NHEJ and HDR occurring simultaneously during gene integration into the genome of Aspergillus niger

preprint OA: closed
Full text JSON View at publisher
Full text 104,372 characters · extracted from preprint-html · click to expand
NHEJ and HDR occurring simultaneously during gene integration into the genome of Aspergillus niger | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article NHEJ and HDR occurring simultaneously during gene integration into the genome of Aspergillus niger Susanne Fritsche, Aline Reinfurt, Felix Fronek, Matthias G. Steiger This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4313903/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 05 Aug, 2024 Read the published version in Fungal Biology and Biotechnology → Version 1 posted 11 You are reading this latest preprint version Abstract Non-homologous end joining (NHEJ) and homology-directed repair (HDR) are two mechanisms in filamentous fungi to repair DNA damages. NHEJ is the dominant response pathway to rapidly join DNA double-strand breaks, but often leads to insertions or deletions. On the other hand, HDR is more precise and utilizes a homologous DNA template to restore the damaged sequence. Both types are exploited in genetic engineering approaches ranging from knock-out mutations to precise sequence modifications. In this study, we evaluated the efficiency of a HDR based gene integration system designed for the pyrG locus of Aspergillus niger . While gene integration was achieved at a rate of 91.4%, we also discovered a mixed-type repair (MTR) mechanism with simultaneous repair of a Cas9-mediated double-strand break by both NHEJ and HDR. In 20.3% of the analyzed transformants the donor DNA was integrated by NHEJ at the 3’ end and by HDR at the 5’ end of the double-strand break. Furthermore, sequencing of the locus revealed different DNA repair mechanisms at the site of the NHEJ event. Together, the results support the applicability of the genome integration system and a novel DNA repair type with implication on the diversity of genetic modifications in filamentous fungi. DNA repair CRISPR/Cas9-mediated genome editing DNA modification homology-directed repair non-homologous end joining self-replicating plasmid palindrome Figures Figure 1 Figure 2 Figure 3 Introduction The filamentous fungus Aspergillus niger is an important cell factory in the biotech industry, which is used to produce organic acids such as citric and gluconic acid, as well as proteins, like glucoamylase or phytase [ 1 , 2 ]. Genetic engineering offers a powerful approach to enhance filamentous fungi in terms of their productivity as well as to minimize undesirable traits like side-product formation. These engineering approaches started in fungi by transforming plasmid [ 3 , 4 ] or cosmid DNA [ 5 ], which was introduced into the genome, relying on ectopic genome integration through non-homologous end joining (NHEJ). Additionally, homology-directed repair (HDR) using typically linear expression cassettes with homologous 5´and 3 ´ flanking regions were employed for genome deletions [ 6 ]. In Saccharomyces cerevisiae , DNA double-strand break repair is facilitated primarily via HR [ 7 ] and is mediated by the RAD52 epistasis group: RAD50, RAD51, RAD52, RAD54, RAD55, RAD57, RAD59, RFA1, MRE11, XRS2, and RDH54/TID1. This group of genes is highly conserved amongst eukaryotes, including A. niger [ 4 , 8 , 9 ]. However, the occurrence of HR events in A. niger was found to be low, standing at 1.78–7%, with NHEJ appearing to be the primary DNA repair mechanism [ 4 , 9 , 10 ]. The introduction of specific genetic modifications in A. niger is a challenging task due to this factor. Upon the deletion of NHEJ factors Ku70 ( kusA in A. niger ) and Ku80 ( kusB in A. niger ), the occurrence of HR significantly increased (65 ->80%) [ 9 , 10 ]. Through this, site-specific gene editing became more accessible and NHEJ deficient strains are thus used by many groups as a tool to enable targeted gene engineering. However, it needs to be considered that NHEJ deficient strains have a slightly higher mutation rate than wild type strains which is relevant if a strain is frequently passaged or kept in a continuous culture [ 11 ]. A homologous transformation system for A. niger based on the pyrG gene was described by van Hartingsveldt et al., 1987 [ 12 ]. It was found that the transformation frequency based on the pyrG gene was at least tenfold higher than the heterologous transformation system for A. niger using the amdS gene and argB gene of Aspergillus nidulans , and the pyr4 gene of Neurospora crassa [ 12 – 14 ]. Nødvig et al., 2015 [ 15 ] were the first to apply CRISPR/Cas9 [ 16 ] to several species of Aspergillus including A. niger . Since then, the usage of this system has been adapted and improved, for example, by finding suitable promoters for guide RNA expression based on 5S RNA [ 17 ] or tRNA promoters [ 18 ] and the topic was well reviewed [ 19 , 20 ]. In addition to CRISPR/Cas9 systems, alternative gene editing and integration tools for filamentous fungi are available. These include systems based on the Cre- loxP system involving site-specific recombination events [ 21 – 23 ] and the FLP/FRT system, which, similar to the Cre- loxP system, relies on site-specific recombination events [ 24 ]. Both strategies are recognized as efficient genetic engineering tools. However, the insertion of specific recombination sites into the genome is necessary and therefore, not scarless. In 2015 we proposed a toolkit for metabolic pathway construction and genetic engineering in A. niger [ 25 ]. This system consists of a modular vector construction system called GoldenMOCS, based on the Golden Gate cloning approach [ 26 ], and a gene integration system for A. niger using CRISPR/Cas9 and self-replicating plasmids. The GoldenMOCS platform enables the versatile integration of host-specific parts such as promoters, terminators and resistance cassettes, replication origins or genome integration loci to customize the plasmid to the needs of the experiment and the host cell to be modified. Parts libraries for other organisms like Pichia pastoris and Yarrowia lipolytica are available [ 27 , 28 ]. The fungal gene integration system uses a pyrG split-marker approach in combination with a transient Cas9 expression to enable selection on the integration event. For this approach, two plasmids are used that can be constructed with the GoldenMOCS pipeline: a Cas9/sgRNA-containing plasmid and a plasmid containing the integration cassette. The plasmids are co-transfomed into A. niger and can be transiently maintained in the fungal host using a size-reduced AMA1 version, which is readily lost after hygromycin selection is stopped. A special feature of the system is that the linear integration cassette can be released from the integration plasmid in vivo by Cas9 thereby the same gRNA/Cas9 complex is used to cut the plasmid and the genomic pyrG locus. Upon successful homologous recombination of the pyrG split-marker, uridine prototrophy is restored, which is exploited as a selection marker for the integration event. Due to the modular character of the GoldenMOCS system up to eight different expression cassettes can be integrated into the pyrG locus using this strategy. The strains obtained in this way most likely have the cassette correctly integrated into the pyrG locus, with a minimal screening effort [ 29 ]. In this study, we evaluate this integration system and its HDR efficiency at the targeted pyrG locus of A. niger and can confirm the previously reported high targeting efficiency of the system. In addition, we observed a novel mixed-type repair mechanism in which the double-strand break mediated by CRISPR/Cas9 was simultaneously repaired by HDR and on the other side of the integration cassette by NHEJ. Materials and Methods Strains A. niger strains ATCC 1015 [ 30 ] and the derivative industrial strain ACIB1 were used as parental strains for genomic integration studies. Parental strains were transformed with pCAS_gpyrG1 according to the protocol of Sarkari et al., 2017 [ 25 ] to obtain A. niger strains ATCC 1015 pyrG m1 and ACIB1 pyrG m1 , respectively. Plasmid construction and proliferation in E. coli The Golden Gate cloning system [ 31 ] was employed for plasmid construction. Vectors for gene integration at the pyrG locus (Additional File 1: Table S1 ) were assembled following the protocol outlined by Sarkari et al., 2017 [ 25 ] and harbored the integration cassettes with the sequences listed in Additional File 1: Text S1. Plasmid proliferation was performed in E. coli Top10, with transformants cultivated on LB agar supplemented with 50 µg/mL kanamycin, 100 µg/mL ampicillin, or 100 µg/mL hygromycin B. Transformation in A. niger and PCR verification Protoplast transformations of A. niger strains was conducted as previously described [ 32 ] using 0,4 mg/mL VinoTaste (Novozymes, Bagsværd, Denmark) in SMC as lysing enzymes. Transformants were selected on minimal medium plates containing 200 µg/mL hygromycin B. Purification of transformants involved three rounds of single colony isolation on selection medium: one round with hygromycin B (100 µg/mL) and two rounds on minimal medium alone. To verify the resulting transformants, three PCRs were performed on the genomic DNA using Q5 Polymerase (New England Biolabs, Ipswich, Massachusetts, USA). The Primers used for the verification PCRs are shown in Table 2 . Sequence analysis PCR products from gDNA were purified from a gel using HiYield ® PCR Clean-up/Gel Extraction Kit following the manufacture’s protocol. Sanger sequencing was performed by Microsynth, Balgach, Switzerland, using primers listed in Table 1 . For PCR verification primers of sets A – E were selected depending on the integrated cassette and are assigned in Additional File 2: Table S2 . Sequence analysis was performed using QIAGEN CLC Main Workbench 21. Table 1 Primer sequences for PCR verification of targeted genomic integration Purpose Primer name Sequence (5’-3’) PCR1 Set A pyrG_5’ out_fwd TTTTGGTTAGCACCTACGCTAGTCTATCAG cexA_rev GGAAGTCGGGGTGTGATTTCAG PCR1 Set B pyrG_5’ out_fwd TTTTGGTTAGCACCTACGCTAGTCTATCAG Tet-on_TcrgA_rev CGCGGCCGCATGATTCATGACGTATAT PCR1 Set C pyrG_5’ out_fwd TTTTGGTTAGCACCTACGCTAGTCTATCAG phkA_rev ATACGTCAACCGGTGAATAAGCCAC PCR1 Set D pyrG_5’ out_fwd TTTTGGTTAGCACCTACGCTAGTCTATCAG phkB_rev GTCTCGTGAGTAGTGGGGGTAG PCR1 Set E pyrG_5’ out_fwd TTTTGGTTAGCACCTACGCTAGTCTATCAG Xfspk_rev GGTGTTTCTGGTGCAAAATGAGATG PCR2 Set A cexA_fwd CTAGGCAATGGCTTTGGATGTATGTC pyrG_3’ out_rev CATCGGAAGCACAATGAGGCGAGTTT PCR2 Set B tetO7_fwd AAAAGTGAAAGTCGAGTTTACCACTCCCTATC pyrG_3’ out_rev CATCGGAAGCACAATGAGGCGAGTTT PCR2 Set C trpC_fwd CCATGCATGGTTGCCTAGTGAATGC pyrG_3’ out_rev CATCGGAAGCACAATGAGGCGAGTTT PCR3 pyrG_5’ out_fwd TTTTGGTTAGCACCTACGCTAGTCTATCAG pyrG_3’ out_rev CATCGGAAGCACAATGAGGCGAGTTT Sequencing pyrG_5’_seq_fwd TCAAGCTCTTATTGTGTCGTTCAAGATTTGTTCGTATG pyrG_5’_seq_fwd2 GACTAATTCTCCGGATGTT PgpdA_seq_rev GCTTCACATTCTCCTTCGCTTACTG Results To evaluate the genomic integration efficiency of the system introduced by Sarkari et al., 2017 [ 25 ], 33 different integration cassettes with sizes from 3556 to 8898 bp were transformed. The cassettes differed in promoter and coding sequences while the terminator sequence, the homologous arms for HDR of the targeted pyrG locus, and the transformation vector remained the same (Additional File 2: Table S2 ). In total, the integration profile at the pyrG locus of 140 transformants was analyzed by three PCR reactions: PCR1 amplified the fragment from the pyrG 5’ region to the integration cassette. With PCR2, a fragment ranging from the integration cassette to the pyrG 3’ region was obtained and PCR3 covered the entire pyrG locus. Table 2 provides a classification of the integration events based on the PCR results. In summary, in 128 of 140 tested transformants the genomic integration of the cassette was confirmed. Twelve potential transformants were excluded from the analysis as five were found to contain a heterokaryon, for three strains it was not possible to obtain all test PCRs and four strains showed the wild-type PCR fragments. Probably due to contamination with uridine prototrophic wild-type strains. Overall, an integration efficiency of 91.4% could be achieved. Interestingly, transformants with cassette integration could be divided into two groups depending on the PCR result: In 102 transformants, the fragment length after PCRs of the integration site was as expected, indicating targeted HDR on both sites of the cassette. However, in 26 cases (20.3%) PCR1 and PCR3 showed fragments longer than expected. While PCR2 showed the expected amplicon length in all 26 cases, indicating correct HDR on the 5’ end of the double-strand break. Table 2 Genomic integration efficiency of A. niger strains PCR verification result Number of transformants % Transformants screened 140 100 Cassette integration at pyrG locus 128 91.4 Heterokaryotic 5 3.6 Non-conclusive PCR result 3 2.1 No cassette integration 4 2.9 To explain the unexpected mutation outcome, the DNA profile at the 3’ end of the CRISPR/Cas9 mediated double-strand break was analyzed by Sanger sequencing. Simultaneous repair of a double-strand break by both, non-homologous end joining and homologous recombination Analysis of the genome integration site revealed two distinct integration events of the cassettes during repair of the double-strand break, as shown in Fig. 1 . Initially, the Cas9-sgRNA complex facilitated a cut at the pyrG gene upstream from the nonsense mutation (Fig. 1 A). The co-transformed donor DNA was flanked with homologous arms on both sites of the integration cassette (Fig. 1 B). In one class of analyzed transformants, the homologous arms flanking the DNA fragment facilitated the expected HDR of the lesion by a double cross-over event. In the second class representing 20.3% of the transformants, the DNA fragment was inserted by a distinct repair mechanism at each site of the double-strand break: At the 5' end, the DNA fragment was introduced as expected by homologous recombination, thus the INDEL mutation was repaired resulting in uridine prototrophy. However, the 5’-flanking sequence of the DNA fragment was inserted by NHEJ (Fig. 1 C). Because of the simultaneous occurrence of both repair mechanisms, NHEJ and HDR, we refer to a mixed-type repair (MTR) mechanism in the following. A detailed description of mixed-type repair (MTR) is provided for the integration of an inducible expression cassette at the pyrG locus of A. niger ATCC 1015. The core of the integration construct consists of a tet-on promoter [ 33 ] and the heterologous coding sequence of Xfspk, a phosphoketolase from Bifidobacterium longum [ 34 ], that is followed by the trpC terminator. Upstream, the cassette is flanked with the homologous sequence of the pyrG promoter region (ASPNIDRAFT2_1163268) and 119 bp and 73 bp of its 5’ and 3’ region, respectively. Downstream of the cassette, the sequence is a truncated version of the pyrG gene ( pyrG m2,trunc , 679 bp) under the control of the coxA promoter. PyrG m2,trunc is homologous to the genomic sequence after where the Cas9 has facilitated the double-strand break [ 16 ]. The integration system is designed to facilitate a double-strand break after the seventh base pair of the startcodon ATG of the pyrG gene. Notably, the 3’ end of the genomic dsDNA ends with the nucleotides 5’-TCCTCCA (Fig. 2 A). Three individual clones transformed with the expression cassette tet-on:xfspk:trpC were analyzed: In the first case, the integration cassette recombined with the genomic DNA by the expected double cross-over event, thus restoring the uridine prototrophy. The successful integration was verified by three PCRs. PCR1-1 amplified 3793 bp upstream of the homologous region to the terminator crgA of the tet-on transactivator rtTA2S-M2. PCR2 covered 6841 bp from the tetO7 promoter to the region downstream of PyrG m2,trunc . PCR3-1 covered the entire integration cassette, including the respective up- and downstream regions (Fig. 2 B), which are 10692 bp. In the second case the expression cassette was integrated by MTR with two observed variations (Fig. 2 C). Both showed insertion of the cassette by homologous recombination of pyrG m2,trunc at the 5’ end of the double-strand break. The 3’ end, however, was repaired by end joining mechanisms: In clone 1, ending nucleotides of the additionally integrated 5’ homologous arm were 5’-TGGAGGA. This forms a palindromic sequence with 5’-TCCTCCA that are ending nucleotides at the double-strand break mediated by Cas9. Sequences are joined, and the amplicon of PCR1 is 1292 bp longer compared to the region after repair by homologous recombination. In clone 2, the 5’ end of the flanking arm of the donor DNA was shortened by 111 bp, and the ending nucleotides were 5’-ATACCGCCTAGTCAT. The double-strand break in the genome at the 3’ end was then repaired by NHEJ of the donor sequence. PCR1 thus amplified a fragment that is 1181 bp longer compared to the locus after HDR. Next, the hypothesis that occurrence of the mixed-type repair mechanism is dependent on the size of the construct was tested. All integration cassettes used for the transformation of A. niger strains were created with identical homologous flanking regions but inserts ranged from 3592 to 8898 bp. Therefore, a weighted linear regression analysis was performed (Additional File 3: Figure S1 ). Varying numbers of transformants were PCR analyzed for the respective construct sizes. Notably, 37 transformants with a 3592 bp cassette were investigated and 18.9% showed MTR. On the other hand, two transformants with integration of the longest construct of 8898 bp were tested and both showed MTR (100%). The weighted analysis shows a positive correlation between cassette length and the occurrence of MTR, however, this is not significant. Discussion In the filamentous fungus A. niger NHEJ and HDR are two major mechanisms for rejoining double-strand breaks. HDR leads to accurate repair of DNA damages by end resection to generate single-stranded DNA overhangs for the recombination event. The NHEJ pathway, however, suppresses end resection and promotes ligation of DNA strands. It is often accompanied by insertions or deletions (INDEL) at the repair site and it is the predominant fungal DNA damage response pathway [ 35 , 36 ]. In genetic engineering, HDR enables the introduction of precise genetic changes by the insertion of desired DNA sequences. NHEJ, on the other hand, allows efficient gene deactivations by the introduction of random mutations. So far, it is known that either NHEJ or HDR facilitates the repair of a DNA double-strand break in the genome. However, there is evidence that both pathways are activated concomitantly to provide genome integrity [ 37 ]. Over time, various genome-editing methods have been described and the advancement of CRISPR/Cas based systems has profoundly influenced modern genome engineering. The technology has been constantly developed and provides a tool base for enabling precise changes of DNA at a specific locus. On the other hand, the availability of various DNA repair mechanisms to the organisms and unknown molecular interaction has triggered unintended DNA modifications [ 38 ]. In filamentous fungi, these unexpected outcomes were reported as large deletions of off-target genes [ 39 ] or the action of multiple DNA repair pathways on the targeted locus [ 40 ]. Here, we report the discovery of a DNA repair mechanism initiated by a CRISPR/Cas9 integration tool that is linked to a selection system. The concept requires targeted repair of one end of the double-strand break but eventually allows other repair pathways on the second end of the DNA lesion. We observe a novel mixed-type repair (MTR) mechanism and describe the simultaneous DNA damage response of NHEJ and HDR, each acting on one particular end of a double-strand break. The 5’ end was always repaird by HDR which is enforced by the selection system for uridine prototrophy. In contrast, the 3’ end in 20.3% of observed integration events was repaired by NHEJ. We further demonstrate that DNA strands were either directly joined together or that the respective integration cassette was shortened prior to integration. Generally, Cas9 generates blunt ends at the cutting site [ 16 , 41 , 42 ] that is not only on the specific locus in the genome but also on the integrating plasmid. This facilitates the release of the integration cassette as a linearized DNA fragment after transformation. Because Cas9 cuts 3 nucleotides upstream of the PAM site 5’-AGG, these six nucleotides form the 3’ end of the double-strand break in the genome. In fact, the same nucleotides in an inverted manner remain also at the 5’ end of the homologous arm of the cassette released from the integrating plasmid. Consequently, a palindrome, where the sequence on the one strand is the reverse complement of the sequence on the other strand, is formed after the respective strands are joined (Fig. 3 A). Presumably, the end joining was mediated by the palindrome sequence itself. The double-strands of each DNA end separate and respective inverted repeats bind and convert to a four-way branch structure as shown in Fig. 3 B. In A. fumigatus it is reported that microhomology-mediated end joining (MMEJ), that employs microhomologous ends flanking the integration cassette, is a highly efficient repair mechanism of CRISPR/Cas9 mediated mutagenesis [ 43 ]. Our findings suggest that the utilization of flanks forming a palindrome to the ends of a double-strand break could therefore also enhance DNA integration. A similar mechanism proposed as an intermolecular model of palindrome formation was demonstrated in S. cerevisiae . Evidence was reported that an in vivo expressed endonuclease releases linear DNA fragments from two transformed plasmids harboring identical short inverted repeats of 42 bp near the cutting site. The findings suggest a 5′ to 3′ resection of DNA ends resulting in 3’ single overhangs that include the respective short inverted repeats. A homologous recombination event then mediates the ligation of the DNA strands [ 44 ]. In contrast, our system already generates DNA strands with the inverted repeats at the blunt ends that are joined without previous end resection and therefore suggests NHEJ as the acting mechanism, possibly mediated by the present palidrome. Our second analyzed case supports this outcome where the 5’ homologous arm of the integration cassette was shortened as a result of the NHEJ pathway and subsequently integrated into the genome. Overall, it still needs to be elucidated why NHEJ was favored over a HDR at this site. One possible explanation is the simultaneous activation of the HDR and NHEJ pathway and the design of the pyrG repair fragment. The crossing-over event with the truncated version of the pyrG ( pyrG m2,trunc ) simultaneously integrates the pcoxA promoter and ensures growth without uridine after this DNA damage response. The precise DNA repair on the 3’ end of the double-strand-break, which is the promoter region of pyrG , is however, not essential for growth. Therefore, NHEJ, the predominant form of double-strand break repair, can compete with HDR on this side of the DNA lesion. Conclusion and outlook In conclusion, the evaluation of the transformation system by Sarkari et al., 2017 confirmed that this integration pipeline enables efficient and flexible introduction of different expression cassettes at the pyrG locus of A. niger strains. It was also observed that the CRISPR/Cas9-mediated double-strand break can be repaired with a template DNA simultaneously by NHEJ and HDR pathways which is referred to as mixed-type repair (MTR). The MTR mechanism allows for an additional damage response through NHEJ, ensuring the stabilization of the double-strand break, while HDR, operating in parallel, provides the accuracy to repair the mutated pyrG gene. The results emphasize the need to further understand factors influencing the mixed-type DNA repair, especially the impact of the palindrome on the genome repair mechanism. Declarations Availability of data and materials All data generated or analysed during this study are included in this published article and its supplementary information files. The industrial strain ACIB1 is not publicly available. Ethics declarations Competing interests The authors declare that they have no competing interests. Funding The COMET center: acib: Next Generation Bioproduction is funded by BMK, BMDW, SFG, Standortagentur Tirol, Government of Lower Austria und Vienna Business Agency in the framework of COMET - Competence Centers for Excellent Technologies. The COMET Funding Program is managed by the Austrian Research Promotion Agency FFG. Authors' contributions MGS initiated this study which was jointly designed with SF. SF and FF performed cloning, transformation and PCR experiments with support from AR. Analysis of PCRs and sequences was done by SF with support from FF. Discussion of results was done by MFS, SF and AR. SF wrote the manuscript and prepared the figures with support of AR. MGS provided guidance and input throughout the preparation of the manuscript. All authors read, edited, and approved the manuscript before submission. Acknowledgements The authors want to thank Henrich Novotný and Nina Filmonova for their support in the lab. We also acknowledge Andreas Holzer for providing PCR data of transformants. Figures were created with BioRender.com. Figure 1 was adapted from “CRISPR/Cas9 Gene Editing”, by BioRender.com (2024). Retrieved from https://app.biorender.com/biorender-templates. References Cairns TC, Barthel L, Meyer V. Something old, something new: Challenges and developments in Aspergillus niger biotechnology. Essays Biochem. 2021;65:213–24. Karaffa L, Kubicek CP. Aspergillus niger citric acid accumulation: Do we understand this well working black box? Appl Microbiol Biotechnol. 2003;61:189–96. Punt PJ, Oliver RP, Dingemanse MA, Pouwels PH, van den Hondel CAMJJ. Transformation of Aspergillus based on the hygromycin B resistance marker from Escherichia coli . Gene. 1987;56:117–24. Krappmann S. Gene targeting in filamentous fungi: the benefits of impaired repair. Fungal Biol Rev. 2007;21:25–9. Yelton MM, Timberlake WE, Van den Hondel CAMJJ. A cosmid for selecting genes by complementation in Aspergillus nidulans : Selection of the developmentally regulated yA locus. Proc Natl Acad Sci U S A. 1985;82:834–8. Timberlake WE. Molecular genetics of Aspergillus developement . Annu Rev Genet. 1990;24:5–36. Boiteux S, Jinks-Robertson S. DNA repair mechanisms and the bypass of DNA damage in Saccharomyces cerevisiae . Genetics. 2013;193:1025–64. Symington LS. Role of RAD52 Epistasis Group Genes in Homologous Recombination and Double-Strand Break Repair . Microbiol Mol Biol Rev. 2002;66:630–70. Meyer V, Arentshorst M, El-Ghezal A, Drews AC, Kooistra R, van den Hondel CAMJJ, et al. Highly efficient gene targeting in the Aspergillus niger kusA mutant. J Biotechnol. 2007;128:770–5. Zhang J, Mao Z, Xue W, Li Y, Tang G, Wang A, et al. Ku80 gene is related to non-homologous end-joining and genome stability in Aspergillus niger . Curr Microbiol. 2011;62:1342–6. Álvarez-Escribano I, Sasse C, Bok JW, Na H, Amirebrahimi M, Lipzen A, et al. Genome sequencing of evolved aspergilli populations reveals robust genomes, transversions in A. flavus , and sexual aberrancy in non-homologous end-joining mutants. BMC Biol. 2019;17:1–17. van Hartingsveldt W, Mattern IE, van Zeijl CMJ, Pouwels PH, van den Hondel CAMJJ. Development of a homologous transformation system for Aspergillus niger based on the pyrG gene. MGG Mol Gen Genet. 1987;206:71–5. Kelly JM, Hynes MJ. Transformation of Aspergillus niger by the amdS gene of Aspergillus nidulans . EMBO J. 1985;4:475–9. Buxton FP, Gwynne DI, Davies RW. Transformation of Aspergillus niger using the argB gene of Aspergillus nidulans . Gene. 1985;37:207–14. Nødvig CS, Nielsen JB, Kogle ME, Mortensen UH. A CRISPR-Cas9 system for genetic engineering of filamentous fungi. PLoS One. 2015;10:1–18. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A Programmable Dual-RNA-guided DNA Endonuclease in Adaptive Bacterial Immunity. Science. 2012;337:816–22. Zheng X, Zheng P, Zhang K, Cairns TC, Meyer V, Sun J, et al. 5S rRNA Promoter for Guide RNA Expression Enabled Highly Efficient CRISPR/Cas9 Genome Editing in Aspergillus niger. ACS Synth Biol. 2018;8:1568–74. Song L, Ouedraogo J, Kolbusz M, Truc T, Nguyen M, Tsang A. Efficient genome editing using tRNA promoter-driven CRISP /Cas9 gRNA in Aspergillus niger . 2018;1–17. Schuster M, Kahmann R. CRISPR-Cas9 genome editing approaches in filamentous fungi and oomycetes. Fungal Genet Biol. 2019;130:43–53. https://doi.org/10.1016/j.fgb.2019.04.016 Shen J-Y, Zhao Q, He Q-L. Application of CRISPR in Filamentous Fungi and Macrofungi: from Component Function to Development Potentiality. Acs Synth Biol. 2023;12:1908–23. Xu Y, Shan L, Zhou Y, Xie Z, Ball AS, Cao W, et al. Development of a Cre-loxP-based genetic system in Aspergillus niger ATCC1015 and its application to construction of efficient organic acid-producing cell factories. Appl Microbiol Biotechnol. 2019;103:8105–14. Mizutani O, Masaki K, Gomi K, Iefuji H. Modified cre-loxp recombination in Aspergillus oryzae by direct introduction of Cre recombinase for marker gene rescue. Appl Environ Microbiol. 2012;78:4126–33. Zhang S, Ban A, Ebara N, Mizutani O, Tanaka M, Shintani T, et al. Self-excising Cre/mutant lox marker recycling system for multiple gene integrations and consecutive gene deletions in Aspergillus oryzae . J Biosci Bioeng. 2017;123:403–11. Kopke K, Hoff B, Kuck U. Application of the saccharomyces cerevisiae FLP/FRT recombination system in filamentous fungi for marker recycling and construction of knockout strains devoid of heterologous genes. Appl Environ Microbiol. 2010;76:4664–74. Sarkari P, Marx H, Blumhoff ML, Mattanovich D, Sauer M, Steiger MG. An efficient tool for metabolic pathway construction and gene integration for Aspergillus niger. Bioresour Technol. 2017;245:1327–33. https://doi.org/10.1016/j.biortech.2017.05.004 Engler C, Kandzia R, Marillonnet S. A one pot, one step, precision cloning method with high throughput capability. PLoS One. 2008;3:e3647. Prielhofer R, Barrero JJ, Steuer S, Gassler T, Zahrl R, Baumann K, et al. GoldenPiCS: A Golden Gate-derived modular cloning system for applied synthetic biology in the yeast Pichia pastoris . BMC Syst Biol. 2017;11:1–14. Egermeier M, Sauer M, Marx H. Golden Gate-based metabolic engineering strategy for wild-type strains of Yarrowia lipolytica . FEMS Microbiol Lett. 2019;366:1–9. Steiger MG, Rassinger A, Mattanovich D, Sauer M. Engineering of the citrate exporter protein enables high citric acid production in Aspergillus niger . Metab Eng. 2019;52:224–31. https://doi.org/10.1016/j.ymben.2018.12.004 Andersen MR, Salazar MP, Schaap PJ, van de Vondervoort PJI, Culley D, Thykaer J, et al. Comparative genomics of citric-acid-producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88. Genome Res. 2011;21:885–97. Engler C, Gruetzner R, Kandzia R, Marillonnet S. Golden Gate Shuffling: A One-Pot DNA Shuffling Method Based on Type IIs Restriction Enzymes. PLoS One. 2009;4:e5553. https://doi.org/10.1371/journal.pone.0005553 Arentshorst M, Lagendijk EL, Ram AF. A new vector for efficient gene targeting to the pyrG locus in Aspergillus niger. Fungal Biol Biotechnol. 2015;2:2–6. Meyer V, Wanka F, van Gent J, Arentshorst M, van den Hondel CAMJJ, Ram AFJ. Fungal gene expression on demand: An inducible, tunable, and metabolism-independent expression system for Aspergillus niger . Appl Environ Microbiol. 2011;77:2975–83. Hellgren J, Godina A, Nielsen J, Siewers V. Promiscuous phosphoketolase and metabolic rewiring enables novel non-oxidative glycolysis in yeast for high-yield production of acetyl-CoA derived products. Metab Eng. 2020;62:150–60. https://doi.org/10.1016/j.ymben.2020.09.003 Villalba F, Collemare J, Landraud P, Lambou K, Brozek V, Cirer B, et al. Improved gene targeting in Magnaporthe grisea by inactivation of MgKU80 required for non-homologous end joining. Fungal Genet Biol. 2008;45:68–75. Ninomiya Y, Suzuki K, Ishii C, Inoue H. Highly efficient gene replacements in Neurospora strains deficient for nonhomologous end-joining. Proc Natl Acad Sci U S A. 2004;101:12248–53. Kass EM, Jasin M. Collaboration and competition between DNA double-strand break repair pathways. FEBS Lett. 2010;584:3703–8. http://dx.doi.org/10.1016/j.febslet.2010.07.057 Huang J, Cook DE. The contribution of DNA repair pathways to genome editing and evolution in filamentous pathogens. FEMS Microbiol Rev. 2022;46:1–21. Foster AJ, Johnstone E, Saunders A, Colic E, Lassel N, Holmes J. Unanticipated Large-Scale Deletion in Fusarium graminearum Genome Using CRISPR/Cas9 and Its Impact on Growth and Virulence. J Fungi. 2023;9. Huang J, Rowe D, Subedi P, Zhang W, Suelter T, Valent B, et al. CRISPR-Cas12a induced DNA double-strand breaks are repaired by multiple pathways with different mutation profiles in Magnaporthe oryzae . Nat Commun. 2022;13:19–21. Sansbury BM, Hewes AM, Kmiec EB. Understanding the diversity of genetic outcomes from CRISPR-Cas generated homology-directed repair. Commun Biol. 2019;2:1–10. Zetsche B, Gootenberg JS, Abudayyeh OO, Slaymaker IM, Makarova KS, Essletzbichler P, et al. Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015;163:759–71. Zhang C, Meng X, Wei X, Lu L. Highly efficient CRISPR mutagenesis by microhomology-mediated end joining in Aspergillus fumigatus. Fungal Genet Biol. ;86:47–57. http://dx.doi.org/10.1016/j.fgb.2015.12.007 Butler DK, Gillespie D, Steele B. Formation of large palindromic DNA by homologous recombination of short inverted repeat sequences in Saccharomyces cerevisiae . Genetics. 2002;161:1065–75. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 05 Aug, 2024 Read the published version in Fungal Biology and Biotechnology → Version 1 posted Editorial decision: Revision requested 14 Jun, 2024 Reviews received at journal 08 Jun, 2024 Reviews received at journal 27 May, 2024 Reviews received at journal 23 May, 2024 Reviewers agreed at journal 07 May, 2024 Reviewers agreed at journal 06 May, 2024 Reviewers agreed at journal 03 May, 2024 Reviewers invited by journal 03 May, 2024 Submission checks completed at journal 02 May, 2024 Editor assigned by journal 02 May, 2024 First submitted to journal 23 Apr, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4313903","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":299815329,"identity":"00d41763-ef1b-49fa-b229-2d720db12f72","order_by":0,"name":"Susanne Fritsche","email":"","orcid":"","institution":"Austrian Centre of Industrial Biotechnology (Austria)","correspondingAuthor":false,"prefix":"","firstName":"Susanne","middleName":"","lastName":"Fritsche","suffix":""},{"id":299815330,"identity":"959a0672-6ae9-47d1-ba17-7eb0a6dfcd97","order_by":1,"name":"Aline Reinfurt","email":"","orcid":"","institution":"Austrian Centre of Industrial Biotechnology (Austria)","correspondingAuthor":false,"prefix":"","firstName":"Aline","middleName":"","lastName":"Reinfurt","suffix":""},{"id":299815331,"identity":"4fd7dcb7-2d53-4ce1-8430-a9648b3935b4","order_by":2,"name":"Felix Fronek","email":"","orcid":"","institution":"Austrian Centre of Industrial Biotechnology (Austria)","correspondingAuthor":false,"prefix":"","firstName":"Felix","middleName":"","lastName":"Fronek","suffix":""},{"id":299815332,"identity":"e2533f11-beac-46a8-b6df-0060d537d5cd","order_by":3,"name":"Matthias G. Steiger","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABLUlEQVRIie2Ov0vDQBTHXziIy0HWc6l/gfBCIShI+6/ccdDVbhYUDATSJTgL/hmCc8pBsgSy3iAYCTgrXYIEa9IfWuhZHAXzgTveu3sfvg+go+OPQgDXFW+Osyn2CFawUshq8jDcVuKflHXYEky2fw3K8TRPy/F4MAQnnxXF+9l5/ynyWDF5BGcaW/PXXcXLpBXcohQ+kwTFzej0IaEe49kLsIwTZkjx4kahSDgwYjMRKfQaRYtQAWgAo5KXrXLdLKYOKhEtsB+2yoeCIw2kMil6maIsH6QNvIoR7VbxFaAG25iiS/eOYipCJvtM+BJZMrqoeKKom4nwJDMtJoo5rS+HjjN7fqvqATqBunerK9XrpUrpya7yhd1eVvj9QJvW3yNsqH8x09HR0fHv+ASbI2kZ57NvGQAAAABJRU5ErkJggg==","orcid":"","institution":"Austrian Centre of Industrial Biotechnology (Austria)","correspondingAuthor":true,"prefix":"","firstName":"Matthias","middleName":"G.","lastName":"Steiger","suffix":""}],"badges":[],"createdAt":"2024-04-23 18:39:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4313903/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4313903/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s40694-024-00180-7","type":"published","date":"2024-08-05T15:57:53+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":56070197,"identity":"0441f0d3-0a65-4987-8865-b80aae311979","added_by":"auto","created_at":"2024-05-08 07:06:57","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1299710,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRepair mechanisms of a double-strand break by homology-directed repair and mixed-type repair in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. niger\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e (A) The 5' region of\u003cem\u003e pyrG\u003c/em\u003e is highlighted in light grey and the \u003cem\u003epyrG\u003c/em\u003e gene in dark grey. A mutation in the \u003cem\u003epyrG\u003c/em\u003e gene (red dot) leads to a uridine auxotroph strain. The cutting site of Cas9 is highlighted by the black line. (B) The double-strand break results in a 3’ end and a 5’ end and is upstream from the mutation of the \u003cem\u003epyrG\u003c/em\u003e gene. The donor template (orange) has flanks designed for a double crossover event. The blue flank is the sequence of the 5' region, and the dark grey flank is homologous to the \u003cem\u003epyrG\u003c/em\u003e gene, restoring the mutation. (C) The first integration mechanism is a homology-directed repair (HDR). The second integration form is a mixed-type repair (MTR) with a non-homologous end joining (NHEJ) event at the 3’ end and a HDR at the 5’ end of the double-strand break, respectively. The \u003cem\u003epyrG\u003c/em\u003e locus is restored for the direct selection of positive integration transformants on minimal medium without uridine.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4313903/v1/01a8465bb67167f902911779.png"},{"id":56070199,"identity":"b5422891-ca59-4ca8-9c89-26a607eacb8e","added_by":"auto","created_at":"2024-05-08 07:06:57","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":588642,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIntegration of an inducible expression cassette at the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003epyrG\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e locus by HDR and variants of MTR. \u003c/strong\u003e(A) Promoter region (light grey) and CDS (dark grey) of \u003cem\u003epyrG\u003c/em\u003e with Cas9-mediated double-strand break. PCR3 of the parental strain \u003cem\u003eA. niger\u003c/em\u003e pyrG\u003csup\u003em1\u003c/sup\u003e gives an amplicon with 4152 bp. The donor fragment consists of a 5’ flank homologous arm (blue), an inducible cassette for heterologous expression of the phosphoketolase Xfspk, followed by the promoter \u003cem\u003ecoxA\u003c/em\u003e (orange). The 3’ flanking sequence is a truncated \u003cem\u003epyrG\u003c/em\u003e CDS (dark grey). (B) Integration via HDR was verified by PCR1-1, PCR2, and PCR3-1 with amplicon sizes of 3793, 6841, and 10692 bp, respectively. (C) Integration via MTR with NHEJ on the 3’ end and HDR at the 5’ end of the double-strand break. In clone 1, NHEJ of sequences form a palindrome. In clone 2, the donor DNA is shortened by end resection prior to the NHEJ event. PCR1-2 and 3-2 are 5085 bp and 11984 bp for variant 1 and 4974 and 11873 bp for variant 2.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4313903/v1/f662db3e07260c9cec7ac0e3.png"},{"id":56070200,"identity":"38458e9f-2fe5-4d13-ad0b-f0496b106b46","added_by":"auto","created_at":"2024-05-08 07:06:57","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1465453,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eModel of double-strand break repair by formation of a palindrome.\u003c/strong\u003e (A) Two inverted repeats of seven nucleotides (5’TCCTCCA and 5’TGGAGGA) are adjacent to one another and after NHEJ form a palindrome. (B) Extrusion of double-strands results in branch migration and leads to the formation of four-way junction. Light grey and dark grey DNA strands represent the genomic DNA and the donor DNA, respectively.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4313903/v1/7545e1c0c6e9b705a2ac1816.png"},{"id":62298494,"identity":"07fef856-345f-406a-95a4-60bb43bd29ce","added_by":"auto","created_at":"2024-08-12 16:13:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3898918,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4313903/v1/37930ba4-e368-43fa-be80-d371bb68d814.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"NHEJ and HDR occurring simultaneously during gene integration into the genome of Aspergillus niger","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe filamentous fungus \u003cem\u003eAspergillus niger\u003c/em\u003e is an important cell factory in the biotech industry, which is used to produce organic acids such as citric and gluconic acid, as well as proteins, like glucoamylase or phytase [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Genetic engineering offers a powerful approach to enhance filamentous fungi in terms of their productivity as well as to minimize undesirable traits like side-product formation. These engineering approaches started in fungi by transforming plasmid [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] or cosmid DNA [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], which was introduced into the genome, relying on ectopic genome integration through non-homologous end joining (NHEJ). Additionally, homology-directed repair (HDR) using typically linear expression cassettes with homologous 5\u0026acute;and 3 \u0026acute; flanking regions were employed for genome deletions [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. In \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e, DNA double-strand break repair is facilitated primarily via HR [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] and is mediated by the RAD52 epistasis group: RAD50, RAD51, RAD52, RAD54, RAD55, RAD57, RAD59, RFA1, MRE11, XRS2, and RDH54/TID1. This group of genes is highly conserved amongst eukaryotes, including \u003cem\u003eA. niger\u003c/em\u003e [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. However, the occurrence of HR events in \u003cem\u003eA. niger\u003c/em\u003e was found to be low, standing at 1.78\u0026ndash;7%, with NHEJ appearing to be the primary DNA repair mechanism [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The introduction of specific genetic modifications in \u003cem\u003eA. niger\u003c/em\u003e is a challenging task due to this factor. Upon the deletion of NHEJ factors Ku70 (\u003cem\u003ekusA\u003c/em\u003e in \u003cem\u003eA. niger\u003c/em\u003e) and Ku80 (\u003cem\u003ekusB\u003c/em\u003e in \u003cem\u003eA. niger\u003c/em\u003e), the occurrence of HR significantly increased (65 -\u0026gt;80%) [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Through this, site-specific gene editing became more accessible and NHEJ deficient strains are thus used by many groups as a tool to enable targeted gene engineering. However, it needs to be considered that NHEJ deficient strains have a slightly higher mutation rate than wild type strains which is relevant if a strain is frequently passaged or kept in a continuous culture [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eA homologous transformation system for \u003cem\u003eA. niger\u003c/em\u003e based on the \u003cem\u003epyrG\u003c/em\u003e gene was described by van Hartingsveldt et al., 1987 [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. It was found that the transformation frequency based on the \u003cem\u003epyrG\u003c/em\u003e gene was at least tenfold higher than the heterologous transformation system for \u003cem\u003eA. niger\u003c/em\u003e using the \u003cem\u003eamdS\u003c/em\u003e gene and \u003cem\u003eargB\u003c/em\u003e gene of \u003cem\u003eAspergillus nidulans\u003c/em\u003e, and the \u003cem\u003epyr4\u003c/em\u003e gene of \u003cem\u003eNeurospora crassa\u003c/em\u003e [\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eN\u0026oslash;dvig et al., 2015 [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] were the first to apply CRISPR/Cas9 [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] to several species of \u003cem\u003eAspergillus\u003c/em\u003e including \u003cem\u003eA. niger\u003c/em\u003e. Since then, the usage of this system has been adapted and improved, for example, by finding suitable promoters for guide RNA expression based on 5S RNA [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] or tRNA promoters [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] and the topic was well reviewed [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn addition to CRISPR/Cas9 systems, alternative gene editing and integration tools for filamentous fungi are available. These include systems based on the Cre-\u003cem\u003eloxP\u003c/em\u003e system involving site-specific recombination events [\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] and the FLP/FRT system, which, similar to the Cre-\u003cem\u003eloxP\u003c/em\u003e system, relies on site-specific recombination events [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Both strategies are recognized as efficient genetic engineering tools. However, the insertion of specific recombination sites into the genome is necessary and therefore, not scarless.\u003c/p\u003e \u003cp\u003eIn 2015 we proposed a toolkit for metabolic pathway construction and genetic engineering in \u003cem\u003eA. niger\u003c/em\u003e [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. This system consists of a modular vector construction system called GoldenMOCS, based on the Golden Gate cloning approach [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], and a gene integration system for \u003cem\u003eA. niger\u003c/em\u003e using CRISPR/Cas9 and self-replicating plasmids. The GoldenMOCS platform enables the versatile integration of host-specific parts such as promoters, terminators and resistance cassettes, replication origins or genome integration loci to customize the plasmid to the needs of the experiment and the host cell to be modified. Parts libraries for other organisms like \u003cem\u003ePichia pastoris\u003c/em\u003e and \u003cem\u003eYarrowia lipolytica\u003c/em\u003e are available [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The fungal gene integration system uses a \u003cem\u003epyrG\u003c/em\u003e split-marker approach in combination with a transient Cas9 expression to enable selection on the integration event. For this approach, two plasmids are used that can be constructed with the GoldenMOCS pipeline: a Cas9/sgRNA-containing plasmid and a plasmid containing the integration cassette. The plasmids are co-transfomed into \u003cem\u003eA. niger\u003c/em\u003e and can be transiently maintained in the fungal host using a size-reduced AMA1 version, which is readily lost after hygromycin selection is stopped. A special feature of the system is that the linear integration cassette can be released from the integration plasmid \u003cem\u003ein vivo\u003c/em\u003e by Cas9 thereby the same gRNA/Cas9 complex is used to cut the plasmid and the genomic \u003cem\u003epyrG\u003c/em\u003e locus.\u003c/p\u003e \u003cp\u003eUpon successful homologous recombination of the \u003cem\u003epyrG\u003c/em\u003e split-marker, uridine prototrophy is restored, which is exploited as a selection marker for the integration event. Due to the modular character of the GoldenMOCS system up to eight different expression cassettes can be integrated into the \u003cem\u003epyrG\u003c/em\u003e locus using this strategy. The strains obtained in this way most likely have the cassette correctly integrated into the \u003cem\u003epyrG\u003c/em\u003e locus, with a minimal screening effort [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, we evaluate this integration system and its HDR efficiency at the targeted \u003cem\u003epyrG\u003c/em\u003e locus of \u003cem\u003eA. niger\u003c/em\u003e and can confirm the previously reported high targeting efficiency of the system. In addition, we observed a novel mixed-type repair mechanism in which the double-strand break mediated by CRISPR/Cas9 was simultaneously repaired by HDR and on the other side of the integration cassette by NHEJ.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e \u003cb\u003eStrains\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eA. niger\u003c/em\u003e strains ATCC 1015 [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] and the derivative industrial strain ACIB1 were used as parental strains for genomic integration studies. Parental strains were transformed with pCAS_gpyrG1 according to the protocol of Sarkari et al., 2017 [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] to obtain \u003cem\u003eA. niger\u003c/em\u003e strains ATCC 1015 pyrG\u003csup\u003em1\u003c/sup\u003e and ACIB1 pyrG\u003csup\u003em1\u003c/sup\u003e, respectively.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePlasmid construction and proliferation in\u003c/b\u003e \u003cb\u003eE. coli\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe Golden Gate cloning system [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] was employed for plasmid construction. Vectors for gene integration at the \u003cem\u003epyrG\u003c/em\u003e locus (Additional File 1: Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e) were assembled following the protocol outlined by Sarkari et al., 2017 [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] and harbored the integration cassettes with the sequences listed in Additional File 1: Text S1. Plasmid proliferation was performed in \u003cem\u003eE. coli\u003c/em\u003e Top10, with transformants cultivated on LB agar supplemented with 50 \u0026micro;g/mL kanamycin, 100 \u0026micro;g/mL ampicillin, or 100 \u0026micro;g/mL hygromycin B.\u003c/p\u003e \u003cp\u003e \u003cb\u003eTransformation in\u003c/b\u003e \u003cb\u003eA. niger\u003c/b\u003e \u003cb\u003eand PCR verification\u003c/b\u003e\u003c/p\u003e \u003cp\u003eProtoplast transformations of \u003cem\u003eA. niger\u003c/em\u003e strains was conducted as previously described [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] using 0,4 mg/mL VinoTaste (Novozymes, Bagsv\u0026aelig;rd, Denmark) in SMC as lysing enzymes. Transformants were selected on minimal medium plates containing 200 \u0026micro;g/mL hygromycin B. Purification of transformants involved three rounds of single colony isolation on selection medium: one round with hygromycin B (100 \u0026micro;g/mL) and two rounds on minimal medium alone. To verify the resulting transformants, three PCRs were performed on the genomic DNA using Q5 Polymerase (New England Biolabs, Ipswich, Massachusetts, USA). The Primers used for the verification PCRs are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSequence analysis\u003c/h2\u003e \u003cp\u003ePCR products from gDNA were purified from a gel using HiYield\u003csup\u003e\u0026reg;\u003c/sup\u003ePCR Clean-up/Gel Extraction Kit following the manufacture\u0026rsquo;s protocol. Sanger sequencing was performed by Microsynth, Balgach, Switzerland, using primers listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. For PCR verification primers of sets A \u0026ndash; E were selected depending on the integrated cassette and are assigned in Additional File 2: Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e. Sequence analysis was performed using QIAGEN CLC Main Workbench 21.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for PCR verification of targeted genomic integration\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePurpose\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePCR1\u003c/p\u003e \u003cp\u003eSet A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epyrG_5\u0026rsquo; out_fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTTGGTTAGCACCTACGCTAGTCTATCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecexA_rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAAGTCGGGGTGTGATTTCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePCR1\u003c/p\u003e \u003cp\u003eSet B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epyrG_5\u0026rsquo; out_fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTTGGTTAGCACCTACGCTAGTCTATCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTet-on_TcrgA_rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCGGCCGCATGATTCATGACGTATAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePCR1\u003c/p\u003e \u003cp\u003eSet C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epyrG_5\u0026rsquo; out_fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTTGGTTAGCACCTACGCTAGTCTATCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ephkA_rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATACGTCAACCGGTGAATAAGCCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePCR1\u003c/p\u003e \u003cp\u003eSet D\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epyrG_5\u0026rsquo; out_fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTTGGTTAGCACCTACGCTAGTCTATCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ephkB_rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCTCGTGAGTAGTGGGGGTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePCR1\u003c/p\u003e \u003cp\u003eSet E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epyrG_5\u0026rsquo; out_fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTTGGTTAGCACCTACGCTAGTCTATCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXfspk_rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTGTTTCTGGTGCAAAATGAGATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePCR2\u003c/p\u003e \u003cp\u003eSet A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecexA_fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTAGGCAATGGCTTTGGATGTATGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epyrG_3\u0026rsquo; out_rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATCGGAAGCACAATGAGGCGAGTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePCR2\u003c/p\u003e \u003cp\u003eSet B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003etetO7_fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAAAGTGAAAGTCGAGTTTACCACTCCCTATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epyrG_3\u0026rsquo; out_rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATCGGAAGCACAATGAGGCGAGTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePCR2\u003c/p\u003e \u003cp\u003eSet C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003etrpC_fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCATGCATGGTTGCCTAGTGAATGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epyrG_3\u0026rsquo; out_rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATCGGAAGCACAATGAGGCGAGTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePCR3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epyrG_5\u0026rsquo; out_fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTTGGTTAGCACCTACGCTAGTCTATCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epyrG_3\u0026rsquo; out_rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATCGGAAGCACAATGAGGCGAGTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eSequencing\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epyrG_5\u0026rsquo;_seq_fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCAAGCTCTTATTGTGTCGTTCAAGATTTGTTCGTATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epyrG_5\u0026rsquo;_seq_fwd2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACTAATTCTCCGGATGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePgpdA_seq_rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTTCACATTCTCCTTCGCTTACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eTo evaluate the genomic integration efficiency of the system introduced by Sarkari et al., 2017 [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], 33 different integration cassettes with sizes from 3556 to 8898 bp were transformed. The cassettes differed in promoter and coding sequences while the terminator sequence, the homologous arms for HDR of the targeted \u003cem\u003epyrG\u003c/em\u003e locus, and the transformation vector remained the same (Additional File 2: Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn total, the integration profile at the \u003cem\u003epyrG\u003c/em\u003e locus of 140 transformants was analyzed by three PCR reactions: PCR1 amplified the fragment from the \u003cem\u003epyrG\u003c/em\u003e 5\u0026rsquo; region to the integration cassette. With PCR2, a fragment ranging from the integration cassette to the \u003cem\u003epyrG\u003c/em\u003e 3\u0026rsquo; region was obtained and PCR3 covered the entire \u003cem\u003epyrG\u003c/em\u003e locus. Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e provides a classification of the integration events based on the PCR results. In summary, in 128 of 140 tested transformants the genomic integration of the cassette was confirmed. Twelve potential transformants were excluded from the analysis as five were found to contain a heterokaryon, for three strains it was not possible to obtain all test PCRs and four strains showed the wild-type PCR fragments. Probably due to contamination with uridine prototrophic wild-type strains. Overall, an integration efficiency of 91.4% could be achieved.\u003c/p\u003e \u003cp\u003eInterestingly, transformants with cassette integration could be divided into two groups depending on the PCR result: In 102 transformants, the fragment length after PCRs of the integration site was as expected, indicating targeted HDR on both sites of the cassette. However, in 26 cases (20.3%) PCR1 and PCR3 showed fragments longer than expected. While PCR2 showed the expected amplicon length in all 26 cases, indicating correct HDR on the 5\u0026rsquo; end of the double-strand break.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGenomic integration efficiency of \u003cem\u003eA. niger\u003c/em\u003e strains\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCR verification result\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNumber of transformants\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e%\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTransformants screened\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e140\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCassette integration at \u003cem\u003epyrG\u003c/em\u003e locus\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e128\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e91.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHeterokaryotic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNon-conclusive PCR result\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo cassette integration\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTo explain the unexpected mutation outcome, the DNA profile at the 3\u0026rsquo; end of the CRISPR/Cas9 mediated double-strand break was analyzed by Sanger sequencing.\u003c/p\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eSimultaneous repair of a double-strand break by both, non-homologous end joining and homologous recombination\u003c/h2\u003e \u003cp\u003eAnalysis of the genome integration site revealed two distinct integration events of the cassettes during repair of the double-strand break, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Initially, the Cas9-sgRNA complex facilitated a cut at the \u003cem\u003epyrG\u003c/em\u003e gene upstream from the nonsense mutation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The co-transformed donor DNA was flanked with homologous arms on both sites of the integration cassette (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). In one class of analyzed transformants, the homologous arms flanking the DNA fragment facilitated the expected HDR of the lesion by a double cross-over event. In the second class representing 20.3% of the transformants, the DNA fragment was inserted by a distinct repair mechanism at each site of the double-strand break: At the 5' end, the DNA fragment was introduced as expected by homologous recombination, thus the INDEL mutation was repaired resulting in uridine prototrophy. However, the 5\u0026rsquo;-flanking sequence of the DNA fragment was inserted by NHEJ (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Because of the simultaneous occurrence of both repair mechanisms, NHEJ and HDR, we refer to a mixed-type repair (MTR) mechanism in the following.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eA detailed description of mixed-type repair (MTR) is provided for the integration of an inducible expression cassette at the \u003cem\u003epyrG\u003c/em\u003e locus of \u003cem\u003eA. niger\u003c/em\u003e ATCC 1015. The core of the integration construct consists of a tet-on promoter [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] and the heterologous coding sequence of Xfspk, a phosphoketolase from \u003cem\u003eBifidobacterium longum\u003c/em\u003e [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], that is followed by the \u003cem\u003etrpC\u003c/em\u003e terminator. Upstream, the cassette is flanked with the homologous sequence of the \u003cem\u003epyrG\u003c/em\u003e promoter region (ASPNIDRAFT2_1163268) and 119 bp and 73 bp of its 5\u0026rsquo; and 3\u0026rsquo; region, respectively. Downstream of the cassette, the sequence is a truncated version of the \u003cem\u003epyrG\u003c/em\u003e gene (\u003cem\u003epyrG\u003c/em\u003e\u003csup\u003em2,trunc\u003c/sup\u003e, 679 bp) under the control of the \u003cem\u003ecoxA\u003c/em\u003e promoter. \u003cem\u003ePyrG\u003c/em\u003e\u003csup\u003em2,trunc\u003c/sup\u003e is homologous to the genomic sequence after where the Cas9 has facilitated the double-strand break [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The integration system is designed to facilitate a double-strand break after the seventh base pair of the startcodon ATG of the \u003cem\u003epyrG\u003c/em\u003e gene. Notably, the 3\u0026rsquo; end of the genomic dsDNA ends with the nucleotides 5\u0026rsquo;-TCCTCCA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eThree individual clones transformed with the expression cassette \u003cem\u003etet-on:xfspk:trpC\u003c/em\u003e were analyzed: In the first case, the integration cassette recombined with the genomic DNA by the expected double cross-over event, thus restoring the uridine prototrophy. The successful integration was verified by three PCRs. PCR1-1 amplified 3793 bp upstream of the homologous region to the terminator \u003cem\u003ecrgA\u003c/em\u003e of the tet-on transactivator rtTA2S-M2. PCR2 covered 6841 bp from the tetO7 promoter to the region downstream of \u003cem\u003ePyrG\u003c/em\u003e\u003csup\u003em2,trunc\u003c/sup\u003e. PCR3-1 covered the entire integration cassette, including the respective up- and downstream regions (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), which are 10692 bp.\u003c/p\u003e \u003cp\u003eIn the second case the expression cassette was integrated by MTR with two observed variations (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Both showed insertion of the cassette by homologous recombination of \u003cem\u003epyrG\u003c/em\u003e\u003csup\u003em2,trunc\u003c/sup\u003e at the 5\u0026rsquo; end of the double-strand break. The 3\u0026rsquo; end, however, was repaired by end joining mechanisms:\u003c/p\u003e \u003cp\u003eIn clone 1, ending nucleotides of the additionally integrated 5\u0026rsquo; homologous arm were 5\u0026rsquo;-TGGAGGA. This forms a palindromic sequence with 5\u0026rsquo;-TCCTCCA that are ending nucleotides at the double-strand break mediated by Cas9. Sequences are joined, and the amplicon of PCR1 is 1292 bp longer compared to the region after repair by homologous recombination.\u003c/p\u003e \u003cp\u003eIn clone 2, the 5\u0026rsquo; end of the flanking arm of the donor DNA was shortened by 111 bp, and the ending nucleotides were 5\u0026rsquo;-ATACCGCCTAGTCAT. The double-strand break in the genome at the 3\u0026rsquo; end was then repaired by NHEJ of the donor sequence. PCR1 thus amplified a fragment that is 1181 bp longer compared to the locus after HDR.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, the hypothesis that occurrence of the mixed-type repair mechanism is dependent on the size of the construct was tested. All integration cassettes used for the transformation of \u003cem\u003eA. niger\u003c/em\u003e strains were created with identical homologous flanking regions but inserts ranged from 3592 to 8898 bp. Therefore, a weighted linear regression analysis was performed (Additional File 3: Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Varying numbers of transformants were PCR analyzed for the respective construct sizes. Notably, 37 transformants with a 3592 bp cassette were investigated and 18.9% showed MTR. On the other hand, two transformants with integration of the longest construct of 8898 bp were tested and both showed MTR (100%). The weighted analysis shows a positive correlation between cassette length and the occurrence of MTR, however, this is not significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the filamentous fungus \u003cem\u003eA. niger\u003c/em\u003e NHEJ and HDR are two major mechanisms for rejoining double-strand breaks. HDR leads to accurate repair of DNA damages by end resection to generate single-stranded DNA overhangs for the recombination event. The NHEJ pathway, however, suppresses end resection and promotes ligation of DNA strands. It is often accompanied by insertions or deletions (INDEL) at the repair site and it is the predominant fungal DNA damage response pathway [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In genetic engineering, HDR enables the introduction of precise genetic changes by the insertion of desired DNA sequences. NHEJ, on the other hand, allows efficient gene deactivations by the introduction of random mutations. So far, it is known that either NHEJ or HDR facilitates the repair of a DNA double-strand break in the genome. However, there is evidence that both pathways are activated concomitantly to provide genome integrity [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOver time, various genome-editing methods have been described and the advancement of CRISPR/Cas based systems has profoundly influenced modern genome engineering. The technology has been constantly developed and provides a tool base for enabling precise changes of DNA at a specific locus. On the other hand, the availability of various DNA repair mechanisms to the organisms and unknown molecular interaction has triggered unintended DNA modifications [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. In filamentous fungi, these unexpected outcomes were reported as large deletions of off-target genes [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e] or the action of multiple DNA repair pathways on the targeted locus [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHere, we report the discovery of a DNA repair mechanism initiated by a CRISPR/Cas9 integration tool that is linked to a selection system. The concept requires targeted repair of one end of the double-strand break but eventually allows other repair pathways on the second end of the DNA lesion. We observe a novel mixed-type repair (MTR) mechanism and describe the simultaneous DNA damage response of NHEJ and HDR, each acting on one particular end of a double-strand break. The 5\u0026rsquo; end was always repaird by HDR which is enforced by the selection system for uridine prototrophy. In contrast, the 3\u0026rsquo; end in 20.3% of observed integration events was repaired by NHEJ. We further demonstrate that DNA strands were either directly joined together or that the respective integration cassette was shortened prior to integration.\u003c/p\u003e \u003cp\u003eGenerally, Cas9 generates blunt ends at the cutting site [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] that is not only on the specific locus in the genome but also on the integrating plasmid. This facilitates the release of the integration cassette as a linearized DNA fragment after transformation. Because Cas9 cuts 3 nucleotides upstream of the PAM site 5\u0026rsquo;-AGG, these six nucleotides form the 3\u0026rsquo; end of the double-strand break in the genome. In fact, the same nucleotides in an inverted manner remain also at the 5\u0026rsquo; end of the homologous arm of the cassette released from the integrating plasmid. Consequently, a palindrome, where the sequence on the one strand is the reverse complement of the sequence on the other strand, is formed after the respective strands are joined (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Presumably, the end joining was mediated by the palindrome sequence itself. The double-strands of each DNA end separate and respective inverted repeats bind and convert to a four-way branch structure as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn \u003cem\u003eA. fumigatus\u003c/em\u003e it is reported that microhomology-mediated end joining (MMEJ), that employs microhomologous ends flanking the integration cassette, is a highly efficient repair mechanism of CRISPR/Cas9 mediated mutagenesis [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Our findings suggest that the utilization of flanks forming a palindrome to the ends of a double-strand break could therefore also enhance DNA integration. A similar mechanism proposed as an intermolecular model of palindrome formation was demonstrated in \u003cem\u003eS. cerevisiae\u003c/em\u003e. Evidence was reported that an \u003cem\u003ein vivo\u003c/em\u003e expressed endonuclease releases linear DNA fragments from two transformed plasmids harboring identical short inverted repeats of 42 bp near the cutting site. The findings suggest a 5\u0026prime; to 3\u0026prime; resection of DNA ends resulting in 3\u0026rsquo; single overhangs that include the respective short inverted repeats. A homologous recombination event then mediates the ligation of the DNA strands [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. In contrast, our system already generates DNA strands with the inverted repeats at the blunt ends that are joined without previous end resection and therefore suggests NHEJ as the acting mechanism, possibly mediated by the present palidrome. Our second analyzed case supports this outcome where the 5\u0026rsquo; homologous arm of the integration cassette was shortened as a result of the NHEJ pathway and subsequently integrated into the genome.\u003c/p\u003e \u003cp\u003eOverall, it still needs to be elucidated why NHEJ was favored over a HDR at this site. One possible explanation is the simultaneous activation of the HDR and NHEJ pathway and the design of the \u003cem\u003epyrG\u003c/em\u003e repair fragment. The crossing-over event with the truncated version of the \u003cem\u003epyrG\u003c/em\u003e (\u003cem\u003epyrG\u003c/em\u003e\u003csup\u003em2,trunc\u003c/sup\u003e) simultaneously integrates the \u003cem\u003epcoxA\u003c/em\u003e promoter and ensures growth without uridine after this DNA damage response. The precise DNA repair on the 3\u0026rsquo; end of the double-strand-break, which is the promoter region of \u003cem\u003epyrG\u003c/em\u003e, is however, not essential for growth. Therefore, NHEJ, the predominant form of double-strand break repair, can compete with HDR on this side of the DNA lesion.\u003c/p\u003e"},{"header":"Conclusion and outlook","content":"\u003cp\u003eIn conclusion, the evaluation of the transformation system by Sarkari et al., 2017 confirmed that this integration pipeline enables efficient and flexible introduction of different expression cassettes at the \u003cem\u003epyrG\u003c/em\u003e locus of \u003cem\u003eA. niger\u003c/em\u003e strains. It was also observed that the CRISPR/Cas9-mediated double-strand break can be repaired with a template DNA simultaneously by NHEJ and HDR pathways which is referred to as mixed-type repair (MTR). The MTR mechanism allows for an additional damage response through NHEJ, ensuring the stabilization of the double-strand break, while HDR, operating in parallel, provides the accuracy to repair the mutated \u003cem\u003epyrG\u003c/em\u003e gene. The results emphasize the need to further understand factors influencing the mixed-type DNA repair, especially the impact of the palindrome on the genome repair mechanism.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this published article and its supplementary information files. The industrial strain ACIB1 is not publicly available.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe COMET center: acib: Next Generation Bioproduction is funded by BMK, BMDW, SFG,\u003c/p\u003e\n\u003cp\u003eStandortagentur Tirol, Government of Lower Austria und Vienna Business Agency in the framework of COMET - Competence Centers for Excellent Technologies. The COMET Funding Program is managed by the Austrian Research Promotion Agency FFG.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMGS initiated this study which was jointly designed with SF. SF and FF performed cloning, transformation and PCR experiments with support from AR. Analysis of PCRs and sequences was done by SF with support from FF. Discussion of results was done by MFS, SF and AR. SF wrote the manuscript and prepared the figures with support of AR. MGS provided guidance and input throughout the preparation of the manuscript. All authors read, edited, and approved the manuscript before submission.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors want to thank Henrich Novotný and Nina Filmonova for their support in the lab. We also acknowledge Andreas Holzer for providing PCR data of transformants. Figures were created with BioRender.com. Figure 1 was adapted from \u0026ldquo;CRISPR/Cas9 Gene Editing\u0026rdquo;, by BioRender.com (2024). Retrieved from https://app.biorender.com/biorender-templates.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eCairns TC, Barthel L, Meyer V. Something old, something new: Challenges and developments in \u003cem\u003eAspergillus niger\u0026nbsp;\u003c/em\u003ebiotechnology. Essays Biochem. 2021;65:213\u0026ndash;24.\u003c/li\u003e\n \u003cli\u003eKaraffa L, Kubicek CP. \u003cem\u003eAspergillus niger\u003c/em\u003e citric acid accumulation: Do we understand this well working black box? Appl Microbiol Biotechnol. 2003;61:189\u0026ndash;96.\u003c/li\u003e\n \u003cli\u003ePunt PJ, Oliver RP, Dingemanse MA, Pouwels PH, van den Hondel CAMJJ. Transformation of \u003cem\u003eAspergillus\u0026nbsp;\u003c/em\u003ebased on the hygromycin B resistance marker from \u003cem\u003eEscherichia coli\u003c/em\u003e. Gene. 1987;56:117\u0026ndash;24.\u003c/li\u003e\n \u003cli\u003eKrappmann S. Gene targeting in filamentous fungi: the benefits of impaired repair. Fungal Biol Rev. 2007;21:25\u0026ndash;9.\u003c/li\u003e\n \u003cli\u003eYelton MM, Timberlake WE, Van den Hondel CAMJJ. A cosmid for selecting genes by complementation in \u003cem\u003eAspergillus nidulans\u003c/em\u003e: Selection of the developmentally regulated \u003cem\u003eyA\u003c/em\u003e locus. Proc Natl Acad Sci U S A. 1985;82:834\u0026ndash;8.\u003c/li\u003e\n \u003cli\u003eTimberlake WE. Molecular genetics of \u003cem\u003eAspergillus developement\u003c/em\u003e. Annu Rev Genet. 1990;24:5\u0026ndash;36.\u003c/li\u003e\n \u003cli\u003eBoiteux S, Jinks-Robertson S. DNA repair mechanisms and the bypass of DNA damage in \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e. Genetics. 2013;193:1025\u0026ndash;64.\u003c/li\u003e\n \u003cli\u003eSymington LS. Role of RAD52 Epistasis Group Genes in Homologous Recombination and Double-Strand Break Repair . Microbiol Mol Biol Rev. 2002;66:630\u0026ndash;70.\u003c/li\u003e\n \u003cli\u003eMeyer V, Arentshorst M, El-Ghezal A, Drews AC, Kooistra R, van den Hondel CAMJJ, et al. Highly efficient gene targeting in the \u003cem\u003eAspergillus niger kusA\u003c/em\u003e mutant. J Biotechnol. 2007;128:770\u0026ndash;5.\u003c/li\u003e\n \u003cli\u003eZhang J, Mao Z, Xue W, Li Y, Tang G, Wang A, et al. Ku80 gene is related to non-homologous end-joining and genome stability in \u003cem\u003eAspergillus niger\u003c/em\u003e. Curr Microbiol. 2011;62:1342\u0026ndash;6.\u003c/li\u003e\n \u003cli\u003e\u0026Aacute;lvarez-Escribano I, Sasse C, Bok JW, Na H, Amirebrahimi M, Lipzen A, et al. Genome sequencing of evolved \u003cem\u003easpergilli\u003c/em\u003e populations reveals robust genomes, transversions in \u003cem\u003eA. flavus\u003c/em\u003e, and sexual aberrancy in non-homologous end-joining mutants. BMC Biol. 2019;17:1\u0026ndash;17.\u003c/li\u003e\n \u003cli\u003evan Hartingsveldt W, Mattern IE, van Zeijl CMJ, Pouwels PH, van den Hondel CAMJJ. Development of a homologous transformation system for\u003cem\u003e\u0026nbsp;Aspergillus niger\u003c/em\u003e based on the \u003cem\u003epyrG\u003c/em\u003e gene. MGG Mol Gen Genet. 1987;206:71\u0026ndash;5.\u003c/li\u003e\n \u003cli\u003eKelly JM, Hynes MJ. Transformation of \u003cem\u003eAspergillus niger\u0026nbsp;\u003c/em\u003eby the\u003cem\u003e\u0026nbsp;amdS\u003c/em\u003e gene of \u003cem\u003eAspergillus nidulans\u003c/em\u003e. EMBO J. 1985;4:475\u0026ndash;9.\u003c/li\u003e\n \u003cli\u003eBuxton FP, Gwynne DI, Davies RW. Transformation of \u003cem\u003eAspergillus niger\u003c/em\u003e using the \u003cem\u003eargB\u003c/em\u003e gene of \u003cem\u003eAspergillus nidulans\u003c/em\u003e. Gene. 1985;37:207\u0026ndash;14.\u003c/li\u003e\n \u003cli\u003eN\u0026oslash;dvig CS, Nielsen JB, Kogle ME, Mortensen UH. A CRISPR-Cas9 system for genetic engineering of filamentous fungi. PLoS One. 2015;10:1\u0026ndash;18.\u003c/li\u003e\n \u003cli\u003eJinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A Programmable Dual-RNA-guided DNA Endonuclease in Adaptive Bacterial Immunity. Science. 2012;337:816\u0026ndash;22.\u003c/li\u003e\n \u003cli\u003eZheng X, Zheng P, Zhang K, Cairns TC, Meyer V, Sun J, et al. 5S rRNA Promoter for Guide RNA Expression Enabled Highly Efficient CRISPR/Cas9 Genome Editing in \u003cem\u003eAspergillus niger.\u003c/em\u003e ACS Synth Biol. 2018;8:1568\u0026ndash;74.\u003c/li\u003e\n \u003cli\u003eSong L, Ouedraogo J, Kolbusz M, Truc T, Nguyen M, Tsang A. Efficient genome editing using tRNA promoter-driven CRISP /Cas9 gRNA in \u003cem\u003eAspergillus niger\u003c/em\u003e. 2018;1\u0026ndash;17.\u003c/li\u003e\n \u003cli\u003eSchuster M, Kahmann R. CRISPR-Cas9 genome editing approaches in filamentous fungi and oomycetes. Fungal Genet Biol. 2019;130:43\u0026ndash;53. https://doi.org/10.1016/j.fgb.2019.04.016\u003c/li\u003e\n \u003cli\u003eShen J-Y, Zhao Q, He Q-L. Application of CRISPR in Filamentous Fungi and Macrofungi: from Component Function to Development Potentiality. Acs Synth Biol. 2023;12:1908\u0026ndash;23.\u003c/li\u003e\n \u003cli\u003eXu Y, Shan L, Zhou Y, Xie Z, Ball AS, Cao W, et al. Development of a Cre-loxP-based genetic system in Aspergillus niger ATCC1015 and its application to construction of efficient organic acid-producing cell factories. Appl Microbiol Biotechnol. 2019;103:8105\u0026ndash;14.\u003c/li\u003e\n \u003cli\u003eMizutani O, Masaki K, Gomi K, Iefuji H. Modified cre-loxp recombination in \u003cem\u003eAspergillus oryzae\u003c/em\u003e by direct introduction of Cre recombinase for marker gene rescue. Appl Environ Microbiol. 2012;78:4126\u0026ndash;33.\u003c/li\u003e\n \u003cli\u003eZhang S, Ban A, Ebara N, Mizutani O, Tanaka M, Shintani T, et al. Self-excising Cre/mutant lox marker recycling system for multiple gene integrations and consecutive gene deletions in \u003cem\u003eAspergillus oryzae\u003c/em\u003e. J Biosci Bioeng. 2017;123:403\u0026ndash;11.\u003c/li\u003e\n \u003cli\u003eKopke K, Hoff B, Kuck U. Application of the saccharomyces cerevisiae FLP/FRT recombination system in filamentous fungi for marker recycling and construction of knockout strains devoid of heterologous genes. Appl Environ Microbiol. 2010;76:4664\u0026ndash;74.\u003c/li\u003e\n \u003cli\u003eSarkari P, Marx H, Blumhoff ML, Mattanovich D, Sauer M, Steiger MG. An efficient tool for metabolic pathway construction and gene integration for \u003cem\u003eAspergillus niger.\u003c/em\u003e Bioresour Technol. 2017;245:1327\u0026ndash;33. https://doi.org/10.1016/j.biortech.2017.05.004\u003c/li\u003e\n \u003cli\u003eEngler C, Kandzia R, Marillonnet S. A one pot, one step, precision cloning method with high throughput capability. PLoS One. 2008;3:e3647.\u003c/li\u003e\n \u003cli\u003ePrielhofer R, Barrero JJ, Steuer S, Gassler T, Zahrl R, Baumann K, et al. GoldenPiCS: A Golden Gate-derived modular cloning system for applied synthetic biology in the yeast \u003cem\u003ePichia pastoris\u003c/em\u003e. BMC Syst Biol. 2017;11:1\u0026ndash;14.\u003c/li\u003e\n \u003cli\u003eEgermeier M, Sauer M, Marx H. Golden Gate-based metabolic engineering strategy for wild-type strains of \u003cem\u003eYarrowia lipolytica\u003c/em\u003e. FEMS Microbiol Lett. 2019;366:1\u0026ndash;9.\u003c/li\u003e\n \u003cli\u003eSteiger MG, Rassinger A, Mattanovich D, Sauer M. Engineering of the citrate exporter protein enables high citric acid production in \u003cem\u003eAspergillus niger\u003c/em\u003e. Metab Eng. 2019;52:224\u0026ndash;31. https://doi.org/10.1016/j.ymben.2018.12.004\u003c/li\u003e\n \u003cli\u003eAndersen MR, Salazar MP, Schaap PJ, van de Vondervoort PJI, Culley D, Thykaer J, et al. Comparative genomics of citric-acid-producing \u003cem\u003eAspergillus niger\u003c/em\u003e ATCC 1015 versus enzyme-producing CBS 513.88. Genome Res. 2011;21:885\u0026ndash;97.\u003c/li\u003e\n \u003cli\u003eEngler C, Gruetzner R, Kandzia R, Marillonnet S. Golden Gate Shuffling: A One-Pot DNA Shuffling Method Based on Type IIs Restriction Enzymes. PLoS One. 2009;4:e5553. https://doi.org/10.1371/journal.pone.0005553\u003c/li\u003e\n \u003cli\u003eArentshorst M, Lagendijk EL, Ram AF. A new vector for efficient gene targeting to the pyrG locus in Aspergillus niger. Fungal Biol Biotechnol. 2015;2:2\u0026ndash;6.\u003c/li\u003e\n \u003cli\u003eMeyer V, Wanka F, van Gent J, Arentshorst M, van den Hondel CAMJJ, Ram AFJ. Fungal gene expression on demand: An inducible, tunable, and metabolism-independent expression system for \u003cem\u003eAspergillus niger\u003c/em\u003e. Appl Environ Microbiol. 2011;77:2975\u0026ndash;83.\u003c/li\u003e\n \u003cli\u003eHellgren J, Godina A, Nielsen J, Siewers V. Promiscuous phosphoketolase and metabolic rewiring enables novel non-oxidative glycolysis in yeast for high-yield production of acetyl-CoA derived products. Metab Eng. 2020;62:150\u0026ndash;60. https://doi.org/10.1016/j.ymben.2020.09.003\u003c/li\u003e\n \u003cli\u003eVillalba F, Collemare J, Landraud P, Lambou K, Brozek V, Cirer B, et al. Improved gene targeting in \u003cem\u003eMagnaporthe grisea\u003c/em\u003e by inactivation of MgKU80 required for non-homologous end joining. Fungal Genet Biol. 2008;45:68\u0026ndash;75.\u003c/li\u003e\n \u003cli\u003eNinomiya Y, Suzuki K, Ishii C, Inoue H. Highly efficient gene replacements in \u003cem\u003eNeurospora\u003c/em\u003e strains deficient for nonhomologous end-joining. Proc Natl Acad Sci U S A. 2004;101:12248\u0026ndash;53.\u003c/li\u003e\n \u003cli\u003eKass EM, Jasin M. Collaboration and competition between DNA double-strand break repair pathways. FEBS Lett. 2010;584:3703\u0026ndash;8. http://dx.doi.org/10.1016/j.febslet.2010.07.057\u003c/li\u003e\n \u003cli\u003eHuang J, Cook DE. The contribution of DNA repair pathways to genome editing and evolution in filamentous pathogens. FEMS Microbiol Rev. 2022;46:1\u0026ndash;21.\u003c/li\u003e\n \u003cli\u003eFoster AJ, Johnstone E, Saunders A, Colic E, Lassel N, Holmes J. Unanticipated Large-Scale Deletion in \u003cem\u003eFusarium graminearum\u0026nbsp;\u003c/em\u003eGenome Using CRISPR/Cas9 and Its Impact on Growth and Virulence. J Fungi. 2023;9.\u003c/li\u003e\n \u003cli\u003eHuang J, Rowe D, Subedi P, Zhang W, Suelter T, Valent B, et al. CRISPR-Cas12a induced DNA double-strand breaks are repaired by multiple pathways with different mutation profiles in \u003cem\u003eMagnaporthe oryzae\u003c/em\u003e. Nat Commun. 2022;13:19\u0026ndash;21.\u003c/li\u003e\n \u003cli\u003eSansbury BM, Hewes AM, Kmiec EB. Understanding the diversity of genetic outcomes from CRISPR-Cas generated homology-directed repair. Commun Biol. 2019;2:1\u0026ndash;10.\u003c/li\u003e\n \u003cli\u003eZetsche B, Gootenberg JS, Abudayyeh OO, Slaymaker IM, Makarova KS, Essletzbichler P, et al. Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015;163:759\u0026ndash;71.\u003c/li\u003e\n \u003cli\u003eZhang C, Meng X, Wei X, Lu L. Highly efficient CRISPR mutagenesis by microhomology-mediated end joining in Aspergillus fumigatus. Fungal Genet Biol. ;86:47\u0026ndash;57. http://dx.doi.org/10.1016/j.fgb.2015.12.007\u003c/li\u003e\n \u003cli\u003eButler DK, Gillespie D, Steele B. Formation of large palindromic DNA by homologous recombination of short inverted repeat sequences in \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e. Genetics. 2002;161:1065\u0026ndash;75.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"fungal-biology-and-biotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"fbab","sideBox":"Learn more about [Fungal Biology and Biotechnology](http://fungalbiolbiotech.biomedcentral.com)","snPcode":"40694","submissionUrl":"https://submission.nature.com/new-submission/40694/3","title":"Fungal Biology and Biotechnology","twitterHandle":"@FBBiotech","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"DNA repair, CRISPR/Cas9-mediated genome editing, DNA modification, homology-directed repair, non-homologous end joining, self-replicating plasmid, palindrome","lastPublishedDoi":"10.21203/rs.3.rs-4313903/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4313903/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eNon-homologous end joining (NHEJ) and homology-directed repair (HDR) are two mechanisms in filamentous fungi to repair DNA damages. NHEJ is the dominant response pathway to rapidly join DNA double-strand breaks, but often leads to insertions or deletions. On the other hand, HDR is more precise and utilizes a homologous DNA template to restore the damaged sequence. Both types are exploited in genetic engineering approaches ranging from knock-out mutations to precise sequence modifications.\u003c/p\u003e \u003cp\u003eIn this study, we evaluated the efficiency of a HDR based gene integration system designed for the \u003cem\u003epyrG\u003c/em\u003e locus of \u003cem\u003eAspergillus niger\u003c/em\u003e. While gene integration was achieved at a rate of 91.4%, we also discovered a mixed-type repair (MTR) mechanism with simultaneous repair of a Cas9-mediated double-strand break by both NHEJ and HDR. In 20.3% of the analyzed transformants the donor DNA was integrated by NHEJ at the 3\u0026rsquo; end and by HDR at the 5\u0026rsquo; end of the double-strand break. Furthermore, sequencing of the locus revealed different DNA repair mechanisms at the site of the NHEJ event.\u003c/p\u003e \u003cp\u003eTogether, the results support the applicability of the genome integration system and a novel DNA repair type with implication on the diversity of genetic modifications in filamentous fungi.\u003c/p\u003e","manuscriptTitle":"NHEJ and HDR occurring simultaneously during gene integration into the genome of Aspergillus niger","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-08 07:06:52","doi":"10.21203/rs.3.rs-4313903/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-06-14T07:43:40+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-08T20:52:46+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-27T14:10:49+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-23T10:39:11+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"107948415725944471732586828642446114822","date":"2024-05-07T15:51:21+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"200378586400997836727396523317739760811","date":"2024-05-06T10:15:31+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"13203654364020650788867449644174705747","date":"2024-05-03T13:05:23+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-05-03T10:40:58+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-05-02T12:38:40+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-05-02T12:38:40+00:00","index":"","fulltext":""},{"type":"submitted","content":"Fungal Biology and Biotechnology","date":"2024-04-23T18:30:18+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"fungal-biology-and-biotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"fbab","sideBox":"Learn more about [Fungal Biology and Biotechnology](http://fungalbiolbiotech.biomedcentral.com)","snPcode":"40694","submissionUrl":"https://submission.nature.com/new-submission/40694/3","title":"Fungal Biology and Biotechnology","twitterHandle":"@FBBiotech","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7d129d31-d0ad-4be9-87bf-8f8afb3e115e","owner":[],"postedDate":"May 8th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-08-12T16:04:48+00:00","versionOfRecord":{"articleIdentity":"rs-4313903","link":"https://doi.org/10.1186/s40694-024-00180-7","journal":{"identity":"fungal-biology-and-biotechnology","isVorOnly":false,"title":"Fungal Biology and Biotechnology"},"publishedOn":"2024-08-05 15:57:53","publishedOnDateReadable":"August 5th, 2024"},"versionCreatedAt":"2024-05-08 07:06:52","video":"","vorDoi":"10.1186/s40694-024-00180-7","vorDoiUrl":"https://doi.org/10.1186/s40694-024-00180-7","workflowStages":[]},"version":"v1","identity":"rs-4313903","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4313903","identity":"rs-4313903","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00