs Cdc42 signalling while attenuating MAPK signalling during fission yeast mating . bioRxiv :2025.2003.2006.641927. ↵ Khalili , B. , L. Merlini , V. Vincenzetti , S.G. Martin , and D. Vavylonis . 2018 . Exploration and stabilization of Ras1 mating zone: A mechanism with positive and negative feedbacks . PLoS Comput Biol . 14 : e1006317 . OpenUrl CrossRef PubMed ↵ Kohda , T.A. , K. Tanaka , M. Konomi , M. Sato , M. Osumi , and M. Yamamoto . 2007 . Fission yeast autophagy induced by nitrogen starvation generates a nitrogen source that drives adaptation processes . Genes Cells . 12 : 155 – 170 . OpenUrl CrossRef PubMed Web of Science ↵ Kokkoris , K. , D. Gallo Castro , and S.G. Martin . 2014 . The Tea4-PP1 landmark promotes local growth by dual Cdc42 GEF recruitment and GAP exclusion . J Cell Sci . 127 : 2005 – 2016 . OpenUrl Abstract / FREE Full Text ↵ Kuhn , S. , and M. Geyer . 2014 . Formins as eRector proteins of Rho GTPases . Small GTPases . 5 : e29513 . OpenUrl CrossRef PubMed ↵ Lamas , I. , L. Merlini , A. Vjestica , V. Vincenzetti , and S.G. Martin . 2020 . Optogenetics reveals Cdc42 local activation by scaRold-mediated positive feedback and Ras GTPase . PLoS Biol . 18 : e3000600 . OpenUrl CrossRef PubMed ↵ Lu , M.S. , and D.G. Drubin . 2020 . Cdc42 GTPase regulates ESCRTs in nuclear envelope sealing and ER remodeling . J Cell Biol . 219 . ↵ Martin , S.G . 2015 . Spontaneous cell polarization: Feedback control of Cdc42 GTPase breaks cellular symmetry . Bioessays . 37 : 1193 – 1201 . OpenUrl CrossRef PubMed ↵ Martin , S.G. , S.A. Rincon , R. Basu , P. Perez , and F. Chang . 2007 . Regulation of the formin for3p by cdc42p and bud6p . Mol Biol Cell . 18 : 4155 – 4167 . OpenUrl Abstract / FREE Full Text ↵ Melendez , J. , M. Grogg , and Y. Zheng . 2011 . Signaling role of Cdc42 in regulating mammalian physiology . J Biol Chem . 286 : 2375 – 2381 . OpenUrl Abstract / FREE Full Text ↵ Merlini , L. , B. Khalili , F.O. Bendezu , D. Hurwitz , V. Vincenzetti , D. Vavylonis , and S.G. Martin . 2016 . Local Pheromone Release from Dynamic Polarity Sites Underlies Cell-Cell Pairing during Yeast Mating . Curr Biol . 26 : 1117 – 1125 . OpenUrl CrossRef PubMed ↵ Merlini , L. , B. Khalili , O. Dudin , L. Michon , V. Vincenzetti , and S.G. Martin . 2018 . Inhibition of Ras activity coordinates cell fusion with cell-cell contact during yeast mating . J Cell Biol . 217 : 1467 – 1483 . OpenUrl Abstract / FREE Full Text ↵ Miller , P.J. , and D.I. Johnson . 1994 . Cdc42p GTPase is involved in controlling polarized cell growth in Schizosaccharomyces pombe . Mol Cell Biol . 14 : 1075 – 1083 . OpenUrl Abstract / FREE Full Text ↵ Ottilie , S. , P.J. Miller , D.I. Johnson , C.L. Creasy , M.A. Sells , S. Bagrodia , S.L. Forsburg , and J. ChernoR . 1995 . Fission yeast pak1+ encodes a protein kinase that interacts with Cdc42p and is involved in the control of cell polarity and mating . Embo J . 14 : 5908 – 5919 . OpenUrl CrossRef PubMed ↵ Pedelacq , J.D. , S. Cabantous , T. Tran , T.C. Terwilliger , and G.S. Waldo . 2006 . Engineering and characterization of a superfolder green fluorescent protein . Nat Biotechnol . 24 : 79 – 88 . OpenUrl CrossRef PubMed Web of Science ↵ Petersen , J. , D. Weilguny , R. Egel , and O. Nielsen . 1995 . Characterization of fus1 of Schizosaccharomyces pombe: a developmentally controlled function needed for conjugation . Mol Cell Biol . 15 : 3697 – 3707 . OpenUrl Abstract / FREE Full Text ↵ Pichaud , F. , R.F. Walther , and F. Nunes de Almeida . 2019 . Regulation of Cdc42 and its eRectors in epithelial morphogenesis . J Cell Sci . 132 . ↵ Rutkowski , D.M. , V. Vincenzetti , D. Vavylonis , and S.G. Martin . 2024 . Cdc42 mobility and membrane flows regulate fission yeast cell shape and survival . Nat Commun . 15 : 8363 . OpenUrl CrossRef PubMed ↵ Sieber , B. , J.M. Coronas-Serna , and S.G. Martin . 2023 . A focus on yeast mating: From pheromone signaling to cell-cell fusion . Semin Cell Dev Biol . 133 : 83 – 95 . OpenUrl CrossRef PubMed ↵ Smith , J.A. , A.E. Hall , and M.D. Rose . 2017 . Membrane curvature directs the localization of Cdc42p to novel foci required for cell-cell fusion . J Cell Biol . 216 : 3971 – 3980 . OpenUrl Abstract / FREE Full Text ↵ Stein , R.A. , J.A. Smith , and M.D. Rose . 2015 . An Amphiphysin-Like Domain in Fus2p Is Required for Rvs161p Interaction and Cortical Localization . G3 . 6 : 337 – 349 . OpenUrl ↵ Tang , X. , J. Huang , A. Padmanabhan , K. Bakka , Y. Bao , B.Y. Tan , W.Z. Cande , and M.K. Balasubramanian . 2011 . Marker reconstitution mutagenesis: a simple and eRicient reverse genetic approach . Yeast . 28 : 205 – 212 . OpenUrl CrossRef PubMed ↵ Tatebe , H. , K. Nakano , R. Maximo , and K. Shiozaki . 2008 . Pom1 DYRK regulates localization of the Rga4 GAP to ensure bipolar activation of Cdc42 in fission yeast . Curr Biol . 18 : 322 – 330 . OpenUrl CrossRef PubMed ↵ Tay , Y.D. , M. Leda , A.B. Goryachev , and K.E. Sawin . 2018 . Local and global Cdc42 GEFs for fission yeast cell polarity are coordinated by microtubules and the Tea1/Tea4/Pom1 axis . J Cell Sci . 131 : jcs216580 . OpenUrl Abstract / FREE Full Text ↵ Thomas , V. , H. Mase , L. Michon , A. Picco , M. Kaksonen , and S.G. Martin . 2025 . High resolution mapping of the actin fusion focus reveals myosin V-dependent transport of formin for actin aster compaction . bioRxiv :2025.2004.2029.651207. ↵ Torres-Garcia , S. , L. Di Pompeo , L. Eivers , B. Gaborieau , S.A. White , A.L. Pidoux , P. Kanigowska , I. Yaseen , Y. Cai , and R.C. Allshire . 2020 . SpEDIT: A fast and eRicient CRISPR/Cas9 method for fission yeast . Wellcome Open Res . 5 : 274 . OpenUrl CrossRef PubMed ↵ Tu , H. , M. Barr , D.L. Dong , and M. Wigler . 1997 . Multiple regulatory domains on the Byr2 protein kinase . Mol Cell Biol . 17 : 5876 – 5887 . OpenUrl Abstract / FREE Full Text ↵ Tu , H. , and M. Wigler . 1999 . Genetic evidence for Pak1 autoinhibition and its release by Cdc42 . Mol Cell Biol . 19 : 602 – 611 . OpenUrl Abstract / FREE Full Text ↵ Valencia , A. , P. Chardin , A. Wittinghofer , and C. Sander . 1991 . The ras protein family: evolutionary tree and role of conserved amino acids . Biochemistry . 30 : 4637 – 4648 . OpenUrl CrossRef PubMed Web of Science ↵ Vasyutina , E. , B. Martarelli , C. Brakebusch , H. Wende , and C. Birchmeier . 2009 . The small G-proteins Rac1 and Cdc42 are essential for myoblast fusion in the mouse . Proc Natl Acad Sci U S A . 106 : 8935 – 8940 . OpenUrl Abstract / FREE Full Text ↵ Vjestica , A. , L. Merlini , O. Dudin , F.O. Bendezu , and S.G. Martin . 2016 . Microscopy of Fission Yeast Sexual Lifecycle . J. Vis. Exp . ↵ Vjestica , A. , L. Merlini , P.J. Nkosi , and S.G. Martin . 2018 . Gamete fusion triggers bipartite transcription factor assembly to block re-fertilization . Nature . 560 : 397 – 400 . OpenUrl CrossRef PubMed ↵ Wei , B. , B.S. Hercyk , N. Mattson , A. Mohammadi , J. Rich , E. DeBruyne , M.M. Clark , and M. Das . 2016 . Unique spatiotemporal activation pattern of Cdc42 by Gef1 and Scd1 promotes diRerent events during cytokinesis . Mol Biol Cell . 27 : 1235 – 1245 . OpenUrl Abstract / FREE Full Text ↵ Wu , C.F. , and D.J. Lew . 2013 . Beyond symmetry-breaking: competition and negative feedback in GTPase regulation . Trends Cell Biol . 23 : 476 – 483 . OpenUrl CrossRef PubMed Web of Science ↵ Ydenberg , C.A. , R.A. Stein , and M.D. Rose . 2012 . Cdc42p and Fus2p act together late in yeast cell fusion . Mol Biol Cell . 23 : 1208 – 1218 . OpenUrl Abstract / FREE Full Text View the discussion thread. Back to top Previous Next Posted May 06, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following High levels of Cdc42 GTPase underlie an all-or-none decision to fuse Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share High levels of Cdc42 GTPase underlie an all-or-none decision to fuse Sajjita Saha , Aiswarya Sajeevan , Laura Merlini , Vincent Vincenzetti , Sophie G Martin bioRxiv 2025.05.05.652171; doi: https://doi.org/10.1101/2025.05.05.652171 Share This Article: Copy Citation Tools High levels of Cdc42 GTPase underlie an all-or-none decision to fuse Sajjita Saha , Aiswarya Sajeevan , Laura Merlini , Vincent Vincenzetti , Sophie G Martin bioRxiv 2025.05.05.652171; doi: https://doi.org/10.1101/2025.05.05.652171 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Cell Biology Subject Areas All Articles Animal Behavior and Cognition (7636) Biochemistry (17704) Bioengineering (13898) Bioinformatics (41967) Biophysics (21460) Cancer Biology (18599) Cell Biology (25525) Clinical Trials (138) Developmental Biology (13384) Ecology (19909) Epidemiology (2067) Evolutionary Biology (24326) Genetics (15613) Genomics (22512) Immunology (17740) Microbiology (40423) Molecular Biology (17191) Neuroscience (88645) Paleontology (667) Pathology (2835) Pharmacology and Toxicology (4825) Physiology (7646) Plant Biology (15158) Scientific Communication and Education (2046) Synthetic Biology (4302) Systems Biology (9825) Zoology (2271)