Effects of Rock Phosphate Application on the Composition of Bacterial Communities Associated with Arbuscular Mycorrhizal Fungal Mycelia

Effects of Rock Phosphate Application on the Composition of Bacterial Communities Associated with Arbuscular Mycorrhizal Fungal Mycelia | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effects of Rock Phosphate Application on the Composition of Bacterial Communities Associated with Arbuscular Mycorrhizal Fungal Mycelia Zakaria Lahrach, Jean Legeay, Bulbul Ahmed, Mohamed Hijri This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8829244/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Background Inter-kingdom interactions between arbuscular mycorrhizal fungi (AMF) and bacteria are increasingly recognized for their potential to enhance fertilizer use efficiency in agroecosystems. Here, we investigated the effects of rock phosphate amendment and AMF inoculation on phosphorus (P) nutrition in leek ( Allium porrum L.), as well as on bacterial communities associated with AMF extraradical mycelium. A bi-compartmental microcosm was used to disentangle root-derived effects from those mediated by AMF mycelium. Results Inoculation with Rhizophagus irregularis significantly increased total plant biomass ( p < 0.001), while rock phosphate amendment enhanced arbuscule abundance in roots ( p = 0.03), leading to higher shoot P content ( p = 0.013) and photosynthetic activity ( p < 0.0001). Because rock phosphate was the sole P source, these results indicate that P solubilized in the soil was translocated to the host plant via the mycorrhizal pathway. Rock phosphate amendment also significantly altered the composition of bacterial communities associated with AMF mycelium ( p = 0.01). Across treatments, bacterial assemblages were dominated by Planctomycetota, Pseudomonadota, Chloroflexota, and Bacillota, with enrichment of Planctomyces and Gemmata in AMF mycelium, and Planctomyces , Gemmata , and Bacillus in soil. The core bacteriome associated with R. irregularis was primarily composed of Planctomycetota and Bacillota, taxa known to form biofilms on AMF extraradical hyphae. Conclusion These findings demonstrate the pivotal role of mycorrhizal symbiosis in enhancing P acquisition from rock phosphate and provide new insights into AMF–bacteria interactions that are relevant for developing sustainable fertilization strategies. arbuscular mycorrhizal fungi core bacteriome community structure symbiosis phosphorus rock phosphate Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Agroecosystem productivity relies on the continuous input of phosphate-based processed chemical fertilizers to maintain soil fertility; this is because the depletion of bioavailable phosphorus (P) occurs as the rate of uptake by crop roots often exceeds nutrient dissolution from bulk soils [ 1 ]. Advances in plant breeding have led to the selection of crops highly dependent on these chemical fertilizers, particularly commodity crops such as corn, wheat, rice, and potato, without considering the contributions of crop microbiota, which potentially represent an alternative genetic reservoir that has barely been tapped [ 2 ]. The root-associated microbiome is a key determinant of soil nutrient availability, plant biomass productivity, and pollutant degradation [ 3 ]. Soil microbes have long been known to contribute to plant health by facilitating nutrient acquisition, inhibiting pathogens, and protecting plant roots against abiotic stresses [ 2 ]. Beneficial soil microbes provide important ecological services to natural and agricultural ecosystems [ 4 ], and, given their potential to positively influence agricultural productivity, harnessing these microbes is a major goal for environmental and agricultural biotechnologies [ 5 ]. Arbuscular mycorrhizal fungi are both root- and soil-inhabiting symbionts and are among the most common soil fungi. They form symbioses with the roots of 71% of all vascular plant species [ 6 ], providing invaluable services for the plants, in particular improving the capacity for P uptake in return for carbon from the host plants [ 7 ]. Additionally, mycorrhizae can provide plants with increased resistance to root pathogens [ 8 – 10 ], alleviate abiotic stress [ 11 ], and improve soil quality by aggregating soil particles and decreasing soil erosion [ 12 , 13 ]. It is becoming recognized that some of the presumed benefits of mycorrhizal symbiosis, such as P uptake and nutrient cycling, are in fact dependent on the interaction between AMF and their associated microbes [ 14 – 18 ]. AMF hyphae also serve as physical pathways for microbial mobility and dispersal [ 19 ], and studies have shown that AMF interact closely with myriad bacteria and fungi that can be exploited to enhance mineral immobilization for plants [ 20 – 23 ]. In AMF–soil bacteria interactions, soil microbes can interact with AMF synergistically, adversely, or commensally. An early study [ 24 ] reported evidence of the presence of bacteria on the AMF spore wall, and a later research study showed that bacteria can invade the spore wall layers and survive in the spore cytoplasm [ 25 ]. Several subsequent studies have reported that diverse bacterial communities are associated with AMF spores [ 21 , 26 – 28 ]. Bacteria belonging to the genera Burkholderia, Pseudomonas, Variovorax , and Chromobacterium were more frequently associated with the AMF Rhizophagus irregularis [ 23 , 29 ], while the authors of Scheublin, et al. [ 30 ] reported that the Oxalobacteraceae family was more specifically associated with the AMF hyphal surface than other bacteria. Moreover, Selvakumar, et al. [ 31 ] isolated 120 strains of bacteria associated with AMF spores belonging to three species ( Funneliformis caledonium, Funneliformis mosseae , and Racocetra alborosea ) using a culture-dependent approach, and the authors characterized and tested these bacterial strains for the following spore functional traits: chitinase, protease, cellulase enzymes, and exopolysaccharide production. These authors [ 31 ] also found that among the 120 isolated bacterial strains, 113 showed at least one functional trait, while 7 strains showed none. The cell wall of AMF is composed of chitin, proteins, and polysaccharides [ 32 ]. Biopolymer-degrading microbes adhering to the spore and hyphal outer layer might use oligomers of chitin as a carbon source [ 33 ], while AMF-associated microbes may also use other cell wall components as a nutrient source. So far, spore-associated bacteria have been isolated from the spore cytoplasm [ 34 ], surface sterilized spores and hyphae, and were reported to either stimulate fungal growth or increase plant nutrient uptake [ 23 , 30 ]. Moreover, the close interaction between AMF and hyphosphere bacteria has been shown to increase plant growth by enhancing phosphate solubility [ 35 , 36 ] and fixing atmospheric nitrogen [ 37 ] and can contribute to AMF spore germination and plant root colonization [ 34 ]. It is well documented that AMF identity influences the microbial communities associated with plant roots and the rhizosphere [ 21 ]. A recent study by Lahrach, et al. [ 38 ] demonstrated that the organismal phylogeny of AMF shapes the bacterial communities associated with their mycelia. However, the factors driving shifts in the microbial community associated with AMF mycelia remain unclear. Finely ground soft rock phosphate fertilizers can be used for direct application under specific conditions, such as permanently moist and acid soils [ 39 ]. However, in most cases, rock Phosphate (RP) does not show agricultural effectiveness, due to its low rate of dissolution. However, some biological solutions, such as the culture of green manure crops [ 40 ] or the use of rhizobacteria can increase the solubilization of RP [ 41 ]. In this study, we investigated the impact of RP amendment on AMF–bacteria interactions. We hypothesized that 1) RP amendment influences the bacterial community associated with AMF mycelium, and 2) RP amendment and AMF inoculation enhance the P nutrition of leek plants. To test these hypotheses, we designed a bi-compartmentalized microcosm to separate root effects from AMF mycelium effects, using leek as the host plant, in a greenhouse trial. We employed metabarcoding targeting the 16S rRNA gene to determine bacterial community changes in the mycelia, bulk soil, and hyphosphere associated with AMF mycelia. This setup allowed us to precisely analyze how RP amendment and AMF inoculation influence bacterial community structure and contribute to the P nutrition of leek plants. Materials and methods Microcosm setup and substrate preparation The investigation utilized microcosm units to partition the soil and ensure the physical separation of AMF mycelia in the root-free compartment (RFC) from the plant roots in the root compartment (RC). Each unit consisted of two pots, measuring 6.5 x 6.5 x 8.5 cm (LxWxH), which were bonded together using silicon glue. One pot served as the plant growth compartment (RC), and the other facilitated hyphal propagation (RFC). The pots had a cut side with a 44 µm membrane (manufactured by SEFAR Incorporation, USA) that enabled interconnection without root passage. Before initiating the experiment, the microcosms were sanitized with 70% ethanol and exposed to UV light under laminar flow for 30 minutes. A sandy loam soil of low P content was collected from the organic farm of the IRDA research station in St-Bruno in Québec (45°32’59.6” N, 73°21’08.0” W). This soil was characterized by a pH of 6.01 and a Mehlich-3 extractable phosphorus concentration of 0.41 mg/kg of soil [ 42 ]. The soil analysis was performed using a commercial service provided by EnvironeX (Longueuil, QC). The chemical properties were described by Renaut, et al. [ 42 ]. The soil was air-dried, sieved at 2 mm, and then mixed with sand (Bomix company, Laval, QC) at a ratio of 1:1 (v/v) to produce a growth substrate with depleted phosphorus level. To eradicate the indigenous microorganisms, both the substrate and RP were sterilized using γ-irradiation with a minimum dose of 22.3 kGy and a maximum of 46.2 kGy (Nordion’s Gamma Centre of Excellence, Laval, QC). The sterilization was confirmed via the serial dilution method and inoculation of the tryptic soy agar (TSA) plates. Each compartment of the microcosm received around 333 g of the substrate and RP was added where required. An amount of 0.16 g of RP per pot was homogenized with the RFC substrate to provide the equivalent of approximately 100 kg P₂O₅ per hectare. The RP used in this study, as the sole source of P, was the sedimentary RP with a bone phosphate of lime ≥ 54 %, kidly supplied by OCP Group, Morocco. Host plant and microbial inoculum Seeds from leek ( Allium porrum ) (McKenzie Seeds, Canada), a highly mycotrophic plant, were used as a host. Under sterile conditions in a laminar flow, the seeds were surface sterilized with ethanol (70%) for 30 s and then bleached (15%) for 5 min, and were then rinsed abundantly with sterile distilled water. The seeds were kept soaked in the last rinsing water for 2h. Three surface-sterilized seeds were sown into each RC at a depth of 5 mm. The spores of the AMF Rhizophagus irregularis DAOM 197198, kindly provided by Premier Tech, Canada, were used to inoculate the seeds at the same time of sowing of each mycorrhizal treatment. To enhance the chance of root colonization by the AMF, a second application was performed one month after the first, directly to the roots after thinning the plants to one per microcosm. The AMF species was chosen based on its in vitro production process, its application as a commercial inoculant in agriculture, and its large distribution [ 43 ]. In each AMF inoculation, the seeds/seedlings received 200 spores diluted in 300 µl of sterile distilled water. To enrich the soil microbial community, a microbial suspension was prepared from natural soil collected from the rhizosphere of organically cultivated crops within the Botanical Garden of Montreal. Soil subsamples were taken separately from potato, leek, tomato, eggplant, and maize during the flowering season and transferred to the lab. The rationale behind using many crop soils was to diversify microbial communities. A composite sample was prepared by pooling equal amounts from each of the five rhizosphere soil samples and homogenizing the mixture. Six kilograms of the composite soil were sieved through a 2 mm mesh to remove roots and rock fragments, and then divided into 3 portions. Firstly, we mixed 1/3 of the soil (2 kg) with 4 L of sterilized distilled water, and the soil was brought into suspension via stirring for 30 min and then kept for at least 2 h at room temperature. The liquid phase of the soil suspension was filtered through autoclaved sieves with mesh widths of 53 µm and 20 µm. This filtration excludes AMF spores in the soil suspension. The same operation was used for the second and the third soil portions using the soil suspension obtained from the first and the second filtration, respectively. The final filtrate was collected in a sterile Erlenmeyer flask and considered as the microbial suspension. The inoculation with the microbial suspension of the RFC substrate was performed two months after the second AMF inoculation using 50 mL of the microbial suspension. Experimental design This study represents a subset of an experiment on the recruitment profile of microbes by AMF carried out in a greenhouse using the microcosm units described earlier. The study examined the effect of sedimentary RP on the community structure of bacteria associated with the mycelium of the AMF R. irregularis DAOM 197198. Two factors were considered: (1) two levels of RP, with or without RP application, and (2) two AMF levels, inoculated or uninoculated. Consequently, the experiment involved four treatment combinations: M0P0, M0P1, M1P0, and M1P1, where M refers to AMF, P to RP, 0 to absence and 1 indicates presence. The trial was organized using a randomized block design, comprising nine replicates on a mesh table to prevent the risk of cross-contamination through water. Three replicates were established each week over a period of three weeks. Leek plants were grown under conditions of photoperiod (16/8 h day/night) and temperature (21/18°C day/night). An additional set of microcosm units was prepared and inoculated with AMF to monitor plant colonization and the presence of mycelia in the RFCs. A layer of calcinated clay of granules (Turface®), approximately 1 cm thick, was added on top of the microcosm pots to cover the soil surface, and it was renewed weekly to minimize or prevent surface contamination by microalgae. The microcosms were watered to maintain soil moisture at holding capacity. Once a week, the plant compartments received 50 mL of modified half-strength Long Ashton nutrient solution containing 22 ppm (0.71 mM) of P. This concentration of P is known to enhance AMF-induced root colonization [ 44 ]. Two months after the second inoculation with the AMF spores (a period allowing the establishment of extraradical AMF mycelia in the RFCs), all RFCs were treated with 50 mL of microbial suspension. Afterwards, the irrigation regime was switched and the diluted nutrient solution without P was supplied once a week to the RFCs. The microcosms were kept watered with tap water as needed throughout the week. Harvest and plant analysis Growth parameters and chlorophyll concentration The harvest was performed five months after setting up the experiment over three weeks to ensure consistent timing across all replicates. Before cutting the shoots, the stem diameter of plants was measured with an electronic caliper at 5 mm above the soil. To verify the effect of the treatments on the plant's photosynthetic activity, an atLEAF chlorophyll meter (FT Green LLC, USA) was used to evaluate the concentration of chlorophyll (µg/cm 2 ) on the fully expanded third or fourth leaf from the top according to the manufacturer’s instructions. Afterward, each microcosm was disassembled, and the RC was carefully discharged. The roots were rinsed with sterile distilled water, and the shoots were cut from the roots, put in a paper bag, and dried in a hot-air oven at 80°C for 72 h. The dry biomass was recorded, and the shoots were ground with a clean dried pestle and mortar for further chemical analysis. The fresh roots were weighed, and to evaluate the mycorrhizal colonization, a small amount of fine roots was placed in a separate 15 mL falcon tube containing 8 mL of 50% ethanol. The remaining roots were weighed a second time and then dried in the oven under the same conditions as the shoots. The second fresh root weight helped to calculate the total amount of dry root weight. Mycorrhizal colonization and phosphorus content The mycorrhizal colonization ratio was evaluated using the ink and vinegar staining method [ 45 ]. The roots preserved in 50% ethanol were washed with tap water and cut into 1 cm long segments. The root segments were cleared in a 10% KOH solution boiling at 90°C for 3 to 4 min until they became transparent and were then rinsed with distilled water. To remove the KOH residues, the roots were soaked in another bath of 1% acetic acid for 4 min. Cleared roots were placed in a 5% ink–vinegar solution at 90°C for 3 min and rinsed with distilled water and then stored in a lactoglycerol solution for a minimum of 24 h at room temperature to remove the excess of ink solution. The stained root segments were mounted on microscope slides with fine-point forceps, and the degree of mycorrhization was determined via the intersection method [ 44 ]. The numbers of arbuscules, vesicles, and intraradical mycelia were counted and the percentages were calculated. The ground shoots were used to determine the total phosphorus content via the modified dry ash method [ 46 ]. Ground shoot aliquots of 0.5 g were incinerated at 500°C for 4 h and digested in 100 mL borosilicate Erlenmeyer containing 6 mL and 1 mL of concentrated sulfuric acid and nitric acid, respectively. The resulting solutions were filtered in an acid-washed flask, filled up to 100 mL with demineralized water, and then homogenized before P concentration analysis via the molybdenum blue colorimetric technique [ 47 ]. The shoot P content (µg) was subsequently calculated from the P concentration and shoot biomass. Extraradical mycelia collection Prior to harvesting the substrate from the hyphal compartment, Turface layer with the top 1 cm of the substrate was removed along with a 1 cm width strip from the membrane side of the substrate to reduce bacterial communities affected respectively by potential surface contamination and by root exudates near the membrane. Afterwards, about 10 mL of the substrate was collected in a 15 mL falcon tube. To collect the extraradical mycelia, the rest of the substrate was transferred to a 1 L sterile glass jar and covered with cold sterile distilled water to a height of almost 1 cm. The jar was lidded, vigorously shaken, and left to stand for approximately 15 min. During this time, the extraradical mycelia of AMF began to agglomerate due to their adhesive properties. Next, the solution was poured through a sterile 40 µm mesh sieve, and this procedure was repeated four to five times until there were no mycelial aggregates observed. To clean them as much as possible from the attached particles, the extraradical mycelia were rinsed with cold sterile saline solution of 0.9% NaCl, after which they were transferred to a microcentrifuge tube using sterile forceps. Mycelia samples were squeezed to remove any remaining liquids, and the weights were recorded. Regarding the non-mycorrhizal RFCs, no extraradical mycelia were found. All tubes containing substrate and mycelia samples were immediately flash frozen in liquid nitrogen after sampling and kept on dry ice in a cooler box before being stored in the freezer at -80°C for the downstream analysis of nucleic acids. DNA extraction and PCR amplification Just before DNA extraction from the substrate, all the samples were transferred into 50 mL falcon tubes with pierced lids and placed in a lyophilizer for 3 days until dried. Then, the samples were sieved with a 1 mm mesh sieve to facilitate substrate particle separation. Hereinafter, the materials resulting from the M1 and M0 treatments were named, respectively, hyphosphere soil and bulk soil. The bulk and hyphosphere soil DNA was extracted from 250 mg of homogenized soil of each sample using the DNeasy PowerSoil Pro Kit (QIAGEN, Canada) according to the manufacturer’s protocol. We performed the DNA extraction from mycelia using the DNeasy Plant Mini Kit (QIAGEN, Canada) following the manufacturer’s instructions, starting by grinding about 50 mg of liquid nitrogen-frozen samples in 1.5 mL tubes containing sterile white sand, which facilitates cell lysis. The elution step was performed in 50 µL of elution buffer for bulk and hyphosphere soils and in 20 µL for mycelia and stored at -20°C. Therefore, genomic DNA extracts were first visualized via gel electrophoresis on 1% agarose stained with GelRed diluted at a ratio of 1/10000 using the GelDoc System (BioRad, Montreal, QC, Canada). The DNA concentration was determined using the Qubit 2.0 Fluorometer (ThermoFisher, Canada) and the Qubit double-stranded DNA (dsDNA) HS Assay Kit. To investigate the total bacterial community, the V3-V4 region of 16S rRNA gene was targeted using Platinum™ Direct PCR Universal Master Mix (ThermoFisher, Canada). The amplicon libraries were constructed using the primers pair of 341F (5’-CACCTACGGGNGGCWGCAG-3’) and 805R (5′-ACTACHVGGGTATCTAATCC-3′) tagged, respectively, with CS1 (5’- ACACTGACGACATGGTTCTA -3’) and CS2 (5′- TACGGTAGCAGAGACTTGGTCTG -3′), which permit barcoding [ 48 ]. The PCR amplification was performed in a 25 µL volume reaction mix containing 10 µL of Platinum Direct PCR Universal Master Mix, 0.25 µM of each primer, 4 µL of Platinum GC Enhancer, 7 µL of water, and 1 µL of template DNA. Negative controls with only water were included in each PCR run. The thermal cycling conditions were as follows: initial step of activation at 94°C for 2 min, followed by 35 cycles of denaturation at 94°C for 15 s, annealing at 60°C for 30 s and extension at 68°C for 20 s, and a final extension at 68°C for 1 min with a hold at 10°C. PCR reactions were amplified in an Eppendorf Mastercycler Pro thermocycler (Eppendorf, Canada). The amplification was confirmed by running the PCR products on a 1% agarose gel. Amplicons were sent for Illumina MiSeq sequencing using 2 × 300 bp paired-end reads which were demultiplexed on the instrument in the NGS platform at the Genome Quebec Innovation Centre (Montreal, QC, Canada). Bioinformatics and statistical analyses A bioinformatic analysis was performed using QIIME2 version 2021.4.0 [ 49 ]. The pipeline used to process the 16S rRNA gene sequences was DADA2 v1.18.0 [ 50 ]. Initially, Cutadapt 3.4 was employed to remove both primer sequences from the 16S rRNA gene amplicons with parameter values “minimum-length = 50”, “times = 2”, “overlap = 6”, and “p-error-rate = 0.1”. Next, we excluded the forward and reverse sequences with less than 220 bp with the command “--p-trunc-len”, as the base quality of the sequences tended to diminish below that threshold in our data. Afterwards, the amplicon sequence variant (ASV) table was calculated, and chimeras were removed. The taxonomy assignment of the ASVs was performed using the naive Bayesian classifier method on the databases SILVA and RDP, and the identities of the ASVs of interest were verified manually using BLASTn on the NCBI (nr/nt) database. AMF and plant-related parameters were analyzed employing JMP Pro 17 software (SAS Institute Inc., Cary, NC, USA). Shapiro–Wilk test was used to verify the normal distribution of the data, and Levene’s test to determine the homoscedasticity. The data of root dry-weight biomass and root colonization were transformed using Box–Cox method before performing statistical analyses. An analysis of variance (ANOVA) was used to assess the effects of AMF inoculation, RP application, and their interactions, followed by Tukey's HSD test to compare the mean values, which differed at p < 0.05. AMF inoculation and RP addition were considered as fixed effects, and the random effect was attributed to the block. Microbial diversity analysis was performed using R (Version 4.3.2); the rare-curve function from the vegan package v2.6-4 [ 51 ] was employed for normalizing the dataset through a random subsampling process that aligned each sample's read data to the minimal read count observed in the dataset. Shannon and Simpson diversity indices were computed to quantify alpha diversity utilizing the vegan package. The influence of RP applicationon alpha diversity was statistically examined via an ANOVA, followed by post hoc analyses using the agricolae package v1.3-7 [ 52 ]. The beta diversity of bacterial ASVs across samples was determined using Bray–Curtis dissimilarity and visualized with principal coordinate analysis (PCoA) plots using the vegan package. The vegan package's ADONIS function was used for the permutational multivariate analysis of variance to evaluate the effects of AMF and RP application on betadiversity, applying a Hellinger-transformation to the data and executing 999 permutations. An indicator species analysis was conducted via the indicspecies package v1.7-14 [ 53 ] to identify the taxa associated with the application of RP. In defining the core microbiome, the designation “core bacteriota” was attributed to the bacterial taxa consistently detected in the mycelial or hyphosphere soil samples associated with the AMF R. irregularis . The core bacteriome was identified using the microbiome package v1.24-0 [ 54 ] with 95% prevalence. The co-occurrence network was built using the R packages [ 55 ] and igraph [ 56 ] only using ASVs with a total abundance superior to 0.05%, thus retaining only 1567 ASVs. Metabolic pathways associated with the taxonomy of bacteria were calculated using the Picrust2 of Galaxy tool [ 57 ]. The taxa associated with treatments were identified using the microbial package in R [ 58 ] and its “ldamarker” command, which implements the Linear discriminant analysis effect size (LEFSe) method. Results Mycorrhizal colonization and mycelial production The mycorrhizal colonization was successfully established in the plants inoculated with R. irregularis , whereas no colonization was observed in non-mycorrhizal roots. Means were 94.82% and 89.32% under the presence and absence of RP respectively, which explains the quantity of mycelial biomass extracted from the hyphal compartment (Table 1 ). While no hyphae were found in the absence of R. irregularis inoculation, they multiplied extensively in the hyphal compartment when the plants were colonized (Table 1 ). RP did not significantly influence the mycelial biomass, the percentages of mycorrhizal colonization and vesicle formation. Surprisingly, the percentage of arbuscules was significantly affected by the RP application ( p = 0.03). Table 1 Mycorrhizal colonization and fresh biomass of the hyphae in the RFC. The abbreviations M1P0 and M1P1 indicate samples inoculated with R. irregularis without RP and those inoculated with R. irregularis and supplemented with RP, respectively. Treatments Mycelial biomass (mg/pot) Mycorrhizal colonization (%) Arbuscules (%) Vesicles (%) M1P0 117.95 ± 27.96 a 89.32 ± 3.66 a 62.86 ± 10.69 a 69.49 ± 6.90 a M1P1 109.60 ± 19.95 a 94.82 ± 2.37 a 90.12 ± 2.23 b 74.07 ± 4.64 a Data are presented as the mean value (n = 9) and standard error. The significance of treatments was determined by one-way ANOVA. Lowercase letters indicate significance at the p < 0.05 level. Plant productivity Plant biomass and stem diameter Agronomic parameters of Allium porrum were affected by the treatments (Fig. 1 ). The colonization with R. irregularis significantly enhanced both root ( p < 0.001) and shoot dry weight biomass ( p < 0.001) (Table S1 , Fig. 1 A, B). However, RP application did not influence shoot ( p = 0.373) and root ( p = 0.493) dry-weight biomass (Table S1 , Fig. 1 A, B). A similar trend was exhibited for stem diameter (Fig. 1 C). While the application of AMF spores significantly increased the stem diameter ( p < 0.001), RP application was statistically insignificant ( p = 0.702) (Table S1 ). However, the combined treatment (M1P1) tended to increase the stem diameter ( p = 0.07) (Table S1 ). M1P1 treatment improved plant biomass and stem diameter by 125.14% and 51.47%, respectively, compared to the control (Table S1 ). Shoot P concentration and photosynthetic capacity Although RP application tended to increase shoot P concentration ( p = 0.072), mycorrhization significantly increased the total P acquired by plants ( p = 0.014) compared to the control (Fig. 2 A; Table S2). Moreover, mycorrhizal plants supplied with RP (M1P1) exhibited 135% increase in shoot P content (P concentration × shoot biomass) relative to the control (Fig. 2 A; Table S2). Regarding photosynthetic capacity, both RP application ( p = 0.017) and AMF inoculation ( p < 0.001) significantly increased chlorophyll concentration compared to the control (Fig. 2 B; Table S2). The combined treatment (M1P1) resulted in the highest chlorophyll concentration, representing a 60% increase relative to the control (Fig. 2 B; Table S2). Taxonomic profiles of the bacteria Raw Illumina MiSeq 16S rRNA gene sequencing generated a total of 2,513,803 bacterial reads. We retrieved 1,004,950 non-chimeric reads from 54 samples, ranging from 1,948 to 91128 reads per sample (two samples were excluded due to insufficient sequencing quality). An extra cleaning of the dataset was performed to remove unidentified ASVs at the phylum level as well as those with fewer than 10 reads in all samples. The final dataset comprised a total of 7514 ASVs, which were subsequently categorized into 31 phyla, 85 classes, 130 orders, 149 families, and 194 genera. The rarefaction curves indicated that all samples had reached saturation (Fig. S1 ). In each of the habitats, Planctomycetota was the most abundant phylum, followed by Pseudomonadota, with 57% and 10% in the mycelia, 39% and 12% in the hyphosphere soil, and 44% and 11% in the bulk soil, respectively (Fig. 3 ), while Parcubacteria candidate phylum OD1 came in third place with 7% in the mycelia. Bacillota, on the other hand, was in the hyphosphere and bulk soils, with 11% in each of these habitats. Among the mycelia, the prevalent genera were Planctomyces (10%) followed by Gemmata (9%) and Pirellula (4%) (Fig. 3 ). In contrast, the predominant genera in the hyphosphere soil were Planctomyces (9%), Bacillus (7%), and Gemmata (5%). Similarly, in bulk soil, the dominant genera were Planctomyces (11%), Bacillus (6%), and Gemmata (5%). An important proportion of bacterial genera remained unidentified, with 62% in the mycelia, 55% in the hyphosphere soil, and 55% in the bulk soil. Furthermore, the Venn diagram analysis (Fig. 4 ) of bacterial ASVs shared among the three habitats revealed 672 ASVs, accounting for 15%, 22%, and 24% of the bacterial communities in mycelia, the hyphosphere, and bulk soil, respectively. Additionally, 281 ASVs (6% of the mycelial community and 9% of the hyphosphere community) were found exclusively in these two habitats. Similarly, 232 ASVs were common between mycelia and bulk soil, representing 5% and 8% of their respective bacterial communities. In contrast, the highest number of shared ASVs (1,216) was observed between the hyphosphere and bulk soil, comprising 40% and 44% of their respective bacterial communities. Notably, 3,404 ASVs were unique to mycelia (47%), 845 were exclusive to the hyphosphere (12%), and 616 were found only in bulk soil (9%). Effect of RP amendment on the bacterial community assemblage in mycelia, hyphosphere, and bulk soil Neither RP nor sample type affected the α-diversity as measured with Shannon and Simpson indices (Fig. 5 and Table 2 ). However, a PCoA showed a clear separation of bacterial communities associated with the AMF mycelia from those in the hyphosphere soil and bulk soil samples (Fig. 6 A). Similarly, RP application led to a distinct categorization of bacterial communities associated with AMF mycelia (Fig. 6 B). Given that the bacterial communities were separated by habitats, an additional PERMANOVA analysis was conducted to determine if RP application affected the bacterial communities within each habitat. The results showed a significant impact of RP application on the bacterial communities associated with AMF mycelia ( p = 0.01) and in the bulk soil ( p = 0.015), accounting for 6.8% and 6.1% of the variation, respectively (Table 3 ). Another PERMANOVA analysis was conducted on bacterial soil communities to evaluate the effect of AMF spore inoculation. The results revealed a significant effect ( p = 0.004) on the bacterial assemblage, accounting for 3.5% of the variation (Table 4 ). Table 2 α-diversity of bacterial community assessed by Shannon and Simpson indices in different habitats under RP amendment. Habitats Index Source of variation Sum Sq Mean Sq NumDF DenDF F value Pr(> F) AMF mycelia Shannon RP 0.305 0.305 1 8.000 0.839 0.387 Simpson RP 6.92E-05 6.92E-05 1 8.000 0.155 0.704 Hyphosphere soil Shannon RP 0.043 0.043 1 16 0.468 0.504 Simpson RP 2.04E-06 2.04E-06 1 16 0.106 0.749 Bulk soil Shannon RP 4.02E-04 4.02E-04 1 8.000 0.006 0.942 Simpson RP 3.98E-06 3.98E-06 1 16 0.094 0.763 Table 3 β-diversity variance partitioning of bacterial community’s structure among RP application in permutational multivariate analysis of variance in different habitats. Variable Source of variation Df SumOfSq R 2 F Pr(> F) AMF mycelia RP 1 0.444 0.068 1.165 0.01** Residual 16 6.092 0.932 Total 17 6.536 1 Hyphosphere Soil RP 1 0.229 0.044 0.732 0.87 Residual 16 5.001 0.956 Total 17 5.230 1 Bulk soil RP 1 0.317 0.061 1.035 0.015* Residual 16 4.900 0.939 Total 17 5.217 1 Table 4 β-diversity variance partitioning of bacterial community’s structure among AMF inoculation in permutational multivariate analysis of variance in soil biotopes. Source of variation Df SumOfSq R2 F Pr(> F) AMF 1 0.677 0.035 1.884 0.004** Residual 52 18.684 0.965 Total 53 19.361 1 Patterns of indicator species and core bacteriome Several bacterial ASVs exhibited consistent shifts in abundance across treatments and sample compartments. Indicator species analysis identified 35 ASVs (Table S3), revealing a strong compartment- and treatment-specific signal. In the absence of RP application, 26 indicator ASVs (74%) were detected, the majority of which were associated with mycelial samples (20 ASVs). These indicators were dominated by Planctomycetota (16 ASVs), with additional representation from the Parcubacteria candidate phylum OD1 (three ASVs) and Bacillota (one ASV). Five indicator ASVs were linked to bulk soil, spanning Actinobacteriota, Chloroflexota, Acidobacteriota, Bacillota, and Planctomycetota, while only a single indicator ASV, affiliated with Verrucomicrobiota, was detected in the hyphosphere soil. In contrast, RP application yielded fewer indicator taxa (nine ASVs, 26%), most of which were associated with bulk soil, primarily Planctomycetota (six ASVs) and one Parcubacteria (OD1). Only one indicator ASV was detected in each of the mycelial and hyphosphere compartments, affiliated with Planctomycetota and OP3, respectively. Core bacteriome analysis further highlighted compartment-specific microbial assemblages. Across all samples, 12 core taxa were identified, occurring in at least 95% of samples (Table S4). The mycelial compartment harbored six core taxa, including Planctomyces sp., three members of the Pirellulaceae family (genera A17, Pirellula sp., and one unclassified taxon), Bacillus flexus , and an unclassified Gemmataceae. Similarly, six core taxa were detected in the hyphosphere soil, comprising Bacillus fumarioli , AKIW781 (Chloroflexota), Planctomyces sp., two Pirellulaceae taxa (A17 and Pirellula sp.), and Gemmata sp. In bulk soil, five core taxa were identified, including AKIW781 (Chloroflexota), Bacillus fumarioli , Planctomyces sp., Pirellula sp., and Gemmata sp. Although no core ASVs were shared between mycelial and hyphosphere compartments, several genera overlapped, whereas two and three shared core ASVs were observed between bulk soil and mycelial samples, and bulk soil and hyphosphere samples, respectively. Consistent with these patterns, LEfSe analysis identified clear treatment-associated biomarkers. The family Anaerolineaceae and one ASV assigned to the genus Planctomyces were significantly enriched under RP amendment (p < 0.001), whereas the order JG30-KF-AS9 within the Chloroflexota was significantly associated with the absence of RP addition (p < 0.001). These discriminant taxa were predominantly detected in soil samples. At a finer resolution, two ASVs were identified as core taxa within the mycelial compartment, being present in more than 90% of mycelial samples: ASV2 ( Planctomyces ) and ASV3 (Pirellulaceae). In soil samples, two core ASVs affiliated with the order AKIW781 (Chloroflexi) were consistently detected (Tables S3, S4). Network analysis and functional profiling The co-occurrence network of bacterial ASVs was structured into two main groups: one predominantly composed of taxa associated with AMF mycelium and the other composed of soil-associated taxa (bulk soil and hyphosphere). A hub taxon was identified in both soil and mycelial compartments (ASV3100), belonging to the family Thermogemmatisporaceae within the phylum Chloroflexota , with a betweenness centrality of 2.2 × 10⁵. This hub taxon did not exhibit significant sensitivity to RP amendment ( p = 0.322) (Fig. 7 ). Discussion We investigated the influence of RP amendment on the assemblage of soil bacterial communities and their association with the AMF mycelia, and subsequently evaluated how this interaction affects P nutrition and growth of leek plants. Furthermore, the microcosm design facilitated the suppression of the direct effect of root exudates. Along with the extraction method, this setup effectively extracted large amounts of AMF mycelia. We observed that all plants inoculated with AMF exhibited an increased colonization rate. Additionally, the RP application led to a higher proportion of root arbuscules, which serve as the symbiotic interface between plant cells and AMF intraradical hyphae. These structures play a crucial role in the exchange of materials between plants and AMF, enhancing the plants’ ability to absorb higher levels of P [ 59 ]. Although mycorrhizal colonization was greater in the treated plants, the RP did not influence mycorrhizal colonization. However, the shoot and root biomass increased with the combined application of AMF and RP; this is consistent with previous results showing that the P concentration does not influence the percentage of mycorrhization but aids in absorbing P from the soil and RP, leading to increased mineralization in Acacia gummifera [ 60 ]. A study Elhaissoufi, et al. [ 61 ] found that inoculating durum wheat with P-solubilizing rhizobacteria, in combination with RP amendment, enhanced both the root morphology and aboveground plant morphological and physiological traits. Similarly, another study by Mahdi, et al. [ 62 ] demonstrated that inoculating quinoa with the halotolerant phosphorus-solubilizing bacterium Bacillus velezensis improved the plant's resilience and phosphorus uptake under high salt stress induced by NaCl application. Moreover, the mycorrhizal plants with access to RP showed a significantly higher uptake of P and an increase in chlorophyll concentration in their shoots, which could potentially enhance their photosynthetic capacity and plant productivity. This enhanced P nutrition is likely an indirect result of RP solubilization facilitated by AMF and its role in shaping the microbiome associated with its hyphae, given that RP was the only form of P source used in the experiment. This can be explained by the ability of R. irregularis to penetrate the pot-separating membranes and explore the RFC soil through its hyphae. These findings are supported by a previous work [ 63 ] demonstrating that the presence of AMF in the hyphal compartment was linked to phytate P depletion. This suggests that the P solubilization in the microcosm was facilitated by the mycelium of AMF. McCormack and Iversen [ 64 ] reported that fungi can access more pore spaces than roots, thereby expanding the resource absorption area. A meta-analysis by See, et al. [ 65 ] estimated that the average AMF hyphal density across different soil systems was 2000 cm/cm³. This extensive network contributes to the distribution of carbon in the soil through the exudation of organic compounds and hyphal turnover, which is a key mechanism driving bacterial abundance in the hyphoplan. This corroborates our findings of enriched bacterial communities in mycelial samples. AMF hyphae secrete various organic compounds, including carbohydrates, organic acids, amino acids, and other substances [ 66 ]. Like plants, AMF interact with soil microbes through their extraradical hyphae [ 67 ]. Ordonez, et al. [ 68 ] found that AMF alone did not significantly enhance P uptake from RP; however, the addition of P-solubilizing bacteria increased P uptake by promoting both intra- and extraradical AMF hyphal growth, underscoring the cooperative relationship between AMF and bacteria. The hyphal network colonizing the RFC supports microbial prokaryotes by providing labile carbon, which facilitates microbial colonization and biofilm formation on the mycelium [ 36 , 69 ]. The specific organic compounds secreted by AMF hyphae can vary depending on the AMF species and environmental conditions [ 66 ]. Additionally, this hyphal network may act as a "highway" for bacterial dispersal, enabling them to access nutrient-rich microhabitats, such as RP particles [ 17 , 68 , 70 ]. Different strategies are used by AMF to acquire P from the soil. Wang et al. [ 71 ] found that AMF can either produce greater amounts of hyphae or recruit different bacterial communities, which are able to mobilize P from unavailable sources. Our results demonstrated that RP did not influence the biomass of AMF mycelia, but instead, it affected the bacterial communities recruited by its mycelium. Thus, soil P availability is potentially increased through the solubilization of RP in the RFC. The microbes associated with AMF hyphae are not random; rather, they vary according to the host's nutritional requirements and the organic compounds secreted into the soil, which are heavily influenced by the bacterial community associated with the hyphae [ 65 , 69 ]. Zhang, et al. [ 72 ] explored the phosphate–carbon (C) exchanges between Rhizophagus irregularis and Rahnella aquatilis and found that AMF hyphae exuded fructose, which induced phosphatase gene expression in R. aquatilis , enhancing phytate mineralization. Furthermore, the AMF phosphate transporter gene was upregulated in the presence of R. aquatilis , suggesting that the specific type of AMF hyphal exudates can influence bacterial communities in the mycorrhizosphere. Additionally, Duan, et al. [ 73 ] demonstrated that interactions within the hyphosphere between R. irregularis and R. aquatilis facilitate C-P exchange at the peri-arbuscular space in Medicago truncatula . Planctomyces, Gemmata and Bacillus were identified as predominant genera in our dataset, with more than 50% of bacterial genera remaining unidentified in the mycelia and both hyphosphere and bulk soils. Most bacterial taxa were identified in the soil samples, and only one ASV ( Planctomyces sp.) was found to be significantly abundant with RP amendment. Candidates from Planctomycetota and Bacillota were identified as core taxa in the mycelia, and in addition to these phyla, a bacterium from Chloroflexota were identified as core taxa in the hyphosphere soil samples. Planctomycetota are significantly under-sampled, and while their partial genomes have been found in a variety of environments, most remain uncultivated [ 74 ]. Although a small number of slow-growing cultivable bacteria in axenic cultures have been characterized, they remain an enigmatic group due to challenges in obtaining pure cultures, limiting their characterization [ 75 ]. Planctomycetota is a phylum of Gram-negative bacteria, within the Planctomycetes-Verrucomicrobia-Chlamydiae (PVC) superphylum, distinguished by their budding reproduction and the absence of peptidoglycan in their cell walls [ 76 – 78 ]. The observed prevalence of Planctomycetota in our experiment can be attributed to their ecological role as symbionts in natural environments, where they typically live in association with other organisms [ 79 – 81 ]. These microbes effectively compete against various microbial communities in challenging habitats by producing specific antimicrobial compounds, such as stieleriacines, which confer a competitive advantage in resource-limited conditions [ 82 ]. A study by Liang, et al. [ 83 ] on P-solubilizing bacteria in ecological restoration noted that certain bacterial groups, including Planctomycetes, were abundant in P solubilization; the authors found that microbes containing the gcd gene were highly abundant in 17 genera, with over half of the gcd- containing genomes represented in Planctomycetota, Bacteroidota, Acidobacteriota, and Gemmatimonadota. The authors found a strong correlation between the abundance of these bacteria and bioavailable P in the soil, identifying them as the main drivers of P mineralization. In another study on peanuts, Planctomycetota, Chloroflexota, and Acidobacteriota were found to be dominant phyla contributing to nutrient cycling in the presence of RP [ 84 ]. A microcosm experiment revealed that phosphorus-solubilizing bacteria were transported along AMF hyphae, facilitating the movement of organic P patches and enhancing P mineralization under soil conditions [ 85 ]. This indicates that the mycelial biomass extracted from the hyphal compartment plays a role in acquiring specific bacteria, predominantly Planctomycetes, which form a co-occurrence network to solubilize RP. Additionally, AMF may recruit other bacteria, including those from Planctobacteriota, Chloroflexota or Bacillota, which may contain gcd gene bins and have not yet been identified as potential RP solubilizers. Conclusions The study demonstrated that inoculation with R. irregularis and the addition of RP significantly improved the P content in leeks, supporting our first hypothesis. Additionally, RP amendment altered the community structure of bacteria associated with R. irregularis mycelium, which confirms our second hypothesis. Our results underscore the abiotic and biotic factors that drive changes in the bacterial community within the hyphosphere associated with AMF mycelia. It also demonstrates the beneficial effects of AMF, particularly with the addition of RP, in which certain bacteria were shown to be abundant and effective in P solubilization. The P made available through this process was then taken up and transported to the leek root cells by AMF, suggesting that the combined use of AMF and RP could be a promising strategy for RP solubilization, potentially reducing the need for chemical fertilizers. To validate these findings, field trials should be conducted before these plant-growth-promoting AMF, and bacterial inoculants can be recommended to farmers for supporting sustainable crop production. This knowledge could be applied to develop bioinoculants for the next generation of fertilizers, enhancing the P efficiency by utilizing RP instead of processed P fertilizers for sustainable agriculture. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare no competing interests. Funding This work was funded by the University Mohammed VI Polytechnic (UM6P), which is gratefully acknowledged. Author Contribution ZL designed and conducted the experiments, developed the methodology, performed the data analysis, and drafted the manuscript. JL and BA contributed to the analysis and data interpretation and participated in the manuscript revision. MH conceived the study, supervised the work, and secured the funding. All authors discussed the results and approved the final version of the manuscript. Acknowledgments We thank Dr. Jean-Baptiste Floc’H for his assistance in bioinformatics and Dr. Marc St-Arnaud for his help and support with the experimental design and protocols development. We also thank Stéphane Daigle for providing statistical assistance. Data Availability The raw reads corresponding to the hyphosphere soil samples and the AMF mycelia samples were submitted to NCBI ( [https://www.ncbi.nlm.nih.gov/](https:/www.ncbi.nlm.nih.gov) ), with accession numbers provided under the BioProject PRJNA1147075. References Ezawa T, Saito K. How do arbuscular mycorrhizal fungi handle phosphate? New insight into fine-tuning of phosphate metabolism. New Phytologist 2018, In Press , 10.1111/nph.15187 Reid A, Greene SE. How Can Microbes Help Feed the World? A Report from the American Society of Microbiology ; 2013. Bell TH, Joly S, Pitre FE, Yergeau E. Increasing phytoremediation efficiency and reliability using novel omics approaches. Trends Biotechnol. 2014;32:271–80. 10.1016/j.tibtech.2014.02.008 . Janzen HH, Fixen P, Franzluebbers AJ, Hattey J, Izaurralde RC, Ketterings QM, Lobb DA, Schlesinger WH. Global prospects rooted in soil science. Soil Sci Soc Am J. 2011;75:1–8. Quiza L, St-Arnaud M, Yergeau E. Harnessing phytomicrobiome signaling for rhizosphere microbiome engineering. Frontiers in Plant Science 2015, 14 , https://doi.org/10.3389/fpls.2015.00507 Brundrett MC, Tedersoo L. Evolutionary history of mycorrhizal symbioses and global host plant diversity. New Phytol. 2018;220:1108–15. 10.1111/nph.14976 . Mosse B. Advances in the Study of Vesicular-Arbuscular Mycorrhiza. Annu Rev Phytopathol. 1973;11:171–96. Ismail Y, Hijri M. Arbuscular mycorrhisation with Glomus irregulare induces expression of potato PR homologues genes in response to infection by Fusarium sambucinum. Funct Plant Biol. 2012;39:236–45. http://dx.doi.org/10.1071/FP11218 . Ismail Y, McCormick S, Hijri M. A fungal symbiont of plant-roots modulates mycotoxin gene expression in the pathogen Fusarium sambucinum. PLoS ONE. 2011;6:e17990. 10.1371/journal.pone.0017990 . Ismail Y, McCormick S, Hijri M. The arbuscular mycorrhizal fungus, Glomus irregulare, controls the mycotoxin production of Fusarium sambucinum in the pathogenesis of potato. FEMS Microbiol Lett. 2013;384:46–51. 10.1111/1574-6968.12236 . Schützendübel A, Polle A. Plant responses to abiotic stresses: heavy metal-induced oxidative stress and protection by mycorrhization. J Exp Bot. 2002;53:1351–65. Fortin JA, Plenchette C, Piché Y. Mycorrhizas: the new green revolution. Édition Multimondes: Quebec; 2009. p. 140. Smith R. Mycorrhizal Symbiosis. 2008, 800. Rouphael Y, Franken P, Schneider C, Schwarz D, Giovannetti M, Agnolucci M, Pascale SD, Bonini P, Colla G. Arbuscular mycorrhizal fungi act as biostimulants in horticultural crops. Sci Hort. 2015;196:91–108. 10.1016/j.scienta.2015.09.002 . Rillig MC, Sosa-Hernandez MA, Roy J, Aguilar-Trigueros CA, Valyi K, Lehmann A. Towards an Integrated Mycorrhizal Technology: Harnessing Mycorrhiza for Sustainable Intensification in Agriculture. Front Plant Sci. 2016;7:1625. 10.3389/fpls.2016.01625 . Rodriguez A, Sanders IR. The role of community and population ecology in applying mycorrhizal fungi for improved food security. ISME J. 2014. 10.1038/ismej.2014.207 . Basiru S, Ait Si Mhand K, Hijri M. Disentangling arbuscular mycorrhizal fungi and bacteria at the soil-root interface. Mycorrhiza. 2023;33:119–37. 10.1007/s00572-023-01107-7 . Basiru S, Mhand KAS, Hijri M. Deciphering the mechanisms through which arbuscular mycorrhizal symbiosis reduces nitrogen losses in agroecosystems. Appl Soil Ecol. 2025;206:105799. 10.1016/j.apsoil.2024.105799 . Kohlmeier S, Smits TH, Ford RM, Keel C, Harms H, Wick LY. Taking the fungal highway: mobilization of pollutant-degrading bacteria by fungi. Environ Sci Technol. 2005;39:4640–6. Iffis B, St-Arnaud M, Hijri M. Bacteria associated with arbuscular mycorrhizal fungi within roots of plants growing in a soil highly contaminated with aliphatic and aromatic petroleum hydrocarbons. FEMS Microbiol Lett. 2014;358:44–54. 10.1111/1574-6968.12533 . Iffis B, St-Arnaud M, Hijri M. Petroleum hydrocarbon contamination, plant identity and arbuscular mycorrhizal fungal (AMF) community determine assemblages of the AMF spore-associated microbes. Environ Microbiol. 2016;18:2689–704. 10.1111/1462-2920.13438 . Iffis B, St-Arnaud M, Hijri M. Petroleum Contamination and Plant Identity Influence Soil and Root Microbial Communities While AMF Spores Retrieved from the Same Plants Possess Markedly Different Communities. Front Plant Sci. 2017;8:1381. 10.3389/fpls.2017.01381 . Lecomte J, St-Arnaud M, Hijri M. Isolation and identification of soil bacteria growing at the expense of arbuscular mycorrhizal fungi. FEMS Microbiol Lett. 2011;317:43–51. 10.1111/j.1574-6968.2011.02209.x . Bonfante-Fasolo P, Vian B. Wall texture in the spore of a vesicular-arbuscular mycorrhizal fungus. Protoplasma. 1984;120:51–60. Levy A, Chang BJ, Abbott LK, Kuo J, Harnett G, Inglis TJJ. Invasion of Spores of the Arbuscular Mycorrhizal Fungus Gigaspora decipiens by Burkholderia spp. Appl Environ Microbiol. 2003;69:6250–6. 10.1128/aem.69.10.6250-6256.2003 . Mansfeld-Giese K, Larsen J, Bodker L. Bacterial populations associated with mycelium of the arbuscular mycorrhizal fungus Glomus intraradices . FEMS Microbiol Ecol. 2002;41:133–40. Xavier LJC, Germida JJ. Bacteria associated with Glomus clarum spores influence mycorrhizal activity. Soil Biol Biochem. 2003;35:471–8. Agnolucci M, Battini F, Cristani C, Giovannetti M. Diverse bacterial communities are recruited on spores of different arbuscular mycorrhizal fungal isolates. Biol Fertil Soils. 2015;51:379–89. Mansfeld-Giese K, Larsen L, Bødker L. Bacterial populations associated with mycelium of the arbuscular mycorrhizal fungus Glomus intraradices. FEMS Microbiol Ecol. 2002;41:133–40. Scheublin TR, Sanders IR, Keel C, van der Meer JR. Characterisation of microbial communities colonising the hyphal surfaces of arbuscular mycorrhizal fungi. ISME J. 2010;4:752–63. http://www.nature.com/ismej/journal/v4/n6/suppinfo/ismej20105s1.html . Selvakumar G, Krishnamoorthy R, Kim K, Sa T-M. Genetic Diversity and Association Characters of Bacteria Isolated from Arbuscular Mycorrhizal Fungal Spore Walls. PLoS ONE. 2016;11:e0160356. 10.1371/journal.pone.0160356 . Bonfante-Fasolo P, Grippiolo R. Cytochemical and biochemical observations on the cell wall of the spore of Glomus epigaeum . Protoplasma. 1984;123:140–51. Roesti D, Ineichen K, Braissant O, Redecker D, Wiemken A, Aragno M. Bacteria associated with spores of the arbuscular mycorrhizal gungi Glomus geosporum and Glomus constrictum. Appl Environ Microbiol. 2005;71:6673–9. 10.1128/aem.71.11.6673-6679.2005 . Cruz AF, Ishii T. Arbuscular mycorrhizal fungal spores host bacteria that affect nutrient biodynamics and biocontrol of soil-borne plant pathogens. Biology open. 2012;1:52–7. 10.1242/bio.2011014 . Taktek S, Trépanier M, Servin PM, St-Arnaud M, Piché Y, Fortin JA, Antoun H. Trapping of phosphate solubilizing bacteria on hyphae of the arbuscular mycorrhizal fungus Rhizophagus irregularis DAOM 197198. Soil Biol Biochem. 2015;90:1–9. 10.1016/j.soilbio.2015.07.016 . Taktek S, St-Arnaud M, Piche Y, Fortin JA, Antoun H. Igneous phosphate rock solubilization by biofilm-forming mycorrhizobacteria and hyphobacteria associated with Rhizoglomus irregulare DAOM 197198. Mycorrhiza. 2017;27:13–22. 10.1007/s00572-016-0726-z . Awasthi A, Bharti N, Nair P, Singh R, Shukla AK, Gupta MM, Darokar MP, Kalra A. Synergistic effect of Glomus mosseae and nitrogen fixing Bacillus subtilis strain Daz26 on artemisinin content in Artemisia annua L. Appl Soil Ecol. 2011;49:125–30. 10.1016/j.apsoil.2011.06.005 . Lahrach Z, Legeay J, Ahmed B, Hijri M. The composition of the arbuscular mycorrhizal fungal bacteriome is species dependent. Environ Microbiome. 2024;19:77. 10.1186/s40793-024-00623-z . Bolland MDA, Gilkes RJ. Rock phosphates are not effective fertilizers in Western Australian soils: A review of one hundred years of research. Fertilizer Res. 1990;22:79–95. 10.1007/bf01116182 . Randhawa PS, Condron LM, Di HJ, Sinaj S, McLenaghen RD. Effect of Green Manure Addition on Soil Organic Phosphorus Mineralisation. Nutr Cycl Agrosyst. 2005;73:181–9. 10.1007/s10705-005-0593-z . Khoshru B, Nosratabad AF, Mitra D, Chaithra M, Danesh YR, Boyno G, Chattaraj S, Priyadarshini A, Anđelković S, Pellegrini M, et al. Rock Phosphate Solubilizing Potential of Soil Microorganisms: Advances in Sustainable Crop Production. Bacteria. 2023;2:98–115. 10.3390/bacteria2020008 . Renaut S, Masse J, Norrie JP, Blal B, Hijri M. A commercial seaweed extract structured microbial communities associated with tomato and pepper roots and significantly increased crop yield. Microb Biotechnol. 2019;12:1346–58. 10.1111/1751-7915.13473 . Kohl L, Lukasiewicz CE, van der Heijden MG. Establishment and effectiveness of inoculated arbuscular mycorrhizal fungi in agricultural soils. Plant Cell Environ. 2016;39:136–46. 10.1111/pce.12600 . Davies FT, Saraiva Grossi JA, Carpio L, Estrada-Luna AA. Colonization and Growth Effects of the Mycorrhizal Fungus Glomus intraradicies in a Commercial Nursery Container Production System. J Environ Hortic. 2000;18:247–51. 10.24266/0738-2898-18.4.247 . Vierheilig H, Coughlan AP, Wyss U, Piche Y. Ink and vinegar, a simple staining technique for arbuscular-mycorrhizal fungi. Appl Environ Microbiol. 1998;64:5004–7. 10.1128/AEM.64.12.5004-5007.1998 . Pequerul A, Pérez C, Madero P, Val J, Monge E. A rapid wetdigestion method for plant analysis. In: Fragoso MAC, Van Beusichem ML, Houwers A, editors. Optimization of plant nutrition. Dordrecht: Eds.; Springer; 1993. Holman WI. A new technique for the determination of phosphorus by the molybdenum blue method. Biochem J. 1943;37:256–9. 10.1042/bj0370256 . Farnelid H, Turk-Kubo K, Ploug H, Ossolinski JE, Collins JR, Van Mooy BAS, Zehr JP. Diverse diazotrophs are present on sinking particles in the North Pacific Subtropical Gyre. ISME J. 2019;13:170–82. 10.1038/s41396-018-0259-x . Bolyen E, Rideout JR, Dillon MR, Bokulich NA, Abnet CC, Al-Ghalith GA, Alexander H, Alm EJ, Arumugam M, Asnicar F, et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat Biotechnol. 2019;37:852–7. 10.1038/s41587-019-0209-9 . Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJA, Holmes SP. DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods. 2016;13:581–3. 10.1038/nmeth.3869 . Oksanen J, Blanchet FG, Kindt R, Legendre P, Minchin PR, O’Hara RB, Simpson GL, Solymos P, Stevens MHH, Wagner H. Vegan: Community Ecology Package. , R Package Version 2.2-0; 2014. de Mendiburu F. agricolae: Statistical Procedures for Agricultural Research , 1.3-7; 2023. Cáceres MD, Jansen F, Dell N. indicspecies: Relationship Between Species and Groups of Sites. https://cran.r-project.org/web/packages/indicspecies/index.html, 1.7.14 ; 2023. Lahti L, Shetty S. Microbiome R package , 1.24-0; Bioconductor: 2017. Kurtz ZD, Muller CL, Miraldi ER, Littman DR, Blaser MJ, Bonneau RA. Sparse and compositionally robust inference of microbial ecological networks. PLoS Comput Biol. 2015;11:e1004226. 10.1371/journal.pcbi.1004226 . Csárdi G, Nepusz T. The igraph software package for complex network research , version 2.2.1; R package: 2006. Douglas GM, Maffei VJ, Zaneveld JR, Yurgel SN, Brown JR, Taylor CM, Huttenhower C, Langille MG. I. PICRUSt2 for prediction of metagenome functions. Nat Biotechnol. 2020;38:685–8. 10.1038/s41587-020-0548-6 . Guo K, Gao P. microbial: Do 16s Data Analysis and Generate Figures , 0.0.21; 2024. Yang SY, Lin WY, Hsiao YM, Chiou TJ. Milestones in understanding transport, sensing, and signaling of the plant nutrient phosphorus. Plant Cell. 2024;36:1504–23. 10.1093/plcell/koad326 . Lahdachi FZ, Bouamri R, Nassiri L, Ibijbijen J. Rock phosphate and arbuscular mycorrhiza effects on growth and mineral nutrition of Acacia gummifera Wild. Int J Innov Appl Stud. 2018;23:384–9. Elhaissoufi W, Khourchi S, Ibnyasser A, Ghoulam C, Rchiad Z, Zeroual Y, Lyamlouli K, Bargaz A. Phosphate Solubilizing Rhizobacteria Could Have a Stronger Influence on Wheat Root Traits and Aboveground Physiology Than Rhizosphere P Solubilization. Front Plant Sci. 2020;11:979. 10.3389/fpls.2020.00979 . Mahdi I, Allaoui A, Fahsi N, Biskri L. Bacillus velezensis QA2 Potentially Induced Salt Stress Tolerance and Enhanced Phosphate Uptake in Quinoa Plants. Microorganisms. 2022;10. 10.3390/microorganisms10091836 . Zhang L, Fan J, Ding X, He X, Zhang F, Feng G. Hyphosphere interactions between an arbuscular mycorrhizal fungus and a phosphate solubilizing bacterium promote phytate mineralization in soil. Soil Biol Biochem. 2014;74:177–83. McCormack ML, Iversen CM. Physical and Functional Constraints on Viable Belowground Acquisition Strategies. Front Plant Sci. 2019;10:1215. 10.3389/fpls.2019.01215 . See CR, Keller AB, Hobbie SE, Kennedy PG, Weber PK, Pett-Ridge J. Hyphae move matter and microbes to mineral microsites: Integrating the hyphosphere into conceptual models of soil organic matter stabilization. Glob Chang Biol. 2022;28:2527–40. 10.1111/gcb.16073 . Luthfiana N, Inamura N, Tantriani; Sato T, Saito K, Oikawa A, Chen W, Tawaraya K. Metabolite profiling of the hyphal exudates of Rhizophagus clarus and Rhizophagus irregularis under phosphorus deficiency. Mycorrhiza. 2021;31:403–12. 10.1007/s00572-020-01016-z . Hnini M, Rabeh K, Oubohssaine M. Interactions between beneficial soil microorganisms (PGPR and AMF) and host plants for environmental restoration: A systematic review. Plant Stress. 2024;11. 10.1016/j.stress.2024.100391 . Ordonez YM, Fernandez BR, Lara LS, Rodriguez A, Uribe-Velez D, Sanders IR. Bacteria with Phosphate Solubilizing Capacity Alter Mycorrhizal Fungal Growth Both Inside and Outside the Root and in the Presence of Native Microbial Communities. PLoS ONE. 2016;11:e0154438. 10.1371/journal.pone.0154438 . Andrino A, Guggenberger G, Kernchen S, Mikutta R, Sauheitl L, Boy J. Production of Organic Acids by Arbuscular Mycorrhizal Fungi and Their Contribution in the Mobilization of Phosphorus Bound to Iron Oxides. Front Plant Sci. 2021;12:661842. 10.3389/fpls.2021.661842 . Jansa J, Hodge A. Swimming, gliding, or hyphal riding? On microbial migration along the arbuscular mycorrhizal hyphal highway and functional consequences thereof. New Phytol. 2021;230:14–6. 10.1111/nph.17244 . Wang G, George TS, Pan Q, Feng G, Zhang L. Two isolates of Rhizophagus irregularis select different strategies for improving plants phosphorus uptake at moderate soil P availability. Geoderma. 2022;421:115910. 10.1016/j.geoderma.2022.115910 . Zhang L, Feng G, Declerck S. Signal beyond nutrient, fructose, exuded by an arbuscular mycorrhizal fungus triggers phytate mineralization by a phosphate solubilizing bacterium. ISME J. 2018;12:2339–51. 10.1038/s41396-018-0171-4 . Duan S, Declerck S, Feng G, Zhang L. Hyphosphere interactions between Rhizophagus irregularis and Rahnella aquatilis promote carbon-phosphorus exchange at the peri-arbuscular space in Medicago truncatula. Environ Microbiol. 2023;25:867–79. 10.1111/1462-2920.16333 . Spring S, Bunk B, Spröer C, Rohde M, Klenk H-P. Genome biology of a novel lineage of planctomycetes widespread in anoxic aquatic environments. Environ Microbiol. 2018;20:2438–55. https://doi.org/10.1111/1462-2920.14253 . Kaboré OD, Godreuil S, Drancourt M. Planctomycetes as Host-Associated Bacteria: A Perspective That Holds Promise for Their Future Isolations, by Mimicking Their Native Environmental Niches in Clinical Microbiology Laboratories. Front Cell Infect Microbiol. 2020;10. 10.3389/fcimb.2020.519301 . Lage OM, van Niftrik L, Jogler C, Devos DP. Planctomycetes. In: Schmidt TM, editor. Encyclopedia of Microbiology (Fourth Edition). Oxford: Academic; 2019. pp. 614–26. Wiegand S, Jogler M, Boedeker C, Pinto D, Vollmers J, Rivas-Marín E, Kohn T, Peeters SH, Heuer A, Rast P, et al. Cultivation and functional characterization of 79 planctomycetes uncovers their unique biology. Nat Microbiol. 2020;5:126–40. 10.1038/s41564-019-0588-1 . Wang J, Jenkins C, Webb RI, Fuerst JA. Isolation of Gemmata-like and Isosphaera-like planctomycete bacteria from soil and freshwater. Appl Environ Microbiol. 2002;68:417–22. 10.1128/AEM.68.1.417-422.2002 . Martin M, Portetelle D, Michel G, Vandenbol M. Microorganisms living on macroalgae: diversity, interactions, and biotechnological applications. Appl Microbiol Biotechnol. 2014;98:2917–35. 10.1007/s00253-014-5557-2 . Gao X, Xiao Y, Wang Z, Zhao H, Yue Y, Nair S, Zhang Z, Zhang Y. Adaptive traits of bacteria to thrive in macroalgal habitats and establish mutually beneficial relationship with macroalgae. Limnology and Oceanography Letters 2024, n/a , 10.1002/lol2.10424 Dedysh SN, Ivanova AA. Planctomycetes in boreal and subarctic wetlands: diversity patterns and potential ecological functions. FEMS Microbiol Ecol. 2019;95:fiy227. 10.1093/femsec/fiy227 . Kallscheuer N, Jeske O, Sandargo B, Boedeker C, Wiegand S, Bartling P, Jogler M, Rohde M, Petersen J, Medema MH, et al. The planctomycete Stieleria maiorica Mal15T employs stieleriacines to alter the species composition in marine biofilms. Commun Biology. 2020;3:1–8. 10.1038/s42003-020-0993-2 . Liang J-L, Liu J, Jia P, Yang T-t, Zeng Q-w, Zhang S-c, Liao B, Shu W-s, Li J. -t. Novel phosphate-solubilizing bacteria enhance soil phosphorus cycling following ecological restoration of land degraded by mining. ISME J. 2020;14:1600–13. 10.1038/s41396-020-0632-4 . Jiang H, Li S, Wang T, Chi X, Qi P, Chen G. Interaction Between Halotolerant Phosphate-Solubilizing Bacteria (Providencia rettgeri Strain TPM23) and Rock Phosphate Improves Soil Biochemical Properties and Peanut Growth in Saline Soil. Front Microbiol. 2021;12. 10.3389/fmicb.2021.777351 . Jiang F, Zhang L, Zhou J, George TS, Feng G. Arbuscular mycorrhizal fungi enhance mineralisation of organic phosphorus by carrying bacteria along their extraradical hyphae. New Phytol. 2021;230:304–15. 10.1111/nph.17081 . Additional Declarations No competing interests reported. Supplementary Files SupplementarymaterialFeb92026.docx Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 12 May, 2026 Reviewers agreed at journal 26 Apr, 2026 Reviewers agreed at journal 26 Apr, 2026 Reviews received at journal 24 Apr, 2026 Reviewers agreed at journal 30 Mar, 2026 Reviewers invited by journal 22 Mar, 2026 Editor assigned by journal 11 Feb, 2026 Submission checks completed at journal 10 Feb, 2026 First submitted to journal 09 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8829244","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":610865335,"identity":"3d4bcfbc-06fc-41cd-bca5-7cca222ad34a","order_by":0,"name":"Zakaria Lahrach","email":"","orcid":"","institution":"Institut de Recherche en Biologie Végétale, Université de Montréal","correspondingAuthor":false,"prefix":"","firstName":"Zakaria","middleName":"","lastName":"Lahrach","suffix":""},{"id":610865336,"identity":"469fefe4-9061-4206-9efb-53c89f9bb3a0","order_by":1,"name":"Jean Legeay","email":"","orcid":"","institution":"University Mohammed VI Polytechnic (UM6P)","correspondingAuthor":false,"prefix":"","firstName":"Jean","middleName":"","lastName":"Legeay","suffix":""},{"id":610865337,"identity":"a3d466ec-e7a4-45a0-b7e3-2a69fc63992a","order_by":2,"name":"Bulbul Ahmed","email":"","orcid":"","institution":"University Mohammed VI Polytechnic (UM6P)","correspondingAuthor":false,"prefix":"","firstName":"Bulbul","middleName":"","lastName":"Ahmed","suffix":""},{"id":610865339,"identity":"9eee45c0-4a34-4d82-9419-71febf7be490","order_by":3,"name":"Mohamed Hijri","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABAklEQVRIiWNgGAWjYFACHhDBzGDAzJDAkFABF7YgVssZCAcIJIjQAqIY24jQotvee/DTjQprBnN2hmcfHs47HM0v3X/sw4caCQb+9gNYtZidOZcsnXMmncGymSF5RuK2w7kz5xxmnjnjmASDxJkE7Fpu5BhI57YdZjA4zJDMANKy4UYyMzMPmwTQqTi1GP/O/QfTMgeq5c8/oBb+B7i0mEnnNsC0NEC1MLYBtUjgsOXMGTPrnGPpPGAtCcfSc2fOSDZm7O2T4JG4gcOW4z3Gt3NqrOUMzp9JZvxRY53bL5H4mOHHNxs5/n7stsAAMHZ4EtBFCAL2A0QoGgWjYBSMgpEIAFiPXDG6pQMPAAAAAElFTkSuQmCC","orcid":"","institution":"Institut de Recherche en Biologie Végétale, Université de Montréal","correspondingAuthor":true,"prefix":"","firstName":"Mohamed","middleName":"","lastName":"Hijri","suffix":""}],"badges":[],"createdAt":"2026-02-09 10:38:43","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8829244/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8829244/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105388814,"identity":"0a0a16f9-5797-4a8e-9606-790fcda868cc","added_by":"auto","created_at":"2026-03-25 12:57:24","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":68006,"visible":true,"origin":"","legend":"\u003cp\u003eResponses of \u003cem\u003eAllium porrum\u003c/em\u003e plants to \u003cem\u003eR. irregulari\u003c/em\u003es inoculation and RP application. (A) Root dry weight, (B) shoot dry weight, and (C) stem diameter (values are means ± standard errors, n = 9). M0P0 (negative control), M0P1 (without AMF and amended with RP), M1P0 (inoculated with \u003cem\u003eR. irregularis\u003c/em\u003e and without RP), and M1P1 (inoculated with \u003cem\u003eR. irregularis\u003c/em\u003e and amended with RP). The significance of treatments and interactions were determined via two-way ANOVA.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8829244/v1/86ef66c1e9c8cddd54361ece.png"},{"id":105388758,"identity":"44150ad1-88be-4c58-b1b1-20b3f32a4f31","added_by":"auto","created_at":"2026-03-25 12:57:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":56537,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of \u003cem\u003eR. irregularis\u003c/em\u003e inoculation and RP application\u003cstrong\u003e \u003c/strong\u003eon (A) shoot phosphorus concentration and (B) chlorophyll concentration in \u003cem\u003eAllium porrum\u003c/em\u003e (values are means ± standard errors, n=9). M0P0 (negative control), M0P1 (without AMF and amended with RP), M1P0 (inoculated with \u003cem\u003eR. irregularis\u003c/em\u003e and without RP), M1P1 (inoculated with \u003cem\u003eR. irregularis\u003c/em\u003e and amended with RP). The significance of treatments and interactions was determined via two-way ANOVA.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8829244/v1/18ebe6fd7f4aee7199894111.png"},{"id":105388751,"identity":"e0a33112-0f73-432d-99a5-b050c8930b6c","added_by":"auto","created_at":"2026-03-25 12:56:57","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":660525,"visible":true,"origin":"","legend":"\u003cp\u003eRelative abundances of the 10 most common bacterial taxa in the mycelia (M1-P0, M1-P1), hyphosphere soil (SM1-P0, SM1-P1), and bulk soil (SM0-P0, SM0-P1) under RP amendment at phylum (A) and genus (B) levels, with all remaining taxa grouped under \"Others\". The abbreviations M1, SM1, and SM0 refer to mycelium, hyphosphere soil, and bulk soil, respectively.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8829244/v1/c7c76729c7471313ca1efb9b.jpeg"},{"id":105388782,"identity":"50428eef-bc97-4806-865d-245509ecb9bd","added_by":"auto","created_at":"2026-03-25 12:57:15","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":142784,"visible":true,"origin":"","legend":"\u003cp\u003eVenn diagram of bacterial ASVs shared between mycelia, hyphosphere, and bulk soil.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8829244/v1/e8209fcc1925dc694b7be566.jpeg"},{"id":105388779,"identity":"ba56e3d8-a8fd-429b-813d-63424fbc9546","added_by":"auto","created_at":"2026-03-25 12:57:13","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":227794,"visible":true,"origin":"","legend":"\u003cp\u003eα-diversity of bacterial communities assessed via (A) Shannon and (B) Simpson indices in the AMF mycelium, hyphosphere, and bulk soils under RP amendment.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8829244/v1/3a289e01288482dcacb77147.jpeg"},{"id":105388764,"identity":"fded4067-bb53-404a-b541-c9c0025413c0","added_by":"auto","created_at":"2026-03-25 12:57:10","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":238725,"visible":true,"origin":"","legend":"\u003cp\u003ePrincipal coordinate analysis based on Bray–Curtis distance displays variations in the bacterial communities among (A) sample types and on (B) \u003cem\u003eR. irregularis\u003c/em\u003e mycelia under RP amendment.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8829244/v1/ed385eb5df9bb1167c2155de.jpeg"},{"id":105388786,"identity":"7949dc5c-1b78-49c0-a51d-a6531510eb07","added_by":"auto","created_at":"2026-03-25 12:57:16","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":494769,"visible":true,"origin":"","legend":"\u003cp\u003ePairwise co-occurrence network representation of bacterial ASVs in the different compartments. The hub taxon is ASV 3100, belonging to the family Thermogemmatisporacea, in the Chloroflexota phylum.\u003c/p\u003e","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8829244/v1/eaf3d2c796b88eb59e855fe3.jpeg"},{"id":105388879,"identity":"2a65cecb-f710-49ad-b5e3-82047ff755f8","added_by":"auto","created_at":"2026-03-25 12:57:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3109887,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8829244/v1/38b3c8bb-f285-42c3-ac63-776036c25272.pdf"},{"id":105388805,"identity":"2a4f388a-f44d-4c16-9e7c-bc91e176066b","added_by":"auto","created_at":"2026-03-25 12:57:22","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":198447,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementarymaterialFeb92026.docx","url":"https://assets-eu.researchsquare.com/files/rs-8829244/v1/553408cf0e9d0e9d5b223e3c.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Effects of Rock Phosphate Application on the Composition of Bacterial Communities Associated with Arbuscular Mycorrhizal Fungal Mycelia","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAgroecosystem productivity relies on the continuous input of phosphate-based processed chemical fertilizers to maintain soil fertility; this is because the depletion of bioavailable phosphorus (P) occurs as the rate of uptake by crop roots often exceeds nutrient dissolution from bulk soils [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Advances in plant breeding have led to the selection of crops highly dependent on these chemical fertilizers, particularly commodity crops such as corn, wheat, rice, and potato, without considering the contributions of crop microbiota, which potentially represent an alternative genetic reservoir that has barely been tapped [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The root-associated microbiome is a key determinant of soil nutrient availability, plant biomass productivity, and pollutant degradation [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Soil microbes have long been known to contribute to plant health by facilitating nutrient acquisition, inhibiting pathogens, and protecting plant roots against abiotic stresses [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBeneficial soil microbes provide important ecological services to natural and agricultural ecosystems [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], and, given their potential to positively influence agricultural productivity, harnessing these microbes is a major goal for environmental and agricultural biotechnologies [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eArbuscular mycorrhizal fungi are both root- and soil-inhabiting symbionts and are among the most common soil fungi. They form symbioses with the roots of 71% of all vascular plant species [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], providing invaluable services for the plants, in particular improving the capacity for P uptake in return for carbon from the host plants [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Additionally, mycorrhizae can provide plants with increased resistance to root pathogens [\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], alleviate abiotic stress [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], and improve soil quality by aggregating soil particles and decreasing soil erosion [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. It is becoming recognized that some of the presumed benefits of mycorrhizal symbiosis, such as P uptake and nutrient cycling, are in fact dependent on the interaction between AMF and their associated microbes [\u003cspan additionalcitationids=\"CR15 CR16 CR17\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. AMF hyphae also serve as physical pathways for microbial mobility and dispersal [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], and studies have shown that AMF interact closely with myriad bacteria and fungi that can be exploited to enhance mineral immobilization for plants [\u003cspan additionalcitationids=\"CR21 CR22\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn AMF\u0026ndash;soil bacteria interactions, soil microbes can interact with AMF synergistically, adversely, or commensally. An early study [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] reported evidence of the presence of bacteria on the AMF spore wall, and a later research study showed that bacteria can invade the spore wall layers and survive in the spore cytoplasm [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Several subsequent studies have reported that diverse bacterial communities are associated with AMF spores [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Bacteria belonging to the genera \u003cem\u003eBurkholderia, Pseudomonas, Variovorax\u003c/em\u003e, and \u003cem\u003eChromobacterium\u003c/em\u003e were more frequently associated with the AMF \u003cem\u003eRhizophagus irregularis\u003c/em\u003e [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], while the authors of Scheublin, \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] reported that the Oxalobacteraceae family was more specifically associated with the AMF hyphal surface than other bacteria. Moreover, Selvakumar, \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] isolated 120 strains of bacteria associated with AMF spores belonging to three species (\u003cem\u003eFunneliformis caledonium, Funneliformis mosseae\u003c/em\u003e, and \u003cem\u003eRacocetra alborosea\u003c/em\u003e) using a culture-dependent approach, and the authors characterized and tested these bacterial strains for the following spore functional traits: chitinase, protease, cellulase enzymes, and exopolysaccharide production. These authors [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] also found that among the 120 isolated bacterial strains, 113 showed at least one functional trait, while 7 strains showed none.\u003c/p\u003e \u003cp\u003eThe cell wall of AMF is composed of chitin, proteins, and polysaccharides [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Biopolymer-degrading microbes adhering to the spore and hyphal outer layer might use oligomers of chitin as a carbon source [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], while AMF-associated microbes may also use other cell wall components as a nutrient source. So far, spore-associated bacteria have been isolated from the spore cytoplasm [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], surface sterilized spores and hyphae, and were reported to either stimulate fungal growth or increase plant nutrient uptake [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Moreover, the close interaction between AMF and hyphosphere bacteria has been shown to increase plant growth by enhancing phosphate solubility [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] and fixing atmospheric nitrogen [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] and can contribute to AMF spore germination and plant root colonization [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIt is well documented that AMF identity influences the microbial communities associated with plant roots and the rhizosphere [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. A recent study by Lahrach, \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] demonstrated that the organismal phylogeny of AMF shapes the bacterial communities associated with their mycelia. However, the factors driving shifts in the microbial community associated with AMF mycelia remain unclear. Finely ground soft rock phosphate fertilizers can be used for direct application under specific conditions, such as permanently moist and acid soils [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. However, in most cases, rock Phosphate (RP) does not show agricultural effectiveness, due to its low rate of dissolution. However, some biological solutions, such as the culture of green manure crops [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e] or the use of rhizobacteria can increase the solubilization of RP [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, we investigated the impact of RP amendment on AMF\u0026ndash;bacteria interactions. We hypothesized that 1) RP amendment influences the bacterial community associated with AMF mycelium, and 2) RP amendment and AMF inoculation enhance the P nutrition of leek plants.\u003c/p\u003e \u003cp\u003eTo test these hypotheses, we designed a bi-compartmentalized microcosm to separate root effects from AMF mycelium effects, using leek as the host plant, in a greenhouse trial. We employed metabarcoding targeting the 16S rRNA gene to determine bacterial community changes in the mycelia, bulk soil, and hyphosphere associated with AMF mycelia. This setup allowed us to precisely analyze how RP amendment and AMF inoculation influence bacterial community structure and contribute to the P nutrition of leek plants.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMicrocosm setup and substrate preparation\u003c/h2\u003e \u003cp\u003eThe investigation utilized microcosm units to partition the soil and ensure the physical separation of AMF mycelia in the root-free compartment (RFC) from the plant roots in the root compartment (RC). Each unit consisted of two pots, measuring 6.5 x 6.5 x 8.5 cm (LxWxH), which were bonded together using silicon glue. One pot served as the plant growth compartment (RC), and the other facilitated hyphal propagation (RFC). The pots had a cut side with a 44 \u0026micro;m membrane (manufactured by SEFAR Incorporation, USA) that enabled interconnection without root passage. Before initiating the experiment, the microcosms were sanitized with 70% ethanol and exposed to UV light under laminar flow for 30 minutes.\u003c/p\u003e \u003cp\u003eA sandy loam soil of low P content was collected from the organic farm of the IRDA research station in St-Bruno in Qu\u0026eacute;bec (45\u0026deg;32\u0026rsquo;59.6\u0026rdquo; N, 73\u0026deg;21\u0026rsquo;08.0\u0026rdquo; W). This soil was characterized by a pH of 6.01 and a Mehlich-3 extractable phosphorus concentration of 0.41 mg/kg of soil [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. The soil analysis was performed using a commercial service provided by EnvironeX (Longueuil, QC). The chemical properties were described by Renaut, \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. The soil was air-dried, sieved at 2 mm, and then mixed with sand (Bomix company, Laval, QC) at a ratio of 1:1 (v/v) to produce a growth substrate with depleted phosphorus level. To eradicate the indigenous microorganisms, both the substrate and RP were sterilized using γ-irradiation with a minimum dose of 22.3 kGy and a maximum of 46.2 kGy (Nordion\u0026rsquo;s Gamma Centre of Excellence, Laval, QC). The sterilization was confirmed via the serial dilution method and inoculation of the tryptic soy agar (TSA) plates. Each compartment of the microcosm received around 333 g of the substrate and RP was added where required. An amount of 0.16 g of RP per pot was homogenized with the RFC substrate to provide the equivalent of approximately 100 kg P₂O₅ per hectare. The RP used in this study, as the sole source of P, was the sedimentary RP with a bone phosphate of lime\u0026thinsp;\u0026ge;\u0026thinsp;54 %, kidly supplied by OCP Group, Morocco.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eHost plant and microbial inoculum\u003c/h3\u003e\n\u003cp\u003eSeeds from leek (\u003cem\u003eAllium porrum\u003c/em\u003e) (McKenzie Seeds, Canada), a highly mycotrophic plant, were used as a host. Under sterile conditions in a laminar flow, the seeds were surface sterilized with ethanol (70%) for 30 s and then bleached (15%) for 5 min, and were then rinsed abundantly with sterile distilled water. The seeds were kept soaked in the last rinsing water for 2h. Three surface-sterilized seeds were sown into each RC at a depth of 5 mm. The spores of the AMF \u003cem\u003eRhizophagus irregularis\u003c/em\u003e DAOM 197198, kindly provided by Premier Tech, Canada, were used to inoculate the seeds at the same time of sowing of each mycorrhizal treatment. To enhance the chance of root colonization by the AMF, a second application was performed one month after the first, directly to the roots after thinning the plants to one per microcosm. The AMF species was chosen based on its \u003cem\u003ein vitro\u003c/em\u003e production process, its application as a commercial inoculant in agriculture, and its large distribution [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. In each AMF inoculation, the seeds/seedlings received 200 spores diluted in 300 \u0026micro;l of sterile distilled water.\u003c/p\u003e \u003cp\u003eTo enrich the soil microbial community, a microbial suspension was prepared from natural soil collected from the rhizosphere of organically cultivated crops within the Botanical Garden of Montreal. Soil subsamples were taken separately from potato, leek, tomato, eggplant, and maize during the flowering season and transferred to the lab. The rationale behind using many crop soils was to diversify microbial communities. A composite sample was prepared by pooling equal amounts from each of the five rhizosphere soil samples and homogenizing the mixture. Six kilograms of the composite soil were sieved through a 2 mm mesh to remove roots and rock fragments, and then divided into 3 portions. Firstly, we mixed 1/3 of the soil (2 kg) with 4 L of sterilized distilled water, and the soil was brought into suspension via stirring for 30 min and then kept for at least 2 h at room temperature. The liquid phase of the soil suspension was filtered through autoclaved sieves with mesh widths of 53 \u0026micro;m and 20 \u0026micro;m. This filtration excludes AMF spores in the soil suspension. The same operation was used for the second and the third soil portions using the soil suspension obtained from the first and the second filtration, respectively. The final filtrate was collected in a sterile Erlenmeyer flask and considered as the microbial suspension.\u003c/p\u003e \u003cp\u003eThe inoculation with the microbial suspension of the RFC substrate was performed two months after the second AMF inoculation using 50 mL of the microbial suspension.\u003c/p\u003e\n\u003ch3\u003eExperimental design\u003c/h3\u003e\n\u003cp\u003eThis study represents a subset of an experiment on the recruitment profile of microbes by AMF carried out in a greenhouse using the microcosm units described earlier. The study examined the effect of sedimentary RP on the community structure of bacteria associated with the mycelium of the AMF \u003cem\u003eR. irregularis\u003c/em\u003e DAOM 197198. Two factors were considered: (1) two levels of RP, with or without RP application, and (2) two AMF levels, inoculated or uninoculated. Consequently, the experiment involved four treatment combinations: M0P0, M0P1, M1P0, and M1P1, where M refers to AMF, P to RP, 0 to absence and 1 indicates presence. The trial was organized using a randomized block design, comprising nine replicates on a mesh table to prevent the risk of cross-contamination through water. Three replicates were established each week over a period of three weeks. Leek plants were grown under conditions of photoperiod (16/8 h day/night) and temperature (21/18\u0026deg;C day/night). An additional set of microcosm units was prepared and inoculated with AMF to monitor plant colonization and the presence of mycelia in the RFCs. A layer of calcinated clay of granules (Turface\u0026reg;), approximately 1 cm thick, was added on top of the microcosm pots to cover the soil surface, and it was renewed weekly to minimize or prevent surface contamination by microalgae. The microcosms were watered to maintain soil moisture at holding capacity. Once a week, the plant compartments received 50 mL of modified half-strength Long Ashton nutrient solution containing 22 ppm (0.71 mM) of P. This concentration of P is known to enhance AMF-induced root colonization [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Two months after the second inoculation with the AMF spores (a period allowing the establishment of extraradical AMF mycelia in the RFCs), all RFCs were treated with 50 mL of microbial suspension. Afterwards, the irrigation regime was switched and the diluted nutrient solution without P was supplied once a week to the RFCs. The microcosms were kept watered with tap water as needed throughout the week.\u003c/p\u003e\n\u003ch3\u003eHarvest and plant analysis\u003c/h3\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eGrowth parameters and chlorophyll concentration\u003c/h2\u003e \u003cp\u003eThe harvest was performed five months after setting up the experiment over three weeks to ensure consistent timing across all replicates. Before cutting the shoots, the stem diameter of plants was measured with an electronic caliper at 5 mm above the soil. To verify the effect of the treatments on the plant's photosynthetic activity, an atLEAF chlorophyll meter (FT Green LLC, USA) was used to evaluate the concentration of chlorophyll (\u0026micro;g/cm\u003csup\u003e2\u003c/sup\u003e) on the fully expanded third or fourth leaf from the top according to the manufacturer\u0026rsquo;s instructions. Afterward, each microcosm was disassembled, and the RC was carefully discharged. The roots were rinsed with sterile distilled water, and the shoots were cut from the roots, put in a paper bag, and dried in a hot-air oven at 80\u0026deg;C for 72 h. The dry biomass was recorded, and the shoots were ground with a clean dried pestle and mortar for further chemical analysis. The fresh roots were weighed, and to evaluate the mycorrhizal colonization, a small amount of fine roots was placed in a separate 15 mL falcon tube containing 8 mL of 50% ethanol. The remaining roots were weighed a second time and then dried in the oven under the same conditions as the shoots. The second fresh root weight helped to calculate the total amount of dry root weight.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eMycorrhizal colonization and phosphorus content\u003c/h2\u003e \u003cp\u003eThe mycorrhizal colonization ratio was evaluated using the ink and vinegar staining method [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. The roots preserved in 50% ethanol were washed with tap water and cut into 1 cm long segments. The root segments were cleared in a 10% KOH solution boiling at 90\u0026deg;C for 3 to 4 min until they became transparent and were then rinsed with distilled water. To remove the KOH residues, the roots were soaked in another bath of 1% acetic acid for 4 min. Cleared roots were placed in a 5% ink\u0026ndash;vinegar solution at 90\u0026deg;C for 3 min and rinsed with distilled water and then stored in a lactoglycerol solution for a minimum of 24 h at room temperature to remove the excess of ink solution. The stained root segments were mounted on microscope slides with fine-point forceps, and the degree of mycorrhization was determined via the intersection method [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The numbers of arbuscules, vesicles, and intraradical mycelia were counted and the percentages were calculated.\u003c/p\u003e \u003cp\u003eThe ground shoots were used to determine the total phosphorus content via the modified dry ash method [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Ground shoot aliquots of 0.5 g were incinerated at 500\u0026deg;C for 4 h and digested in 100 mL borosilicate Erlenmeyer containing 6 mL and 1 mL of concentrated sulfuric acid and nitric acid, respectively. The resulting solutions were filtered in an acid-washed flask, filled up to 100 mL with demineralized water, and then homogenized before P concentration analysis via the molybdenum blue colorimetric technique [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. The shoot P content (\u0026micro;g) was subsequently calculated from the P concentration and shoot biomass.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eExtraradical mycelia collection\u003c/h3\u003e\n\u003cp\u003ePrior to harvesting the substrate from the hyphal compartment, Turface layer with the top 1 cm of the substrate was removed along with a 1 cm width strip from the membrane side of the substrate to reduce bacterial communities affected respectively by potential surface contamination and by root exudates near the membrane. Afterwards, about 10 mL of the substrate was collected in a 15 mL falcon tube. To collect the extraradical mycelia, the rest of the substrate was transferred to a 1 L sterile glass jar and covered with cold sterile distilled water to a height of almost 1 cm. The jar was lidded, vigorously shaken, and left to stand for approximately 15 min. During this time, the extraradical mycelia of AMF began to agglomerate due to their adhesive properties. Next, the solution was poured through a sterile 40 \u0026micro;m mesh sieve, and this procedure was repeated four to five times until there were no mycelial aggregates observed. To clean them as much as possible from the attached particles, the extraradical mycelia were rinsed with cold sterile saline solution of 0.9% NaCl, after which they were transferred to a microcentrifuge tube using sterile forceps. Mycelia samples were squeezed to remove any remaining liquids, and the weights were recorded. Regarding the non-mycorrhizal RFCs, no extraradical mycelia were found. All tubes containing substrate and mycelia samples were immediately flash frozen in liquid nitrogen after sampling and kept on dry ice in a cooler box before being stored in the freezer at -80\u0026deg;C for the downstream analysis of nucleic acids.\u003c/p\u003e\n\u003ch3\u003eDNA extraction and PCR amplification\u003c/h3\u003e\n\u003cp\u003eJust before DNA extraction from the substrate, all the samples were transferred into 50 mL falcon tubes with pierced lids and placed in a lyophilizer for 3 days until dried. Then, the samples were sieved with a 1 mm mesh sieve to facilitate substrate particle separation. Hereinafter, the materials resulting from the M1 and M0 treatments were named, respectively, hyphosphere soil and bulk soil.\u003c/p\u003e \u003cp\u003eThe bulk and hyphosphere soil DNA was extracted from 250 mg of homogenized soil of each sample using the DNeasy PowerSoil Pro Kit (QIAGEN, Canada) according to the manufacturer\u0026rsquo;s protocol. We performed the DNA extraction from mycelia using the DNeasy Plant Mini Kit (QIAGEN, Canada) following the manufacturer\u0026rsquo;s instructions, starting by grinding about 50 mg of liquid nitrogen-frozen samples in 1.5 mL tubes containing sterile white sand, which facilitates cell lysis. The elution step was performed in 50 \u0026micro;L of elution buffer for bulk and hyphosphere soils and in 20 \u0026micro;L for mycelia and stored at -20\u0026deg;C. Therefore, genomic DNA extracts were first visualized via gel electrophoresis on 1% agarose stained with GelRed diluted at a ratio of 1/10000 using the GelDoc System (BioRad, Montreal, QC, Canada). The DNA concentration was determined using the Qubit 2.0 Fluorometer (ThermoFisher, Canada) and the Qubit double-stranded DNA (dsDNA) HS Assay Kit.\u003c/p\u003e \u003cp\u003eTo investigate the total bacterial community, the V3-V4 region of 16S rRNA gene was targeted using Platinum\u0026trade; Direct PCR Universal Master Mix (ThermoFisher, Canada). The amplicon libraries were constructed using the primers pair of 341F (5\u0026rsquo;-CACCTACGGGNGGCWGCAG-3\u0026rsquo;) and 805R (5\u0026prime;-ACTACHVGGGTATCTAATCC-3\u0026prime;) tagged, respectively, with CS1 (5\u0026rsquo;-\u003cem\u003eACACTGACGACATGGTTCTA\u003c/em\u003e-3\u0026rsquo;) and CS2 (5\u0026prime;-\u003cem\u003eTACGGTAGCAGAGACTTGGTCTG\u003c/em\u003e-3\u0026prime;), which permit barcoding [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. The PCR amplification was performed in a 25 \u0026micro;L volume reaction mix containing 10 \u0026micro;L of Platinum Direct PCR Universal Master Mix, 0.25 \u0026micro;M of each primer, 4 \u0026micro;L of Platinum GC Enhancer, 7 \u0026micro;L of water, and 1 \u0026micro;L of template DNA. Negative controls with only water were included in each PCR run. The thermal cycling conditions were as follows: initial step of activation at 94\u0026deg;C for 2 min, followed by 35 cycles of denaturation at 94\u0026deg;C for 15 s, annealing at 60\u0026deg;C for 30 s and extension at 68\u0026deg;C for 20 s, and a final extension at 68\u0026deg;C for 1 min with a hold at 10\u0026deg;C. PCR reactions were amplified in an Eppendorf Mastercycler Pro thermocycler (Eppendorf, Canada). The amplification was confirmed by running the PCR products on a 1% agarose gel. Amplicons were sent for Illumina MiSeq sequencing using 2 \u0026times; 300 bp paired-end reads which were demultiplexed on the instrument in the NGS platform at the Genome Quebec Innovation Centre (Montreal, QC, Canada).\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics and statistical analyses\u003c/h2\u003e \u003cp\u003eA bioinformatic analysis was performed using QIIME2 version 2021.4.0 [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. The pipeline used to process the 16S rRNA gene sequences was DADA2 v1.18.0 [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Initially, Cutadapt 3.4 was employed to remove both primer sequences from the 16S rRNA gene amplicons with parameter values \u0026ldquo;minimum-length\u0026thinsp;=\u0026thinsp;50\u0026rdquo;, \u0026ldquo;times\u0026thinsp;=\u0026thinsp;2\u0026rdquo;, \u0026ldquo;overlap\u0026thinsp;=\u0026thinsp;6\u0026rdquo;, and \u0026ldquo;p-error-rate\u0026thinsp;=\u0026thinsp;0.1\u0026rdquo;. Next, we excluded the forward and reverse sequences with less than 220 bp with the command \u0026ldquo;--p-trunc-len\u0026rdquo;, as the base quality of the sequences tended to diminish below that threshold in our data. Afterwards, the amplicon sequence variant (ASV) table was calculated, and chimeras were removed. The taxonomy assignment of the ASVs was performed using the naive Bayesian classifier method on the databases SILVA and RDP, and the identities of the ASVs of interest were verified manually using BLASTn on the NCBI (nr/nt) database.\u003c/p\u003e \u003cp\u003eAMF and plant-related parameters were analyzed employing JMP Pro 17 software (SAS Institute Inc., Cary, NC, USA). Shapiro\u0026ndash;Wilk test was used to verify the normal distribution of the data, and Levene\u0026rsquo;s test to determine the homoscedasticity. The data of root dry-weight biomass and root colonization were transformed using Box\u0026ndash;Cox method before performing statistical analyses. An analysis of variance (ANOVA) was used to assess the effects of AMF inoculation, RP application, and their interactions, followed by Tukey's HSD test to compare the mean values, which differed at \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05. AMF inoculation and RP addition were considered as fixed effects, and the random effect was attributed to the block.\u003c/p\u003e \u003cp\u003eMicrobial diversity analysis was performed using R (Version 4.3.2); the rare-curve function from the vegan package v2.6-4 [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e] was employed for normalizing the dataset through a random subsampling process that aligned each sample's read data to the minimal read count observed in the dataset. Shannon and Simpson diversity indices were computed to quantify alpha diversity utilizing the vegan package. The influence of RP applicationon alpha diversity was statistically examined via an ANOVA, followed by post hoc analyses using the agricolae package v1.3-7 [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. The beta diversity of bacterial ASVs across samples was determined using Bray\u0026ndash;Curtis dissimilarity and visualized with principal coordinate analysis (PCoA) plots using the vegan package. The vegan package's ADONIS function was used for the permutational multivariate analysis of variance to evaluate the effects of AMF and RP application on betadiversity, applying a Hellinger-transformation to the data and executing 999 permutations. An indicator species analysis was conducted via the indicspecies package v1.7-14 [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e] to identify the taxa associated with the application of RP. In defining the core microbiome, the designation \u0026ldquo;core bacteriota\u0026rdquo; was attributed to the bacterial taxa consistently detected in the mycelial or hyphosphere soil samples associated with the AMF \u003cem\u003eR. irregularis\u003c/em\u003e. The core bacteriome was identified using the microbiome package v1.24-0 [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e] with 95% prevalence. The co-occurrence network was built using the R packages [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e] and igraph [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e] only using ASVs with a total abundance superior to 0.05%, thus retaining only 1567 ASVs. Metabolic pathways associated with the taxonomy of bacteria were calculated using the Picrust2 of Galaxy tool [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. The taxa associated with treatments were identified using the microbial package in R [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e] and its \u0026ldquo;ldamarker\u0026rdquo; command, which implements the Linear discriminant analysis effect size (LEFSe) method.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eMycorrhizal colonization and mycelial production\u003c/h2\u003e \u003cp\u003eThe mycorrhizal colonization was successfully established in the plants inoculated with \u003cem\u003eR. irregularis\u003c/em\u003e, whereas no colonization was observed in non-mycorrhizal roots. Means were 94.82% and 89.32% under the presence and absence of RP respectively, which explains the quantity of mycelial biomass extracted from the hyphal compartment (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). While no hyphae were found in the absence of \u003cem\u003eR. irregularis\u003c/em\u003e inoculation, they multiplied extensively in the hyphal compartment when the plants were colonized (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). RP did not significantly influence the mycelial biomass, the percentages of mycorrhizal colonization and vesicle formation. Surprisingly, the percentage of arbuscules was significantly affected by the RP application (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.03).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMycorrhizal colonization and fresh biomass of the hyphae in the RFC. The abbreviations M1P0 and M1P1 indicate samples inoculated with \u003cem\u003eR. irregularis\u003c/em\u003e without RP and those inoculated with \u003cem\u003eR. irregularis\u003c/em\u003e and supplemented with RP, respectively.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatments\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMycelial biomass (mg/pot)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMycorrhizal colonization (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eArbuscules (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eVesicles (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eM1P0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e117.95\u0026thinsp;\u0026plusmn;\u0026thinsp;27.96 a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e89.32\u0026thinsp;\u0026plusmn;\u0026thinsp;3.66 a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e62.86\u0026thinsp;\u0026plusmn;\u0026thinsp;10.69 a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e69.49\u0026thinsp;\u0026plusmn;\u0026thinsp;6.90 a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eM1P1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e109.60\u0026thinsp;\u0026plusmn;\u0026thinsp;19.95 a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e94.82\u0026thinsp;\u0026plusmn;\u0026thinsp;2.37 a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e90.12\u0026thinsp;\u0026plusmn;\u0026thinsp;2.23 b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e74.07\u0026thinsp;\u0026plusmn;\u0026thinsp;4.64 a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eData are presented as the mean value (n\u0026thinsp;=\u0026thinsp;9) and standard error. The significance of treatments was determined by one-way ANOVA. Lowercase letters indicate significance at the \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 level.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003ePlant productivity\u003c/h2\u003e \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e \u003ch2\u003ePlant biomass and stem diameter\u003c/h2\u003e \u003cp\u003eAgronomic parameters of \u003cem\u003eAllium porrum\u003c/em\u003e were affected by the treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The colonization with \u003cem\u003eR. irregularis\u003c/em\u003e significantly enhanced both root (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and shoot dry weight biomass (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, B). However, RP application did not influence shoot (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.373) and root (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.493) dry-weight biomass (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, B). A similar trend was exhibited for stem diameter (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). While the application of AMF spores significantly increased the stem diameter (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), RP application was statistically insignificant (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.702) (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). However, the combined treatment (M1P1) tended to increase the stem diameter (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.07) (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). M1P1 treatment improved plant biomass and stem diameter by 125.14% and 51.47%, respectively, compared to the control (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eShoot P concentration and photosynthetic capacity\u003c/h2\u003e \u003cp\u003eAlthough RP application tended to increase shoot P concentration (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.072), mycorrhization significantly increased the total P acquired by plants (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.014) compared to the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA; Table S2). Moreover, mycorrhizal plants supplied with RP (M1P1) exhibited 135% increase in shoot P content (P concentration \u0026times; shoot biomass) relative to the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA; Table S2). Regarding photosynthetic capacity, both RP application (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.017) and AMF inoculation (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) significantly increased chlorophyll concentration compared to the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB; Table S2). The combined treatment (M1P1) resulted in the highest chlorophyll concentration, representing a 60% increase relative to the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB; Table S2).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eTaxonomic profiles of the bacteria\u003c/h2\u003e \u003cp\u003eRaw Illumina MiSeq 16S rRNA gene sequencing generated a total of 2,513,803 bacterial reads. We retrieved 1,004,950 non-chimeric reads from 54 samples, ranging from 1,948 to 91128 reads per sample (two samples were excluded due to insufficient sequencing quality). An extra cleaning of the dataset was performed to remove unidentified ASVs at the phylum level as well as those with fewer than 10 reads in all samples. The final dataset comprised a total of 7514 ASVs, which were subsequently categorized into 31 phyla, 85 classes, 130 orders, 149 families, and 194 genera. The rarefaction curves indicated that all samples had reached saturation (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). In each of the habitats, Planctomycetota was the most abundant phylum, followed by Pseudomonadota, with 57% and 10% in the mycelia, 39% and 12% in the hyphosphere soil, and 44% and 11% in the bulk soil, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), while \u003cem\u003eParcubacteria candidate phylum\u003c/em\u003e OD1 came in third place with 7% in the mycelia. Bacillota, on the other hand, was in the hyphosphere and bulk soils, with 11% in each of these habitats. Among the mycelia, the prevalent genera were \u003cem\u003ePlanctomyces\u003c/em\u003e (10%) followed by \u003cem\u003eGemmata\u003c/em\u003e (9%) and \u003cem\u003ePirellula\u003c/em\u003e (4%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). In contrast, the predominant genera in the hyphosphere soil were \u003cem\u003ePlanctomyces\u003c/em\u003e (9%), \u003cem\u003eBacillus\u003c/em\u003e (7%), and \u003cem\u003eGemmata\u003c/em\u003e (5%). Similarly, in bulk soil, the dominant genera were \u003cem\u003ePlanctomyces\u003c/em\u003e (11%), \u003cem\u003eBacillus\u003c/em\u003e (6%), and \u003cem\u003eGemmata\u003c/em\u003e (5%). An important proportion of bacterial genera remained unidentified, with 62% in the mycelia, 55% in the hyphosphere soil, and 55% in the bulk soil.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFurthermore, the Venn diagram analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) of bacterial ASVs shared among the three habitats revealed 672 ASVs, accounting for 15%, 22%, and 24% of the bacterial communities in mycelia, the hyphosphere, and bulk soil, respectively. Additionally, 281 ASVs (6% of the mycelial community and 9% of the hyphosphere community) were found exclusively in these two habitats. Similarly, 232 ASVs were common between mycelia and bulk soil, representing 5% and 8% of their respective bacterial communities.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn contrast, the highest number of shared ASVs (1,216) was observed between the hyphosphere and bulk soil, comprising 40% and 44% of their respective bacterial communities. Notably, 3,404 ASVs were unique to mycelia (47%), 845 were exclusive to the hyphosphere (12%), and 616 were found only in bulk soil (9%).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eEffect of RP amendment on the bacterial community assemblage in mycelia, hyphosphere, and bulk soil\u003c/h2\u003e \u003cp\u003eNeither RP nor sample type affected the α-diversity as measured with Shannon and Simpson indices (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). However, a PCoA showed a clear separation of bacterial communities associated with the AMF mycelia from those in the hyphosphere soil and bulk soil samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Similarly, RP application led to a distinct categorization of bacterial communities associated with AMF mycelia (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Given that the bacterial communities were separated by habitats, an additional PERMANOVA analysis was conducted to determine if RP application affected the bacterial communities within each habitat. The results showed a significant impact of RP application on the bacterial communities associated with AMF mycelia (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.01) and in the bulk soil (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.015), accounting for 6.8% and 6.1% of the variation, respectively (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Another PERMANOVA analysis was conducted on bacterial soil communities to evaluate the effect of AMF spore inoculation. The results revealed a significant effect (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.004) on the bacterial assemblage, accounting for 3.5% of the variation (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eα-diversity of bacterial community assessed by Shannon and Simpson indices in different habitats under RP amendment.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHabitats\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIndex\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSource of variation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSum Sq\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMean Sq\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNumDF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eDenDF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eF value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003ePr(\u0026gt;\u0026thinsp;F)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAMF mycelia\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eShannon\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.305\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.305\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e8.000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.839\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.387\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSimpson\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.92E-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.92E-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e8.000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.155\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.704\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHyphosphere soil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eShannon\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.043\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.043\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.468\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.504\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSimpson\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.04E-06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.04E-06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.106\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.749\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBulk soil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eShannon\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.02E-04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.02E-04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e8.000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.006\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.942\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSimpson\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.98E-06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.98E-06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0.094\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e0.763\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eβ-diversity variance partitioning of bacterial community\u0026rsquo;s structure among RP application in permutational multivariate analysis of variance in different habitats.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariable\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSource of variation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSumOfSq\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePr(\u0026gt;\u0026thinsp;F)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eAMF mycelia\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.444\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.068\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.165\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.01**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eResidual\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6.092\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.932\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6.536\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eHyphosphere Soil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.229\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.044\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.732\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.87\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eResidual\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.956\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5.230\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eBulk soil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.317\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.061\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.035\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.015*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eResidual\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4.900\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.939\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5.217\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eβ-diversity variance partitioning of bacterial community\u0026rsquo;s structure among AMF inoculation in permutational multivariate analysis of variance in soil biotopes.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSource of variation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSumOfSq\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePr(\u0026gt;\u0026thinsp;F)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAMF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.677\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.035\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.884\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.004**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eResidual\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e18.684\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.965\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19.361\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003ePatterns of indicator species and core bacteriome\u003c/h2\u003e \u003cp\u003eSeveral bacterial ASVs exhibited consistent shifts in abundance across treatments and sample compartments. Indicator species analysis identified 35 ASVs (Table S3), revealing a strong compartment- and treatment-specific signal. In the absence of RP application, 26 indicator ASVs (74%) were detected, the majority of which were associated with mycelial samples (20 ASVs). These indicators were dominated by Planctomycetota (16 ASVs), with additional representation from the \u003cem\u003eParcubacteria candidate phylum\u003c/em\u003e OD1 (three ASVs) and Bacillota (one ASV). Five indicator ASVs were linked to bulk soil, spanning Actinobacteriota, Chloroflexota, Acidobacteriota, Bacillota, and Planctomycetota, while only a single indicator ASV, affiliated with Verrucomicrobiota, was detected in the hyphosphere soil. In contrast, RP application yielded fewer indicator taxa (nine ASVs, 26%), most of which were associated with bulk soil, primarily Planctomycetota (six ASVs) and one Parcubacteria (OD1). Only one indicator ASV was detected in each of the mycelial and hyphosphere compartments, affiliated with Planctomycetota and OP3, respectively.\u003c/p\u003e \u003cp\u003eCore bacteriome analysis further highlighted compartment-specific microbial assemblages. Across all samples, 12 core taxa were identified, occurring in at least 95% of samples (Table S4). The mycelial compartment harbored six core taxa, including \u003cem\u003ePlanctomyces\u003c/em\u003e sp., three members of the Pirellulaceae family (genera A17, \u003cem\u003ePirellula\u003c/em\u003e sp., and one unclassified taxon), \u003cem\u003eBacillus flexus\u003c/em\u003e, and an unclassified Gemmataceae. Similarly, six core taxa were detected in the hyphosphere soil, comprising \u003cem\u003eBacillus fumarioli\u003c/em\u003e, AKIW781 (Chloroflexota), \u003cem\u003ePlanctomyces\u003c/em\u003e sp., two Pirellulaceae taxa (A17 and \u003cem\u003ePirellula\u003c/em\u003e sp.), and \u003cem\u003eGemmata\u003c/em\u003e sp. In bulk soil, five core taxa were identified, including AKIW781 (Chloroflexota), \u003cem\u003eBacillus fumarioli\u003c/em\u003e, \u003cem\u003ePlanctomyces\u003c/em\u003e sp., \u003cem\u003ePirellula\u003c/em\u003e sp., and \u003cem\u003eGemmata\u003c/em\u003e sp. Although no core ASVs were shared between mycelial and hyphosphere compartments, several genera overlapped, whereas two and three shared core ASVs were observed between bulk soil and mycelial samples, and bulk soil and hyphosphere samples, respectively.\u003c/p\u003e \u003cp\u003eConsistent with these patterns, LEfSe analysis identified clear treatment-associated biomarkers. The family Anaerolineaceae and one ASV assigned to the genus \u003cem\u003ePlanctomyces\u003c/em\u003e were significantly enriched under RP amendment (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), whereas the order JG30-KF-AS9 within the Chloroflexota was significantly associated with the absence of RP addition (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). These discriminant taxa were predominantly detected in soil samples. At a finer resolution, two ASVs were identified as core taxa within the mycelial compartment, being present in more than 90% of mycelial samples: ASV2 (\u003cem\u003ePlanctomyces\u003c/em\u003e) and ASV3 (Pirellulaceae). In soil samples, two core ASVs affiliated with the order AKIW781 (Chloroflexi) were consistently detected (Tables S3, S4).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eNetwork analysis and functional profiling\u003c/h2\u003e \u003cp\u003eThe co-occurrence network of bacterial ASVs was structured into two main groups: one predominantly composed of taxa associated with AMF mycelium and the other composed of soil-associated taxa (bulk soil and hyphosphere). A hub taxon was identified in both soil and mycelial compartments (ASV3100), belonging to the family \u003cem\u003eThermogemmatisporaceae\u003c/em\u003e within the phylum \u003cem\u003eChloroflexota\u003c/em\u003e, with a betweenness centrality of 2.2 \u0026times; 10⁵. This hub taxon did not exhibit significant sensitivity to RP amendment (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.322) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eWe investigated the influence of RP amendment on the assemblage of soil bacterial communities and their association with the AMF mycelia, and subsequently evaluated how this interaction affects P nutrition and growth of leek plants.\u003c/p\u003e \u003cp\u003eFurthermore, the microcosm design facilitated the suppression of the direct effect of root exudates. Along with the extraction method, this setup effectively extracted large amounts of AMF mycelia. We observed that all plants inoculated with AMF exhibited an increased colonization rate. Additionally, the RP application led to a higher proportion of root arbuscules, which serve as the symbiotic interface between plant cells and AMF intraradical hyphae. These structures play a crucial role in the exchange of materials between plants and AMF, enhancing the plants\u0026rsquo; ability to absorb higher levels of P [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. Although mycorrhizal colonization was greater in the treated plants, the RP did not influence mycorrhizal colonization. However, the shoot and root biomass increased with the combined application of AMF and RP; this is consistent with previous results showing that the P concentration does not influence the percentage of mycorrhization but aids in absorbing P from the soil and RP, leading to increased mineralization in \u003cem\u003eAcacia gummifera\u003c/em\u003e [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. A study Elhaissoufi, \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e] found that inoculating durum wheat with P-solubilizing rhizobacteria, in combination with RP amendment, enhanced both the root morphology and aboveground plant morphological and physiological traits. Similarly, another study by Mahdi, \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e] demonstrated that inoculating quinoa with the halotolerant phosphorus-solubilizing bacterium \u003cem\u003eBacillus velezensis\u003c/em\u003e improved the plant's resilience and phosphorus uptake under high salt stress induced by NaCl application. Moreover, the mycorrhizal plants with access to RP showed a significantly higher uptake of P and an increase in chlorophyll concentration in their shoots, which could potentially enhance their photosynthetic capacity and plant productivity. This enhanced P nutrition is likely an indirect result of RP solubilization facilitated by AMF and its role in shaping the microbiome associated with its hyphae, given that RP was the only form of P source used in the experiment. This can be explained by the ability of \u003cem\u003eR. irregularis\u003c/em\u003e to penetrate the pot-separating membranes and explore the RFC soil through its hyphae. These findings are supported by a previous work [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e] demonstrating that the presence of AMF in the hyphal compartment was linked to phytate P depletion. This suggests that the P solubilization in the microcosm was facilitated by the mycelium of AMF. McCormack and Iversen [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e] reported that fungi can access more pore spaces than roots, thereby expanding the resource absorption area. A meta-analysis by See, \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e] estimated that the average AMF hyphal density across different soil systems was 2000 cm/cm\u0026sup3;. This extensive network contributes to the distribution of carbon in the soil through the exudation of organic compounds and hyphal turnover, which is a key mechanism driving bacterial abundance in the hyphoplan. This corroborates our findings of enriched bacterial communities in mycelial samples. AMF hyphae secrete various organic compounds, including carbohydrates, organic acids, amino acids, and other substances [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]. Like plants, AMF interact with soil microbes through their extraradical hyphae [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOrdonez, \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e] found that AMF alone did not significantly enhance P uptake from RP; however, the addition of P-solubilizing bacteria increased P uptake by promoting both intra- and extraradical AMF hyphal growth, underscoring the cooperative relationship between AMF and bacteria. The hyphal network colonizing the RFC supports microbial prokaryotes by providing labile carbon, which facilitates microbial colonization and biofilm formation on the mycelium [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. The specific organic compounds secreted by AMF hyphae can vary depending on the AMF species and environmental conditions [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]. Additionally, this hyphal network may act as a \"highway\" for bacterial dispersal, enabling them to access nutrient-rich microhabitats, such as RP particles [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e, \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDifferent strategies are used by AMF to acquire P from the soil. Wang et al. [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e] found that AMF can either produce greater amounts of hyphae or recruit different bacterial communities, which are able to mobilize P from unavailable sources. Our results demonstrated that RP did not influence the biomass of AMF mycelia, but instead, it affected the bacterial communities recruited by its mycelium. Thus, soil P availability is potentially increased through the solubilization of RP in the RFC. The microbes associated with AMF hyphae are not random; rather, they vary according to the host's nutritional requirements and the organic compounds secreted into the soil, which are heavily influenced by the bacterial community associated with the hyphae [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e, \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. Zhang, \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e] explored the phosphate\u0026ndash;carbon (C) exchanges between \u003cem\u003eRhizophagus irregularis\u003c/em\u003e and \u003cem\u003eRahnella aquatilis\u003c/em\u003e and found that AMF hyphae exuded fructose, which induced phosphatase gene expression in \u003cem\u003eR. aquatilis\u003c/em\u003e, enhancing phytate mineralization. Furthermore, the AMF phosphate transporter gene was upregulated in the presence of \u003cem\u003eR. aquatilis\u003c/em\u003e, suggesting that the specific type of AMF hyphal exudates can influence bacterial communities in the mycorrhizosphere. Additionally, Duan, \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e] demonstrated that interactions within the hyphosphere between \u003cem\u003eR. irregularis\u003c/em\u003e and \u003cem\u003eR. aquatilis\u003c/em\u003e facilitate C-P exchange at the peri-arbuscular space in \u003cem\u003eMedicago truncatula\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cem\u003ePlanctomyces, Gemmata\u003c/em\u003e and \u003cem\u003eBacillus\u003c/em\u003e were identified as predominant genera in our dataset, with more than 50% of bacterial genera remaining unidentified in the mycelia and both hyphosphere and bulk soils. Most bacterial taxa were identified in the soil samples, and only one ASV (\u003cem\u003ePlanctomyces\u003c/em\u003e sp.) was found to be significantly abundant with RP amendment. Candidates from \u003cem\u003ePlanctomycetota\u003c/em\u003e and \u003cem\u003eBacillota\u003c/em\u003e were identified as core taxa in the mycelia, and in addition to these phyla, a bacterium from Chloroflexota were identified as core taxa in the hyphosphere soil samples. Planctomycetota are significantly under-sampled, and while their partial genomes have been found in a variety of environments, most remain uncultivated [\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e]. Although a small number of slow-growing cultivable bacteria in axenic cultures have been characterized, they remain an enigmatic group due to challenges in obtaining pure cultures, limiting their characterization [\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]. Planctomycetota is a phylum of Gram-negative bacteria, within the Planctomycetes-Verrucomicrobia-Chlamydiae (PVC) superphylum, distinguished by their budding reproduction and the absence of peptidoglycan in their cell walls [\u003cspan additionalcitationids=\"CR77\" citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe observed prevalence of Planctomycetota in our experiment can be attributed to their ecological role as symbionts in natural environments, where they typically live in association with other organisms [\u003cspan additionalcitationids=\"CR80\" citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e]. These microbes effectively compete against various microbial communities in challenging habitats by producing specific antimicrobial compounds, such as stieleriacines, which confer a competitive advantage in resource-limited conditions [\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e]. A study by Liang, \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e] on P-solubilizing bacteria in ecological restoration noted that certain bacterial groups, including Planctomycetes, were abundant in P solubilization; the authors found that microbes containing the \u003cem\u003egcd\u003c/em\u003e gene were highly abundant in 17 genera, with over half of the \u003cem\u003egcd-\u003c/em\u003econtaining genomes represented in Planctomycetota, Bacteroidota, Acidobacteriota, and Gemmatimonadota. The authors found a strong correlation between the abundance of these bacteria and bioavailable P in the soil, identifying them as the main drivers of P mineralization. In another study on peanuts, Planctomycetota, Chloroflexota, and Acidobacteriota were found to be dominant phyla contributing to nutrient cycling in the presence of RP [\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e]. A microcosm experiment revealed that phosphorus-solubilizing bacteria were transported along AMF hyphae, facilitating the movement of organic P patches and enhancing P mineralization under soil conditions [\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e]. This indicates that the mycelial biomass extracted from the hyphal compartment plays a role in acquiring specific bacteria, predominantly Planctomycetes, which form a co-occurrence network to solubilize RP. Additionally, AMF may recruit other bacteria, including those from Planctobacteriota, Chloroflexota or Bacillota, which may contain \u003cem\u003egcd\u003c/em\u003e gene bins and have not yet been identified as potential RP solubilizers.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe study demonstrated that inoculation with \u003cem\u003eR. irregularis\u003c/em\u003e and the addition of RP significantly improved the P content in leeks, supporting our first hypothesis. Additionally, RP amendment altered the community structure of bacteria associated with \u003cem\u003eR. irregularis\u003c/em\u003e mycelium, which confirms our second hypothesis. Our results underscore the abiotic and biotic factors that drive changes in the bacterial community within the hyphosphere associated with AMF mycelia. It also demonstrates the beneficial effects of AMF, particularly with the addition of RP, in which certain bacteria were shown to be abundant and effective in P solubilization. The P made available through this process was then taken up and transported to the leek root cells by AMF, suggesting that the combined use of AMF and RP could be a promising strategy for RP solubilization, potentially reducing the need for chemical fertilizers.\u003c/p\u003e \u003cp\u003eTo validate these findings, field trials should be conducted before these plant-growth-promoting AMF, and bacterial inoculants can be recommended to farmers for supporting sustainable crop production. This knowledge could be applied to develop bioinoculants for the next generation of fertilizers, enhancing the P efficiency by utilizing RP instead of processed P fertilizers for sustainable agriculture.\u003c/p\u003e"},{"header":"Declarations","content":" \u003cp\u003e \u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e \u003cp\u003eNot applicable.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for publication\u003c/strong\u003e \u003cp\u003eNot applicable.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eCompeting interests\u003c/strong\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was funded by the University Mohammed VI Polytechnic (UM6P), which is gratefully acknowledged.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eZL designed and conducted the experiments, developed the methodology, performed the data analysis, and drafted the manuscript. JL and BA contributed to the analysis and data interpretation and participated in the manuscript revision. MH conceived the study, supervised the work, and secured the funding. All authors discussed the results and approved the final version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eWe thank Dr. Jean-Baptiste Floc\u0026rsquo;H for his assistance in bioinformatics and Dr. Marc St-Arnaud for his help and support with the experimental design and protocols development. We also thank St\u0026eacute;phane Daigle for providing statistical assistance.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe raw reads corresponding to the hyphosphere soil samples and the AMF mycelia samples were submitted to NCBI ( [https://www.ncbi.nlm.nih.gov/](https:/www.ncbi.nlm.nih.gov) ), with accession numbers provided under the BioProject PRJNA1147075.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eEzawa T, Saito K. How do arbuscular mycorrhizal fungi handle phosphate? New insight into fine-tuning of phosphate metabolism. \u003cem\u003eNew Phytologist\u003c/em\u003e 2018, \u003cem\u003eIn Press\u003c/em\u003e, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/nph.15187\u003c/span\u003e\u003cspan address=\"10.1111/nph.15187\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReid A, Greene SE. \u003cem\u003eHow Can Microbes Help Feed the World? A Report from the American Society of Microbiology\u003c/em\u003e; 2013.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBell TH, Joly S, Pitre FE, Yergeau E. Increasing phytoremediation efficiency and reliability using novel omics approaches. Trends Biotechnol. 2014;32:271\u0026ndash;80. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tibtech.2014.02.008\u003c/span\u003e\u003cspan address=\"10.1016/j.tibtech.2014.02.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJanzen HH, Fixen P, Franzluebbers AJ, Hattey J, Izaurralde RC, Ketterings QM, Lobb DA, Schlesinger WH. Global prospects rooted in soil science. Soil Sci Soc Am J. 2011;75:1\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQuiza L, St-Arnaud M, Yergeau E. Harnessing phytomicrobiome signaling for rhizosphere microbiome engineering. \u003cem\u003eFrontiers in Plant Science\u003c/em\u003e 2015, \u003cem\u003e14\u003c/em\u003e, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2015.00507\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2015.00507\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrundrett MC, Tedersoo L. Evolutionary history of mycorrhizal symbioses and global host plant diversity. New Phytol. 2018;220:1108\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/nph.14976\u003c/span\u003e\u003cspan address=\"10.1111/nph.14976\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMosse B. Advances in the Study of Vesicular-Arbuscular Mycorrhiza. Annu Rev Phytopathol. 1973;11:171\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIsmail Y, Hijri M. Arbuscular mycorrhisation with Glomus irregulare induces expression of potato PR homologues genes in response to infection by Fusarium sambucinum. Funct Plant Biol. 2012;39:236\u0026ndash;45. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1071/FP11218\u003c/span\u003e\u003cspan address=\"10.1071/FP11218\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIsmail Y, McCormick S, Hijri M. A fungal symbiont of plant-roots modulates mycotoxin gene expression in the pathogen Fusarium sambucinum. PLoS ONE. 2011;6:e17990. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0017990\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0017990\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIsmail Y, McCormick S, Hijri M. The arbuscular mycorrhizal fungus, Glomus irregulare, controls the mycotoxin production of Fusarium sambucinum in the pathogenesis of potato. FEMS Microbiol Lett. 2013;384:46\u0026ndash;51. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/1574-6968.12236\u003c/span\u003e\u003cspan address=\"10.1111/1574-6968.12236\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSch\u0026uuml;tzend\u0026uuml;bel A, Polle A. Plant responses to abiotic stresses: heavy metal-induced oxidative stress and protection by mycorrhization. J Exp Bot. 2002;53:1351\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFortin JA, Plenchette C, Pich\u0026eacute; Y. Mycorrhizas: the new green revolution. \u0026Eacute;dition Multimondes: Quebec; 2009. p. 140.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmith R. Mycorrhizal Symbiosis. 2008, 800.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRouphael Y, Franken P, Schneider C, Schwarz D, Giovannetti M, Agnolucci M, Pascale SD, Bonini P, Colla G. Arbuscular mycorrhizal fungi act as biostimulants in horticultural crops. Sci Hort. 2015;196:91\u0026ndash;108. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.scienta.2015.09.002\u003c/span\u003e\u003cspan address=\"10.1016/j.scienta.2015.09.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRillig MC, Sosa-Hernandez MA, Roy J, Aguilar-Trigueros CA, Valyi K, Lehmann A. Towards an Integrated Mycorrhizal Technology: Harnessing Mycorrhiza for Sustainable Intensification in Agriculture. Front Plant Sci. 2016;7:1625. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fpls.2016.01625\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2016.01625\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodriguez A, Sanders IR. The role of community and population ecology in applying mycorrhizal fungi for improved food security. ISME J. 2014. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ismej.2014.207\u003c/span\u003e\u003cspan address=\"10.1038/ismej.2014.207\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBasiru S, Ait Si Mhand K, Hijri M. Disentangling arbuscular mycorrhizal fungi and bacteria at the soil-root interface. Mycorrhiza. 2023;33:119\u0026ndash;37. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00572-023-01107-7\u003c/span\u003e\u003cspan address=\"10.1007/s00572-023-01107-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBasiru S, Mhand KAS, Hijri M. Deciphering the mechanisms through which arbuscular mycorrhizal symbiosis reduces nitrogen losses in agroecosystems. Appl Soil Ecol. 2025;206:105799. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.apsoil.2024.105799\u003c/span\u003e\u003cspan address=\"10.1016/j.apsoil.2024.105799\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKohlmeier S, Smits TH, Ford RM, Keel C, Harms H, Wick LY. Taking the fungal highway: mobilization of pollutant-degrading bacteria by fungi. Environ Sci Technol. 2005;39:4640\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIffis B, St-Arnaud M, Hijri M. Bacteria associated with arbuscular mycorrhizal fungi within roots of plants growing in a soil highly contaminated with aliphatic and aromatic petroleum hydrocarbons. FEMS Microbiol Lett. 2014;358:44\u0026ndash;54. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/1574-6968.12533\u003c/span\u003e\u003cspan address=\"10.1111/1574-6968.12533\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIffis B, St-Arnaud M, Hijri M. Petroleum hydrocarbon contamination, plant identity and arbuscular mycorrhizal fungal (AMF) community determine assemblages of the AMF spore-associated microbes. Environ Microbiol. 2016;18:2689\u0026ndash;704. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/1462-2920.13438\u003c/span\u003e\u003cspan address=\"10.1111/1462-2920.13438\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIffis B, St-Arnaud M, Hijri M. Petroleum Contamination and Plant Identity Influence Soil and Root Microbial Communities While AMF Spores Retrieved from the Same Plants Possess Markedly Different Communities. Front Plant Sci. 2017;8:1381. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fpls.2017.01381\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2017.01381\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLecomte J, St-Arnaud M, Hijri M. Isolation and identification of soil bacteria growing at the expense of arbuscular mycorrhizal fungi. FEMS Microbiol Lett. 2011;317:43\u0026ndash;51. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1574-6968.2011.02209.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1574-6968.2011.02209.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonfante-Fasolo P, Vian B. Wall texture in the spore of a vesicular-arbuscular mycorrhizal fungus. Protoplasma. 1984;120:51\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLevy A, Chang BJ, Abbott LK, Kuo J, Harnett G, Inglis TJJ. Invasion of Spores of the Arbuscular Mycorrhizal Fungus Gigaspora decipiens by Burkholderia spp. Appl Environ Microbiol. 2003;69:6250\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/aem.69.10.6250-6256.2003\u003c/span\u003e\u003cspan address=\"10.1128/aem.69.10.6250-6256.2003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMansfeld-Giese K, Larsen J, Bodker L. Bacterial populations associated with mycelium of the arbuscular mycorrhizal fungus \u003cem\u003eGlomus intraradices\u003c/em\u003e. FEMS Microbiol Ecol. 2002;41:133\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXavier LJC, Germida JJ. Bacteria associated with \u003cem\u003eGlomus clarum\u003c/em\u003e spores influence mycorrhizal activity. Soil Biol Biochem. 2003;35:471\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgnolucci M, Battini F, Cristani C, Giovannetti M. Diverse bacterial communities are recruited on spores of different arbuscular mycorrhizal fungal isolates. Biol Fertil Soils. 2015;51:379\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMansfeld-Giese K, Larsen L, B\u0026oslash;dker L. Bacterial populations associated with mycelium of the arbuscular mycorrhizal fungus Glomus intraradices. FEMS Microbiol Ecol. 2002;41:133\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScheublin TR, Sanders IR, Keel C, van der Meer JR. Characterisation of microbial communities colonising the hyphal surfaces of arbuscular mycorrhizal fungi. ISME J. 2010;4:752\u0026ndash;63. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.nature.com/ismej/journal/v4/n6/suppinfo/ismej20105s1.html\u003c/span\u003e\u003cspan address=\"http://www.nature.com/ismej/journal/v4/n6/suppinfo/ismej20105s1.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelvakumar G, Krishnamoorthy R, Kim K, Sa T-M. Genetic Diversity and Association Characters of Bacteria Isolated from Arbuscular Mycorrhizal Fungal Spore Walls. PLoS ONE. 2016;11:e0160356. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0160356\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0160356\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonfante-Fasolo P, Grippiolo R. Cytochemical and biochemical observations on the cell wall of the spore of \u003cem\u003eGlomus epigaeum\u003c/em\u003e. Protoplasma. 1984;123:140\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoesti D, Ineichen K, Braissant O, Redecker D, Wiemken A, Aragno M. Bacteria associated with spores of the arbuscular mycorrhizal gungi Glomus geosporum and Glomus constrictum. Appl Environ Microbiol. 2005;71:6673\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/aem.71.11.6673-6679.2005\u003c/span\u003e\u003cspan address=\"10.1128/aem.71.11.6673-6679.2005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCruz AF, Ishii T. Arbuscular mycorrhizal fungal spores host bacteria that affect nutrient biodynamics and biocontrol of soil-borne plant pathogens. Biology open. 2012;1:52\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1242/bio.2011014\u003c/span\u003e\u003cspan address=\"10.1242/bio.2011014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaktek S, Tr\u0026eacute;panier M, Servin PM, St-Arnaud M, Pich\u0026eacute; Y, Fortin JA, Antoun H. Trapping of phosphate solubilizing bacteria on hyphae of the arbuscular mycorrhizal fungus Rhizophagus irregularis DAOM 197198. Soil Biol Biochem. 2015;90:1\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.soilbio.2015.07.016\u003c/span\u003e\u003cspan address=\"10.1016/j.soilbio.2015.07.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaktek S, St-Arnaud M, Piche Y, Fortin JA, Antoun H. Igneous phosphate rock solubilization by biofilm-forming mycorrhizobacteria and hyphobacteria associated with Rhizoglomus irregulare DAOM 197198. Mycorrhiza. 2017;27:13\u0026ndash;22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00572-016-0726-z\u003c/span\u003e\u003cspan address=\"10.1007/s00572-016-0726-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAwasthi A, Bharti N, Nair P, Singh R, Shukla AK, Gupta MM, Darokar MP, Kalra A. Synergistic effect of Glomus mosseae and nitrogen fixing Bacillus subtilis strain Daz26 on artemisinin content in Artemisia annua L. Appl Soil Ecol. 2011;49:125\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.apsoil.2011.06.005\u003c/span\u003e\u003cspan address=\"10.1016/j.apsoil.2011.06.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLahrach Z, Legeay J, Ahmed B, Hijri M. The composition of the arbuscular mycorrhizal fungal bacteriome is species dependent. Environ Microbiome. 2024;19:77. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s40793-024-00623-z\u003c/span\u003e\u003cspan address=\"10.1186/s40793-024-00623-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBolland MDA, Gilkes RJ. Rock phosphates are not effective fertilizers in Western Australian soils: A review of one hundred years of research. Fertilizer Res. 1990;22:79\u0026ndash;95. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/bf01116182\u003c/span\u003e\u003cspan address=\"10.1007/bf01116182\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRandhawa PS, Condron LM, Di HJ, Sinaj S, McLenaghen RD. Effect of Green Manure Addition on Soil Organic Phosphorus Mineralisation. Nutr Cycl Agrosyst. 2005;73:181\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10705-005-0593-z\u003c/span\u003e\u003cspan address=\"10.1007/s10705-005-0593-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhoshru B, Nosratabad AF, Mitra D, Chaithra M, Danesh YR, Boyno G, Chattaraj S, Priyadarshini A, Anđelković S, Pellegrini M, et al. Rock Phosphate Solubilizing Potential of Soil Microorganisms: Advances in Sustainable Crop Production. Bacteria. 2023;2:98\u0026ndash;115. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/bacteria2020008\u003c/span\u003e\u003cspan address=\"10.3390/bacteria2020008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRenaut S, Masse J, Norrie JP, Blal B, Hijri M. A commercial seaweed extract structured microbial communities associated with tomato and pepper roots and significantly increased crop yield. Microb Biotechnol. 2019;12:1346\u0026ndash;58. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/1751-7915.13473\u003c/span\u003e\u003cspan address=\"10.1111/1751-7915.13473\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKohl L, Lukasiewicz CE, van der Heijden MG. Establishment and effectiveness of inoculated arbuscular mycorrhizal fungi in agricultural soils. Plant Cell Environ. 2016;39:136\u0026ndash;46. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/pce.12600\u003c/span\u003e\u003cspan address=\"10.1111/pce.12600\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDavies FT, Saraiva Grossi JA, Carpio L, Estrada-Luna AA. Colonization and Growth Effects of the Mycorrhizal Fungus Glomus intraradicies in a Commercial Nursery Container Production System. J Environ Hortic. 2000;18:247\u0026ndash;51. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.24266/0738-2898-18.4.247\u003c/span\u003e\u003cspan address=\"10.24266/0738-2898-18.4.247\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVierheilig H, Coughlan AP, Wyss U, Piche Y. Ink and vinegar, a simple staining technique for arbuscular-mycorrhizal fungi. Appl Environ Microbiol. 1998;64:5004\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/AEM.64.12.5004-5007.1998\u003c/span\u003e\u003cspan address=\"10.1128/AEM.64.12.5004-5007.1998\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePequerul A, P\u0026eacute;rez C, Madero P, Val J, Monge E. A rapid wetdigestion method for plant analysis. In: Fragoso MAC, Van Beusichem ML, Houwers A, editors. Optimization of plant nutrition. Dordrecht: Eds.; Springer; 1993.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHolman WI. A new technique for the determination of phosphorus by the molybdenum blue method. Biochem J. 1943;37:256\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1042/bj0370256\u003c/span\u003e\u003cspan address=\"10.1042/bj0370256\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarnelid H, Turk-Kubo K, Ploug H, Ossolinski JE, Collins JR, Van Mooy BAS, Zehr JP. Diverse diazotrophs are present on sinking particles in the North Pacific Subtropical Gyre. ISME J. 2019;13:170\u0026ndash;82. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41396-018-0259-x\u003c/span\u003e\u003cspan address=\"10.1038/s41396-018-0259-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBolyen E, Rideout JR, Dillon MR, Bokulich NA, Abnet CC, Al-Ghalith GA, Alexander H, Alm EJ, Arumugam M, Asnicar F, et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat Biotechnol. 2019;37:852\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41587-019-0209-9\u003c/span\u003e\u003cspan address=\"10.1038/s41587-019-0209-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCallahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJA, Holmes SP. DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods. 2016;13:581\u0026ndash;3. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nmeth.3869\u003c/span\u003e\u003cspan address=\"10.1038/nmeth.3869\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOksanen J, Blanchet FG, Kindt R, Legendre P, Minchin PR, O\u0026rsquo;Hara RB, Simpson GL, Solymos P, Stevens MHH, Wagner H. \u003cem\u003eVegan: Community Ecology Package.\u003c/em\u003e, R Package Version 2.2-0; 2014.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Mendiburu F. \u003cem\u003eagricolae: Statistical Procedures for Agricultural Research\u003c/em\u003e, 1.3-7; 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eC\u0026aacute;ceres MD, Jansen F, Dell N. \u003cem\u003eindicspecies: Relationship Between Species and Groups of Sites.\u003c/em\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cran.r-project.org/web/packages/indicspecies/index.html, 1.7.14\u003c/span\u003e\u003cspan address=\"https://cran.r-project.org/web/packages/indicspecies/index.html, 1.7.14\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e; 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLahti L, Shetty S. \u003cem\u003eMicrobiome R package\u003c/em\u003e, 1.24-0; Bioconductor: 2017.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKurtz ZD, Muller CL, Miraldi ER, Littman DR, Blaser MJ, Bonneau RA. Sparse and compositionally robust inference of microbial ecological networks. PLoS Comput Biol. 2015;11:e1004226. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pcbi.1004226\u003c/span\u003e\u003cspan address=\"10.1371/journal.pcbi.1004226\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCs\u0026aacute;rdi G, Nepusz T. \u003cem\u003eThe igraph software package for complex network research\u003c/em\u003e, version 2.2.1; R package: 2006.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDouglas GM, Maffei VJ, Zaneveld JR, Yurgel SN, Brown JR, Taylor CM, Huttenhower C, Langille MG. I. PICRUSt2 for prediction of metagenome functions. Nat Biotechnol. 2020;38:685\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41587-020-0548-6\u003c/span\u003e\u003cspan address=\"10.1038/s41587-020-0548-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo K, Gao P. \u003cem\u003emicrobial: Do 16s Data Analysis and Generate Figures\u003c/em\u003e, 0.0.21; 2024.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang SY, Lin WY, Hsiao YM, Chiou TJ. Milestones in understanding transport, sensing, and signaling of the plant nutrient phosphorus. Plant Cell. 2024;36:1504\u0026ndash;23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/plcell/koad326\u003c/span\u003e\u003cspan address=\"10.1093/plcell/koad326\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLahdachi FZ, Bouamri R, Nassiri L, Ibijbijen J. Rock phosphate and arbuscular mycorrhiza effects on growth and mineral nutrition of Acacia gummifera Wild. Int J Innov Appl Stud. 2018;23:384\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElhaissoufi W, Khourchi S, Ibnyasser A, Ghoulam C, Rchiad Z, Zeroual Y, Lyamlouli K, Bargaz A. Phosphate Solubilizing Rhizobacteria Could Have a Stronger Influence on Wheat Root Traits and Aboveground Physiology Than Rhizosphere P Solubilization. Front Plant Sci. 2020;11:979. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fpls.2020.00979\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2020.00979\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMahdi I, Allaoui A, Fahsi N, Biskri L. \u003cem\u003eBacillus velezensis\u003c/em\u003e QA2 Potentially Induced Salt Stress Tolerance and Enhanced Phosphate Uptake in Quinoa Plants. Microorganisms. 2022;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/microorganisms10091836\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms10091836\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang L, Fan J, Ding X, He X, Zhang F, Feng G. Hyphosphere interactions between an arbuscular mycorrhizal fungus and a phosphate solubilizing bacterium promote phytate mineralization in soil. Soil Biol Biochem. 2014;74:177\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcCormack ML, Iversen CM. Physical and Functional Constraints on Viable Belowground Acquisition Strategies. Front Plant Sci. 2019;10:1215. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fpls.2019.01215\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2019.01215\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSee CR, Keller AB, Hobbie SE, Kennedy PG, Weber PK, Pett-Ridge J. Hyphae move matter and microbes to mineral microsites: Integrating the hyphosphere into conceptual models of soil organic matter stabilization. Glob Chang Biol. 2022;28:2527\u0026ndash;40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/gcb.16073\u003c/span\u003e\u003cspan address=\"10.1111/gcb.16073\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuthfiana N, Inamura N, Tantriani; Sato T, Saito K, Oikawa A, Chen W, Tawaraya K. Metabolite profiling of the hyphal exudates of Rhizophagus clarus and Rhizophagus irregularis under phosphorus deficiency. Mycorrhiza. 2021;31:403\u0026ndash;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00572-020-01016-z\u003c/span\u003e\u003cspan address=\"10.1007/s00572-020-01016-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHnini M, Rabeh K, Oubohssaine M. Interactions between beneficial soil microorganisms (PGPR and AMF) and host plants for environmental restoration: A systematic review. Plant Stress. 2024;11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.stress.2024.100391\u003c/span\u003e\u003cspan address=\"10.1016/j.stress.2024.100391\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOrdonez YM, Fernandez BR, Lara LS, Rodriguez A, Uribe-Velez D, Sanders IR. Bacteria with Phosphate Solubilizing Capacity Alter Mycorrhizal Fungal Growth Both Inside and Outside the Root and in the Presence of Native Microbial Communities. PLoS ONE. 2016;11:e0154438. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0154438\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0154438\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAndrino A, Guggenberger G, Kernchen S, Mikutta R, Sauheitl L, Boy J. Production of Organic Acids by Arbuscular Mycorrhizal Fungi and Their Contribution in the Mobilization of Phosphorus Bound to Iron Oxides. Front Plant Sci. 2021;12:661842. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fpls.2021.661842\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2021.661842\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJansa J, Hodge A. Swimming, gliding, or hyphal riding? On microbial migration along the arbuscular mycorrhizal hyphal highway and functional consequences thereof. New Phytol. 2021;230:14\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/nph.17244\u003c/span\u003e\u003cspan address=\"10.1111/nph.17244\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang G, George TS, Pan Q, Feng G, Zhang L. Two isolates of \u003cem\u003eRhizophagus irregularis\u003c/em\u003e select different strategies for improving plants phosphorus uptake at moderate soil P availability. Geoderma. 2022;421:115910. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.geoderma.2022.115910\u003c/span\u003e\u003cspan address=\"10.1016/j.geoderma.2022.115910\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang L, Feng G, Declerck S. Signal beyond nutrient, fructose, exuded by an arbuscular mycorrhizal fungus triggers phytate mineralization by a phosphate solubilizing bacterium. ISME J. 2018;12:2339\u0026ndash;51. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41396-018-0171-4\u003c/span\u003e\u003cspan address=\"10.1038/s41396-018-0171-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuan S, Declerck S, Feng G, Zhang L. Hyphosphere interactions between Rhizophagus irregularis and Rahnella aquatilis promote carbon-phosphorus exchange at the peri-arbuscular space in Medicago truncatula. Environ Microbiol. 2023;25:867\u0026ndash;79. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/1462-2920.16333\u003c/span\u003e\u003cspan address=\"10.1111/1462-2920.16333\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpring S, Bunk B, Spr\u0026ouml;er C, Rohde M, Klenk H-P. Genome biology of a novel lineage of planctomycetes widespread in anoxic aquatic environments. Environ Microbiol. 2018;20:2438\u0026ndash;55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/1462-2920.14253\u003c/span\u003e\u003cspan address=\"10.1111/1462-2920.14253\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKabor\u0026eacute; OD, Godreuil S, Drancourt M. Planctomycetes as Host-Associated Bacteria: A Perspective That Holds Promise for Their Future Isolations, by Mimicking Their Native Environmental Niches in Clinical Microbiology Laboratories. Front Cell Infect Microbiol. 2020;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcimb.2020.519301\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2020.519301\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLage OM, van Niftrik L, Jogler C, Devos DP. Planctomycetes. In: Schmidt TM, editor. Encyclopedia of Microbiology (Fourth Edition). Oxford: Academic; 2019. pp. 614\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWiegand S, Jogler M, Boedeker C, Pinto D, Vollmers J, Rivas-Mar\u0026iacute;n E, Kohn T, Peeters SH, Heuer A, Rast P, et al. Cultivation and functional characterization of 79 planctomycetes uncovers their unique biology. Nat Microbiol. 2020;5:126\u0026ndash;40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41564-019-0588-1\u003c/span\u003e\u003cspan address=\"10.1038/s41564-019-0588-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Jenkins C, Webb RI, Fuerst JA. Isolation of Gemmata-like and Isosphaera-like planctomycete bacteria from soil and freshwater. Appl Environ Microbiol. 2002;68:417\u0026ndash;22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/AEM.68.1.417-422.2002\u003c/span\u003e\u003cspan address=\"10.1128/AEM.68.1.417-422.2002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartin M, Portetelle D, Michel G, Vandenbol M. Microorganisms living on macroalgae: diversity, interactions, and biotechnological applications. Appl Microbiol Biotechnol. 2014;98:2917\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00253-014-5557-2\u003c/span\u003e\u003cspan address=\"10.1007/s00253-014-5557-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao X, Xiao Y, Wang Z, Zhao H, Yue Y, Nair S, Zhang Z, Zhang Y. Adaptive traits of bacteria to thrive in macroalgal habitats and establish mutually beneficial relationship with macroalgae. \u003cem\u003eLimnology and Oceanography Letters\u003c/em\u003e 2024, \u003cem\u003en/a\u003c/em\u003e, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/lol2.10424\u003c/span\u003e\u003cspan address=\"10.1002/lol2.10424\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDedysh SN, Ivanova AA. Planctomycetes in boreal and subarctic wetlands: diversity patterns and potential ecological functions. FEMS Microbiol Ecol. 2019;95:fiy227. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/femsec/fiy227\u003c/span\u003e\u003cspan address=\"10.1093/femsec/fiy227\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKallscheuer N, Jeske O, Sandargo B, Boedeker C, Wiegand S, Bartling P, Jogler M, Rohde M, Petersen J, Medema MH, et al. The planctomycete Stieleria maiorica Mal15T employs stieleriacines to alter the species composition in marine biofilms. Commun Biology. 2020;3:1\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s42003-020-0993-2\u003c/span\u003e\u003cspan address=\"10.1038/s42003-020-0993-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang J-L, Liu J, Jia P, Yang T-t, Zeng Q-w, Zhang S-c, Liao B, Shu W-s, Li J. -t. Novel phosphate-solubilizing bacteria enhance soil phosphorus cycling following ecological restoration of land degraded by mining. ISME J. 2020;14:1600\u0026ndash;13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41396-020-0632-4\u003c/span\u003e\u003cspan address=\"10.1038/s41396-020-0632-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang H, Li S, Wang T, Chi X, Qi P, Chen G. Interaction Between Halotolerant Phosphate-Solubilizing Bacteria (Providencia rettgeri Strain TPM23) and Rock Phosphate Improves Soil Biochemical Properties and Peanut Growth in Saline Soil. Front Microbiol. 2021;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fmicb.2021.777351\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2021.777351\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang F, Zhang L, Zhou J, George TS, Feng G. Arbuscular mycorrhizal fungi enhance mineralisation of organic phosphorus by carrying bacteria along their extraradical hyphae. New Phytol. 2021;230:304\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/nph.17081\u003c/span\u003e\u003cspan address=\"10.1111/nph.17081\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"environmental-microbiome","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"sigs","sideBox":"Learn more about [Environmental Microbiome](https://environmentalmicrobiome.biomedcentral.com)","snPcode":"40793","submissionUrl":"https://submission.nature.com/new-submission/40793/3","title":"Environmental Microbiome","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"arbuscular mycorrhizal fungi, core bacteriome, community structure, symbiosis, phosphorus, rock phosphate","lastPublishedDoi":"10.21203/rs.3.rs-8829244/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8829244/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eInter-kingdom interactions between arbuscular mycorrhizal fungi (AMF) and bacteria are increasingly recognized for their potential to enhance fertilizer use efficiency in agroecosystems. Here, we investigated the effects of rock phosphate amendment and AMF inoculation on phosphorus (P) nutrition in leek (\u003cem\u003eAllium porrum\u003c/em\u003e L.), as well as on bacterial communities associated with AMF extraradical mycelium. A bi-compartmental microcosm was used to disentangle root-derived effects from those mediated by AMF mycelium.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eInoculation with \u003cem\u003eRhizophagus irregularis\u003c/em\u003e significantly increased total plant biomass (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), while rock phosphate amendment enhanced arbuscule abundance in roots (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.03), leading to higher shoot P content (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.013) and photosynthetic activity (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Because rock phosphate was the sole P source, these results indicate that P solubilized in the soil was translocated to the host plant via the mycorrhizal pathway. Rock phosphate amendment also significantly altered the composition of bacterial communities associated with AMF mycelium (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.01). Across treatments, bacterial assemblages were dominated by Planctomycetota, Pseudomonadota, Chloroflexota, and Bacillota, with enrichment of \u003cem\u003ePlanctomyces\u003c/em\u003e and \u003cem\u003eGemmata\u003c/em\u003e in AMF mycelium, and \u003cem\u003ePlanctomyces\u003c/em\u003e, \u003cem\u003eGemmata\u003c/em\u003e, and \u003cem\u003eBacillus\u003c/em\u003e in soil. The core bacteriome associated with \u003cem\u003eR. irregularis\u003c/em\u003e was primarily composed of Planctomycetota and Bacillota, taxa known to form biofilms on AMF extraradical hyphae.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThese findings demonstrate the pivotal role of mycorrhizal symbiosis in enhancing P acquisition from rock phosphate and provide new insights into AMF\u0026ndash;bacteria interactions that are relevant for developing sustainable fertilization strategies.\u003c/p\u003e","manuscriptTitle":"Effects of Rock Phosphate Application on the Composition of Bacterial Communities Associated with Arbuscular Mycorrhizal Fungal Mycelia","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-25 12:54:45","doi":"10.21203/rs.3.rs-8829244/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2026-05-12T06:56:48+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"325266993130226795867986581852836683091","date":"2026-04-27T01:43:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"2044038426296026210970116603525998657","date":"2026-04-26T15:16:34+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-24T12:14:50+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"299099884986153356116181720747255402775","date":"2026-03-30T12:27:13+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-23T03:05:11+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-11T08:00:43+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-10T14:04:51+00:00","index":"","fulltext":""},{"type":"submitted","content":"Environmental Microbiome","date":"2026-02-09T09:59:32+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"environmental-microbiome","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"sigs","sideBox":"Learn more about [Environmental Microbiome](https://environmentalmicrobiome.biomedcentral.com)","snPcode":"40793","submissionUrl":"https://submission.nature.com/new-submission/40793/3","title":"Environmental Microbiome","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"63cf9e86-b2af-4b60-87a7-4d3e0f3d3cb9","owner":[],"postedDate":"March 25th, 2026","published":true,"recentEditorialEvents":[{"type":"editorInvitedReview","content":"","date":"2026-05-12T06:56:48+00:00","index":28,"fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-03-25T12:54:45+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-25 12:54:45","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8829244","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8829244","identity":"rs-8829244","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}