AKAP8 regulates R-loop balance and promotes growth of lung carcinoma cell

preprint OA: closed
Full text JSON View at publisher
Full text 157,721 characters · extracted from preprint-html · click to expand
AKAP8 regulates R-loop balance and promotes growth of lung carcinoma cell | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article AKAP8 regulates R-loop balance and promotes growth of lung carcinoma cell Xu Wang, Liang Liu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4868523/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background RNA:DNA hybrid structure known as R-loop, which forms during transcription plays a pivotal roles in transcriptional regulation. Dysregulation of R-loop dynamics disrupt normal DNA replication or RNA transcription, potentially leading to disturbances of cell metabolism, abnormal cell proliferation and disease progression. Methods Interactome data of nucleic AKAPs and R-loop were collected and analyzed to nominate the candidate of AKAP8 (A-kinase-anchoring protein 8) as R-loop binding protein. The interaction of AKAP8 and R-loop were confirmed by co-immunoprecipitation and immunofluorescence. R-loop resolution protein DDX5 were identified to interact with AKAP8 and its nucleic abundance was estimated. AKAP8 knock down cell lines were constructed. The mRNA profile and differential expressed genes of were analyzed. Downstream target gene UCP2 was confirmed upregulate by AKAP8 and R-loop level of UCP2 promoter was estimated. Cell growth and migration of lung carcinoma cell line with depletion of AKAP8 or not were also investigated by EdU, colony formation and wound healing essay. Expression score of AKAP8 comparing lung cancer tissue with normal tissue, and correlation between survival possibility of lung cancer patients and expression level of AKAP8, were also investigated. Results This study identified that AKAP8 interacted with R-loop structure within cells. Depletion of AKAP8 resulted in perturbation of genomic R-loop balance and gene transcription. Evidences was shown that AKAP8 interacted with R-loop resolution protein DDX5 and regulated chromatin associated DDX5 level. Furthermore, AKAP8 was found to enhance transcription uncoupling protein UCP2 as well as alleviate R-loop level of UCP2 promoter, and promoted cell growth and migration of lung carcinoma cell. The lower survival possibility was found in lung cancer patients with high level AKAP8 expression. Conclusions This study elucidates novel roles of AKAP8 in modulating R-loop balance by cooperation of DDX5 and AKAP8 is as one of the motivators for lung carcinoma cell growth contributed by mitochondrial metabolism. This insight may offer prognostic significance for patients with lung adenocarcinoma exhibiting higher AKAP8 expression. R-loop AKAP8 cell growth lung carcinoma Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Background The R-loop is intricate tri-strand nucleic acid structure formed during transcription process. It consists of a single strand DNA paired with complementary RNA formed RNA:DNA hybrid and an exposed single DNA strand which configuration is thermodynamically more stable than double strand DNA [ 1 ]. R-loop is a double-edged sword due to its advantages and disadvantages for cell metabolism. On the one hand, R-loop plays roles in regulation of transcription by multiple mechanism, including promoter methylation, transcription factor binding, or transcription termination [ 2 ] [ 3 ] [ 4 ]. Moreover, R-loop is indispensable for replication of bacterial plasmid and human mitochondrial genome [ 5 ]. It is also necessary to class switch recombination of animal immunoglobulin gene for generation of diverse antibody types [ 6 ].On the other hand, the disadvantage of R-loop mainly addressed by its destruction to DNA. R-loop makes DNA more sensitive to damages, including transcription dependent DNA recombination, double strand DNA breaks, fragile site instability or even severe chromosome loss [ 7 ]. Dysregulation of R-loop, due to abnormal accumulation or resolution, has been implicated in pathogenesis of various disease. For instance, mutation of RNA:DNA helicase SETX cause neurodegeneration in adolescent predominant amyotrophic lateral sclerosis type 4 (ALS4) [ 8 ]. Cell of autoimmune disease Aicardi-Goutieres syndrome (AGS) accumulates R-loop and significantly activates cGAS-STING pathway, which is regarded to associate with RNase H mutation affecting cellular resolution of RNA:DNA [ 9 ] [ 10 ]. Mutation driving metabolism perturbation and R-loop accumulation induced DNA damage by breast cancer susceptibility factor BRCA is sort of related to breast tumorigenesis [ 11 ]. In immune cells, unexpected R-loop accumulation simultaneously in immunoglobulin switch gene and its translocation partner including oncogene c-MYC enhance the pathological translocation of them mediated by activation induced cytosine deaminase (AID) [ 12 ]. The involvement of several important helicases including RNA/DNA helicase Senataxin SETX, Auarius AQR, DNA helicase RECO5, RNA helicase DDX1, DDX5, DDX19, DDX21, DHX9 in R-loop formation and resolution is well-documented [ 13 ] [ 14 ] [ 15 ]. Among these, DDX5 as coregulator for cellular transcription and splicing, and participator in processing of small noncoding RNA is previously shown to unwind RNA:RNA, RNA:DNA, and R-loop in vitro [ 16 ] [ 14 ]. Deficiency of DDX5 accumulates R-loop at propensity loci to form such structure in U2OS cell. The unexpectable aberrant expression of them may impair cellular metabolism and contribute to disease progression. The interaction between Sox2 and DDX5, which inhibits the R-loop resolvase activity of DDX5, facilitates reprogramming [ 17 ]. In Gastric cancer (GC), aberrantly high expression of TCOF1 in cooperation with DDX5 contributes to maintaining GC cell proliferation though alleviating R-loop associated DNA replication stress [ 18 ]. Therefore, identification and revelation of R-loop associated protein can provide a basis for elucidation of R-loop regulatory mechanism and diagnostic strategy for disease. Despite the known involvement of numerous proteins in R-loop metabolism, the identification of an anchoring protein that regulates the R-loop and associated protein complex micro-domain has been elusive. AKAP (A kinase anchoring protein) is large family of anchoring protein with three classical domain including protein kinase A (PKA) binding domain exerting by hydrophobic face of conserved amphipathic helix, targeting sequence serving to tether the complex to specific subcellular compartment, and signal molecular binding domain elevating second messenger cyclic AMP (cAMP) [ 19 ]. Most of AKAPs is cytoplasmic except AKAP8, AKAP8 homologue AKAP8L, and splicing factor SFRS17A (known as AKAP17A) [ 20 ] [ 21 ] [ 22 ] .Herein, we identified AKAP8 was R-loop association protein. Further deciphering interaction between AKAP8 and DDX5, we claimed that AKAP8 regulates chromatin associated DDX5 level and R-loop resolution resulting in transcription changes of mitochondrial genes specially UCP2. It was also suggested this regulation pattern of AKAP8 may contribute to lung carcinoma cell growth, offering AKAP8 as potential prognostic target for lung cancer. Methods Cell and cell culture. HEK293T human embryonic kidney, A549 human lung adenocarcinoma, HeLa human ovarian carcinoma, U2OS human osteosarcoma cell lines and UMSC umbilical cord mesenchymal stem cell were used in this study. Generally, cells were cultured in DMEM medium supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin in at 37°C in a humidified atmosphere with 5% CO 2 . Cells were cultured to a confluence of about 90% and then passage by 1:3 ~ 5 to fresh complete medium. Cells were regularly confirmed mycoplasma free before experiment. Plasmid construction. Plasmids used in this study are listed in Supplementary Table S1 . pLKO.1-TRC-shRNA plasmid were constructed by restriction enzyme digestion and ligation. Oligo of hair pin shRNA of AKAP8 containing flanking Age I and Eco R I enzyme site sequence were synthesized (shCTRL oligo: 5’3’; shAKAP8-CDS oligo: 5’ CCGGGCCAAGATCAACCAGCGTTTGCTCGAGCAAACGCTGGTTGATCTTGGCTTTTTG3’, 5’ AATTCAAAAAGCCAAGATCAACCAGCGTTTGCTCGAGCAAACGCTGGTTGATCTTGGC3’; shAKAP8-3’UTR oligo: 5’CCGGGCTGAAGTACATTGTCCTTAGCTCGAGCTAAGGACAATGTACTTCAGCTTTTTG3’, 5’AATTCAAAAAGCTGAAGTACATTGTCCTTAGCTCGAGCTAAGGACAATGTACTTCAGC3’). The sense and antisense oligo were mixed and heated to 95℃ and annealed to base pair complementary by immediately transfer to ice or programmed gradient cooling to 25℃. pLKO.1-TRC-shRNA empty plasmid were digested by Age I and EcoR I, recycled and ligated with annealed shRNA oligo. pLKO.1-SHC002 (Sigma-Aldrich, #SHC002) was as control shRNA plasmid. Expression plasmid was generally constructed by seamless method or blunt end ligation. pCR3.1 backbone, AKAP8 with plasmid flanking overlap sequence were amplified and then homologous recombination according to guide of seamless kit instruction to construct pCR3.1-HA-AKAP8. Truncated HA-AKAP8 expression plasmid were constructed by PCR amplified using pCR3.1-HA-AKAP8 as template and blunt end ligation. pCMV3-DDX5-FLAG were bought from Sino Biological company (#HG16175-CF). Truncated DDX5-FLAG expression plasmid was constructed by PCR and blunt end ligation. pGEX-AKAP8 expressing GST-AKAP8, and pET28a-DDX5 expressing His-DDX5 were also constructed by seamless method. The truncated expression plasmid was constructed by PCR and blunt end ligation. pLV3-CMV-TurboID-NLS-FLAG were originally bought from MiaoLingBio company. Kozak sequence were added after CMV before TurboID and used to construct HBD-TurboID plasmid. HBD with overlap sequence and pLV3-TurboID-NLS-FLAG backbone plasmid were amplified to homologous recombined as pLV3-HBD-TurboID-NLS-FLAG. Antibody used in this study. S9.6 (Merck, #MABE1095), anti-AKAP8 (Zenbio, #R26398), anti-AKAP8L (Zenbio, #160665), anti-DDX5 (Cell signaling technology, #9877; Proteintech, #67025-1-Ig), anti-DHX9 (Zenbio, #382331), anti-H2A.X (Zenbio, #201082-7G9), anti-FLAG (Sigma-Aldrich, #F1804; Proteintech, #80010-1-RR), anti-HA (Proteintech, # 66006-2-Ig), anti-GAPDH (Proteintech, #60004-1-Ig), anti-H3 (Proteintech, #68345-1-Ig), Normal Rabbit IgG (Cell signaling technology, #2729), Mouse IgG (Proteintech, # B900620), HRP-Goat antibody (Proteintech, SA00001-2, SA00001-3), fluorescence crosslinked donkey antibody (Proteintech, # SA00013-5, SA00013-6, SA00013-7, SA00013-8). Lentivirus package and infection. 293T cell were passage and cultured over night to confluence of 80% in 6 well plate. The cell transfection was carried out for lentivirus package by using following plasmid: 2 µg pLKO.1-shRNA, 1.5 µg psPAX2, 0.5 µg pMD2.G mixed in 100 µL FBS free DMEM medium. 8 µg PEI in equal volume DMEM was added into plasmid and gently mixed, incubated for 10 min at room temperature. Mixture of plasmid and PEI were dropwise addition to transfect 293T cell. Virus was harvested after 48 h. For infection, target cells were passage and cultured over night to confluence of 80% in 6 well plate. Medium were discarded and 1 mL virus and 1 mL fresh complete medium were added with mixture of final concentration of 8 µg/mL polybrene. Medium was replaced by 1 µg/mL Puro for 293T and 1 µg/mL Puro for A549 after 48 h culture. The selection was lasted at least for 5 days for stable cell line. Biotin labelling and Sa affinity precipitation. Biotin stock was prepared at concentration of 100 mM in dimethyl sulfoxide (DMSO). The cells were cultured to confluence about 90%. Biotin stock was diluted by serum medium and directly added to medium at final concentration of 500 µM for 10 min unless indicated otherwise. To terminating the labelling proceed, cell was transferred to ice, discarding the medium and washed by pre frozen PBS for 3 times. The cell was scraped from plate and harvest by centrifuging under 4°C 500 g for 5 min. Supernatant was removed. The pellet of about 10 7 cell was resuspended and lysed by 1 mL WCE buffer (50 mM Tris pH 8.0, 150 mM NaCl, 0.5% NP-40, 1 mM EDTA and 10% glycerol). After 15 min rotation in 4°C refrigerator, whole cell lysate (WCL) was clarified by centrifuging 4°C 12000 g for 10 min. The total protein concentration of WCL was estimated by BCA protein assay. WCL containing about 0.2 mg protein was incubated with 15 µL Sa magbeads for 1.5 h rotation under 4°C. Beads was subsequently washed twice by WCE buffer, once by 1 M KCl, once by 0.1 M Na 2 CO 3 , once by 2 M urea/10 mM Tirs pH 8.0, recovered by twice WCE buffer washing. For western blotting, the slurry was boiled at 95°C for 5 ~ 10 min by adding 30 µL loading buffer. RNA:DNA hybrid (R-loop) associated protein immunoprecipitation. R-loop associated protein of cell was precipitated by S9.6 referring to previous reports. Briefly, 10 7 cell were harvest and washed twice by pre cold PBS. 1 mL WCL buffer was added and fully suspended by vortex following 30 min incubation on ice. After high speeded centrifugation, supernatant was collected for IP. Antibody was incubated for 2 h with 15 µL pre balanced protein A/G beads in 100 µL WCL buffer per IP reaction. 500 µL WCL was added into beads and incubated for 2 h in 4°C condition with gently upside-down mix. Beads were separated and supernatant was discarded. Beads was washed by 500 µL WCL for 3 min at least 6 times. The beads slurry was resuspended by 30 µL SDS-loading buffer and boiled under 95°C for 10 min. the IP products was separated by SDS-PAGE and target protein was estimated by western blotting. For RNase H or RNase A test group, 5U RNase H or 10 µg RNase A were added per IP reaction and incubated at 37℃ overnight. Immunofluorescence. Cell was cultured into confluence about 90% and enzymatic digested by trypsin, seeded by 1:5 in 6 or 12 well plate before 24h of immunofluorescence. The 20 mm slide was pre-autoclaved and placed in well before seeding cell. For transfecting, cell was seed by 1:8 and cultured for 24 h. Transfecting of cells was conducted according to method mentioned in this section. After 24 ~ 36 h culture, the following operation was carried out. The plate was washed by PBS, fixed by 4% PFA for 15 min, stop fixation process by 2mg/mL Glycine for 10 min twice, permeated by 0.2% Triton X-100 for 10 min. Following PBS washing twice, cells were blocked by 3% BSA/PBS for 1h at room temperature. After PBS washing thrice, cells were incubated with primary antibody diluted by 3% BSA/PBS for 1 h at room temperature. After washing thrice by wash buffer (1% BSA, 0.05% Tween 20, PBS) thrice, cells were incubated with fluorescence labeled second antibody for 1 h. After washing thrice by wash buffer, cells were incubated with DAPI for DNA stain. The slide was sealed for imaging by Nikon A1. For R-loop immunofluorescence, cell was fixed and permeated by pre-cold methanol for 10 min at -20℃ and acetone for 1 min at room temperature. After washing thrice by PBS, the cells were blocked and incubated with antibody. DRIP to enrich R-loop DNA. Cells were cultivated into confluence of 90% and medium were discarded. Cells were washed by PBS twice and scraped from dish placing on ice. After centrifugation at 4℃ 500g for 5 min, 10 cm dish cultivated or 10 7 cell were harvested and resuspended by 0.5 mL lysis buffer (10mM Tris pH 8.0, 1% SDS, 2mM EDTA, 100mM NaCl) with 50 µg/mL Protein K. after incubation at 37℃ overnight, final concentration of 20 µg/mL RNase A (DNase free) were added and incubated for 30 min. Add one volume phenol/chloroform extract liquid, vertex and rest for 10 min at room temperature. Transfer to phase gel lock tube and centrifugate at 12000 rpm for 5 min, transfer liquid to new tube. Add 1/10 volume 3 M NaAc (pH 5.2) and 2 volume alcohol. After DNA depositing at -20℃ for at least 30 min, centrifugate at 12000 rpm for 10 min and discard supernatant. DNA was resuspended by 1 mL 80% alcohol and then centrifugated at 10000 rpm for 10 min. supernatant was aspirated totally and DNA was air-dried. About 1 mL TE buffer (10 mM Tris–HCl pH 8.0, 1 mM EDTA) was added and DNA was totally resolved for DNA concentration measurement. Diluted DNA concentration to 0.5 mg/mL. DNA was fragmented into 200–1000 bp by ultrasonication. 300 µL DNA (150 µg) was placed in sonication tube (Diagenode, Bioruptor Pico). The parameter of sonication instrument was set at 4℃ 15 s/45 s (work/off) for 8 cycles. 50 µg DNA fragment was diluted by IP buffer (10 mM Na 2 HPO 4 pH 7.0, 140 mM NaCl, 0.05% Triton X-100) to 500 µL was used for DRIP. 15 µL Protein A/G beads used for one DRIP sample. Protein A/G beads was pre-blocked by 0.5% BSA/PBS for 2 h and washed by IP buffer for twice. Protein A/G beads was incubated with 2 ug S9.6 in 100 mL IP buffer at 4℃ for 2 h by upside down mix. 50 µg DNA fragment was diluted by IP buffer up to 500 mL. S9.6 protein A/G beads suspend slurry was added into DNA fragment. Before this, 5 µL DNA was aspirated as input. The IP component was mixed by gently upside down at 4℃ for 2 h. beads slurry was separated and supernatant was aspirated. Beads slurry was washed with 1 mL IP buffer over five times. the beads slurry was resuspended by 200 µL PK buffer (50 mM Tris–HCl pH 8.0, 10 mM EDTA, 0.5% SDS) with 1 µL 20 mg/mL protein K and incubated at 55℃ for 4 h. IP DNA and input diluted by IP to total volume of 200 µL was purified by phenol/chloroform protocol mentioned in this method. Purified DNA was resolved by 50 µL TE buffer for further experiment. Full length transcriptome. Cells were cultured to influence of 90% in 6 well plate. Medium was discarded and cells were washed by PBS twice. 1 mL TRIZOL was added for lysis of cell. The lysate was transferred to tube and incubated at room temperature for 5 min. 0.2 mL chloroform was added and drastic mixed and then placed for 10 min. One volume of isopropanol was added and mixed upside down. after centrifugation of 12000 rpm for 10 min, two volume alcohol was added to supernatant. After DNA depositing at -20℃ for at least 30 min, centrifugate at 12000 rpm for 10 min and discard supernatant. DNA was resuspended by 1 mL 80% alcohol and then centrifugated at 10000 rpm for 10 min. Supernatant was aspirated totally and DNA was air-dried. 50 µL distill water was added to resuspend total RNA at 65℃ for 10 min. Oxford Nanopore Technologies(ONT) full length RNA-seq and analysis was carried out by Biomarker Technologies Co., LTD. qPCR. Primers used in this study are listed in Table S2 . cDNA was synthesized by reverse transcription using of 1µg total RNA as template according to manufacture instrument of HiScript III RT SuperMix for qPCR (Vazyme, #R323-01). cDNA was generally diluted 10 folds by distill water. For IP DNA qPCR, DNA was resuspended in 50 µL distill water. qPCR was carried out using of PCR mix, DNA template, primer according manufacture instruments of TB Green Fast qPCR Mix (Takara, #RR430) and CFX96 Real-Time System (BIO-RAD, C1000 Touch). The Ct value was used for relative abundance calculation by 2 (−ΔΔCt) method. Isolation of cytoplasm, nucleoplasm, chromatin associated fraction. 10 7 cell cultured in 10 cm dish was washed by pre-cold PBS twice. Cells were scraped and harvested by centrifugation at 4℃ 500g for 5min. Cells were resuspended by 0.5 mL cytoplasmic lysis buffer (50 mM Tris-HCl pH 8.0, 140 mM NaCl, 1.5 mM MgCl 2 , 0.5% NP-40, 1 mM DTT and protease inhibitor) and lysed for 5 min in ice. After centrifugation of 800 g for 2 min at 4℃, supernatant was harvested as cytoplasmic fraction after high speed centrifugation. The pellet was washed by cytoplasmic lysis buffer without NP-40, centrifuged and then resuspended in 50 µL nucleoplasmic lysis buffer 1 (20 mM Tris-HCl pH 7.9, 75 mM NaCl, 0.5 mM EDTA and 50% (v/v) glycerol) totally. 0.5 mL pre-cold nucleoplasmic lysis buffer 2 (20 mM HEPES-KOH pH 7.6, 300 mM NaCl, 0.2 mM EDTA, 7.5 mM MgCl 2 , 1% (v/v) NP-40, 1 M urea and protease inhibitor) was added to suspension, vortexed and incubated for 15 min on ice. The supernatant was gently harvested by centrifugation at 4℃ 2000 g for 4 min as nucleoplasmic fraction after high speed centrifugation. The pellet was quickly washed by nucleoplasmic lysis buffer 2 and harvested by centrifugation of 13000 g at 4℃ for 4 min. the supernatant was discarded and pellet was resuspended by 0.5 mL high salt buffer (50 mM Tis pH 8.0, 500 mM NaCl and protease inhibitor) with 250 U Turbo DNase and incubated for 30 min at 37℃ as chromatin associated fraction. Cell colony formation. Cells were cultured in complete medium to logarithmic phase and enzymic digested from dish. Cells were then inoculated in 6 well plate by 500 cell per well. After 24 h, plasmids were transfected by PEI and medium were refreshed after 24 h. cell were continue cultured for another 10 days. Medium were discarded and cell were washed by PBS twice. Cells were fixed by adding 1 mL methanol for 30 min. methanol was discarded and cell were stained by 0.1% crystal violet for 3 min. Plate were washed by PBS to clear for cell colony imaging. EdU assay. For OD 450 measurement, 5000 A549 cell per well were seeded in 96 well plate and cultured. For microscope imagination, 2×10 5 cell per well was seeded in 6 well plate. Before measuring, EdU with final concentration of 10 µM was added in medium and culture for 2 h. then cell fix, permeation, chemical click and enzymatic reaction of HPR were carried out referring to manufacture’s instruction (BeyoClickTM EdU-TMB Cell Proliferation Kit for OD450 measurement and BeyoClickTM EdU-488 Cell Proliferation Kit for imagination). Cell wound healing assay. Cells were seeded in 6 well plate and make sure the confluence up to about 100% after overnight or no less than 24h culture. Scrape cell layer in a straight line using 20 µL pipette tip. Keep the tip perpendicular and maintain contact to the bottom of cell. Gently wash cell monolayer to remove detached cells by PBS and replenish with fresh medium containing 2% FBS. The scraped spot was imaged using microscope on 10×magnification immediately and after culture. The migration distance defined by gap between the edges of cell-free area was quantified by using of Image J software and migration ratio was then determined. Bioinformatic analysis and statistics analysis. Interactome information were collected from BioGRID database. The interaction new work was constructed and presented by Cytoscape. Statistic expression of AKAP8 and graph plot in pan-cancer/normal tissue and different types of lung cancer/normal tissue were analyzed by UALCAN platform. Correlation between gene and survival in lung cancer were analyzed by Kaplan-Meier Plotter with default parameters. Dimensionality reduction of DEG set from RNA-seq, gene correlation, and graphic plotting were analyzed by GEPIA2 platform. T-test and p value were estimated by GraphPad Prism 9. Results AKAP8 shares interactors with R-loop. We intended to investigate R-loop associated anchoring protein and whether it participates in R-loop associated proteins recruitment or dissociation (Fig. 1 A). Interactome data of three nucleic AKAPs, AKAP8, AKAP8L, AKAP17A from BioGRID, and R-loop interactors identified by HBD proximity labeling (RDProx) were collected and interaction network was constructed with highlights of shared interactors (Fig. 1 B). Notably, RPA1 emerged as the only common interactor of these AKPAs and R-loop. AKAP8 has maximal number of interactors of 33 shared with R-loop, while AKAP8L has 21 and AKAP17A has 14 (Fig. 1 B, C). Besides, the common interaction set of AKAP8 and R-loop contains previously investigated R-loop associated proteins TOP1, RPA, hnRNPs and DDX5. In addition, AKAP8 was among protein set of RDProx. Taking together, AKAP8 appears to be candidate of R-loop associated protein. HBD-TurboID for identification of R-loop associated protein. To estimate R-loop interactors, we first constructed proximity labeling system of R-loop associated proteins. TurboID were used for biotin proximity labeling and recombined with HBD (RNA:DNA hybrid binding domain) along with nuclear location sequence (Fig. 2 A). HBD-TurboID were stable expressed in 293T (Fig. 2 B). After biotin incubation, the protein of HBD-TurboID 293T cell line showed significant biotinylated (Fig. 2 C). The biotinylated proteins were affinity precipitated (AP) and estimated. More affinity precipitated proteins were detected for TurboID expressed 293T cell lines comparing with that of without biotin (Fig. 2 D). To exclude if direct interaction of HBD-TurboID and R-loop associated proteins exist or not, HBD-TurboID immunoprecipitation (IP) were firstly carried out. The result showed R-loop associated proteins DHX9 DDX5, as well as inner reference markers GAPDH and histone H3, were found no immunoprecipitation with HBD-TurboID protein (Fig. 2 E). However, significantly amount of DHX9 and DDX5 instead of GAPDH and histone H3 were labeled after adding biotin (Fig. 2 F). So HBD-TurboID system was suggested to be an efficient R-loop associated protein labeling system. AKAP8 binds and modulates the R-loop. To investigate the relationship between AKAP8 and R-loop, we confirmed their interaction by HBD-TurboID proximity labelling system. The result showed AKAP8 was not detected in IP product of HBD-TurboID expressed cells, however was obviously detected in AP product of HBD-TurboID expressed cell after incubation with biotin (Fig. 3 A). The interaction between R-loop and AKAP8 was further confirmed by immunoprecipitation. AKAP8 co-precipitated with S9.6 in 293T cell while AKAP8L and AKAP17A did not (Fig. 3 C). After RNase H treatment, no AKAP8 signal was showed in S9.6 IP products of 293T cell (Fig. 3 B). The results suggested that AKAP8 is a new revealed R-loop associated protein. We further estimated and confirmed this interaction in HeLa, U2OS, and UMSC (Figure S1 ). Giving AKAP8 was reported as RNA binding protein, we also investigated whether RNA is in charge with the interaction between AKAP8 and R-loop containing RNA. Interestingly, after RNase A treatment, more AKAP8 signal seamed shown in S9.6 IP products of various cells (Fig. 3 B, Figure S1 ). This may be cause by release of AKAP8 trapped by RNA and more amount of AKAP8 interaction with R-loop. Subcellular location of AKAP8 and R-loop was subsequently to be estimated. The immunofluorescence image showed AKAP8 had mostly nuclear location, while R-loop was also found partially nuclear location (Fig. 3 D). Signal abundance distribution presented by gray value-distance was shown accordingly. S9.6 was reported to positively closed related to double strand break DNA represented by molecular marker γH2A.X. We also estimated subcellular distribution of AKAP8 and γH2A.X. It was imaged that AKAP8 formed speckles colocalized with γH2A.X foci. They showed obviously merged signal distribution according to gray value-distance analysis (Fig. 3 D). These results implicated nucleus colocalization of AKAP8 and R-loop. We nest explored whether AKAP8 involved in R-loop homeostasis. Relative nuclear average inter density of S9.6 was estimated in control and AKAP8 knock down 293T cell lines. The result showed AKAP8 signal of its knock down cell was significantly decreased in according with expression level, however bare differences for nuclear S9.6 signal comparing to control cell (Fig. 3 E). Expression and R-loop associated DHX9 were investigated after AKAP8 knock down in 293T cell. The results showed enrichment of DHX9 by S9.6 IP were not significantly unchanged (Fig. 3 F). R-loop was reported formed in MYC gene. R-loop level of MYC gene loci were investigated after AKAP8 knock down. The results showed that promoter region instead of exon of MYC gene positively accumulated R-loop in shAKAP8 293T cell (Fig. 3 G). These results suggested that AKAP8 was closely associated with R-loop in nuclear and contributed to its resolution in special genomic region. AKAP8 interacts with DDX5 independence of nuclear acid. Previous study revealed AKAP8 interactome contains R-loop associated proteins. Among of them, DDX5 was one of these proteins participating in R-loop resolution (Fig. 1 B). To investigation association of AKAP8 and DDX5, GST pull down experiment were carried out and results showed exogeneous expressed AKAP8 co-precipitated with endogenous DDX5 both in 293T and A549 cell (Fig. 4 A). The estimation of AKAP8 and DDX5 interaction by exogenous expression, half endogenous expression of HA-AKAP8 DDX5-FLAG confirmed interaction of these two proteins in both experiments (Figure S2 A, B). In addition, their interaction was found to be DNA/RNA independent implicated by treatment of benzonase nuclease for cell lysate before IP process (Fig. 4 B, Figure S2 C). AKAP8 and DDX5 were also found to be co-precipitated in 293T cell (Fig. 4 C Figure S2 D). GST-AKAP8 and DDX5-His were expressed in E.coli and co-precipitation was estimated by GST pull down. DDX5-His was found to be co-precipitated with GST-AKAP8 instead of GST (Fig. 4 D). These results revealed the interaction of AKAP8 and DDX5 protein. The subcellular location of AKAP8 and DDX5 was nest investigated. The immunofluorescence image of exogenous HA-AKAP and DDX5-FLAG of 293T cell showed that both of them had most of nucleus location. Besides, the signal profile distribution seemed to have a positive correlation (Fig. 4 E). The immunofluorescence image of AKAP8 and DDX5 of A549 cell showed both of them had almost nucleus location and correlation of signal profile distribution (Fig. 4 E). It was suggested AKAP8 and DDX5 were almost transported into nucleus and had a direct interaction. To investigate binding domain of AKAP8 and DDX5, several truncated HA-AKAP8 and DDX5-FLAG taking their conserved domain into consideration were expressed in 293T cell. For human AKAP8 protein, it contains NMTS, two NLS, two ZF domains, and PKA binding domain. For human DDX5 protein, it contains Q motif, DEAD box motif, helicase C terminal, and transactivation domain (Fig. 4 F). The HA IP of co-expressed truncated HA-AKAP and DDX5-FLAG gave the evidence that N terminal of AKAP8 contain NMTS was co precipitated with DDX-FLAG. However, the FLAG IP of co-expressed truncated DDX5-FLAG and full length HA-AKAP8 showed all expressed truncated DDX5-FLAG co precipitated with HA-AKAP8 (Fig. 4 G). Given subcellular colocalization and interaction relation, we nest investigated whether truncated HA-AKAP8 disturb DDX5-FLAG subcellular location when co express in 293T. The immunofluorescence image showed N terminal of AKAP8 containing NMTS was sufficient to satisfy nuclear location nevertheless C terminal of AKAP8 lacking NMTS and NLS domain showed cytoplasmic distribution (Fig. 4 H). Overexpressed DDX5-FLAG with empty HA and other truncated AKAP8 plasmid in 293T cell showed mostly nuclear sublocation excepted for only PKA binding domain deleted AKAP8. This truncated AKAP8 showed nuclear location, but the DDX5-FLAG appear to have more cytoplasmic distribution (Fig. 4 H). It was imaged that N terminal of AKAP8 contributed to its nuclear targeting character and NMTS domain containing region was sufficient to achieve as well as AKAP8 interaction with DDX5. We further investigated interaction and subcellular location between NMTS deletion AKAP8 and DDX5. The results showed that NMTS deletion AKAP8 interact and co-localized with DDX5 in nucleus (Figure S2 E, F). These results indicated that NMTS and NLS are redundancy for nucleus location of AKAP8. AKAP8 interacts with DDX5 in nucleus independence of nuclear acid. N region but not NMTS of AKAP8 is binding region for interacting of AKAP8 and DDX5. Since both of them were reported to have liquid-liquid phase separation characteristic, there interaction feature may be distinguished to soluble proteins. AKAP8 reduction interferes level of chromatin associated DDX5. Whether AKAP8 affects DDX5 expression or distribution were investigated. Transcriptional and expressional level of AKAP8 was significantly reduced in two cell lines (Fig. 5 A, B). The expression level of DDX5 was found no significant changes (Fig. 5 B). We estimated subcellular DDX5 level in fractions. The results showed that DDX5 level in cytoplasm and nucleoplasm have few changes but increasing of chromatin associated component in AKAP8 depleted cell comparing to control cell (Fig. 5 C, D). Another known R-loop protein DHX9 has bare changes in all test cell fraction (Fig. 5 C, D). The result implicated that reduction of AKAP8 increased chromatin associated DDX5 level. Subcellular distribution of DDX5 with different AKAP8 abundance was estimated by IF. For AKAP8 depleting cell, DDX5 uniformly distribute in nuclear as well as AKAP8. High expression of AKAP8 appeared to have high concentration of AKAP8 near nuclear membrane as well as DDX5 implied from signal distribution profile (Fig. 5 E, F). These results indicated that high concentration of AKAP8 may trapped DDX5 near nuclear membrane by their interaction which imped DDX5 biofunction in nuclear. AKAP8 plays roles in regulating mitochondrial redox process of cancer cell. To decipher regulatory function of AKAP8, RNA-seq by long reads method and data analysis of AKAP8 knock down HeLa were carried out. Comparing to control cell, differential expressed genes (DEGs) of 214 up regulated and 221 down regulated were found in shAKAP8 HeLa (Fig. 6 A, Figure S3 A, Table S3 ). Tendency of relative RNA level of AKAP8 and several DEGs in two cell line were estimated by qPCR (Fig. 6 B). Since AKAP8 was reported to play roles in RNA splice, we also investigated different expressed transcripts and alternative polyadenylation (APA). The APA motifs were analysis and listed including canonical AATAAA motif as well as CG abundance motif like CCAGCCTG (Figure S3 B). The alternative splicing happened mostly by exon skipping which was over 60% of all splicing events. Other splicing ways including 5’, 3’ stie splicing ranged from about 3 ~ 13% (Fig. 6 C). The different splicing ways of two cell lines showed comparable percentage value suggested AKAP8 appeared to no preference for alternative splicing location in this test condition. To comprehensively investigate roles of AKAP8 in biological metabolism and metabolic network, KEGG annotation and classification of DEGs were carried out. Classified KEGG item of upregulated and downregulated DEGs were listed respectively (Fig. 6 D). It was attractive that pathway in cancer item was found both in upregulated gens and downregulated genes. RNA degradation item was found only in up regulated genes while oxidative phosphorylation item was found in downregulated genes which possibly contributed by transcription factor regulating pattern (Figure S3 C). Gene set enrichment analysis (GSEA) of all genes were perform to achieve enrichment analysis on all genes based on the expression of all genes without prior experience. Among the GSEA item, RNA degradation item appeared to show positive enrichment score (Figure S3 D). Mitochondrial respiratory chain complex I and mitophagy item related to oxidative phosphorylation pathway showed negative and positive enrichment score from comprehensive judgements respectively (Fig. 6 E). These GSEA character was in according with KEGG classification results. It was implicated that AKAP8 seemed to involving in RNA degradation and mitochondrial metabolism in carcinoma cell line. AKAP8 as a potential oncogene involves in lung adenocarcinoma cell proliferation. To investigate whether AKAP8 is associated to carcinoma progress, statistical analysis of its expression across different types of cancers were carried out. As is shown, except pancreatic adenocarcinoma (PAAD), clear cell of renal cell carcinoma (RCC), and uterine corpus endometrial cancer (UCEC), AKAP8 expression in other types of carcinomas had higher score than that in normal tissue (Fig. 7 A). Since over expression of AKAP8 in lung carcinoma was reported in several cases but less experimental evidences were addressed, we emphasized to investigate its roles in lung carcinoma. As is shown, both of expression of AKAP8 in a lung adenocarcinoma and lung squamous cell carcinoma tissue had significantly high score than that in normal tissue (Fig. 7 B). High expressed AKAP8 lung carcinoma patient seemed to have lower survival probability (Fig. 7 C). We further performed PCA dimensionality reduction of DEGs of shCTRL and shAKAP8 in lung carcinoma of TCGA gene expression database. The results showed that expression profile of DEG set of normal tissue including lung, lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC) (Figure S4 ). Normal tissue aggregated in similar location of PCA 3d axis graph. Expression profile of DEG set of LUAD and LUSC aggregated in distinct location. Moreover, the PCA aggregation of LUAD and LUSC separated in a 2d axis graph (PC1-PC3). This was implicated that AKAP8 may had difference effect of metabolism in LUAD and LUSC. We investigated relation of AKAP8 and lung carcinoma cell line A549. shAKAP8 A549 formed less colony and over expression of AKAP8 rescued the ability of colony formation (Fig. 7 D, E). Besides, AKAP8 depleted cell suggested lower proliferation and migration ratio comparing to control cell line (Fig. 7 F, G, H). It was implicated that high expression of AKAP8 promotes growth and migration in lung carcinoma cell. These results suggested that AKAP8 was regarded as one of oncogenes for lung carcinoma. AKAP8 remodulates R-loop accumulation and transcription of UCP2 in lung cancer cell line. RNA-seq results in this study showed AKAP8 contributed to mitochondrial metabolism. One of most regulated gene of mitochondrial associated DEGs is UCP2. Lower survival probability was presented in UCP2 high expression patients (Fig. 8 A). In addition, gene expression correlation analysis of AKAP8 and UCP2 was with significant p value (0.018) and positive R value. However, no significant correlation appeared to be found in both LUSC and normal tissue (Fig. 8 B). It is implicated that the positive regulation of UCP2 by AKAP8 may play roles in LUAD progress. We estimated R-loop formation after AKAP8 depleted in A549. We confirmed mRNA level of UCP2 significantly reduced in AKAP8 knock down A549 cell line (Fig. 8 D). AKAP8 signal of its knock down cell was significantly decreased in according with expression level and nuclear S9.6 signal also reduced comparing to control cell (Fig. 8 C). Further the R-loop level of UCP2 gene was estimated. The results showed R-loop significant accumulated in UCP2 promoter but bare changes in exon in AKAP8 knock down cell (Fig. 8 D). Together, these results suggested AKAP8 modulated R-loop of UCP2 promoter and mRNA level of UCP2 may play roles in lung adenocarcinoma progress (Fig. 8 E). Discussion In this study, we claim that AKAP family member AKAP8 binds with R-loop and is associated with cellular R-loop regulation. N terminal of AKAP8 is responsible for its nucleus location and interaction with DDX5. Depletion of AKAP8 contributes to interfere chromatin associated DDX5 and nuclear distribution within cells. The depletion ofAKAP8 also changes transcriptional profile in carcinoma cell line and regulates pathways including RNA metabolism and mitochondrial pathway. AKAP8 is predicted as positive regulator for lung cancer cell proliferation. We employed HBD (hybrid binding domain from RNase H), less instinct interactors comparing dead RNase H, and TurboID, harmless proximity label for cell comparing with APEX-H 2 O 2 labeling system, to establish HBD-TurboID proximity labeling system for identifying R-loop interactors. We had verified this system by labeling and detection of previous known R-loop binding protein DHX9 and DDX5. Further we identified AKAP8 as new R-loop associated protein by this system. For HBD-TurboID proximity labeling system, 20% volume of cell extraction used in S9.6 immunoprecipitation is sufficient and more obvious signal of target protein can be achieved by western blotting in our experimental condition. It appears advantageous for detection of weak binding R-loop protein comparing with traditional S9.6 immunoprecipitation method. Nevertheless, one thing can’t be neglected that both S9.6 and HBD showed slight preference for dsRNA, like 1/25 affinity preference of S9.6 binding with RNA:DNA and 1/(16–127) for that of HBD [ 23 ] [ 24 ] [ 25 ]. There is possibility that R-loop interactors identified by using two methods may also contain dsRNA binding proteins. The interaction of AKAP8 with R-loop was conformed dsRNA independent by RNase treatment before S9.6 IP reaction. AKAP8, instead of other two nuclear AKAPs, was identified as R-loop associated protein. AKAP8 is reported as scaffold for phosphorylation of substrate, post modification of histone, DNA damage and mRNA splicing [ 26 ] [ 27 ] [ 28 ]. AKAP8 contains two ZF (zinc finger) domains in its middle region proposed function including mediation of chromatin condensation and RNA motif binding [ 29 ] [ 30 ]. ZF1 is responsible for its DNA binding ability while ZF2 is regarded to be dispensable for chromatin binding. ZF2 is required for condensing targeting and condensing recruitment possibly with help of adjacent residues [ 31 ]. Two ZF domains mediate AKAP8 binding to GC rich DNA in vitro [ 32 ].These motifs were supposed to involve in RNA splicing by direct binding with pre-mRNA [ 33 ]. It is presumable that ZFs is also responsible for AKAP8 binding with genomic R-loop structure. AKAP8 is reported with feature of liquid-liquid phase separation in vitro and within cell. N terminal IDR (intrinsically disordered region) 101-210aa of AKAP8 especial Tyr site is regarded as the pivot site responsible for phase-liquid dynamic status in nucleus. Mutation of IDR Tyr or deletion of IDR changes phase-liquid balance of nucleus AKAP8 in carcinoma cell resulting in disturb of RNA splicing [ 34 ]. N terminal region 1-100 aa of AKAP8 is reported to interact with RNA processing proteins including splicing factors, RNA helicase and hnRNPs [ 30 ]. NMTS and NLS is responsible for nucleus location of AKAP8 however they have a redundancy role implicated by our experiments. N terminal region 1-260aa of AKAP8 is responsible for DDX5 binding and NMTS region contained in this region is not dispensable. Recently, DDX5 homolog are reported to be featured with liquid-liquid phase separation with cells, so the interaction of AKAP8 and DDX5 is regarded to be complicated [ 35 ] [ 36 ]. It also may be associated to balance of nucleic and chromatin DDX5 modulated by AKAP8. N terminal region and ZFs of AKAP8 are possibly responsible for anchoring of DDX5 to genomic R-loop by AKAP8 which is needed to be deciphered in further study. Our study revealed that AKAP8 contributed to cell growth and migration of lung carcinoma cell line. AKAP8 is reported to be closely related to tumorigenesis in diverse types of cancer. High expression level of AKAP8 positively contributes to growth of breast cancer cell maybe by regulation of inflammatory response and apoptosis gene expression as well as splicing of tumorigenesis gene [ 34 ]. AKAP8 is considered as suppressor of tumor metastasis by antagonizing EMT (epithelial-mesenchymal transition) process [ 37 ]. Dynamically interacted with Cx43 (connexin 43) and competitively separates from cyclinE1/E2 to regulate G1/S conversion in lung carcinoma cells [ 38 ] [ 39 ]. Besides, transforming growth factor beta(TGF-beta) is considered one of most main driver of fibrosis in progressive interstitial lung disease IPF (Idiopathic pulmonary fibrosis) [ 40 ]. RNA-seq results show that knock down of AKAP8 disturbs TGF-beta/SMAD3 regulating patten. The regulation of TGF-beta by AKAP8 is also reported in previous research [ 34 ]. Therefore, it is not to be neglected the roles of AKAP8 in progress of lung disease and cancer. DDX5 as a prognostic marker involves in proliferation and tumorigenesis of NSCLC (non-small cell lung cancer) cells through activating the β-catenin signaling pathway [ 41 ]. Evidence showed depletion of DDX5 reduced growth and mitochondrial dysfunction in chemo-resistant SCLC (small cell lung cancer) cell line by possibility of reduction of intracellular succinate which serves as direct electron donor to mitochondrial [ 42 ]. DDX5 reduced expression in various cancer cell lines and tumor xenografts under hypoxia condition and rescued DDX5 in hypoxia showed R-loop levels accumulation further [ 43 ]. DDX5 was phosphorylated at tyrosine residue in cell and was a cellular target of p38 MAP kinase. The phosphorylation of DDX5 showed effects on its RNA unwinding activity [ 44 ]. However, there is no direct evidence that phosphorylation of DDX5 involved in R-loop resolution. AKAP8 is kinase anchoring protein and associated with kinase subcellular spatial orientation. Whether AKAP8 interacting with DDX5 direct DDX5 phosphorylation and play roles in regulating cellular R-loop level is an attractive question. Besides of its function in R-loop, DDX5 resolves G4 structure of oncogene MYC promoter to regulate its transcriptional activation [ 45 ]. Positive prognostic factor DDX5 expression is negatively associated with MYC expression in lung cancer [ 46 ]. It is also interesting that DDX5 interacted with UCP2 in NSCLC cells and affected tolerance of cell to chemotherapy drugs by AKT/mTOR signaling [ 47 ]. Therefore, both AKAP8 and DDX5 play roles in lung carcinoma. In this study, we found that UCP2 transcription was down regulated but R-loop level of UCP2 gene promoter was up regulated in AKAP8 depleted lung carcinoma cell line. UCP2 locates in the mitochondrial inner membrane as member of mitochondrial anion carrier protein and has been demonstrated to regulate cellular metabolism and energy. UCP2 was reported as metabolism reprogramming to induce oxidative stress in age-associated lung fibrosis. Higher basal expression of UCP2 idiopathic pulmonary fibrosis (IPF) fibroblasts is closely related to elevating level of ROS contributing to oxidative stress [ 48 ]. UCP2 promotes NSCLC proliferation via mTOR/HIF-α signaling pathway [ 49 ]. Blocking of UCP2 significantly decreased A549 cell viability [ 50 ]. Considering these evidences, it is not difficult to speculate that AKAP8, DDX5, R-loop and UCP2 showed a complex regulating net to remodel metabolism of lung carcinoma cell. Conclusion This study reveals AKAP8 as an R-loop anchoring protein binds with DDX5 to form AKAP8/DDX5/R-loop microdomain. In addition, AKAP8 regulates R-loop balance and mitochondrial genes transcription to promote lung cancer cell growth, offering evidence for poor prognosis of lung cancer of high AKAP8 expression patients. Abbreviations AKAP A kinase anchoring protein UCP mitochondrial uncoupling protein HBD RNA:DNA hybrid binding domain RDProx HBD proximity labeling Sa streptavidin HRP horseradish peroxidase AP affinity precipitation IP immunoprecipitation IF immunofluorescence DEG differential expressed gene APA alternative polyadenylation GSEA Gene set enrichment analysis KEGG Kyoto encyclopedia of genes and genomes NSCLC non-small cell lung cancer DRIP DNA:RNA hybrid immunoprecipitation Declarations Ethics approval and consent to participate There were no human participants and human data, and human tissue used in this study. No animal experiments were performed in this study. Consent for publication We declare that our data does not contain any individual person’s data. Availability of data and materials The datasets used and/or produced during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests. Funding This work was supported by the Guangzhou National Laboratory Research Foundation (YW-YWYM0401) and National Natural Science Foundation of China (31900655). Author contributions X.W. and L.L. designed this project. X.W. carried out experiment and wrote this manuscript. X.W. and L.L. revised the manuscript. Acknowledgements It was grateful to Feng Zhou (Guangzhou Laboratory) for regent ordering, Lanlan Zhang (Guangzhou Laboratory) for help of confocal microscope operation, Dr. Yaping Chen (Chinese Academy of Science) for kind gift of pCR3.1-HA-AKAP8 plasmid, Di Wu (Guangzhou Medical University) for kind gift of UMSC cell extraction, Lin Lu and Prof. Yan Wang (Sun Yat-sen University) for help of funding (31900655) managements and Prof. Dajiang Qin (The Fifth Affiliated Hospital of Guangzhou Medical University) for helpful advisement. Authors’ information Xu Wang: Guangzhou National Laboratory, No. 9 XingDaoHuanBei Road, Guangzhou International Bio-island, Guangzhou, Guangdong, 510005, China; [email protected] Liang Liu: Guangzhou National Laboratory, No. 9 XingDaoHuanBei Road, Guangzhou International Bio-island, Guangzhou, Guangdong, 510005, China; [email protected] References Thomas M, White RL, Davis RW. Hybridization of RNA to double-stranded DNA: formation of R-loops. Proc Natl Acad Sci U S A. 1976;73:2294–8. Grunseich C, Wang IX, Watts JA, Burdick JT, Guber RD, Zhu Z, et al. Senataxin Mutation Reveals How R-Loops Promote Transcription by Blocking DNA Methylation at Gene Promoters. Mol Cell. 2018;69:426–e4377. Chen PB, Chen HV, Acharya D, Rando OJ, Fazzio TG. R loops regulate promoter-proximal chromatin architecture and cellular differentiation. Nat Struct Mol Biol. 2015;22:999–1007. Boque-Sastre R, Soler M, Oliveira-Mateos C, Portela A, Moutinho C, Sayols S, et al. Head-to-head antisense transcription and R-loop formation promotes transcriptional activation. Proc Natl Acad Sci U S A. 2015;112:5785–90. Renaudin X, Lee M, Shehata M, Surmann E-M, Venkitaraman AR. BRCA2 deficiency reveals that oxidative stress impairs RNaseH1 function to cripple mitochondrial DNA maintenance. Cell Rep. 2021;36:109478. Refaat AM, Nakata M, Husain A, Kosako H, Honjo T, Begum NA. HNRNPU facilitates antibody class-switch recombination through C-NHEJ promotion and R-loop suppression. Cell Rep. 2023;42:112284. Groh M, Gromak N. Out of balance: R-loops in human disease. PLoS Genet. 2014;10:e1004630. Kannan A, Cuartas J, Gangwani P, Branzei D, Gangwani L. Mutation in senataxin alters the mechanism of R-loop resolution in amyotrophic lateral sclerosis 4. Brain. 2022;145:3072–94. Lim YW, Sanz LA, Xu X, Hartono SR, Chédin F. Genome-wide DNA hypomethylation and RNA:DNA hybrid accumulation in Aicardi-Goutières syndrome. Elife. 2015;4:e08007. Crow YJ, Manel N. Aicardi-Goutières syndrome and the type I interferonopathies. Nat Rev Immunol. 2015;15:429–40. Tan SLW, Chadha S, Liu Y, Gabasova E, Perera D, Ahmed K, et al. A Class of Environmental and Endogenous Toxins Induces BRCA2 Haploinsufficiency and Genome Instability. Cell. 2017;169:1105–e111815. Ruiz JF, Gómez-González B, Aguilera A. AID induces double-strand breaks at immunoglobulin switch regions and c-MYC causing chromosomal translocations in yeast THO mutants. PLoS Genet. 2011;7:e1002009. Ribeiro de Almeida C, Dhir S, Dhir A, Moghaddam AE, Sattentau Q, Meinhart A, et al. RNA Helicase DDX1 Converts RNA G-Quadruplex Structures into R-Loops to Promote IgH Class Switch Recombination. Mol Cell. 2018;70:650–e6628. Mersaoui SY, Yu Z, Coulombe Y, Karam M, Busatto FF, Masson J-Y et al. Arginine methylation of the DDX5 helicase RGG/RG motif by PRMT5 regulates resolution of RNA:DNA hybrids. EMBO J. 2019;20. Chakraborty P, Huang JTJ, Hiom K. DHX9 helicase promotes R-loop formation in cells with impaired RNA splicing. Nat Commun. 2018;9:4346. Xing Z, Wang S, Tran EJ. Characterization of the mammalian DEAD-box protein DDX5 reveals functional conservation with S. cerevisiae ortholog Dbp2 in transcriptional control and glucose metabolism. RNA. 2017;23:1125–38. Li Y, Song Y, Xu W, Li Q, Wang X, Li K, et al. R-loops coordinate with SOX2 in regulating reprogramming to pluripotency. Sci Adv. 2020;6:eaba0777. Nie X, Zhao C, Zhang Y, Huang W, Zhou Y, Liu H, et al. Nucleolar protein treacle ribosome biogenesis factor 1 maintains gastric cancer cell proliferation by regulating R-loop associated DNA replication stress. J Gastroenterol Hepatol. 2023;38:1170–80. Langeberg LK, Scott JD. A-kinase-anchoring proteins. J Cell Sci. 2005;118:3217–20. Kubota S, Morii M, Yuki R, Yamaguchi N, Yamaguchi H, Aoyama K, et al. Role for Tyrosine Phosphorylation of A-kinase Anchoring Protein 8 (AKAP8) in Its Dissociation from Chromatin and the Nuclear Matrix. J Biol Chem. 2015;290:10891–904. Martins S, Eikvar S, Furukawa K, Collas P. HA95 and LAP2 beta mediate a novel chromatin-nuclear envelope interaction implicated in initiation of DNA replication. J Cell Biol. 2003;160:177–88. Jarnaess E, Stokka AJ, Kvissel A-K, Skålhegg BS, Torgersen KM, Scott JD, et al. Splicing factor arginine/serine-rich 17A (SFRS17A) is an A-kinase anchoring protein that targets protein kinase A to splicing factor compartments. J Biol Chem. 2009;284:35154–64. Bou-Nader C, Bothra A, Garboczi DN, Leppla SH, Zhang J. Structural basis of R-loop recognition by the S9.6 monoclonal antibody. Nat Commun. 2022;13:1641. Nowotny M, Cerritelli SM, Ghirlando R, Gaidamakov SA, Crouch RJ, Yang W. Specific recognition of RNA/DNA hybrid and enhancement of human RNase H1 activity by HBD. EMBO J. 2008;27:1172–81. Wang K, Wang H, Li C, Yin Z, Xiao R, Li Q, et al. Genomic profiling of native R loops with a DNA-RNA hybrid recognition sensor. Sci Adv. 2021;7:eabe3516. Bieluszewska A, Weglewska M, Bieluszewski T, Lesniewicz K, Poreba E. PKA -binding domain of AKAP 8 is essential for direct interaction with DPY 30 protein. FEBS J. 2018;285:947–64. Kong X, An P, Xu J, Liu W, Lin F, Yang Y. A-Kinase Anchor Protein 95 Is Involved in ERK1/2-Elk-1 Signal Transduction in Colon Cancer. Anal Cell Pathol (Amst). 2023;2023:8242646. Chan DKH, Mandal A, Hester S, Yu Z, Higgins GS, Kessler BM, et al. Biallelic FBXW7 knockout induces AKAP8-mediated DNA damage in neighbouring wildtype cells. Cell Death Discov. 2023;9:200. Collas P, Le Guellec K, Taskén K. The A-kinase-anchoring protein AKAP95 is a multivalent protein with a key role in chromatin condensation at mitosis. J Cell Biol. 1999;147:1167–80. Hu J, Khodadadi-Jamayran A, Mao M, Shah K, Yang Z, Nasim MT, et al. AKAP95 regulates splicing through scaffolding RNAs and RNA processing factors. Nat Commun. 2016;7:13347. Eide T, Carlson C, Taskén KA, Hirano T, Taskén K, Collas P. Distinct but overlapping domains of AKAP95 are implicated in chromosome condensation and condensin targeting. EMBO Rep. 2002;3:426–32. Marstad A, Landsverk OJB, Strømme O, Otterlei M, Collas P, Sundan A, et al. A-kinase anchoring protein AKAP95 is a novel regulator of ribosomal RNA synthesis. FEBS J. 2016;283:757–70. Hu J, Khodadadi-Jamayran A, Mao M, Shah K, Yang Z, Nasim MT, et al. AKAP95 regulates splicing through scaffolding RNAs and RNA processing factors. Nat Commun. 2016;7:13347. Li W, Hu J, Shi B, Palomba F, Digman MA, Gratton E, et al. Biophysical properties of AKAP95 protein condensates regulate splicing and tumorigenesis. Nat Cell Biol. 2020;22:960–72. Huang J, Zhao Y, Liu S, Chen Y, Du M, Wang Q, et al. RH20, a phase-separated RNA helicase protein, facilitates plant resistance to viruses. Plant Sci. 2024;347:112176. Harel I, Chen YR, Ziv I, Singh PP, Heinzer D, Negredo PN et al. Identification of protein aggregates in the aging vertebrate brain with prion-like and phase-separation properties. Cell Reports [Internet]. 2024 [cited 2024 Jul 12];43. https://www.cell.com/cell-reports/abstract/S2211-1247(23)00798-2 Hu X, Harvey SE, Zheng R, Lyu J, Grzeskowiak CL, Powell E, et al. The RNA-binding protein AKAP8 suppresses tumor metastasis by antagonizing EMT-associated alternative splicing. Nat Commun. 2020;11:486. Chen R, Chen Y, Yuan Y, Zou X, Sun Q, Lin H, et al. Cx43 and AKAP95 regulate G1/S conversion by competitively binding to cyclin E1/E2 in lung cancer cells. Thorac Cancer. 2020;11:1594–602. Chen X, Kong X, Zhuang W, Teng B, Yu X, Hua S, et al. Dynamic changes in protein interaction between AKAP95 and Cx43 during cell cycle progression of A549 cells. Sci Rep. 2016;6:21224. Young ON, Bourke JE, Widdop RE. Catch your breath: The protective role of the angiotensin AT2 receptor for the treatment of idiopathic pulmonary fibrosis. Biochem Pharmacol. 2023;217:115839. Wang Z, Luo Z, Zhou L, Li X, Jiang T, Fu E. DDX5 promotes proliferation and tumorigenesis of non-small-cell lung cancer cells by activating β-catenin signaling pathway. Cancer Sci. 2015;106:1303–12. Xing Z, Russon MP, Utturkar SM, Tran EJ. The RNA helicase DDX5 supports mitochondrial function in small cell lung cancer. J Biol Chem. 2020;295:8988–98. Leszczynska KB, Dzwigonska M, Estephan H, Moehlenbrink J, Bowler E, Giaccia AJ, et al. Hypoxia-mediated regulation of DDX5 through decreased chromatin accessibility and post-translational targeting restricts R-loop accumulation. Mol Oncol. 2023;17:1173–91. Yang L, Lin C, Liu Z-R. Signaling to the DEAD box–regulation of DEAD-box p68 RNA helicase by protein phosphorylations. Cell Signal. 2005;17:1495–504. Wu G, Xing Z, Tran EJ, Yang D. DDX5 helicase resolves G-quadruplex and is involved in MYC gene transcriptional activation. Proc Natl Acad Sci USA. 2019;116:20453–61. Cui Y, Hunt A, Li Z, Birkin E, Lane J, Ruge F, et al. Lead DEAD/H box helicase biomarkers with the therapeutic potential identified by integrated bioinformatic approaches in lung cancer. Comput Struct Biotechnol J. 2021;19:261–78. Yang Z, Li G, Zhao Y, Zhang L, Yuan X, Meng L, et al. Molecular Insights into the Recruiting Between UCP2 and DDX5/UBAP2L in the Metabolic Plasticity of Non-Small-Cell Lung Cancer. J Chem Inf Model. 2021;61:3978–87. Rangarajan S, Locy ML, Chanda D, Kurundkar A, Kurundkar D, Larson-Casey JL et al. Mitochondrial uncoupling protein‐2 reprograms metabolism to induce oxidative stress and myofibroblast senescence in age‐associated lung fibrosis. Aging Cell [Internet]. 2022 [cited 2023 Apr 20];21. https://onlinelibrary.wiley.com/doi/ 10.1111/acel.13674 Song C, Liu Q, Qin J, Liu L, Zhou Z, Yang H. UCP2 promotes NSCLC proliferation and glycolysis via the mTOR / HIF -1α signaling. Cancer Med. 2024;13:e6938. Lee JH, Cho YS, Jung K-H, Park JW, Lee K-H. Genipin enhances the antitumor effect of elesclomol in A549 lung cancer cells by blocking uncoupling protein–2 and stimulating reactive oxygen species production. Oncol Lett. 2020;20:1–1. Additional Declarations No competing interests reported. Supplementary Files Additionalfile1FigureS14.docx Additional file 1: Figure S1. AKAP8 bind with R-loop in cells. HeLa, U2OS and UMSC cells were used. RA: Rnase A treatment before S9.6 IP. Additional file 1: Figure S2. AKAP8 bind with DDX5. A, Co-IP analysis interaction of endogenous expressed AKAP8 and DDX5. B, Co-IP analysis interaction of half-exogenous expressed AKAP8 and DDX5. C, interaction estimation of AKAP8 and DDX5 after benzonase treatment. D, interaction estimation of exogenous AKAP8 and DDX5. E, confocal imagination of HA-AKAP8 (NMTS deletion) and DDX5-FLAG. F, HA IP and WB for HA-AKAP8 (NMTS deletion) and DDX5-FLAG. Additional file 1: Figure S3. AKAP8 regulated cell metabolism. A, PC analysis of shCTRL and shAKAP8 cell lines. B, Alternative polyadenylation (APA) site motif clustering. C, clustered heatmap of significant TF’ in shCTRL and shAKAP8 samples. D, GSEA analysis revealed AKAP8 knock down regulated RNA degradation. Additional file 1: Figure S4. PCA statistics for DEGs set in lung carcinoma tumor and normal tissue. Additionalfile2TableS12.docx Additional file 2: Table S1. Plasmid used in this study. Additional file 2: Table S2. Primers for qPCR used in this study Additionalfile3TableS3.xlsx Additional file 3: Table S3. Information of screened differential expressed genes. Additionalfile4RawfigureofgelandWB.docx Additional file 4: Raw picture of gel and WB. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4868523","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":344635377,"identity":"b75ea93e-700e-4841-b362-6e7a60802ea2","order_by":0,"name":"Xu Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7ElEQVRIiWNgGAWjYBADOX4GBsYDjA0kaDGWBKomTUvihgPEajE4fvbwC8a2w4ybzy9/cODnDgZ5/gbmZw/wajmTl2bBcOYws9mNBwkHe88wGM44wGZugE+L2YEcMwOGisNsZjcOHDjA28bAuIGBh00Cr5bzb4BaDA7zGM842HDwbxuDPWEtN3KMHwBtkTDgb2Y4DLQlkaAW+xtvzBgYzqQbSNxgYzgse0YieQbQkXi1SPbnGH9gbLOu7+8//vDh2x02tv3tzc/wagECNuk/IEoiAUwyMDATUA8EzB/AFP8BwkpHwSgYBaNgZAIAzM5Ml9wXcQEAAAAASUVORK5CYII=","orcid":"","institution":"Guangzhou National Laboratory","correspondingAuthor":true,"prefix":"","firstName":"Xu","middleName":"","lastName":"Wang","suffix":""},{"id":344635378,"identity":"6d023fd9-1ff1-4333-8f02-6f8f8bced53a","order_by":1,"name":"Liang Liu","email":"","orcid":"","institution":"Guangzhou National Laboratory","correspondingAuthor":false,"prefix":"","firstName":"Liang","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2024-08-06 12:36:42","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4868523/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4868523/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":64568778,"identity":"5752e482-132f-4592-b513-387a801ab55b","added_by":"auto","created_at":"2024-09-16 00:42:22","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1897011,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInteraction network of AKAPs and R-loop associated proteins.\u003c/strong\u003e A, schematic graph representing for R-loop associated anchoring protein. B, shared proteins analysis of AKAPs and R-loop. AKAP8, AKAP8L, and AKAP17A are nuclear AKAPs. Their interactomes are collected from BioGRID database. R-loop associated proteins are collected by reported RDProx method. Proteins in dashed box are shared interacting proteins of these AKAPs and R-loop. C, number and represented protein shared by AKAP and R-loop.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4868523/v1/3d6a3873403e78a6cf4f53db.png"},{"id":64568785,"identity":"37a14364-5ac3-4bea-be32-09128791ae73","added_by":"auto","created_at":"2024-09-16 00:42:22","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":537077,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eProximity labelling of R-loop associated protein by HBD-TurboID.\u003c/strong\u003e A, schematic graph represented regions of HBD-TurboID protein. HBD and TurboID were recombined by G\u003csub\u003e4\u003c/sub\u003eS linker. NLS and FLAG were recombined in N terminal. B, HBD-TurboID protein expression in 293T stable cell line. C, estimation of biotinylated whole cell protein by TurboID. D, Sa affinity precipitation (Sa AP) of biotinylated proteins labeled by TurboID system. Sa AP product of biotin linked protein were estimated by PAGE and Sa-HRP. E, estimation of HBD-TurboID interaction with R-loop associated proteins and reference protein by FLAG IP. F, estimation of R-loop associated protein by HBD-TurboID system.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4868523/v1/9fb57c16c3ea6c7a48d1a59e.png"},{"id":64569438,"identity":"672b5472-434d-4143-96d6-012e146e18b7","added_by":"auto","created_at":"2024-09-16 00:50:22","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1381644,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAKAP8 binds with R-loop and regulated its formation.\u003c/strong\u003e A, AKAP8 interacting with R-loop by proximity labeling. Estimation of HBD-TurboID interacting with AKAP8 by FLAG IP. AKAP8 interacting with R-loop by HBD-TurboID system. B, AKAP8 interacting with R-loop by S9.6 IP. RH: for RNase H treatment. C, estimating of AKAP8L, AKAP17A binding with R-loop by S9.6 IP. D, immunofluorescence and signal profile of AKAP8, R-loop, rH2A.x in cells. E, immunofluorescence and signal profile of AKAP8 and R-loop (S9.6) in shCTRL and shAKAP8 293T cells (n\u0026gt;60). F, protein expression and R-loop associated abundance of DHX9 in shCTRL and shAKAP8 cells (n=3). G, diagram for MYC gene, mRNA and R-loop signal from database and evaluated by DRIP-qPCR (n=3). Primer pair 1, 2, and 3 used for promoter, promoter (G4) and exon qPCR analysis.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4868523/v1/8fd5ea38de3c978fadaa6e60.png"},{"id":64569983,"identity":"f702c178-a625-45f1-bcf4-820378fd5e8b","added_by":"auto","created_at":"2024-09-16 00:58:22","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2241601,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAKAP8 binds with DDX5 in nucleus.\u003c/strong\u003eA, GST pull down estimation of AKAP8 interacting with DDX5 in 293T and A549. Input: whole cell extraction. B, AKAP8 interacting with DDX5 by HA IP after benzonase treatment. C, interaction of AKAP8 and DDX5 by IP. D, estimation of GST-AKAP8 and His-DDX5 interaction expressed in E. coli. Input: whole cell extraction of His-DDX5 expression E. coli after IPTG induction. E, immunofluorescence image of AKAP8 and DDX5. F, schematic diagram of structure domain and truncated regions of AKAP8 and DDX5. G, interacting region estimated by truncated HA-AKAP8 and DDX5-FLAG through IP. H, immunofluorescence image of truncated HA-AKAP8 and full length DDX5-FLAG expressed in 293T.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4868523/v1/baf37c9f2b08d83bf7e60eac.png"},{"id":64568788,"identity":"b241c157-86a2-485c-bee3-95d2b39cbba5","added_by":"auto","created_at":"2024-09-16 00:42:22","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1081983,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAKAP8 knock down increased chromatin DDX5 level.\u003c/strong\u003eA, relative transcriptional level of AKAP8 in shCTRL and shAKAP8 293T cell line (n=3). B, AKAP8, DDX5 expression in shCTRL and shAKAP8 293T cell line (n=3). C, expression of proteins in cytoplasm (cyto), nucleioplasm (nucleio) and chromatin associated (chromatin) fraction of cell. D, statistic of AKAP8, DDX5 expression in cell fractions (n=3). E, IF image and distribution profiles of AKAP8 and DDX5 in cells (n=3). F, schematic diagram for nuclear distribution of DDX5 with different concentration of AKAP8.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4868523/v1/98027f759ae2e55354bf8fe4.png"},{"id":64568789,"identity":"b7ffa5ec-66ac-4acf-825d-4a57ee7b47cb","added_by":"auto","created_at":"2024-09-16 00:42:22","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":821914,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAKAP8 regulates metabolism and pathway of cancer cell.\u003c/strong\u003eA, heat map of clustered DEGs in shCTRL and shAKAP8 HeLa cell. B, qPCR estimation for relative transcriptional level of selected DEGs (n=3). C, statistic for alternative splicing ways for shCTRL and shAKAP8 cell. D, KEGG pathway analysis of up regulated and down regulated DEGs. E, GSEA analysis revealed AKAP8 knock down regulated mitochondrial metabolism pathways.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4868523/v1/e1ddc64f3dffb406eb74c349.png"},{"id":64568787,"identity":"42aab544-504e-4d0f-ac23-ab5ef19dac6b","added_by":"auto","created_at":"2024-09-16 00:42:22","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1244773,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAKAP8 participates in cell growth and progress of lung carcinoma.\u003c/strong\u003e A, estimation of AKAP8 expression across types of cancer. Blue for normal tissue; red for tumor tissue. B, statistical analysis of AKAP8 expression in lung adenocarcinoma and lung squamous cell carcinoma by comparing that of normal tissue and tumor tissue. C, survival probability with high and low AKAP8 expression. D, AKAP8 expression level estimation. E, colony formation of A549 cells with various AKAP8 expression (n=3). F, cell proliferation valued by OD\u003csub\u003e450\u003c/sub\u003e (n=4). G, cell proliferation estimated by EdU assay through microscope imagination (n=4). H, cell migration ability of A549 estimated by wound healing assay (n=5).\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4868523/v1/94286777e81e380cb4d6b692.png"},{"id":64568786,"identity":"a2366f25-3bc0-4ad2-abee-c94b3808416f","added_by":"auto","created_at":"2024-09-16 00:42:22","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":908375,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUCP2 is regulated by AKAP8 served as promoting factor to lung adenocarcinoma.\u003c/strong\u003e A, survival probability of patient with high and low UCP2 expression. B, correlation analysis of AKAP8 and UCP2 in LUSC tumor, LUAD tumor and LUAD normal tissue. C, image and statistics signal of immunofluorescence of AKAP8 and R-loop (S9.6) in shCTRL and shAKAP8 A549 cell lines (n\u0026gt;60). D, UCP2 mRNA level and DRIP-seq of UCP2 gene in shCTRL and shAKAP8 A549 cell lines (n=3). E, proposed working model for AKAP8 involving in R-loop balance regulation and lung cancer cell proliferation.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-4868523/v1/91d4b658828b0fad86250b6d.png"},{"id":64571006,"identity":"65fc9604-92d0-42f5-8cbe-44b013fd21ea","added_by":"auto","created_at":"2024-09-16 01:14:31","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":12027914,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4868523/v1/7a81b08b-00a6-4170-b22a-1b5bd20eae5d.pdf"},{"id":64569982,"identity":"4d27a559-229f-4b27-850d-dd899805be1d","added_by":"auto","created_at":"2024-09-16 00:58:22","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1859110,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAdditional file 1: Figure S1. AKAP8 bind with R-loop in cells.\u003c/strong\u003e HeLa, U2OS and UMSC cells were used. RA: Rnase A treatment before S9.6 IP.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional file 1: Figure S2. AKAP8 bind with DDX5.\u003c/strong\u003e A, Co-IP analysis interaction of endogenous expressed AKAP8 and DDX5. B, Co-IP analysis interaction of half-exogenous expressed AKAP8 and DDX5. C, interaction estimation of AKAP8 and DDX5 after benzonase treatment. D, interaction estimation of exogenous AKAP8 and DDX5. E, confocal imagination of HA-AKAP8 (NMTS deletion) and DDX5-FLAG. F, HA IP and WB for HA-AKAP8 (NMTS deletion) and DDX5-FLAG.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional file 1: Figure S3. AKAP8 regulated cell metabolism.\u003c/strong\u003e A, PC analysis of shCTRL and shAKAP8 cell lines. B, Alternative polyadenylation (APA) site motif clustering. C, clustered heatmap of significant TF’ in shCTRL and shAKAP8 samples. D, GSEA analysis revealed AKAP8 knock down regulated RNA degradation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional file 1: Figure S4. PCA statistics for DEGs set in lung carcinoma tumor and normal tissue.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Additionalfile1FigureS14.docx","url":"https://assets-eu.researchsquare.com/files/rs-4868523/v1/4bfab3f1528d56ee6860ecd0.docx"},{"id":64569435,"identity":"27ebfbd8-dfa3-476a-b56f-9ef2c259c9c7","added_by":"auto","created_at":"2024-09-16 00:50:22","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":16278,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAdditional file 2: Table S1. Plasmid used in this study.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional file 2: Table S2. Primers for qPCR used in this study\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Additionalfile2TableS12.docx","url":"https://assets-eu.researchsquare.com/files/rs-4868523/v1/5aa0556d699904148588e693.docx"},{"id":64568784,"identity":"ab40e4ff-bb37-430b-89d5-ef604585572a","added_by":"auto","created_at":"2024-09-16 00:42:22","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":74827,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAdditional file 3: Table S3. Information of screened differential expressed genes.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Additionalfile3TableS3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4868523/v1/eabe070747edcc32d693f775.xlsx"},{"id":64568781,"identity":"499c527c-b9e5-47ab-aadd-0b82be73d1e4","added_by":"auto","created_at":"2024-09-16 00:42:22","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":4975602,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAdditional file 4: Raw picture of gel and WB.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Additionalfile4RawfigureofgelandWB.docx","url":"https://assets-eu.researchsquare.com/files/rs-4868523/v1/d31cb197383c6b1adeb0eacd.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"AKAP8 regulates R-loop balance and promotes growth of lung carcinoma cell","fulltext":[{"header":"Background","content":"\u003cp\u003eThe R-loop is intricate tri-strand nucleic acid structure formed during transcription process. It consists of a single strand DNA paired with complementary RNA formed RNA:DNA hybrid and an exposed single DNA strand which configuration is thermodynamically more stable than double strand DNA [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. R-loop is a double-edged sword due to its advantages and disadvantages for cell metabolism. On the one hand, R-loop plays roles in regulation of transcription by multiple mechanism, including promoter methylation, transcription factor binding, or transcription termination [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e] [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Moreover, R-loop is indispensable for replication of bacterial plasmid and human mitochondrial genome [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. It is also necessary to class switch recombination of animal immunoglobulin gene for generation of diverse antibody types [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].On the other hand, the disadvantage of R-loop mainly addressed by its destruction to DNA. R-loop makes DNA more sensitive to damages, including transcription dependent DNA recombination, double strand DNA breaks, fragile site instability or even severe chromosome loss [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDysregulation of R-loop, due to abnormal accumulation or resolution, has been implicated in pathogenesis of various disease. For instance, mutation of RNA:DNA helicase SETX cause neurodegeneration in adolescent predominant amyotrophic lateral sclerosis type 4 (ALS4) [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Cell of autoimmune disease Aicardi-Goutieres syndrome (AGS) accumulates R-loop and significantly activates cGAS-STING pathway, which is regarded to associate with RNase H mutation affecting cellular resolution of RNA:DNA [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e] [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Mutation driving metabolism perturbation and R-loop accumulation induced DNA damage by breast cancer susceptibility factor BRCA is sort of related to breast tumorigenesis [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In immune cells, unexpected R-loop accumulation simultaneously in immunoglobulin switch gene and its translocation partner including oncogene c-MYC enhance the pathological translocation of them mediated by activation induced cytosine deaminase (AID) [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe involvement of several important helicases including RNA/DNA helicase Senataxin SETX, Auarius AQR, DNA helicase RECO5, RNA helicase DDX1, DDX5, DDX19, DDX21, DHX9 in R-loop formation and resolution is well-documented [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Among these, DDX5 as coregulator for cellular transcription and splicing, and participator in processing of small noncoding RNA is previously shown to unwind RNA:RNA, RNA:DNA, and R-loop in vitro [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Deficiency of DDX5 accumulates R-loop at propensity loci to form such structure in U2OS cell. The unexpectable aberrant expression of them may impair cellular metabolism and contribute to disease progression. The interaction between Sox2 and DDX5, which inhibits the R-loop resolvase activity of DDX5, facilitates reprogramming [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. In Gastric cancer (GC), aberrantly high expression of TCOF1 in cooperation with DDX5 contributes to maintaining GC cell proliferation though alleviating R-loop associated DNA replication stress [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Therefore, identification and revelation of R-loop associated protein can provide a basis for elucidation of R-loop regulatory mechanism and diagnostic strategy for disease.\u003c/p\u003e \u003cp\u003eDespite the known involvement of numerous proteins in R-loop metabolism, the identification of an anchoring protein that regulates the R-loop and associated protein complex micro-domain has been elusive. AKAP (A kinase anchoring protein) is large family of anchoring protein with three classical domain including protein kinase A (PKA) binding domain exerting by hydrophobic face of conserved amphipathic helix, targeting sequence serving to tether the complex to specific subcellular compartment, and signal molecular binding domain elevating second messenger cyclic AMP (cAMP) [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Most of AKAPs is cytoplasmic except AKAP8, AKAP8 homologue AKAP8L, and splicing factor SFRS17A (known as AKAP17A) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] .Herein, we identified AKAP8 was R-loop association protein. Further deciphering interaction between AKAP8 and DDX5, we claimed that AKAP8 regulates chromatin associated DDX5 level and R-loop resolution resulting in transcription changes of mitochondrial genes specially UCP2. It was also suggested this regulation pattern of AKAP8 may contribute to lung carcinoma cell growth, offering AKAP8 as potential prognostic target for lung cancer.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e \u003cb\u003eCell and cell culture.\u003c/b\u003e HEK293T human embryonic kidney, A549 human lung adenocarcinoma, HeLa human ovarian carcinoma, U2OS human osteosarcoma cell lines and UMSC umbilical cord mesenchymal stem cell were used in this study. Generally, cells were cultured in DMEM medium supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin in at 37\u0026deg;C in a humidified atmosphere with 5% CO\u003csub\u003e2\u003c/sub\u003e. Cells were cultured to a confluence of about 90% and then passage by 1:3\u0026thinsp;~\u0026thinsp;5 to fresh complete medium. Cells were regularly confirmed mycoplasma free before experiment.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePlasmid construction.\u003c/b\u003e Plasmids used in this study are listed in Supplementary Table\u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e. pLKO.1-TRC-shRNA plasmid were constructed by restriction enzyme digestion and ligation. Oligo of hair pin shRNA of AKAP8 containing flanking \u003cem\u003eAge\u003c/em\u003e I and \u003cem\u003eEco\u003c/em\u003eR I enzyme site sequence were synthesized (shCTRL oligo: 5\u0026rsquo;3\u0026rsquo;; shAKAP8-CDS oligo: 5\u0026rsquo; CCGGGCCAAGATCAACCAGCGTTTGCTCGAGCAAACGCTGGTTGATCTTGGCTTTTTG3\u0026rsquo;, 5\u0026rsquo; AATTCAAAAAGCCAAGATCAACCAGCGTTTGCTCGAGCAAACGCTGGTTGATCTTGGC3\u0026rsquo;; shAKAP8-3\u0026rsquo;UTR oligo: 5\u0026rsquo;CCGGGCTGAAGTACATTGTCCTTAGCTCGAGCTAAGGACAATGTACTTCAGCTTTTTG3\u0026rsquo;, 5\u0026rsquo;AATTCAAAAAGCTGAAGTACATTGTCCTTAGCTCGAGCTAAGGACAATGTACTTCAGC3\u0026rsquo;). The sense and antisense oligo were mixed and heated to 95℃ and annealed to base pair complementary by immediately transfer to ice or programmed gradient cooling to 25℃. pLKO.1-TRC-shRNA empty plasmid were digested by Age I and EcoR I, recycled and ligated with annealed shRNA oligo. pLKO.1-SHC002 (Sigma-Aldrich, #SHC002) was as control shRNA plasmid.\u003c/p\u003e \u003cp\u003eExpression plasmid was generally constructed by seamless method or blunt end ligation. pCR3.1 backbone, AKAP8 with plasmid flanking overlap sequence were amplified and then homologous recombination according to guide of seamless kit instruction to construct pCR3.1-HA-AKAP8. Truncated HA-AKAP8 expression plasmid were constructed by PCR amplified using pCR3.1-HA-AKAP8 as template and blunt end ligation. pCMV3-DDX5-FLAG were bought from Sino Biological company (#HG16175-CF). Truncated DDX5-FLAG expression plasmid was constructed by PCR and blunt end ligation.\u003c/p\u003e \u003cp\u003epGEX-AKAP8 expressing GST-AKAP8, and pET28a-DDX5 expressing His-DDX5 were also constructed by seamless method. The truncated expression plasmid was constructed by PCR and blunt end ligation.\u003c/p\u003e \u003cp\u003epLV3-CMV-TurboID-NLS-FLAG were originally bought from MiaoLingBio company. Kozak sequence were added after CMV before TurboID and used to construct HBD-TurboID plasmid. HBD with overlap sequence and pLV3-TurboID-NLS-FLAG backbone plasmid were amplified to homologous recombined as pLV3-HBD-TurboID-NLS-FLAG.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAntibody used in this study.\u003c/b\u003e S9.6 (Merck, #MABE1095), anti-AKAP8 (Zenbio, #R26398), anti-AKAP8L (Zenbio, #160665), anti-DDX5 (Cell signaling technology, #9877; Proteintech, #67025-1-Ig), anti-DHX9 (Zenbio, #382331), anti-H2A.X (Zenbio, #201082-7G9), anti-FLAG (Sigma-Aldrich, #F1804; Proteintech, #80010-1-RR), anti-HA (Proteintech, # 66006-2-Ig), anti-GAPDH (Proteintech, #60004-1-Ig), anti-H3 (Proteintech, #68345-1-Ig), Normal Rabbit IgG (Cell signaling technology, #2729), Mouse IgG (Proteintech, # B900620), HRP-Goat antibody (Proteintech, SA00001-2, SA00001-3), fluorescence crosslinked donkey antibody (Proteintech, # SA00013-5, SA00013-6, SA00013-7, SA00013-8).\u003c/p\u003e \u003cp\u003e \u003cb\u003eLentivirus package and infection.\u003c/b\u003e 293T cell were passage and cultured over night to confluence of 80% in 6 well plate. The cell transfection was carried out for lentivirus package by using following plasmid: 2 \u0026micro;g pLKO.1-shRNA, 1.5 \u0026micro;g psPAX2, 0.5 \u0026micro;g pMD2.G mixed in 100 \u0026micro;L FBS free DMEM medium. 8 \u0026micro;g PEI in equal volume DMEM was added into plasmid and gently mixed, incubated for 10 min at room temperature. Mixture of plasmid and PEI were dropwise addition to transfect 293T cell. Virus was harvested after 48 h. For infection, target cells were passage and cultured over night to confluence of 80% in 6 well plate. Medium were discarded and 1 mL virus and 1 mL fresh complete medium were added with mixture of final concentration of 8 \u0026micro;g/mL polybrene. Medium was replaced by 1 \u0026micro;g/mL Puro for 293T and 1 \u0026micro;g/mL Puro for A549 after 48 h culture. The selection was lasted at least for 5 days for stable cell line.\u003c/p\u003e \u003cp\u003e \u003cb\u003eBiotin labelling and Sa affinity precipitation.\u003c/b\u003e Biotin stock was prepared at concentration of 100 mM in dimethyl sulfoxide (DMSO). The cells were cultured to confluence about 90%. Biotin stock was diluted by serum medium and directly added to medium at final concentration of 500 \u0026micro;M for 10 min unless indicated otherwise. To terminating the labelling proceed, cell was transferred to ice, discarding the medium and washed by pre frozen PBS for 3 times. The cell was scraped from plate and harvest by centrifuging under 4\u0026deg;C 500 g for 5 min. Supernatant was removed. The pellet of about 10\u003csup\u003e7\u003c/sup\u003e cell was resuspended and lysed by 1 mL WCE buffer (50 mM Tris pH 8.0, 150 mM NaCl, 0.5% NP-40, 1 mM EDTA and 10% glycerol). After 15 min rotation in 4\u0026deg;C refrigerator, whole cell lysate (WCL) was clarified by centrifuging 4\u0026deg;C 12000 g for 10 min. The total protein concentration of WCL was estimated by BCA protein assay. WCL containing about 0.2 mg protein was incubated with 15 \u0026micro;L Sa magbeads for 1.5 h rotation under 4\u0026deg;C. Beads was subsequently washed twice by WCE buffer, once by 1 M KCl, once by 0.1 M Na\u003csub\u003e2\u003c/sub\u003eCO\u003csub\u003e3\u003c/sub\u003e, once by 2 M urea/10 mM Tirs pH 8.0, recovered by twice WCE buffer washing. For western blotting, the slurry was boiled at 95\u0026deg;C for 5\u0026thinsp;~\u0026thinsp;10 min by adding 30 \u0026micro;L loading buffer.\u003c/p\u003e \u003cp\u003e \u003cb\u003eRNA:DNA hybrid (R-loop) associated protein immunoprecipitation.\u003c/b\u003e R-loop associated protein of cell was precipitated by S9.6 referring to previous reports. Briefly, 10\u003csup\u003e7\u003c/sup\u003e cell were harvest and washed twice by pre cold PBS. 1 mL WCL buffer was added and fully suspended by vortex following 30 min incubation on ice. After high speeded centrifugation, supernatant was collected for IP. Antibody was incubated for 2 h with 15 \u0026micro;L pre balanced protein A/G beads in 100 \u0026micro;L WCL buffer per IP reaction. 500 \u0026micro;L WCL was added into beads and incubated for 2 h in 4\u0026deg;C condition with gently upside-down mix. Beads were separated and supernatant was discarded. Beads was washed by 500 \u0026micro;L WCL for 3 min at least 6 times. The beads slurry was resuspended by 30 \u0026micro;L SDS-loading buffer and boiled under 95\u0026deg;C for 10 min. the IP products was separated by SDS-PAGE and target protein was estimated by western blotting. For RNase H or RNase A test group, 5U RNase H or 10 \u0026micro;g RNase A were added per IP reaction and incubated at 37℃ overnight.\u003c/p\u003e \u003cp\u003e\u003cb\u003eImmunofluorescence.\u003c/b\u003e Cell was cultured into confluence about 90% and enzymatic digested by trypsin, seeded by 1:5 in 6 or 12 well plate before 24h of immunofluorescence. The 20 mm slide was pre-autoclaved and placed in well before seeding cell. For transfecting, cell was seed by 1:8 and cultured for 24 h. Transfecting of cells was conducted according to method mentioned in this section. After 24\u0026thinsp;~\u0026thinsp;36 h culture, the following operation was carried out. The plate was washed by PBS, fixed by 4% PFA for 15 min, stop fixation process by 2mg/mL Glycine for 10 min twice, permeated by 0.2% Triton X-100 for 10 min. Following PBS washing twice, cells were blocked by 3% BSA/PBS for 1h at room temperature. After PBS washing thrice, cells were incubated with primary antibody diluted by 3% BSA/PBS for 1 h at room temperature. After washing thrice by wash buffer (1% BSA, 0.05% Tween 20, PBS) thrice, cells were incubated with fluorescence labeled second antibody for 1 h. After washing thrice by wash buffer, cells were incubated with DAPI for DNA stain. The slide was sealed for imaging by Nikon A1. For R-loop immunofluorescence, cell was fixed and permeated by pre-cold methanol for 10 min at -20℃ and acetone for 1 min at room temperature. After washing thrice by PBS, the cells were blocked and incubated with antibody.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDRIP to enrich R-loop DNA.\u003c/b\u003e Cells were cultivated into confluence of 90% and medium were discarded. Cells were washed by PBS twice and scraped from dish placing on ice. After centrifugation at 4℃ 500g for 5 min, 10 cm dish cultivated or 10\u003csup\u003e7\u003c/sup\u003e cell were harvested and resuspended by 0.5 mL lysis buffer (10mM Tris pH 8.0, 1% SDS, 2mM EDTA, 100mM NaCl) with 50 \u0026micro;g/mL Protein K. after incubation at 37℃ overnight, final concentration of 20 \u0026micro;g/mL RNase A (DNase free) were added and incubated for 30 min. Add one volume phenol/chloroform extract liquid, vertex and rest for 10 min at room temperature. Transfer to phase gel lock tube and centrifugate at 12000 rpm for 5 min, transfer liquid to new tube. Add 1/10 volume 3 M NaAc (pH 5.2) and 2 volume alcohol. After DNA depositing at -20℃ for at least 30 min, centrifugate at 12000 rpm for 10 min and discard supernatant. DNA was resuspended by 1 mL 80% alcohol and then centrifugated at 10000 rpm for 10 min. supernatant was aspirated totally and DNA was air-dried. About 1 mL TE buffer (10 mM Tris\u0026ndash;HCl pH 8.0, 1 mM EDTA) was added and DNA was totally resolved for DNA concentration measurement. Diluted DNA concentration to 0.5 mg/mL. DNA was fragmented into 200\u0026ndash;1000 bp by ultrasonication. 300 \u0026micro;L DNA (150 \u0026micro;g) was placed in sonication tube (Diagenode, Bioruptor Pico). The parameter of sonication instrument was set at 4℃ 15 s/45 s (work/off) for 8 cycles. 50 \u0026micro;g DNA fragment was diluted by IP buffer (10 mM Na\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e pH 7.0, 140 mM NaCl, 0.05% Triton X-100) to 500 \u0026micro;L was used for DRIP. 15 \u0026micro;L Protein A/G beads used for one DRIP sample. Protein A/G beads was pre-blocked by 0.5% BSA/PBS for 2 h and washed by IP buffer for twice. Protein A/G beads was incubated with 2 ug S9.6 in 100 mL IP buffer at 4℃ for 2 h by upside down mix. 50 \u0026micro;g DNA fragment was diluted by IP buffer up to 500 mL. S9.6 protein A/G beads suspend slurry was added into DNA fragment. Before this, 5 \u0026micro;L DNA was aspirated as input. The IP component was mixed by gently upside down at 4℃ for 2 h. beads slurry was separated and supernatant was aspirated. Beads slurry was washed with 1 mL IP buffer over five times. the beads slurry was resuspended by 200 \u0026micro;L PK buffer (50 mM Tris\u0026ndash;HCl pH 8.0, 10 mM EDTA, 0.5% SDS) with 1 \u0026micro;L 20 mg/mL protein K and incubated at 55℃ for 4 h. IP DNA and input diluted by IP to total volume of 200 \u0026micro;L was purified by phenol/chloroform protocol mentioned in this method. Purified DNA was resolved by 50 \u0026micro;L TE buffer for further experiment.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFull length transcriptome.\u003c/b\u003e Cells were cultured to influence of 90% in 6 well plate. Medium was discarded and cells were washed by PBS twice. 1 mL TRIZOL was added for lysis of cell. The lysate was transferred to tube and incubated at room temperature for 5 min. 0.2 mL chloroform was added and drastic mixed and then placed for 10 min. One volume of isopropanol was added and mixed upside down. after centrifugation of 12000 rpm for 10 min, two volume alcohol was added to supernatant. After DNA depositing at -20℃ for at least 30 min, centrifugate at 12000 rpm for 10 min and discard supernatant. DNA was resuspended by 1 mL 80% alcohol and then centrifugated at 10000 rpm for 10 min. Supernatant was aspirated totally and DNA was air-dried. 50 \u0026micro;L distill water was added to resuspend total RNA at 65℃ for 10 min. Oxford Nanopore Technologies(ONT) full length RNA-seq and analysis was carried out by Biomarker Technologies Co., LTD.\u003c/p\u003e \u003cp\u003e \u003cb\u003eqPCR.\u003c/b\u003e Primers used in this study are listed in Table\u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e. cDNA was synthesized by reverse transcription using of 1\u0026micro;g total RNA as template according to manufacture instrument of HiScript III RT SuperMix for qPCR (Vazyme, #R323-01). cDNA was generally diluted 10 folds by distill water. For IP DNA qPCR, DNA was resuspended in 50 \u0026micro;L distill water. qPCR was carried out using of PCR mix, DNA template, primer according manufacture instruments of TB Green Fast qPCR Mix (Takara, #RR430) and CFX96 Real-Time System (BIO-RAD, C1000 Touch). The Ct value was used for relative abundance calculation by 2\u003csup\u003e(\u0026minus;ΔΔCt)\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIsolation of cytoplasm, nucleoplasm, chromatin associated fraction.\u003c/b\u003e 10\u003csup\u003e7\u003c/sup\u003e cell cultured in 10 cm dish was washed by pre-cold PBS twice. Cells were scraped and harvested by centrifugation at 4℃ 500g for 5min. Cells were resuspended by 0.5 mL cytoplasmic lysis buffer (50 mM Tris-HCl pH 8.0, 140 mM NaCl, 1.5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.5% NP-40, 1 mM DTT and protease inhibitor) and lysed for 5 min in ice. After centrifugation of 800 g for 2 min at 4℃, supernatant was harvested as cytoplasmic fraction after high speed centrifugation. The pellet was washed by cytoplasmic lysis buffer without NP-40, centrifuged and then resuspended in 50 \u0026micro;L nucleoplasmic lysis buffer 1 (20 mM Tris-HCl pH 7.9, 75 mM NaCl, 0.5 mM EDTA and 50% (v/v) glycerol) totally. 0.5 mL pre-cold nucleoplasmic lysis buffer 2 (20 mM HEPES-KOH pH 7.6, 300 mM NaCl, 0.2 mM EDTA, 7.5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 1% (v/v) NP-40, 1 M urea and protease inhibitor) was added to suspension, vortexed and incubated for 15 min on ice. The supernatant was gently harvested by centrifugation at 4℃ 2000 g for 4 min as nucleoplasmic fraction after high speed centrifugation. The pellet was quickly washed by nucleoplasmic lysis buffer 2 and harvested by centrifugation of 13000 g at 4℃ for 4 min. the supernatant was discarded and pellet was resuspended by 0.5 mL high salt buffer (50 mM Tis pH 8.0, 500 mM NaCl and protease inhibitor) with 250 U Turbo DNase and incubated for 30 min at 37℃ as chromatin associated fraction.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCell colony formation.\u003c/b\u003e Cells were cultured in complete medium to logarithmic phase and enzymic digested from dish. Cells were then inoculated in 6 well plate by 500 cell per well. After 24 h, plasmids were transfected by PEI and medium were refreshed after 24 h. cell were continue cultured for another 10 days. Medium were discarded and cell were washed by PBS twice. Cells were fixed by adding 1 mL methanol for 30 min. methanol was discarded and cell were stained by 0.1% crystal violet for 3 min. Plate were washed by PBS to clear for cell colony imaging.\u003c/p\u003e \u003cp\u003e \u003cb\u003eEdU assay.\u003c/b\u003e For OD\u003csub\u003e450\u003c/sub\u003e measurement, 5000 A549 cell per well were seeded in 96 well plate and cultured. For microscope imagination, 2\u0026times;10\u003csup\u003e5\u003c/sup\u003e cell per well was seeded in 6 well plate. Before measuring, EdU with final concentration of 10 \u0026micro;M was added in medium and culture for 2 h. then cell fix, permeation, chemical click and enzymatic reaction of HPR were carried out referring to manufacture\u0026rsquo;s instruction (BeyoClickTM EdU-TMB Cell Proliferation Kit for OD450 measurement and BeyoClickTM EdU-488 Cell Proliferation Kit for imagination).\u003c/p\u003e \u003cp\u003e \u003cb\u003eCell wound healing assay.\u003c/b\u003e Cells were seeded in 6 well plate and make sure the confluence up to about 100% after overnight or no less than 24h culture. Scrape cell layer in a straight line using 20 \u0026micro;L pipette tip. Keep the tip perpendicular and maintain contact to the bottom of cell. Gently wash cell monolayer to remove detached cells by PBS and replenish with fresh medium containing 2% FBS. The scraped spot was imaged using microscope on 10\u0026times;magnification immediately and after culture. The migration distance defined by gap between the edges of cell-free area was quantified by using of Image J software and migration ratio was then determined.\u003c/p\u003e \u003cp\u003e \u003cb\u003eBioinformatic analysis and statistics analysis.\u003c/b\u003e Interactome information were collected from BioGRID database. The interaction new work was constructed and presented by Cytoscape. Statistic expression of AKAP8 and graph plot in pan-cancer/normal tissue and different types of lung cancer/normal tissue were analyzed by UALCAN platform. Correlation between gene and survival in lung cancer were analyzed by Kaplan-Meier Plotter with default parameters. Dimensionality reduction of DEG set from RNA-seq, gene correlation, and graphic plotting were analyzed by GEPIA2 platform. T-test and p value were estimated by GraphPad Prism 9.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eAKAP8 shares interactors with R-loop.\u003c/b\u003e We intended to investigate R-loop associated anchoring protein and whether it participates in R-loop associated proteins recruitment or dissociation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Interactome data of three nucleic AKAPs, AKAP8, AKAP8L, AKAP17A from BioGRID, and R-loop interactors identified by HBD proximity labeling (RDProx) were collected and interaction network was constructed with highlights of shared interactors (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Notably, RPA1 emerged as the only common interactor of these AKPAs and R-loop. AKAP8 has maximal number of interactors of 33 shared with R-loop, while AKAP8L has 21 and AKAP17A has 14 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, C). Besides, the common interaction set of AKAP8 and R-loop contains previously investigated R-loop associated proteins TOP1, RPA, hnRNPs and DDX5. In addition, AKAP8 was among protein set of RDProx. Taking together, AKAP8 appears to be candidate of R-loop associated protein.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eHBD-TurboID for identification of R-loop associated protein.\u003c/b\u003e To estimate R-loop interactors, we first constructed proximity labeling system of R-loop associated proteins. TurboID were used for biotin proximity labeling and recombined with HBD (RNA:DNA hybrid binding domain) along with nuclear location sequence (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). HBD-TurboID were stable expressed in 293T (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). After biotin incubation, the protein of HBD-TurboID 293T cell line showed significant biotinylated (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). The biotinylated proteins were affinity precipitated (AP) and estimated. More affinity precipitated proteins were detected for TurboID expressed 293T cell lines comparing with that of without biotin (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eTo exclude if direct interaction of HBD-TurboID and R-loop associated proteins exist or not, HBD-TurboID immunoprecipitation (IP) were firstly carried out. The result showed R-loop associated proteins DHX9 DDX5, as well as inner reference markers GAPDH and histone H3, were found no immunoprecipitation with HBD-TurboID protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). However, significantly amount of DHX9 and DDX5 instead of GAPDH and histone H3 were labeled after adding biotin (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). So HBD-TurboID system was suggested to be an efficient R-loop associated protein labeling system.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAKAP8 binds and modulates the R-loop.\u003c/b\u003e To investigate the relationship between AKAP8 and R-loop, we confirmed their interaction by HBD-TurboID proximity labelling system. The result showed AKAP8 was not detected in IP product of HBD-TurboID expressed cells, however was obviously detected in AP product of HBD-TurboID expressed cell after incubation with biotin (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). The interaction between R-loop and AKAP8 was further confirmed by immunoprecipitation. AKAP8 co-precipitated with S9.6 in 293T cell while AKAP8L and AKAP17A did not (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). After RNase H treatment, no AKAP8 signal was showed in S9.6 IP products of 293T cell (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The results suggested that AKAP8 is a new revealed R-loop associated protein. We further estimated and confirmed this interaction in HeLa, U2OS, and UMSC (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGiving AKAP8 was reported as RNA binding protein, we also investigated whether RNA is in charge with the interaction between AKAP8 and R-loop containing RNA. Interestingly, after RNase A treatment, more AKAP8 signal seamed shown in S9.6 IP products of various cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). This may be cause by release of AKAP8 trapped by RNA and more amount of AKAP8 interaction with R-loop.\u003c/p\u003e \u003cp\u003eSubcellular location of AKAP8 and R-loop was subsequently to be estimated. The immunofluorescence image showed AKAP8 had mostly nuclear location, while R-loop was also found partially nuclear location (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Signal abundance distribution presented by gray value-distance was shown accordingly.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eS9.6 was reported to positively closed related to double strand break DNA represented by molecular marker γH2A.X. We also estimated subcellular distribution of AKAP8 and γH2A.X. It was imaged that AKAP8 formed speckles colocalized with γH2A.X foci. They showed obviously merged signal distribution according to gray value-distance analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). These results implicated nucleus colocalization of AKAP8 and R-loop.\u003c/p\u003e \u003cp\u003eWe nest explored whether AKAP8 involved in R-loop homeostasis. Relative nuclear average inter density of S9.6 was estimated in control and AKAP8 knock down 293T cell lines. The result showed AKAP8 signal of its knock down cell was significantly decreased in according with expression level, however bare differences for nuclear S9.6 signal comparing to control cell (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Expression and R-loop associated DHX9 were investigated after AKAP8 knock down in 293T cell. The results showed enrichment of DHX9 by S9.6 IP were not significantly unchanged (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). R-loop was reported formed in MYC gene. R-loop level of MYC gene loci were investigated after AKAP8 knock down. The results showed that promoter region instead of exon of MYC gene positively accumulated R-loop in shAKAP8 293T cell (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). These results suggested that AKAP8 was closely associated with R-loop in nuclear and contributed to its resolution in special genomic region.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAKAP8 interacts with DDX5 independence of nuclear acid.\u003c/b\u003e Previous study revealed AKAP8 interactome contains R-loop associated proteins. Among of them, DDX5 was one of these proteins participating in R-loop resolution (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). To investigation association of AKAP8 and DDX5, GST pull down experiment were carried out and results showed exogeneous expressed AKAP8 co-precipitated with endogenous DDX5 both in 293T and A549 cell (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The estimation of AKAP8 and DDX5 interaction by exogenous expression, half endogenous expression of HA-AKAP8 DDX5-FLAG confirmed interaction of these two proteins in both experiments (Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eA, B). In addition, their interaction was found to be DNA/RNA independent implicated by treatment of benzonase nuclease for cell lysate before IP process (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eC). AKAP8 and DDX5 were also found to be co-precipitated in 293T cell (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eD). GST-AKAP8 and DDX5-His were expressed in \u003cem\u003eE.coli\u003c/em\u003e and co-precipitation was estimated by GST pull down. DDX5-His was found to be co-precipitated with GST-AKAP8 instead of GST (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). These results revealed the interaction of AKAP8 and DDX5 protein.\u003c/p\u003e \u003cp\u003eThe subcellular location of AKAP8 and DDX5 was nest investigated. The immunofluorescence image of exogenous HA-AKAP and DDX5-FLAG of 293T cell showed that both of them had most of nucleus location. Besides, the signal profile distribution seemed to have a positive correlation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). The immunofluorescence image of AKAP8 and DDX5 of A549 cell showed both of them had almost nucleus location and correlation of signal profile distribution (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). It was suggested AKAP8 and DDX5 were almost transported into nucleus and had a direct interaction.\u003c/p\u003e \u003cp\u003eTo investigate binding domain of AKAP8 and DDX5, several truncated HA-AKAP8 and DDX5-FLAG taking their conserved domain into consideration were expressed in 293T cell. For human AKAP8 protein, it contains NMTS, two NLS, two ZF domains, and PKA binding domain. For human DDX5 protein, it contains Q motif, DEAD box motif, helicase C terminal, and transactivation domain (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). The HA IP of co-expressed truncated HA-AKAP and DDX5-FLAG gave the evidence that N terminal of AKAP8 contain NMTS was co precipitated with DDX-FLAG. However, the FLAG IP of co-expressed truncated DDX5-FLAG and full length HA-AKAP8 showed all expressed truncated DDX5-FLAG co precipitated with HA-AKAP8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG).\u003c/p\u003e \u003cp\u003eGiven subcellular colocalization and interaction relation, we nest investigated whether truncated HA-AKAP8 disturb DDX5-FLAG subcellular location when co express in 293T. The immunofluorescence image showed N terminal of AKAP8 containing NMTS was sufficient to satisfy nuclear location nevertheless C terminal of AKAP8 lacking NMTS and NLS domain showed cytoplasmic distribution (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). Overexpressed DDX5-FLAG with empty HA and other truncated AKAP8 plasmid in 293T cell showed mostly nuclear sublocation excepted for only PKA binding domain deleted AKAP8. This truncated AKAP8 showed nuclear location, but the DDX5-FLAG appear to have more cytoplasmic distribution (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). It was imaged that N terminal of AKAP8 contributed to its nuclear targeting character and NMTS domain containing region was sufficient to achieve as well as AKAP8 interaction with DDX5.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe further investigated interaction and subcellular location between NMTS deletion AKAP8 and DDX5. The results showed that NMTS deletion AKAP8 interact and co-localized with DDX5 in nucleus (Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eE, F). These results indicated that NMTS and NLS are redundancy for nucleus location of AKAP8. AKAP8 interacts with DDX5 in nucleus independence of nuclear acid. N region but not NMTS of AKAP8 is binding region for interacting of AKAP8 and DDX5. Since both of them were reported to have liquid-liquid phase separation characteristic, there interaction feature may be distinguished to soluble proteins.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAKAP8 reduction interferes level of chromatin associated DDX5.\u003c/b\u003e Whether AKAP8 affects DDX5 expression or distribution were investigated. Transcriptional and expressional level of AKAP8 was significantly reduced in two cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, B). The expression level of DDX5 was found no significant changes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). We estimated subcellular DDX5 level in fractions. The results showed that DDX5 level in cytoplasm and nucleoplasm have few changes but increasing of chromatin associated component in AKAP8 depleted cell comparing to control cell (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, D). Another known R-loop protein DHX9 has bare changes in all test cell fraction (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, D). The result implicated that reduction of AKAP8 increased chromatin associated DDX5 level.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSubcellular distribution of DDX5 with different AKAP8 abundance was estimated by IF. For AKAP8 depleting cell, DDX5 uniformly distribute in nuclear as well as AKAP8. High expression of AKAP8 appeared to have high concentration of AKAP8 near nuclear membrane as well as DDX5 implied from signal distribution profile (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE, F). These results indicated that high concentration of AKAP8 may trapped DDX5 near nuclear membrane by their interaction which imped DDX5 biofunction in nuclear.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAKAP8 plays roles in regulating mitochondrial redox process of cancer cell.\u003c/b\u003e To decipher regulatory function of AKAP8, RNA-seq by long reads method and data analysis of AKAP8 knock down HeLa were carried out. Comparing to control cell, differential expressed genes (DEGs) of 214 up regulated and 221 down regulated were found in shAKAP8 HeLa (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, Figure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eA, Table\u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e). Tendency of relative RNA level of AKAP8 and several DEGs in two cell line were estimated by qPCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Since AKAP8 was reported to play roles in RNA splice, we also investigated different expressed transcripts and alternative polyadenylation (APA). The APA motifs were analysis and listed including canonical AATAAA motif as well as CG abundance motif like CCAGCCTG (Figure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eB). The alternative splicing happened mostly by exon skipping which was over 60% of all splicing events. Other splicing ways including 5\u0026rsquo;, 3\u0026rsquo; stie splicing ranged from about 3\u0026thinsp;~\u0026thinsp;13% (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). The different splicing ways of two cell lines showed comparable percentage value suggested AKAP8 appeared to no preference for alternative splicing location in this test condition.\u003c/p\u003e \u003cp\u003eTo comprehensively investigate roles of AKAP8 in biological metabolism and metabolic network, KEGG annotation and classification of DEGs were carried out. Classified KEGG item of upregulated and downregulated DEGs were listed respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). It was attractive that pathway in cancer item was found both in upregulated gens and downregulated genes. RNA degradation item was found only in up regulated genes while oxidative phosphorylation item was found in downregulated genes which possibly contributed by transcription factor regulating pattern (Figure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eC). Gene set enrichment analysis (GSEA) of all genes were perform to achieve enrichment analysis on all genes based on the expression of all genes without prior experience. Among the GSEA item, RNA degradation item appeared to show positive enrichment score (Figure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eD). Mitochondrial respiratory chain complex I and mitophagy item related to oxidative phosphorylation pathway showed negative and positive enrichment score from comprehensive judgements respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). These GSEA character was in according with KEGG classification results. It was implicated that AKAP8 seemed to involving in RNA degradation and mitochondrial metabolism in carcinoma cell line.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAKAP8 as a potential oncogene involves in lung adenocarcinoma cell proliferation.\u003c/b\u003e To investigate whether AKAP8 is associated to carcinoma progress, statistical analysis of its expression across different types of cancers were carried out. As is shown, except pancreatic adenocarcinoma (PAAD), clear cell of renal cell carcinoma (RCC), and uterine corpus endometrial cancer (UCEC), AKAP8 expression in other types of carcinomas had higher score than that in normal tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eSince over expression of AKAP8 in lung carcinoma was reported in several cases but less experimental evidences were addressed, we emphasized to investigate its roles in lung carcinoma. As is shown, both of expression of AKAP8 in a lung adenocarcinoma and lung squamous cell carcinoma tissue had significantly high score than that in normal tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). High expressed AKAP8 lung carcinoma patient seemed to have lower survival probability (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). We further performed PCA dimensionality reduction of DEGs of shCTRL and shAKAP8 in lung carcinoma of TCGA gene expression database. The results showed that expression profile of DEG set of normal tissue including lung, lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC) (Figure \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e). Normal tissue aggregated in similar location of PCA 3d axis graph. Expression profile of DEG set of LUAD and LUSC aggregated in distinct location. Moreover, the PCA aggregation of LUAD and LUSC separated in a 2d axis graph (PC1-PC3). This was implicated that AKAP8 may had difference effect of metabolism in LUAD and LUSC.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe investigated relation of AKAP8 and lung carcinoma cell line A549. shAKAP8 A549 formed less colony and over expression of AKAP8 rescued the ability of colony formation (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD, E). Besides, AKAP8 depleted cell suggested lower proliferation and migration ratio comparing to control cell line (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF, G, H). It was implicated that high expression of AKAP8 promotes growth and migration in lung carcinoma cell. These results suggested that AKAP8 was regarded as one of oncogenes for lung carcinoma.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAKAP8 remodulates R-loop accumulation and transcription of UCP2 in lung cancer cell line.\u003c/b\u003e RNA-seq results in this study showed AKAP8 contributed to mitochondrial metabolism. One of most regulated gene of mitochondrial associated DEGs is UCP2. Lower survival probability was presented in UCP2 high expression patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). In addition, gene expression correlation analysis of AKAP8 and UCP2 was with significant p value (0.018) and positive R value. However, no significant correlation appeared to be found in both LUSC and normal tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). It is implicated that the positive regulation of UCP2 by AKAP8 may play roles in LUAD progress.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe estimated R-loop formation after AKAP8 depleted in A549. We confirmed mRNA level of UCP2 significantly reduced in AKAP8 knock down A549 cell line (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD). AKAP8 signal of its knock down cell was significantly decreased in according with expression level and nuclear S9.6 signal also reduced comparing to control cell (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). Further the R-loop level of UCP2 gene was estimated. The results showed R-loop significant accumulated in UCP2 promoter but bare changes in exon in AKAP8 knock down cell (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD). Together, these results suggested AKAP8 modulated R-loop of UCP2 promoter and mRNA level of UCP2 may play roles in lung adenocarcinoma progress (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we claim that AKAP family member AKAP8 binds with R-loop and is associated with cellular R-loop regulation. N terminal of AKAP8 is responsible for its nucleus location and interaction with DDX5. Depletion of AKAP8 contributes to interfere chromatin associated DDX5 and nuclear distribution within cells. The depletion ofAKAP8 also changes transcriptional profile in carcinoma cell line and regulates pathways including RNA metabolism and mitochondrial pathway. AKAP8 is predicted as positive regulator for lung cancer cell proliferation.\u003c/p\u003e \u003cp\u003eWe employed HBD (hybrid binding domain from RNase H), less instinct interactors comparing dead RNase H, and TurboID, harmless proximity label for cell comparing with APEX-H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e labeling system, to establish HBD-TurboID proximity labeling system for identifying R-loop interactors. We had verified this system by labeling and detection of previous known R-loop binding protein DHX9 and DDX5. Further we identified AKAP8 as new R-loop associated protein by this system. For HBD-TurboID proximity labeling system, 20% volume of cell extraction used in S9.6 immunoprecipitation is sufficient and more obvious signal of target protein can be achieved by western blotting in our experimental condition. It appears advantageous for detection of weak binding R-loop protein comparing with traditional S9.6 immunoprecipitation method. Nevertheless, one thing can\u0026rsquo;t be neglected that both S9.6 and HBD showed slight preference for dsRNA, like 1/25 affinity preference of S9.6 binding with RNA:DNA and 1/(16\u0026ndash;127) for that of HBD [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. There is possibility that R-loop interactors identified by using two methods may also contain dsRNA binding proteins. The interaction of AKAP8 with R-loop was conformed dsRNA independent by RNase treatment before S9.6 IP reaction.\u003c/p\u003e \u003cp\u003eAKAP8, instead of other two nuclear AKAPs, was identified as R-loop associated protein. AKAP8 is reported as scaffold for phosphorylation of substrate, post modification of histone, DNA damage and mRNA splicing [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. AKAP8 contains two ZF (zinc finger) domains in its middle region proposed function including mediation of chromatin condensation and RNA motif binding [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. ZF1 is responsible for its DNA binding ability while ZF2 is regarded to be dispensable for chromatin binding. ZF2 is required for condensing targeting and condensing recruitment possibly with help of adjacent residues [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Two ZF domains mediate AKAP8 binding to GC rich DNA in vitro [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].These motifs were supposed to involve in RNA splicing by direct binding with pre-mRNA [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. It is presumable that ZFs is also responsible for AKAP8 binding with genomic R-loop structure.\u003c/p\u003e \u003cp\u003eAKAP8 is reported with feature of liquid-liquid phase separation in vitro and within cell. N terminal IDR (intrinsically disordered region) 101-210aa of AKAP8 especial Tyr site is regarded as the pivot site responsible for phase-liquid dynamic status in nucleus. Mutation of IDR Tyr or deletion of IDR changes phase-liquid balance of nucleus AKAP8 in carcinoma cell resulting in disturb of RNA splicing [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. N terminal region 1-100 aa of AKAP8 is reported to interact with RNA processing proteins including splicing factors, RNA helicase and hnRNPs [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. NMTS and NLS is responsible for nucleus location of AKAP8 however they have a redundancy role implicated by our experiments. N terminal region 1-260aa of AKAP8 is responsible for DDX5 binding and NMTS region contained in this region is not dispensable. Recently, DDX5 homolog are reported to be featured with liquid-liquid phase separation with cells, so the interaction of AKAP8 and DDX5 is regarded to be complicated [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. It also may be associated to balance of nucleic and chromatin DDX5 modulated by AKAP8. N terminal region and ZFs of AKAP8 are possibly responsible for anchoring of DDX5 to genomic R-loop by AKAP8 which is needed to be deciphered in further study.\u003c/p\u003e \u003cp\u003eOur study revealed that AKAP8 contributed to cell growth and migration of lung carcinoma cell line. AKAP8 is reported to be closely related to tumorigenesis in diverse types of cancer. High expression level of AKAP8 positively contributes to growth of breast cancer cell maybe by regulation of inflammatory response and apoptosis gene expression as well as splicing of tumorigenesis gene [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. AKAP8 is considered as suppressor of tumor metastasis by antagonizing EMT (epithelial-mesenchymal transition) process [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Dynamically interacted with Cx43 (connexin 43) and competitively separates from cyclinE1/E2 to regulate G1/S conversion in lung carcinoma cells [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Besides, transforming growth factor beta(TGF-beta) is considered one of most main driver of fibrosis in progressive interstitial lung disease IPF (Idiopathic pulmonary fibrosis) [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. RNA-seq results show that knock down of AKAP8 disturbs TGF-beta/SMAD3 regulating patten. The regulation of TGF-beta by AKAP8 is also reported in previous research [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Therefore, it is not to be neglected the roles of AKAP8 in progress of lung disease and cancer.\u003c/p\u003e \u003cp\u003eDDX5 as a prognostic marker involves in proliferation and tumorigenesis of NSCLC (non-small cell lung cancer) cells through activating the β-catenin signaling pathway [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Evidence showed depletion of DDX5 reduced growth and mitochondrial dysfunction in chemo-resistant SCLC (small cell lung cancer) cell line by possibility of reduction of intracellular succinate which serves as direct electron donor to mitochondrial [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. DDX5 reduced expression in various cancer cell lines and tumor xenografts under hypoxia condition and rescued DDX5 in hypoxia showed R-loop levels accumulation further [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. DDX5 was phosphorylated at tyrosine residue in cell and was a cellular target of p38 MAP kinase. The phosphorylation of DDX5 showed effects on its RNA unwinding activity [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. However, there is no direct evidence that phosphorylation of DDX5 involved in R-loop resolution. AKAP8 is kinase anchoring protein and associated with kinase subcellular spatial orientation. Whether AKAP8 interacting with DDX5 direct DDX5 phosphorylation and play roles in regulating cellular R-loop level is an attractive question. Besides of its function in R-loop, DDX5 resolves G4 structure of oncogene MYC promoter to regulate its transcriptional activation [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Positive prognostic factor DDX5 expression is negatively associated with MYC expression in lung cancer [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. It is also interesting that DDX5 interacted with UCP2 in NSCLC cells and affected tolerance of cell to chemotherapy drugs by AKT/mTOR signaling [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Therefore, both AKAP8 and DDX5 play roles in lung carcinoma.\u003c/p\u003e \u003cp\u003eIn this study, we found that UCP2 transcription was down regulated but R-loop level of UCP2 gene promoter was up regulated in AKAP8 depleted lung carcinoma cell line. UCP2 locates in the mitochondrial inner membrane as member of mitochondrial anion carrier protein and has been demonstrated to regulate cellular metabolism and energy. UCP2 was reported as metabolism reprogramming to induce oxidative stress in age-associated lung fibrosis. Higher basal expression of UCP2 idiopathic pulmonary fibrosis (IPF) fibroblasts is closely related to elevating level of ROS contributing to oxidative stress [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. UCP2 promotes NSCLC proliferation via mTOR/HIF-α signaling pathway [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Blocking of UCP2 significantly decreased A549 cell viability [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Considering these evidences, it is not difficult to speculate that AKAP8, DDX5, R-loop and UCP2 showed a complex regulating net to remodel metabolism of lung carcinoma cell.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study reveals AKAP8 as an R-loop anchoring protein binds with DDX5 to form AKAP8/DDX5/R-loop microdomain. In addition, AKAP8 regulates R-loop balance and mitochondrial genes transcription to promote lung cancer cell growth, offering evidence for poor prognosis of lung cancer of high AKAP8 expression patients.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAKAP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eA kinase anchoring protein\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eUCP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emitochondrial uncoupling protein\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHBD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRNA:DNA hybrid binding domain\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eRDProx\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHBD proximity labeling\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSa\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003estreptavidin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHRP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehorseradish peroxidase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eaffinity precipitation\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eIP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eimmunoprecipitation\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eIF\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eimmunofluorescence\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDEG\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003edifferential expressed gene\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAPA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ealternative polyadenylation\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGSEA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGene set enrichment analysis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eKEGG\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eKyoto encyclopedia of genes and genomes\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNSCLC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003enon-small cell lung cancer\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDRIP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDNA:RNA hybrid immunoprecipitation\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere were no human participants and human data, and human tissue used in this study. No animal experiments were performed in this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe declare that our data does not contain any individual person\u0026rsquo;s data.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or produced during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Guangzhou National Laboratory Research Foundation (YW-YWYM0401) and National Natural Science Foundation of China (31900655).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eX.W. and L.L. designed this project. X.W. carried out experiment and wrote this manuscript. X.W. and L.L. revised the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIt was grateful to Feng Zhou (Guangzhou Laboratory) for regent ordering, Lanlan Zhang (Guangzhou Laboratory) for help of confocal microscope operation, Dr. Yaping Chen (Chinese Academy of Science) for kind gift of\u0026nbsp;pCR3.1-HA-AKAP8 plasmid,\u0026nbsp;Di Wu (Guangzhou Medical University) for kind gift of UMSC cell extraction, Lin Lu and Prof. Yan Wang (Sun Yat-sen University) for help of funding (31900655) managements and Prof. Dajiang Qin (The Fifth Affiliated Hospital of Guangzhou Medical University) for helpful advisement.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXu Wang: Guangzhou National Laboratory, No. 9 XingDaoHuanBei Road, Guangzhou International Bio-island, Guangzhou, Guangdong, 510005, China;\u0026nbsp;\u003ca href=\"mailto:[email protected]\"\[email protected]\u003c/a\u003e\u003c/p\u003e\n\u003cp\u003eLiang Liu: Guangzhou National Laboratory, No. 9 XingDaoHuanBei Road, Guangzhou International Bio-island, Guangzhou, Guangdong, 510005, China;\u0026nbsp;\u003ca href=\"mailto:[email protected]\"\[email protected]\u003c/a\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eThomas M, White RL, Davis RW. Hybridization of RNA to double-stranded DNA: formation of R-loops. Proc Natl Acad Sci U S A. 1976;73:2294\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrunseich C, Wang IX, Watts JA, Burdick JT, Guber RD, Zhu Z, et al. Senataxin Mutation Reveals How R-Loops Promote Transcription by Blocking DNA Methylation at Gene Promoters. Mol Cell. 2018;69:426\u0026ndash;e4377.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen PB, Chen HV, Acharya D, Rando OJ, Fazzio TG. R loops regulate promoter-proximal chromatin architecture and cellular differentiation. Nat Struct Mol Biol. 2015;22:999\u0026ndash;1007.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoque-Sastre R, Soler M, Oliveira-Mateos C, Portela A, Moutinho C, Sayols S, et al. Head-to-head antisense transcription and R-loop formation promotes transcriptional activation. Proc Natl Acad Sci U S A. 2015;112:5785\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRenaudin X, Lee M, Shehata M, Surmann E-M, Venkitaraman AR. BRCA2 deficiency reveals that oxidative stress impairs RNaseH1 function to cripple mitochondrial DNA maintenance. Cell Rep. 2021;36:109478.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRefaat AM, Nakata M, Husain A, Kosako H, Honjo T, Begum NA. HNRNPU facilitates antibody class-switch recombination through C-NHEJ promotion and R-loop suppression. Cell Rep. 2023;42:112284.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGroh M, Gromak N. Out of balance: R-loops in human disease. PLoS Genet. 2014;10:e1004630.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKannan A, Cuartas J, Gangwani P, Branzei D, Gangwani L. Mutation in senataxin alters the mechanism of R-loop resolution in amyotrophic lateral sclerosis 4. Brain. 2022;145:3072\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLim YW, Sanz LA, Xu X, Hartono SR, Ch\u0026eacute;din F. Genome-wide DNA hypomethylation and RNA:DNA hybrid accumulation in Aicardi-Gouti\u0026egrave;res syndrome. Elife. 2015;4:e08007.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCrow YJ, Manel N. Aicardi-Gouti\u0026egrave;res syndrome and the type I interferonopathies. Nat Rev Immunol. 2015;15:429\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan SLW, Chadha S, Liu Y, Gabasova E, Perera D, Ahmed K, et al. A Class of Environmental and Endogenous Toxins Induces BRCA2 Haploinsufficiency and Genome Instability. Cell. 2017;169:1105\u0026ndash;e111815.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRuiz JF, G\u0026oacute;mez-Gonz\u0026aacute;lez B, Aguilera A. AID induces double-strand breaks at immunoglobulin switch regions and c-MYC causing chromosomal translocations in yeast THO mutants. PLoS Genet. 2011;7:e1002009.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRibeiro de Almeida C, Dhir S, Dhir A, Moghaddam AE, Sattentau Q, Meinhart A, et al. RNA Helicase DDX1 Converts RNA G-Quadruplex Structures into R-Loops to Promote IgH Class Switch Recombination. Mol Cell. 2018;70:650\u0026ndash;e6628.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMersaoui SY, Yu Z, Coulombe Y, Karam M, Busatto FF, Masson J-Y et al. Arginine methylation of the DDX5 helicase RGG/RG motif by PRMT5 regulates resolution of RNA:DNA hybrids. EMBO J. 2019;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChakraborty P, Huang JTJ, Hiom K. DHX9 helicase promotes R-loop formation in cells with impaired RNA splicing. Nat Commun. 2018;9:4346.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXing Z, Wang S, Tran EJ. Characterization of the mammalian DEAD-box protein DDX5 reveals functional conservation with S. cerevisiae ortholog Dbp2 in transcriptional control and glucose metabolism. RNA. 2017;23:1125\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Song Y, Xu W, Li Q, Wang X, Li K, et al. R-loops coordinate with SOX2 in regulating reprogramming to pluripotency. Sci Adv. 2020;6:eaba0777.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNie X, Zhao C, Zhang Y, Huang W, Zhou Y, Liu H, et al. Nucleolar protein treacle ribosome biogenesis factor 1 maintains gastric cancer cell proliferation by regulating R-loop associated DNA replication stress. J Gastroenterol Hepatol. 2023;38:1170\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLangeberg LK, Scott JD. A-kinase-anchoring proteins. J Cell Sci. 2005;118:3217\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKubota S, Morii M, Yuki R, Yamaguchi N, Yamaguchi H, Aoyama K, et al. Role for Tyrosine Phosphorylation of A-kinase Anchoring Protein 8 (AKAP8) in Its Dissociation from Chromatin and the Nuclear Matrix. J Biol Chem. 2015;290:10891\u0026ndash;904.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartins S, Eikvar S, Furukawa K, Collas P. HA95 and LAP2 beta mediate a novel chromatin-nuclear envelope interaction implicated in initiation of DNA replication. J Cell Biol. 2003;160:177\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJarnaess E, Stokka AJ, Kvissel A-K, Sk\u0026aring;lhegg BS, Torgersen KM, Scott JD, et al. Splicing factor arginine/serine-rich 17A (SFRS17A) is an A-kinase anchoring protein that targets protein kinase A to splicing factor compartments. J Biol Chem. 2009;284:35154\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBou-Nader C, Bothra A, Garboczi DN, Leppla SH, Zhang J. Structural basis of R-loop recognition by the S9.6 monoclonal antibody. Nat Commun. 2022;13:1641.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNowotny M, Cerritelli SM, Ghirlando R, Gaidamakov SA, Crouch RJ, Yang W. Specific recognition of RNA/DNA hybrid and enhancement of human RNase H1 activity by HBD. EMBO J. 2008;27:1172\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang K, Wang H, Li C, Yin Z, Xiao R, Li Q, et al. Genomic profiling of native R loops with a DNA-RNA hybrid recognition sensor. Sci Adv. 2021;7:eabe3516.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBieluszewska A, Weglewska M, Bieluszewski T, Lesniewicz K, Poreba E. PKA -binding domain of AKAP 8 is essential for direct interaction with DPY 30 protein. FEBS J. 2018;285:947\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKong X, An P, Xu J, Liu W, Lin F, Yang Y. A-Kinase Anchor Protein 95 Is Involved in ERK1/2-Elk-1 Signal Transduction in Colon Cancer. Anal Cell Pathol (Amst). 2023;2023:8242646.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChan DKH, Mandal A, Hester S, Yu Z, Higgins GS, Kessler BM, et al. Biallelic FBXW7 knockout induces AKAP8-mediated DNA damage in neighbouring wildtype cells. Cell Death Discov. 2023;9:200.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCollas P, Le Guellec K, Task\u0026eacute;n K. The A-kinase-anchoring protein AKAP95 is a multivalent protein with a key role in chromatin condensation at mitosis. J Cell Biol. 1999;147:1167\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu J, Khodadadi-Jamayran A, Mao M, Shah K, Yang Z, Nasim MT, et al. AKAP95 regulates splicing through scaffolding RNAs and RNA processing factors. Nat Commun. 2016;7:13347.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEide T, Carlson C, Task\u0026eacute;n KA, Hirano T, Task\u0026eacute;n K, Collas P. Distinct but overlapping domains of AKAP95 are implicated in chromosome condensation and condensin targeting. EMBO Rep. 2002;3:426\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarstad A, Landsverk OJB, Str\u0026oslash;mme O, Otterlei M, Collas P, Sundan A, et al. A-kinase anchoring protein AKAP95 is a novel regulator of ribosomal RNA synthesis. FEBS J. 2016;283:757\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu J, Khodadadi-Jamayran A, Mao M, Shah K, Yang Z, Nasim MT, et al. AKAP95 regulates splicing through scaffolding RNAs and RNA processing factors. Nat Commun. 2016;7:13347.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi W, Hu J, Shi B, Palomba F, Digman MA, Gratton E, et al. Biophysical properties of AKAP95 protein condensates regulate splicing and tumorigenesis. Nat Cell Biol. 2020;22:960\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang J, Zhao Y, Liu S, Chen Y, Du M, Wang Q, et al. RH20, a phase-separated RNA helicase protein, facilitates plant resistance to viruses. Plant Sci. 2024;347:112176.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarel I, Chen YR, Ziv I, Singh PP, Heinzer D, Negredo PN et al. Identification of protein aggregates in the aging vertebrate brain with prion-like and phase-separation properties. Cell Reports [Internet]. 2024 [cited 2024 Jul 12];43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.cell.com/cell-reports/abstract/S2211-1247(23)00798-2\u003c/span\u003e\u003cspan address=\"https://www.cell.com/cell-reports/abstract/S2211-1247(23)00798-2\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu X, Harvey SE, Zheng R, Lyu J, Grzeskowiak CL, Powell E, et al. The RNA-binding protein AKAP8 suppresses tumor metastasis by antagonizing EMT-associated alternative splicing. Nat Commun. 2020;11:486.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen R, Chen Y, Yuan Y, Zou X, Sun Q, Lin H, et al. Cx43 and AKAP95 regulate G1/S conversion by competitively binding to cyclin E1/E2 in lung cancer cells. Thorac Cancer. 2020;11:1594\u0026ndash;602.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X, Kong X, Zhuang W, Teng B, Yu X, Hua S, et al. Dynamic changes in protein interaction between AKAP95 and Cx43 during cell cycle progression of A549 cells. Sci Rep. 2016;6:21224.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoung ON, Bourke JE, Widdop RE. Catch your breath: The protective role of the angiotensin AT2 receptor for the treatment of idiopathic pulmonary fibrosis. Biochem Pharmacol. 2023;217:115839.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z, Luo Z, Zhou L, Li X, Jiang T, Fu E. DDX5 promotes proliferation and tumorigenesis of non-small-cell lung cancer cells by activating β-catenin signaling pathway. Cancer Sci. 2015;106:1303\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXing Z, Russon MP, Utturkar SM, Tran EJ. The RNA helicase DDX5 supports mitochondrial function in small cell lung cancer. J Biol Chem. 2020;295:8988\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeszczynska KB, Dzwigonska M, Estephan H, Moehlenbrink J, Bowler E, Giaccia AJ, et al. Hypoxia-mediated regulation of DDX5 through decreased chromatin accessibility and post-translational targeting restricts R-loop accumulation. Mol Oncol. 2023;17:1173\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang L, Lin C, Liu Z-R. Signaling to the DEAD box\u0026ndash;regulation of DEAD-box p68 RNA helicase by protein phosphorylations. Cell Signal. 2005;17:1495\u0026ndash;504.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu G, Xing Z, Tran EJ, Yang D. DDX5 helicase resolves G-quadruplex and is involved in \u003cem\u003eMYC\u003c/em\u003e gene transcriptional activation. Proc Natl Acad Sci USA. 2019;116:20453\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui Y, Hunt A, Li Z, Birkin E, Lane J, Ruge F, et al. Lead DEAD/H box helicase biomarkers with the therapeutic potential identified by integrated bioinformatic approaches in lung cancer. Comput Struct Biotechnol J. 2021;19:261\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Z, Li G, Zhao Y, Zhang L, Yuan X, Meng L, et al. Molecular Insights into the Recruiting Between UCP2 and DDX5/UBAP2L in the Metabolic Plasticity of Non-Small-Cell Lung Cancer. J Chem Inf Model. 2021;61:3978\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRangarajan S, Locy ML, Chanda D, Kurundkar A, Kurundkar D, Larson-Casey JL et al. Mitochondrial uncoupling protein‐2 reprograms metabolism to induce oxidative stress and myofibroblast senescence in age‐associated lung fibrosis. Aging Cell [Internet]. 2022 [cited 2023 Apr 20];21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://onlinelibrary.wiley.com/doi/\u003c/span\u003e\u003cspan address=\"https://onlinelibrary.wiley.com/doi/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/acel.13674\u003c/span\u003e\u003cspan address=\"10.1111/acel.13674\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong C, Liu Q, Qin J, Liu L, Zhou Z, Yang H. UCP2 promotes NSCLC proliferation and glycolysis via the mTOR / HIF -1α signaling. Cancer Med. 2024;13:e6938.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee JH, Cho YS, Jung K-H, Park JW, Lee K-H. Genipin enhances the antitumor effect of elesclomol in A549 lung cancer cells by blocking uncoupling protein\u0026ndash;2 and stimulating reactive oxygen species production. Oncol Lett. 2020;20:1\u0026ndash;1.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"R-loop, AKAP8, cell growth, lung carcinoma","lastPublishedDoi":"10.21203/rs.3.rs-4868523/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4868523/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cb\u003eBackground\u003c/b\u003e\u003c/p\u003e \u003cp\u003eRNA:DNA hybrid structure known as R-loop, which forms during transcription plays a pivotal roles in transcriptional regulation. Dysregulation of R-loop dynamics disrupt normal DNA replication or RNA transcription, potentially leading to disturbances of cell metabolism, abnormal cell proliferation and disease progression.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMethods\u003c/b\u003e\u003c/p\u003e \u003cp\u003eInteractome data of nucleic AKAPs and R-loop were collected and analyzed to nominate the candidate of AKAP8 (A-kinase-anchoring protein 8) as R-loop binding protein. The interaction of AKAP8 and R-loop were confirmed by co-immunoprecipitation and immunofluorescence. R-loop resolution protein DDX5 were identified to interact with AKAP8 and its nucleic abundance was estimated. AKAP8 knock down cell lines were constructed. The mRNA profile and differential expressed genes of were analyzed. Downstream target gene UCP2 was confirmed upregulate by AKAP8 and R-loop level of UCP2 promoter was estimated. Cell growth and migration of lung carcinoma cell line with depletion of AKAP8 or not were also investigated by EdU, colony formation and wound healing essay. Expression score of AKAP8 comparing lung cancer tissue with normal tissue, and correlation between survival possibility of lung cancer patients and expression level of AKAP8, were also investigated.\u003c/p\u003e\u003cp\u003e\u003cb\u003eResults\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThis study identified that AKAP8 interacted with R-loop structure within cells. Depletion of AKAP8 resulted in perturbation of genomic R-loop balance and gene transcription. Evidences was shown that AKAP8 interacted with R-loop resolution protein DDX5 and regulated chromatin associated DDX5 level. Furthermore, AKAP8 was found to enhance transcription uncoupling protein UCP2 as well as alleviate R-loop level of UCP2 promoter, and promoted cell growth and migration of lung carcinoma cell. The lower survival possibility was found in lung cancer patients with high level AKAP8 expression.\u003c/p\u003e\u003cp\u003e\u003cb\u003eConclusions\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThis study elucidates novel roles of AKAP8 in modulating R-loop balance by cooperation of DDX5 and AKAP8 is as one of the motivators for lung carcinoma cell growth contributed by mitochondrial metabolism. This insight may offer prognostic significance for patients with lung adenocarcinoma exhibiting higher AKAP8 expression.\u003c/p\u003e","manuscriptTitle":"AKAP8 regulates R-loop balance and promotes growth of lung carcinoma cell","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-16 00:42:17","doi":"10.21203/rs.3.rs-4868523/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7094d416-7f09-4a3b-9d92-13eb4ce1e9fb","owner":[],"postedDate":"September 16th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-09-16T00:42:19+00:00","versionOfRecord":[],"versionCreatedAt":"2024-09-16 00:42:17","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4868523","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4868523","identity":"rs-4868523","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00