USP19 potentiates autophagic cell death via inhibiting mTOR pathway through deubiquitinating NEK9 in pancreatic cancer

preprint OA: closed
Full text JSON View at publisher
Full text 107,055 characters · extracted from preprint-html · click to expand
USP19 potentiates autophagic cell death via inhibiting mTOR pathway through deubiquitinating NEK9 in pancreatic cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article USP19 potentiates autophagic cell death via inhibiting mTOR pathway through deubiquitinating NEK9 in pancreatic cancer Zipeng Lu, Guangfu Wang, Shangnan Dai, Jin Chen, Kai Zhang, Chenyu Huang, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4512791/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Dec, 2024 Read the published version in Cell Death & Differentiation → Version 1 posted 10 You are reading this latest preprint version Abstract The ubiquitin-specific protease (USP) family is the largest and most diverse deubiquitinase (DUBs) family and plays a significant role in maintaining cell homeostasis. Dysregulation of USPs has been associated with carcinogenesis of various tumors. We identified that USP19 was downregulated in pancreatic tumor tissues and forced expression of USP19 diminished tumorigenicity of pancreatic cancer. Mechanistically, USP19 directly interacts with and stabilized NEK9 via inhibiting K48-specific poly-ubiquitination process on NEK9 protein at K525 site through its USP domain. Moreover, NEK9 phosphorylates the regulatory associated protein of mTOR (Raptor) at Ser792 and links USP19 to the inhibition of mTOR signaling pathway, which further leads to autophagic cell death of pancreatic cancer cells. Inhibition of autophagy by Atg5 knockdown or lysosome inhibitor bafilomycin A1 abolished the decreased malignant phenotype of USP19 and NEK9 overexpressed cancer cells. Importantly, USP19 expression exhibits a positive correlation with NEK9 expression in clinical samples, and low USP19 or NEK9 expression is associated with a worse prognosis. This study revealed that USP19-mediated NEK9 deubiquitylation is a regulatory mechanism for mTORC1 inhibition and provides a therapeutic target for diseases involving mTORC1 dysregulation. Pancreatic cancer USP19/NKE9 Autophagic cell death Warburg effect Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Pancreatic cancer is one of the most lethal cancers with a five-year survival rate of less than 11%[ 1 ]. Although important advances have been achieved in improving patient outcomes with comprehensive treatment based on surgical resection in recent years, a large proportion of advanced patients are not suitable for surgery. Pancreatic cancer remains difficult to detect and diagnose because of atypical early symptoms. Chemotherapy is currently routinely recommended except for surgery. However, owing to the rapid development of chemotherapy resistance, the survival of patients can only be moderately extended. Hence, there is an urgent need to explore the potential mechanisms of pancreatic cancer progression and seek more comprehensive and effective treatments. The ubiquitin-specific protease (USPs) family is the largest and most diverse deubiquitinase (DUBs). In addition to the conserved USP domain, USPs also contain a ubiquitin-associated domain (UBA), ubiquitin-interacting motif (UIM), zinc finger ubiquitin-specific protease domain (ZnF-UBP), as well as terminal extensions[ 2 ]. Ubiquitination and ubiquitin-like post-translational modifications regulate the activity and stability of different oncoproteins and tumor suppressors. Numerous studies have revealed the important mechanisms by which USPs regulate biological processes by removing ubiquitin or ubiquitin-like peptides from substrate proteins, such as protein stabilization, cell signaling activity, tumorigenesis, and progression[ 3 ]. Therefore, it is important to explore the potential role of the USPs family in the development of pancreatic cancer. USP19, a member of the USPs family of proteins, has been reported to play distinct roles in the regulation of biological processes in different neoplasms. Functionally, several proteins have been found to be substrates of USP19, such as BECN1, ME1, and BAG6[ 4 – 6 ]. Zhang et al. found that USP19 activates apoptotic endoplasmic reticulum stress by deubiquitinating BAG6 in triple-negative breast cancer.[ 6 ] In another study, USP19 was found to enhance lipogenesis by stabilizing ME1, which in turn promotes colorectal carcinogenesis[ 5 ]. However, the detailed functional role of USP19 in pancreatic cancer and its underlying mechanisms remain unclear. The present study identified USP19 as a functional deubiquitinase that is downregulated in pancreatic cancer and is associated with poor prognosis. Our results showed that USP19 inhibits pancreatic cancer progression by interacting with and inhibiting the degradation of NEK9, thus activating Raptor/mTOR/autophagy signaling. This study reveals a novel role for the USP19/NEK9 axis in pancreatic cancer progression, providing a promising target for the treatment of pancreatic cancer. Materials and Methods Clinical specimens and cell lines Pancreatic tumor tissues were collected during pancreatectomy and the postoperative pathological diagnosis was pancreatic ductal adenocarcinoma. Surgically resected specimens were fixed with 10% formalin and cut into 4µm thick sections for subsequent studies. This study was approved by the Ethics Committee of the First Affiliated Hospital of Nanjing Medical University. The telomerase-immortalized HPNE (hTERT‐HPNE) and its oncogenic Kras variant HPNE KrasG12D cells were obtained from the American Type Culture Collection (ATCC). HEK293T, PANC-1, Colo-357, MiaPaca-2, and CFPAC-1 cells were obtained from the Cell Bank of the Chinese Academy of Science (Shanghai, China) and cultured according to established protocols. Cell proliferation assays The proliferation of CFPAC-1 and MiaPaca-2 cells was studied using the cell counting kit-8 (CCK-8, Dojindo, Japan) and 5-ethynyl-2′-deoxyuridine assay (EdU, Beyotime, China) assays, as described in our previous studies[ 7 ]. For the colony-formation assay, 2.5×10 2 cells were seeded on 12-well plates and cultured with complete medium. The colonies were stained with crystal violet for 10 days. The apoptotic rates of cells were measured using a cell apoptosis assay (MULTI SCIENCES, China) according to the manufacturer’s instructions. Migration, invasion and Wound-healing assay Cell migration and invasion were assessed using transwell filters (8.0µm) purchased from BD Biosciences (Franklin Lakes, NJ, USA) according to our previous study[ 8 ]. For the wound-healing assay, 2×10 5 cells were plated in 6-well plates and reached 100% confluence. Wounds were scratched onto a monolayer of cells with a 200µL pipette tip and then washed twice. The cells were then cultured in serum-reduced medium, and the images were captured at 0 and 48h using an inverted microscope (ZEISS, Germany). RNA isolation and real-time q-PCR Total RNA was purified using an RNA quick purification kit (ESscience, China). A PrimeScript RT Master Mix Kit (Vazyme, China) was used to perform mRNA reverse transcription according to the manufacturer’s instructions. The relative expression level was compared to that of β-actin, and fold changes were calculated using the 2- △△ct method. The primer sequences are listed as follow: β-actin (F): CATGTACGTTGCTATCCAGGC, (R): CTCCTTAATGTCACGCACGAT; NEK9 (F): GCTGTGATGGGACATTTCTG, (R): CCAAGGTAAAGGACGTTGTG and USP19 (F): CGGCACAAGATGAGGAATGA, (R): GGCACCGGCAGATAAAGAAA. Autophagosome detection by transmission electron microscopy (TEM) Briefly, CFPAC-1 and Miapaca-2 cells were fixed with 2.5% glutaraldehyde at room temperature. Then, cells were gently scraped off from culture dishes with a cell scraper and collected by centrifugation, resuspended in 2.5% glutaraldehyde, and stored at 4°C. The cells were then fixed, dehydrated, embedded, polymerized, and sliced. The slice thickness was 60–80 nm. The sections were observed under a transmission electron microscope (FEI Tecnai, USA) and images were collected for analysis. Measurement of oxidative phosphorylation and glycolysis A Seahorse XF96 Metabolic Flux Analyzer (Seahorse Biosciences, USA) was used to measure the extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) in CFPAC-1 and MiaPaca-2 cells in the indicated groups according to the manufacturer’s instructions. Briefly, 3×10 4 cells from the indicated groups were seeded into each well of a Seahorse XF96 cell culture microplate. The extracellular acidification rate was assessed by sequential injection of 10mM glucose, 1mM oligomycin and 80mM 2-deoxyglucose (2-DG). The oxygen consumption rate was determined by sequential addition of 1mM ATP synthase blocker oligomycin, 1mM mitochondrial uncoupler carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone and 2mM complex I and III inhibitors antimycin A and 2mM rotenone. Data quantification was carried out using XFe Wave software (Seahorse Biosciences) according to the manufacturer’s protocol. Immunohistochemistry (IHC) and multiple-color immunohistochemistry Tissue sections were prepared for antigen retrieval using microwave treatment in citrate buffer (Beyotime) and then incubated with primary antibodies overnight at 4°C, followed by incubation with secondary antibodies. Immunostaining was performed using diaminobenzidine as a substrate. Multiple-color immunofluorescence reagent (Recordbio, China) was used to detect co-focal proteins in pancreatic tumor specimens, according to the manufacturer’s protocols. Plasmids and adenoviral infection Cells were infected with adenovirus USP19 (USP19), adenovirus NEK9 (NEK9) and adenovirus vector (Vector), adenovirus shRNA-control (shCtrl), shRNA-USP19 (shUSP19), shRNA-NEK9 (shNEK9) and shRNA-Atg5 (shAtg5). Full-length sequences for human USP19, NEK9, ubiquitin and its mutants were subcloned into the EcoRI and NotI sites of Myc-, Flag- and HA tagged pcDNA3.1 vectors (Thermo Fisher Scientific). RNA sequence (RNA-Seq) RNA-seq analysis was performed by BGI Group (Guangzhou, China). Total RNAs from MiaPaca-2 cells transfected with the Vector and USP19 (n = 3/group) was extracted. RNA samples of high quality were then converted into cDNA libraries. cDNA libraries were then sequenced on DNBSEQ, following the manufacturer’s protocols. Fold changes > 1.5 and p < 0.05 represented differentially expressed genes (DEGs). Antibodies and reagents The following antibodies and reagents were used in this study: USP19 (Proteintech, 25768-1-AP), NEK9 (Proteintech, 11192-1-AP),α-Tubulin (Proteintech, 66031-1-Ig), Myc-Tag (Proteintech, 16286-1-AP), HA-Tag (Proteintech, 81290-1-RR), Flag-Tag (Proteintech, 66008-4-Ig), SQSTM1/p62 (Proteintech, 18420-1-AP), LC3 (CST, #12741), AKT (CST, #4691), AKT Ser473 (CST, #4060), mTOR (Proteintech, 66888-1-Ig), mTOR Ser2448 (Proteintech, 67778-1-Ig), Raptor (Proteintech, 20984-1-AP), Raptor Ser792 (Invitrogen, PA5-118730), Ki67 (Proteintech, 27309-1-AP), Cleaved Caspase 3 (CST, #9661), CK-19 (Proteintech, 10712-1-AP), MG132 (MCE, HY-13259), CHX (MCE, HY-12320) and Bafilomycin A1 (MCE, HY-100558). Immunoprecipitation (IP) Pierce™ IP lysis buffer (Thermo Fisher Scientific, USA) containing protease inhibitors was used to lyse cells. Protein concentrations were determined using the BCA Protein Quantification Kit (Beyotime Biotechnology). Cell lysates were pre-cleared with protein A/G-agarose beads (Beyotime) for 1h and immunoprecipitated with the indicated antibodies at 4°C overnight. After that, the lysates were collected and incubated with protein A/G-agarose beads for 2h and the immunocomplexes were washed five times with IP lysis buffer and the bound proteins were then eluted by boiling and subjected to SDS-PAGE for Western blot analysis. Animal experiments All animal experiments were performed in accordance with a protocol approved by the Institutional Animal Care and Use Committee of the Nanjing Medical University. Four-week-old nude mice (BALB/c mice) were obtained from GemPharmatech™ (Nanjing, China) and used for in vivo assays. The nude mice were randomly divided into several groups according to the experimental requirements. Stably transfected pancreatic cancer cells (1×10 6 cells) in 50µL of medium were subcutaneously injected into the left side of the posterior flank of the nude mice. For the tumor metastasis assay, medium containing 1×10 6 cells were injected through the tail vein. The development of metastases was imaged and evaluated using an IVIS200 imaging system (Caliper Life Science, USA). The investigators were blinded to the experimental groups and the outcome evaluations. Statistical analysis Data are presented as the mean ± SD and contain at least three independent biological replicates. Statistical analyses were performed using GraphPad Prism, version 8 (GraphPad Software, USA). For two-group comparisons, the unpaired two-tailed Student’s t-test was performed. For comparisons between more than two groups, one-way or two-way ANOVA followed by Tukey’s post-hoc test was performed. Kaplan-Meier curves and log-rank tests were performed to compare survival difference. p < 0.05 was considered statistically significant. Results USP19 is downregulated in pancreatic cancer and related with a worse prognosis Based on four published datasets (TCGA, GSE71729, ICGC-CA, and ICGC-AU) and our cohort obtained from pancreatic tumor samples, the expression of USP19 was first examined, and the analyzed data suggested that USP19 was significantly downregulated in tumor specimens compared with non-tumor tissues and further decreased with tumor progression (Fig. 1 A-B). Kaplan-Meier analysis showed that patients with high USP19 expression had a better prognosis (Fig. 1 C). In addition, the downregulation of USP19 expression in tumor tissues compared to that in adjacent non-tumor tissues was confirmed by immunohistochemical staining (Fig. 1 D-E). Moreover, results from a published dataset (GSE71729) and western blot results showed that USP19 expression was lower in human pancreatic cancer cell lines than that in normal pancreatic ductal cells (Fig. 1 F-G). Therefore, these results indicate that USP19 may play an inhibitory role in pancreatic cancer progression and is associated with a better prognosis. Inhibitory effects of USP19 on proliferation and metastasis of pancreatic cancer To investigate the functional role of USP19 in pancreatic cancer, CFPAC-1 and MiaPaca-2 cells were stably overexpressed USP19. Results from CCK-8, EdU and colony formation assay indicated that cell proliferation was markedly inhibited after USP19 overexpression in both cell lines (Fig. 2 A-C). Furthermore, flow cytometric analysis of cell apoptosis indicated that USP19 overexpression in both cell lines promoted cell apoptosis (Fig. 2 D). In vivo, the USP19-overexpressing xenografted tumors grew much more slowly than the tumors in the vector control group (Fig. 2 E-G). Furthermore, the IHC assay showed a decreased expression of Ki67 and an increased expression of cleaved caspase 3 in USP19 overexpressed xenografts (Fig. 2 H). We further performed a series of functional experiments to investigate whether USP19 is associated with metastasis of pancreatic cancer cells. The wound healing assay suggested that USP19 overexpression significantly inhibited the migration of CFPAC-1 and MiaPaca-2 cells (Fig. 2 I). In addition, the transwell assay also revealed that overexpression of USP19 attenuated the aggressiveness and migration of both cell types (Fig. 2 J-K). In vivo, we found that lung metastasis was remarkably suppressed in the USP19 overexpression group compared to that in the control group (Fig. 2 L-M). In conclusion, these results demonstrated that USP19 plays an inhibitory role in proliferation and metastasis of pancreatic cancer. USP19 binds to and inhibits NEK9 degradation To further investigate the potential mechanism by which USP19 inhibits pancreatic cancer proliferation and metastasis, we used immunoprecipitation coupled mass spectrometry (IP/MS) to determine the proteins that interact with USP19. NIMA-related kinase 9 (NEK9) was identified as a protein that interacts with USP19. As shown in Fig. 3 A-B, we found that endogenous USP19 co-precipitated with NEK9 in both pancreatic cancer cells. Complementarily, we also confirmed an interaction between ectopically expressed Flag-tagged NEK9 and Myc-tagged USP19 in HEK293T cells (Fig. 3 C-D). Mapping USP19-NEK9 interaction motifs revealed that the U domain (497–1318) of USP19 as well as the R domain (347–726) of NEK9 were required for their interaction (Fig. 3 E–G). As USP19 interacts with NEK9, the effects of USP19 overexpression on NEK9 expression levels in pancreatic cancer cells were subsequently investigated. Overexpression of USP19 significantly increased NEK9 protein levels but had no influence on transcription (Fig. 3 H-I). Furthermore, addition of the proteasome inhibitor MG132 reversed the decline in NEK9 protein levels after silencing USP19 in HEK293T cells (Fig. 3 J). We also conducted experiments to see if NEK9 is stabilized by USP19. It was found that NEK9 protein levels were significantly increased after overexpression of USP19, but were not influenced by the enzymatically inactive C607S variant of USP19 (Fig. 3 K). USP19 catalyzes K48-linked deubiquitination of NEK9 at K525 We then explored the effect of USP19 expression on the protein stability of endogenous NEK9 in the presence of the protein synthesis inhibitor cycloheximide (CHX). It was shown that overexpression of USP19 markedly suppressed NEK9 degradation, whereas silencing USP19 significantly promoted NEK9 degradation (Fig. 4 A-B). Next, we sought to determine the effect of USP19 on the ubiquitination of NEK9. Forced expression of USP19 WT, but not the C607S mutant, significantly decreased the ubiquitination of NEK9. Meanwhile, USP19 knockdown significantly increased NEK9 ubiquitination (Fig. 4 C-G). These results suggest that USP19 regulates the stability of NEK9 by regulating its proteasomal degradation via deubiquitination. We also performed a ubiquitination assay on two major forms of ubiquitin (K48 and K63), to investigate which type of ubiquitin chain of NEK9 was deubiquitylated by USP19. The result indicated that USP19 could efficiently remove the K48-linked ubiquitin chain from the NEK9 protein (Fig. 4 H). To confirm that Lys48-linked polyubiquitination is essential for USP19-regulated degradation of NEK9, we expressed a Lys48-resistant (Lys48R) form of ubiquitin in USP19-knockdown HEK293T cells and found that the expression of Lys48R ubiquitin abolished the USP19 knockdown-induced decrease in NEK9 levels (Fig. 4 I). To determine the specific sites of NEK9 protein that are deubiquitinated by USP19, we mutated the lysine residues of NEK9. A ubiquitination assay indicated that K525 was the key site on NEK9 deubiquitinated by USP19 (Fig. 4 J). Taken together, these data indicate that USP19 regulates the stability of NEK9 by deubiquitinating it in pancreatic cancer cells. USP19 inhibits pancreatic tumorigenicity through interacting with NEK9 We then analyzed the correlation between USP19 and NEK9 in pancreatic cancer. The results suggested that NEK9 expression was significantly decreased in pancreatic cancer specimens and cancer cell lines (Fig. S1 A-D). Furthermore, a significant positive correlation was observed between the expression of USP19 and NEK9 proteins (Fig. S1 E). Survival analysis revealed that high expression of NEK9 was related to poor prognosis (Fig. S1 F). We also conducted a series of in vitro experiments to elucidate the role of NEK9 in pancreatic cancer progression. The results showed that NEK9 overexpression significantly diminished tumorigenicity of pancreatic cancer cells (Fig. S1 G-M). These results indicate that NEK9 is positively correlated with USP19 and may act as a tumor suppressor protein. In vitro and in vivo rescue experiments were performed to investigate the role of NEK9 in the mechanism by which USP19 inhibits the progression of pancreatic cancer. The results showed that the diminished tumorigenicity, including proliferation, migration, and invasion in USP19-overexpressed pancreatic cancer cells were reversed when NEK9 was knocked down (Fig. 5 ) or USP19 was enzymatically inactivated (Fig. S2 ). Overall, these results revealed that NEK9 is the downstream target of USP19 and mediates the role of USP19 in inhibiting pancreatic tumor progression. USP19/NEK9 axis inhibits Warburg effect and activates autophagy via inhibiting mTORC1 signaling To further explore the mechanism by which USP19 inhibits pancreatic cancer progression, transcriptome analysis by high-throughput RNA sequencing (RNA-Seq) was performed in MiaPaca-2 cells transfected with the vector and USP19. As shown in Fig. 6 A, 1488 DEGs were upregulated, whereas 1369 DEGs were downregulated in USP19-overexpressed MiaPaca-2 cells. Subsequently, gene set enrichment analysis (GSEA) showed that USP19 overexpression was positively correlated with mTORC1 signaling, glycolysis/gluconeogenesis inhibition and oxidative phosphorylation, and positive regulation of autophagy activation, suggesting a potential regulatory role of USP19 in mTORC1/Autophagy signaling (Fig. 6 B). Western blot analysis confirmed that overexpression of USP19 decreased the phosphorylation levels of mTOR, whereas downregulation of NEK9 (Fig. 6 C) or deubiquitinating enzyme inactivation of USP19 (Fig. S3A) showed the opposite results, independent of phosphorylated AKT. The Warburg effect refers to the phenomenon in which cancer cells produce energy mainly through aerobic glycolysis, rather than oxidative phosphorylation, which contributes to cancer cell survival and inhibits apoptosis[ 9 ]. Importantly, mTORC1 signaling is closely related to cellular energy homeostasis, and its activation significantly promote the shift of the Warburg effect in cancer cells. Conversely, inhibition of mTORC1 signaling is associated with autophagy activation[ 10 , 11 ]. Metabolic analysis showed that overexpression of USP19 resulted in a decrease in the glycolytic rate (ECAR) and an increase in the mitochondrial respiration (OCR) in pancreatic cancer cells. Western blot analysis of LC3 and p62 expression and detection of autophagosomes confirmed that USP19 overexpression significantly activated autophagy. We found that silencing of NEK9 or deubiquitinating enzyme inactivation of USP19 partially rescued these effects (Fig. 6 and S3). Overall, these results indicate that USP19/NEK9 cascade inhibits Warburg effect and activates autophagy via inhibiting mTORC1 signaling. USP19/NEK9 axis inhibits mTORC1 signaling via Raptor Ser792 phosphorylation This study further explored the mechanism of NEK9 inhibiting pancreatic cancer progression, separately. Consistently, overexpression of NEK9 significantly inhibited mTOR phosphorylation, the Warburg effect, and promoted autophagy (Fig. S3D-F). We found that Raptor, an important molecule regulating the activation of the mTORC1 pathway, was identified as a substrate that interacts with NEK9 but not USP19 via IP/MS analysis (Fig. 7 A). As shown in Fig. 7 C-E, endogenous Raptor was co-precipitated with NEK9 in both pancreatic cancer cells. NEK9 is a member of the NEK family of serine/threonine-protein kinases. We speculated that NEK9 may serve as an intermediary signaling molecule between USP19 and the mTOR pathway by regulating Raptor activation. Western blot analysis confirmed that overexpression of USP19 or NEK9 both increased the expression level of phosphorylated Raptor Ser792 in pancreatic cell lines, and NEK9 knockdown inhibited the elevated phosphorylation level of Raptor Ser792 caused by USP19 overexpression (Fig. S3D and 7E). In addition, we performed multiple-color immunohistochemistry to detect the colocalization of genes in tumor tissues, and found that USP19 was positively correlated with NEK9 and negatively correlated with p-mTOR Ser2448 in CK19 + pancreatic cancer lesions (Fig. 7 F-G). These results indicate that USP19/NEK9 axis inhibits mTORC1 signaling via Raptor Ser792 phosphorylation. Autophagy inhibition diminishes the inhibitory role of USP19 in pancreatic cancer progression To determine the role of USP19/NEK9-mediated autophagy activation in pancreatic cancer progression, we knocked down Atg5 or applied the autophagy inhibitor BafA1 in USP19 and NEK9 overexpressed pancreatic cancer cells, respectively. The results suggested that inhibition of autophagy by Atg5 knockdown or BafA1 significantly reversed the decreased malignant phenotypes in USP19- and NEK9-overexpressing cells (Fig. S4 and S5). Overall, these results suggest that USP19 inhibits pancreatic cancer progression by stabilizing NEK9 and activating Raptor/mTOR/autophagy signaling. Discussion Ubiquitin-specific proteases can remove ubiquitin or ubiquitin-like peptides from substrates to alter the stability or state of proteins and dynamically regulate cellular biological processes[ 3 ]. The existing studies suggest that USP19 plays distinct roles in the regulation of biological processes in different tissues. Several targets including p53, survivin, and ME1 have been implicated in USP19-mediated tumorigenesis[ 5 , 12 , 13 ]. USP19 promoted the migration and proliferation of cervical cancer cells through negatively regulating p53 protein levels[ 13 ]. Meanwhile, USP19 accelerated colorectal tumorigenesis via enhancing surviving-mediated signaling pathway[ 12 ]. Additionally, USP19 enhances lipogenesis by stabilizing ME1, which in turn promotes colorectal carcinogenesis[ 5 ]. However, several studies have identified different biological functions of USP19. A study showed that USP19 exerts its inhibitory effect on clear cell renal cell carcinoma proliferation and migration by suppressing the ERK signaling pathway[ 14 ]. In another study, USP19 inhibited proliferation by deubiquitinating BAG6 in triple-negative breast cancer[ 6 ]. Herein, through a series of in vitro and vivo experiments, we elucidated the role of USP19 in inhibiting pancreatic cancer progression. USP19 was found to be significantly downregulated in pancreatic tumor specimens, and low USP19 expression was associated with a worse prognosis. Multiple functional experiments were performed to investigate the role of USP19 in the proliferation, invasion, and migration of pancreatic cancer cells. USP19 is negatively associated with malignant tumor phenotypes by stabilizing and decreasing the degradation of NEK9, a well-known serine/threonine protein kinase. A series of rescue functional experiments was performed to verify the role of the USP19/NEK9 axis in inhibiting pancreatic cancer progression. Metabolic flux analysis and autophagy were measured, and it was found that the USP19/NEK9 axis could inhibit the Warburg effect and promote autophagic cell death in pancreatic cancers by activating the Raptor/mTOR/autophagy signaling pathway. NEK9 has been identified as a potential protein that interacts with USP19 in pancreatic cancer cells. NEK9 has previously been reported to play an important role in spindle assembly and centrosome separation[ 15 ]. Moreover, as a well-known serine/threonine protein kinase, its function in tumor progression has also been revealed in several studies. NEK9 was upregulated in gastric cancer cells and was correlated with a worse prognosis via activation of the TRIM28/NF-κB and STAT3 signaling pathways[ 16 ]. Also, as a downstream of the IL-6/STAT3 pathway, NEK9 could promote the metastasis of gastric cancer by phosphorylating ARHGEF2[ 17 ]. However, in pancreatic and breast cancer, high expression of NEK9 suggested a better prognosis[ 18 , 19 ]. NEK9 links the short isoform of PRLR to the activation of the Hippo signaling pathway and suppression of the pentose phosphate pathway and nucleotide synthesis in pancreatic cancer[ 19 ]. In our study, we also found a significantly downregulated expression of NEK9 in pancreatic cancer specimens, which was associated with worse prognosis. We found that NEK9 phosphorylates Raptor and is involved in the inhibition of the mTOR signaling pathway in pancreatic cancer. These data provide new evidence for the downstream signaling of NEK9 in tumor development, suggesting that NEK9 regulates cellular malignant features through the mTOR pathway, in addition to its role in spindle assembly and centrosome separation. Several studies have suggested that autophagy plays an essential role in various biological processes. However, the exact functional role of autophagy in tumor biology remains controversial[ 20 ]. On the one hand, many studies have shown the cytoprotective role of autophagy in the development of malignant tumors via promoting cancer cell survival, metastasis as well as drug resistance[ 21 – 23 ]. On the other hand, other studies have shown that autophagy can inhibit tumorigenesis due to autophagic cell death in cancer cells[ 24 ]. In our study, we found that USP19- and NEK9-activated autophagy induced autophagic cell death in pancreatic cancer cells. Previous studies have suggested that USP19 and NEK9 are involved in autophagy. BECN1, a key protein in autophagy initiation and progression, is deubiquitinated by USP19 to promote the formation of autophagosomes[ 25 ]. Furthermore, USP19 also can promote TBK1 degradation through chaperone-mediated autophagy in addition to its deubiquitination function[ 26 ]. In our study, we found that USP19 promoted autophagy activation through inhibition of the mTOR signaling pathway. These data further confirmed the diverse roles of USP19 in autophagy progression. In contrast to USP19, which plays a relatively clear role in promoting autophagy, NEK9 has shown different effects in different studies. A study revealed that NEK9 promotes primary cilia formation by acting as a selective autophagy adaptor for myosin IIA through its LC3-interacting region (LIR)[ 27 ]. Moreover, Behrends et al. identified NEK9 as a positive regulator of autophagosome formation based on the reduced formation of LC3-positive puncta upon downregulation of NEK9[ 28 ]. However, another study suggested that NEK9 suppresses LC3B-mediated autophagy of p62 by phosphorylating LC3B[ 29 ]. These results suggest that the autophagy regulation and protein kinase function of NEK9 may be dynamic and tissue specific. Although we found that NEK9 can phosphorylate Raptor via its protein kinase function, the underlying mechanism requires further exploration. In conclusion, this study showed that USP19 inhibits pancreatic cancer progression by interacting with and inhibiting ubiquitination and degradation of NEK9. The USP19/NEK9 axis further activates Raptor/mTOR/autophagy signaling, leading to autophagic cell death in pancreatic cancer. Therefore, these findings indicate that the USP19/NEK9 axis may be a promising therapeutic target for treating pancreatic cancer. Declarations Competing interests The authors declare no competing interests. References Siegel, R.L., et al., Cancer statistics, 2023. CA Cancer J Clin, 2023. 73 (1): p. 17-48. Kitamura, H., Ubiquitin-Specific Proteases (USPs) and Metabolic Disorders. Int J Mol Sci, 2023. 24 (4). Bonacci, T. and M.J. Emanuele, Dissenting degradation: Deubiquitinases in cell cycle and cancer. Semin Cancer Biol, 2020. 67 (Pt 2): p. 145-158. Jin, S., et al., USP19 modulates autophagy and antiviral immune responses by deubiquitinating Beclin-1. EMBO J, 2016. 35 (8): p. 866-80. Zhu, Y., et al., USP19 exacerbates lipogenesis and colorectal carcinogenesis by stabilizing ME1. Cell Rep, 2021. 37 (13): p. 110174. Zhang, X., et al., Deubiquitinase USP19 modulates apoptotic calcium release and endoplasmic reticulum stress by deubiquitinating BAG6 in triple negative breast cancer. Clin Transl Med, 2023. 13 (9): p. e1398. Wang, G., et al., Metformin inhibits neutrophil extracellular traps-promoted pancreatic carcinogenesis in obese mice. Cancer Lett, 2023. 562 : p. 216155. Wang, G., et al., Insulin promotes invasion and migration of KRAS(G12D) mutant HPNE cells by upregulating MMP-2 gelatinolytic activity via ERK- and PI3K-dependent signalling. Cell Prolif, 2019. 52 (3): p. e12575. Bononi, G., et al., Historical perspective of tumor glycolysis: A century with Otto Warburg. Semin Cancer Biol, 2022. 86 (Pt 2): p. 325-333. Perl, A., mTOR activation is a biomarker and a central pathway to autoimmune disorders, cancer, obesity, and aging. Ann N Y Acad Sci, 2015. 1346 (1): p. 33-44. Fan, H., et al., Critical role of mTOR in regulating aerobic glycolysis in carcinogenesis (Review). Int J Oncol, 2021. 58 (1): p. 9-19. Chandrasekaran, A.P., et al., Dual role of deubiquitinating enzyme USP19 regulates mitotic progression and tumorigenesis by stabilizing survivin. Mol Ther, 2022. 30 (11): p. 3414-3429. Tyagi, A., et al., USP19 Negatively Regulates p53 and Promotes Cervical Cancer Progression. Mol Biotechnol, 2023. Hu, W., et al., Ubiquitin specific peptidase 19 is a prognostic biomarker and affect the proliferation and migration of clear cell renal cell carcinoma. Oncol Rep, 2020. 43 (6): p. 1964-1974. Bertran, M.T., et al., Nek9 is a Plk1-activated kinase that controls early centrosome separation through Nek6/7 and Eg5. EMBO J, 2011. 30 (13): p. 2634-47. Lu, G., et al., Cancer associated fibroblast derived SLIT2 drives gastric cancer cell metastasis by activating NEK9. Cell Death Dis, 2023. 14 (7): p. 421. Lu, G., et al., NEK9, a novel effector of IL-6/STAT3, regulates metastasis of gastric cancer by targeting ARHGEF2 phosphorylation. Theranostics, 2021. 11 (5): p. 2460-2474. Gao, W.L., et al., Integrative Analysis of the Expression Levels and Prognostic Values for NEK Family Members in Breast Cancer. Front Genet, 2022. 13 : p. 798170. Nie, H., et al., The short isoform of PRLR suppresses the pentose phosphate pathway and nucleotide synthesis through the NEK9-Hippo axis in pancreatic cancer. Theranostics, 2021. 11 (8): p. 3898-3915. Levy, J.M.M., C.G. Towers, and A. Thorburn, Targeting autophagy in cancer. Nat Rev Cancer, 2017. 17 (9): p. 528-542. Liu, Y., et al., TRPML1-induced autophagy inhibition triggers mitochondrial mediated apoptosis. Cancer Lett, 2022. 541 : p. 215752. Sang, J., et al., Jolkinolide B sensitizes bladder cancer to mTOR inhibitors via dual inhibition of Akt signaling and autophagy. Cancer Lett, 2022. 526 : p. 352-362. Li, Y.J., et al., Autophagy and multidrug resistance in cancer. Chin J Cancer, 2017. 36 (1): p. 52. Denton, D. and S. Kumar, Autophagy-dependent cell death. Cell Death Differ, 2019. 26 (4): p. 605-616. Cui, J., S. Jin, and R.F. Wang, The BECN1-USP19 axis plays a role in the crosstalk between autophagy and antiviral immune responses. Autophagy, 2016. 12 (7): p. 1210-1. Zhao, X., et al., USP19 (ubiquitin specific peptidase 19) promotes TBK1 (TANK-binding kinase 1) degradation via chaperone-mediated autophagy. Autophagy, 2022. 18 (4): p. 891-908. Yamamoto, Y., et al., NEK9 regulates primary cilia formation by acting as a selective autophagy adaptor for MYH9/myosin IIA. Nat Commun, 2021. 12 (1): p. 3292. Behrends, C., et al., Network organization of the human autophagy system. Nature, 2010. 466 (7302): p. 68-76. Shrestha, B.K., et al., NIMA-related kinase 9-mediated phosphorylation of the microtubule-associated LC3B protein at Thr-50 suppresses selective autophagy of p62/sequestosome 1. J Biol Chem, 2020. 295 (5): p. 1240-1260. Additional Declarations There is no duality of interest Supplementary Files Fulllengthuncroppedoriginalwesternblots.docx SupplementaryFigures.docx Cite Share Download PDF Status: Published Journal Publication published 03 Dec, 2024 Read the published version in Cell Death & Differentiation → Version 1 posted Editorial decision: revise 30 Jun, 2024 Review # 2 received at journal 29 Jun, 2024 Review # 1 received at journal 24 Jun, 2024 Reviewer # 2 agreed at journal 12 Jun, 2024 Reviewer # 1 agreed at journal 12 Jun, 2024 Reviewers invited by journal 12 Jun, 2024 Submission checks completed at journal 09 Jun, 2024 First submitted to journal 03 Jun, 2024 Unknown event 03 Jun, 2024 Editor assigned by journal 01 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4512791","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":313743749,"identity":"c80c198f-9e91-4790-af1f-75f004e2bd3e","order_by":0,"name":"Zipeng Lu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6klEQVRIie3RMQrCMBQG4FcCurxmjlTsFSqFuniYSNcq4uBqoVAX0VVv4RHq1KU6t7gozk4uog6mUdfUUTD/kp8kH0kIgI7OL4a8hibUQ3BkTb4kCJh8S+BDGH/XKmJPzc1peAN0inMyKmJo0Zwbl6GCGBH13dVckP2Au/0Y3EbOibVUEELQs8xZSQKnJL11zmsEFUSsdu6SFJkkk0qC4hSCV0FylIQ7VYQR6ltmyLCRiYsFO9ZeZcfIUhF7sd1c8NFt0TTz3GDctWnqixkFKX8EjJjJd4mvLIsRKoEk8JCNHCq26ujo6PxpnqQzQHtD0PT2AAAAAElFTkSuQmCC","orcid":"","institution":"Jiangsu Province Hospital and Nanjing Medical University First Affiliated Hospital","correspondingAuthor":true,"prefix":"","firstName":"Zipeng","middleName":"","lastName":"Lu","suffix":""},{"id":313743750,"identity":"abd8d0be-dd90-478e-83ff-f3f23fde80d1","order_by":1,"name":"Guangfu Wang","email":"","orcid":"","institution":"First Affiliated Hospital of Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Guangfu","middleName":"","lastName":"Wang","suffix":""},{"id":313743751,"identity":"b38bbe9a-d6d3-4a1a-9ebc-afc7731571a5","order_by":2,"name":"Shangnan Dai","email":"","orcid":"","institution":"First Affiliated Hospital of Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shangnan","middleName":"","lastName":"Dai","suffix":""},{"id":313743752,"identity":"ad46c3b1-6089-4e22-97c8-116e1cb04a72","order_by":3,"name":"Jin Chen","email":"","orcid":"","institution":"Jiangsu Cancer Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jin","middleName":"","lastName":"Chen","suffix":""},{"id":313743753,"identity":"33a706b3-40c8-4921-8b07-a032d197a5b6","order_by":4,"name":"Kai Zhang","email":"","orcid":"","institution":"the First Affiliated Hospital of Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Kai","middleName":"","lastName":"Zhang","suffix":""},{"id":313743754,"identity":"bf3bf432-dc5a-487b-b130-46ed4245884a","order_by":5,"name":"Chenyu Huang","email":"","orcid":"","institution":"Nanjing First Hospital","correspondingAuthor":false,"prefix":"","firstName":"Chenyu","middleName":"","lastName":"Huang","suffix":""},{"id":313743755,"identity":"3bb77e65-e89d-47f1-abdf-907e4ba09d1a","order_by":6,"name":"Jinfan Zhang","email":"","orcid":"","institution":"First Affiliated Hospital of Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jinfan","middleName":"","lastName":"Zhang","suffix":""},{"id":313743756,"identity":"f1b4822f-fec3-4c20-9a2b-243e997fc786","order_by":7,"name":"Yong Gao","email":"","orcid":"","institution":"First Affiliated Hospital of Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Gao","suffix":""},{"id":313743757,"identity":"601406d2-7281-4875-960e-6568ac0f0b89","order_by":8,"name":"Lingdi Yin","email":"","orcid":"","institution":"First Affiliated Hospital of Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lingdi","middleName":"","lastName":"Yin","suffix":""},{"id":313743758,"identity":"e0a517e9-af87-432c-9663-433029c803fc","order_by":9,"name":"Kuirong Jiang","email":"","orcid":"https://orcid.org/0000-0002-2849-5450","institution":"The First Affiliated Hospital of Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Kuirong","middleName":"","lastName":"Jiang","suffix":""},{"id":313743759,"identity":"0c0c7ce1-e98c-42d3-99ee-dfd5a4fbc8f4","order_by":10,"name":"Yi Miao","email":"","orcid":"https://orcid.org/0000-0003-2542-8663","institution":"Pancreas Center, the First Affiliated Hospital of Nanjing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Miao","suffix":""}],"badges":[],"createdAt":"2024-06-01 08:55:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4512791/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4512791/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41418-024-01426-y","type":"published","date":"2024-12-03T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":59279744,"identity":"1ed5b429-e93b-4db8-8e4d-dee1a0efe579","added_by":"auto","created_at":"2024-06-28 15:05:42","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":6243134,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUSP19 is downregulated in pancreatic cancer and related with a worse prognosis. \u003c/strong\u003e(A) The expression of USP19 in tumor tissues and normal non-tumor tissues from TCGA, GSE71729, ICGC-CA and ICGC-AU. (B) The expression of USP19 in tumor tissues and compared normal non-tumor tissues from our center. (C) Kaplan-Meier analysis of the overall survival from published database. (D) Representative IHC staining of USP19 in pancreatic tumor tissues and paired non-tumor tissues. (E) The expression of USP19 was determined in thirty-four pairs of pancreatic cancer tissues and matched non-tumor tissues by IHC. (F) The relative expression of USP19 in pancreatic cell lines from GSE71729. (G) The expression of USP19 was examined in six pancreatic cell lines by western blot. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4512791/v1/f9853808fd2e6fa5cb71df60.png"},{"id":59279220,"identity":"d193bc52-7492-411b-8600-3ea18144e1ef","added_by":"auto","created_at":"2024-06-28 14:57:42","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":7774892,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInhibitory effects of USP19 on proliferation and metastasis of pancreatic cancer cells.\u003c/strong\u003e (A) CCK-8 assays, (B) EdU assays, (C) Colony formation assays, (D) Flow cytometric analysis of MiaPaca-2 and CFPAC-1 cells transfected with USP19 or vector control. (E) Representative images of xenograft tumors after subcutaneous injection of MiaPaca-2 and CFPAC-1 cells transfected with USP19 or vector control 28d after inoculation. (F-G) Time course of growth and tumor weight of pancreatic cancer xenografts. (H) IHC staining of Ki67 and cleaved caspase 3 of tumor sections. Scale bar, 100μm. (I) Wound healing assay (J and K) Transwell assays of MiaPaca-2 and CFPAC-1 cells transfected with USP19 or vector control. (L) Representative images of lung metastasis in nude mice after tail injection of MiaPaca-2 and CFPAC-1 cells transfected with USP19 or vector control. (M) H\u0026amp;E staining and quantification of pulmonary metastatic nodules. Scale bar, 500μm. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4512791/v1/e38b04a9669e5c3653510be9.png"},{"id":59279222,"identity":"ad60d46b-47ae-4f9f-810f-05a82fec8ec6","added_by":"auto","created_at":"2024-06-28 14:57:42","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1436387,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUSP19 binds to and inhibits NEK9 degradation. \u003c/strong\u003e(A-B) Detection of endogenous protein interactions between USP19 and NEK9 in MiaPaca-2 and CFPAC-1 cells lysates, respectively. (C-D) Detection of exogenous protein interactions between USP19 and NEK9 in HEK293T cells. Myc-tagged USP19 and Flag-tagged NEK9 plasmids were transfected into HEK293T cells. (E) Schematic representations of Myc-tagged various deletion mutations of USP19 and Flag-tagged various deletion mutations of NEK9. (F) Flag-NEK9 and Myc-tagged deletion mutations of USP19 were co-transfected into HEK293T cells, and cell lysates were analyzed by immunoprecipitation followed by immunoblotting with anti-Flag and anti-Myc. (G) Myc-USP19 and Flag-tagged deletion mutations of NEK9 were co-transfected into HEK293T cells, and cell lysates were analyzed by immunoprecipitation followed by immunoblotting with anti-Flag and anti-Myc. FL = Full length. (H) Western blot analysis of NEK9 expression in transfected MiaPaca-2 and CFPAC-1 cells. (I) NEK9 mRNA levels in MiaPaca-2 and CFPAC-1 cells in indicated groups. (J) Evaluation of NEK9 protein levels in HEK293T cells downregulated with USP19 with or without proteasome inhibitor MG132 treatment. (K) Increasing amounts of Myc-tagged USP19 (WT or C607S mutant) were transfected and the expression levels of NEK9 and Myc-tagged USP19 expression were detected by Western blot in HEK293T cells. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4512791/v1/66b468e1848c33bf649ba742.png"},{"id":59279217,"identity":"e191c0ff-08bf-4d16-b095-fd3c7de18443","added_by":"auto","created_at":"2024-06-28 14:57:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2867256,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of USP19 on ubiquitination of NEK9.\u003c/strong\u003e (A) Detection of NEK9 expression in HEK293T cells transfected with USP19 or vector control in the presence of CHX (10μg/ml) for the indicated time points. (B) Detection of NEK9 expression in HEK293T cells transfected with shUSP19 or vector in the presence of CHX (10μg/ml) for indicated time point. CHX = cycloheximide. (C) Evaluation of endogenous NEK9 ubiquitination in HEK293T cells transfected with USP19 and (D) shUSP19 or vector control. (E and F) Evaluation of endogenous NEK9 ubiquitination in MiaPaca-2 and CFPAC-1 cells transfected with USP19 or vector control, respectively. (G) Evaluation of exogenous NEK9 ubiquitination in HEK293T cells co-transfected with Myc-tagged USP19 (WT) or Myc-tagged TRIM22 (C607S), HA-tagged Ub and Flag-tagged NEK9. (H) HEK293T cells were co-transfected with Myc-USP19, Flag-NEK9 and HA-Ub Lys0, Lys48 alone, or Lys63 alone plasmids, and then NEK9 ubiquitination was analyzed. (I) In the presence of shCtrl or shUSP19, HEK293T cells transfected with either Ub WT or Ub Lys48R were cultured for 72 h. Cell lysates were analyzed by immunoblotting with anti-USP19 and anti-NEK9. (J) HEK293 cells transfected with Myc-USP19, ubiquitin K48, and different Flag-NEK9 mutants were subjected to Co-IP with anti-Flag antibody and analyzed by western blotting. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01.\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4512791/v1/fff467133ff38f8e5f022d13.png"},{"id":59279221,"identity":"9b6ffc69-f93a-4bc0-95cf-de9c88fe7b33","added_by":"auto","created_at":"2024-06-28 14:57:42","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":14405213,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUSP19 inhibits pancreatic cancer proliferation and metastasis through interacting with and stabling NEK9. \u003c/strong\u003e(A)CCK-8 assays, (B) EdU assays, (C) colony formation assays and (D) apoptosis assays were conducted in MiaPaca-2 and CFPAC-1 cells as indicated. (E and F) Representative images of tumors and quantification of tumor volumes and tumor weights in nude mice bearing MiaPaca-2 and CFPAC-1 cells in indicated groups. (G) IHC staining of Ki67 and cleaved caspase 3 of tumor sections in indicated groups. Scale bar, 100μm. (H) Transwell invasion assays and (I) wound healing assays were performed in MiaPaca-2 and CFPAC-1 cells as indicated. (J) H\u0026amp;E staining and quantification of pulmonary metastatic nodules in indicated groups. Scale bar, 500μm. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4512791/v1/43ee0957effd2aee5efcf6eb.png"},{"id":59279218,"identity":"29e1c845-519a-44f2-8c24-21094f5bd095","added_by":"auto","created_at":"2024-06-28 14:57:41","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3453892,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUSP19/NEK9 cascade inhibited Warburg effect and activated autophagy pathway. \u003c/strong\u003e(A) Heatmap of differentially expressed genes of MiaPaca-2 cells transfected with USP19 or vector control. (B) Gene set enrichment analysis was performed to identify the distribution of key differentially expressed gene set of MiaPaca-2 cells transfected with USP19. (C) Western blot analysis of mTOR signaling and LC3 as well as p62 protein levels in MiaPaca-2 and CFPAC-1 cells as indicated. (D-F) Detection and quantification of ECAR and OCR in MiaPaca-2 and CFPAC-1 cells as indicated. (G) TEM was applied to determine the autophagic microstructure of transfected MiaPaca-2 and CFPAC-1 cells as indicated. ECAR = extracellular acidification rate; OCR = O\u003csub\u003e2\u003c/sub\u003e consumption rate. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4512791/v1/c09b3e9582e3e0031e374ad0.png"},{"id":59279219,"identity":"538ec5a7-ef2c-40ad-99fc-377698881a69","added_by":"auto","created_at":"2024-06-28 14:57:42","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":5953418,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNEK9 binds to and promotes Raptor phosphorylation at Ser792. \u003c/strong\u003e(A) The Venn diagram shows the endogenous protein interactions between USP19, NEK9 and Raptor in HEK293T cells lysates. (B) Detection of exogenous protein interactions between NEK9 or USP19 and Raptor in HEK293T cells. (C) Detection of exogenous protein interactions between NEK9 and Raptor in MiaPaca-2 and CFPAC-1 cells. (D) Detection of exogenous protein interactions between USP19 and Raptor in MiaPaca-2 and CFPAC-1 cells. (E) Western blot analysis of Raptor signaling in MiaPaca-2 and CFPAC-1 cells as indicated. (F) Representative images of multiple immunofluorescent staining of CK-19, USP19, NEK9 expression and phosphorylated mTOR\u003csup\u003eSer2448\u003c/sup\u003e in human pancreatic cancer tissues. Scale bar, 100μm. (G) Co-localization analysis of indicated proteins in human pancreatic cancer tissues. (H) Schematic depiction of the mechanisms how USP19 act as a novel activator of the NEK9/Raptor/autophagy axis in pancreatic cancer cells.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4512791/v1/13fc62409e895ca53af16610.png"},{"id":70540217,"identity":"29940cdc-72f9-4c66-8f80-c01afad1fdf2","added_by":"auto","created_at":"2024-12-04 08:09:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":57377365,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4512791/v1/d45e1320-9252-42b8-a11a-9bc1027be49f.pdf"},{"id":59279224,"identity":"b0aac85c-59c9-47f8-9d75-9a1ce226eab0","added_by":"auto","created_at":"2024-06-28 14:57:42","extension":"docx","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":2730739,"visible":true,"origin":"","legend":"","description":"","filename":"Fulllengthuncroppedoriginalwesternblots.docx","url":"https://assets-eu.researchsquare.com/files/rs-4512791/v1/ca2f345b26450665a53cca51.docx"},{"id":59279225,"identity":"4d78ace5-4cc2-4ee7-95df-d590cfff4ffe","added_by":"auto","created_at":"2024-06-28 14:57:42","extension":"docx","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":18979834,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigures.docx","url":"https://assets-eu.researchsquare.com/files/rs-4512791/v1/f2ced67942802bd7c2bc41df.docx"}],"financialInterests":"There is no duality of interest","formattedTitle":"USP19 potentiates autophagic cell death via inhibiting mTOR pathway through deubiquitinating NEK9 in pancreatic cancer","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePancreatic cancer is one of the most lethal cancers with a five-year survival rate of less than 11%[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Although important advances have been achieved in improving patient outcomes with comprehensive treatment based on surgical resection in recent years, a large proportion of advanced patients are not suitable for surgery. Pancreatic cancer remains difficult to detect and diagnose because of atypical early symptoms. Chemotherapy is currently routinely recommended except for surgery. However, owing to the rapid development of chemotherapy resistance, the survival of patients can only be moderately extended. Hence, there is an urgent need to explore the potential mechanisms of pancreatic cancer progression and seek more comprehensive and effective treatments.\u003c/p\u003e \u003cp\u003eThe ubiquitin-specific protease (USPs) family is the largest and most diverse deubiquitinase (DUBs). In addition to the conserved USP domain, USPs also contain a ubiquitin-associated domain (UBA), ubiquitin-interacting motif (UIM), zinc finger ubiquitin-specific protease domain (ZnF-UBP), as well as terminal extensions[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Ubiquitination and ubiquitin-like post-translational modifications regulate the activity and stability of different oncoproteins and tumor suppressors. Numerous studies have revealed the important mechanisms by which USPs regulate biological processes by removing ubiquitin or ubiquitin-like peptides from substrate proteins, such as protein stabilization, cell signaling activity, tumorigenesis, and progression[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Therefore, it is important to explore the potential role of the USPs family in the development of pancreatic cancer.\u003c/p\u003e \u003cp\u003eUSP19, a member of the USPs family of proteins, has been reported to play distinct roles in the regulation of biological processes in different neoplasms. Functionally, several proteins have been found to be substrates of USP19, such as BECN1, ME1, and BAG6[\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Zhang et al. found that USP19 activates apoptotic endoplasmic reticulum stress by deubiquitinating BAG6 in triple-negative breast cancer.[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] In another study, USP19 was found to enhance lipogenesis by stabilizing ME1, which in turn promotes colorectal carcinogenesis[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. However, the detailed functional role of USP19 in pancreatic cancer and its underlying mechanisms remain unclear.\u003c/p\u003e \u003cp\u003eThe present study identified USP19 as a functional deubiquitinase that is downregulated in pancreatic cancer and is associated with poor prognosis. Our results showed that USP19 inhibits pancreatic cancer progression by interacting with and inhibiting the degradation of NEK9, thus activating Raptor/mTOR/autophagy signaling. This study reveals a novel role for the USP19/NEK9 axis in pancreatic cancer progression, providing a promising target for the treatment of pancreatic cancer.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eClinical specimens and cell lines\u003c/h2\u003e \u003cp\u003ePancreatic tumor tissues were collected during pancreatectomy and the postoperative pathological diagnosis was pancreatic ductal adenocarcinoma. Surgically resected specimens were fixed with 10% formalin and cut into 4\u0026micro;m thick sections for subsequent studies. This study was approved by the Ethics Committee of the First Affiliated Hospital of Nanjing Medical University. The telomerase-immortalized HPNE (hTERT‐HPNE) and its oncogenic Kras variant HPNE\u003csup\u003e\u003cem\u003eKrasG12D\u003c/em\u003e\u003c/sup\u003e cells were obtained from the American Type Culture Collection (ATCC). HEK293T, PANC-1, Colo-357, MiaPaca-2, and CFPAC-1 cells were obtained from the Cell Bank of the Chinese Academy of Science (Shanghai, China) and cultured according to established protocols.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCell proliferation assays\u003c/h2\u003e \u003cp\u003eThe proliferation of CFPAC-1 and MiaPaca-2 cells was studied using the cell counting kit-8 (CCK-8, Dojindo, Japan) and 5-ethynyl-2\u0026prime;-deoxyuridine assay (EdU, Beyotime, China) assays, as described in our previous studies[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. For the colony-formation assay, 2.5\u0026times;10\u003csup\u003e2\u003c/sup\u003e cells were seeded on 12-well plates and cultured with complete medium. The colonies were stained with crystal violet for 10 days. The apoptotic rates of cells were measured using a cell apoptosis assay (MULTI SCIENCES, China) according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eMigration, invasion and Wound-healing assay\u003c/h2\u003e \u003cp\u003eCell migration and invasion were assessed using transwell filters (8.0\u0026micro;m) purchased from BD Biosciences (Franklin Lakes, NJ, USA) according to our previous study[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFor the wound-healing assay, 2\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells were plated in 6-well plates and reached 100% confluence. Wounds were scratched onto a monolayer of cells with a 200\u0026micro;L pipette tip and then washed twice. The cells were then cultured in serum-reduced medium, and the images were captured at 0 and 48h using an inverted microscope (ZEISS, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eRNA isolation and real-time q-PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was purified using an RNA quick purification kit (ESscience, China). A PrimeScript RT Master Mix Kit (Vazyme, China) was used to perform mRNA reverse transcription according to the manufacturer\u0026rsquo;s instructions. The relative expression level was compared to that of β-actin, and fold changes were calculated using the 2-\u003csup\u003e△△ct\u003c/sup\u003e method. The primer sequences are listed as follow: β-actin (F): CATGTACGTTGCTATCCAGGC, (R): CTCCTTAATGTCACGCACGAT; NEK9 (F): GCTGTGATGGGACATTTCTG, (R): CCAAGGTAAAGGACGTTGTG and USP19 (F): CGGCACAAGATGAGGAATGA, (R): GGCACCGGCAGATAAAGAAA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eAutophagosome detection by transmission electron microscopy (TEM)\u003c/h2\u003e \u003cp\u003eBriefly, CFPAC-1 and Miapaca-2 cells were fixed with 2.5% glutaraldehyde at room temperature. Then, cells were gently scraped off from culture dishes with a cell scraper and collected by centrifugation, resuspended in 2.5% glutaraldehyde, and stored at 4\u0026deg;C. The cells were then fixed, dehydrated, embedded, polymerized, and sliced. The slice thickness was 60\u0026ndash;80 nm. The sections were observed under a transmission electron microscope (FEI Tecnai, USA) and images were collected for analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of oxidative phosphorylation and glycolysis\u003c/h2\u003e \u003cp\u003eA Seahorse XF96 Metabolic Flux Analyzer (Seahorse Biosciences, USA) was used to measure the extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) in CFPAC-1 and MiaPaca-2 cells in the indicated groups according to the manufacturer\u0026rsquo;s instructions. Briefly, 3\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells from the indicated groups were seeded into each well of a Seahorse XF96 cell culture microplate. The extracellular acidification rate was assessed by sequential injection of 10mM glucose, 1mM oligomycin and 80mM 2-deoxyglucose (2-DG). The oxygen consumption rate was determined by sequential addition of 1mM ATP synthase blocker oligomycin, 1mM mitochondrial uncoupler carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone and 2mM complex I and III inhibitors antimycin A and 2mM rotenone. Data quantification was carried out using XFe Wave software (Seahorse Biosciences) according to the manufacturer\u0026rsquo;s protocol.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry (IHC) and multiple-color immunohistochemistry\u003c/h2\u003e \u003cp\u003eTissue sections were prepared for antigen retrieval using microwave treatment in citrate buffer (Beyotime) and then incubated with primary antibodies overnight at 4\u0026deg;C, followed by incubation with secondary antibodies. Immunostaining was performed using diaminobenzidine as a substrate. Multiple-color immunofluorescence reagent (Recordbio, China) was used to detect co-focal proteins in pancreatic tumor specimens, according to the manufacturer\u0026rsquo;s protocols.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003ePlasmids and adenoviral infection\u003c/h2\u003e \u003cp\u003eCells were infected with adenovirus USP19 (USP19), adenovirus NEK9 (NEK9) and adenovirus vector (Vector), adenovirus shRNA-control (shCtrl), shRNA-USP19 (shUSP19), shRNA-NEK9 (shNEK9) and shRNA-Atg5 (shAtg5). Full-length sequences for human USP19, NEK9, ubiquitin and its mutants were subcloned into the EcoRI and NotI sites of Myc-, Flag- and HA tagged pcDNA3.1 vectors (Thermo Fisher Scientific).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eRNA sequence (RNA-Seq)\u003c/h2\u003e \u003cp\u003eRNA-seq analysis was performed by BGI Group (Guangzhou, China). Total RNAs from MiaPaca-2 cells transfected with the Vector and USP19 (n\u0026thinsp;=\u0026thinsp;3/group) was extracted. RNA samples of high quality were then converted into cDNA libraries. cDNA libraries were then sequenced on DNBSEQ, following the manufacturer\u0026rsquo;s protocols. Fold changes\u0026thinsp;\u0026gt;\u0026thinsp;1.5 and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 represented differentially expressed genes (DEGs).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eAntibodies and reagents\u003c/h2\u003e \u003cp\u003eThe following antibodies and reagents were used in this study: USP19 (Proteintech, 25768-1-AP), NEK9 (Proteintech, 11192-1-AP),α-Tubulin (Proteintech, 66031-1-Ig), Myc-Tag (Proteintech, 16286-1-AP), HA-Tag (Proteintech, 81290-1-RR), Flag-Tag (Proteintech, 66008-4-Ig), SQSTM1/p62 (Proteintech, 18420-1-AP), LC3 (CST, #12741), AKT (CST, #4691), AKT\u003csup\u003eSer473\u003c/sup\u003e (CST, #4060), mTOR (Proteintech, 66888-1-Ig), mTOR\u003csup\u003eSer2448\u003c/sup\u003e (Proteintech, 67778-1-Ig), Raptor (Proteintech, 20984-1-AP), Raptor\u003csup\u003eSer792\u003c/sup\u003e (Invitrogen, PA5-118730), Ki67 (Proteintech, 27309-1-AP), Cleaved Caspase 3 (CST, #9661), CK-19 (Proteintech, 10712-1-AP), MG132 (MCE, HY-13259), CHX (MCE, HY-12320) and Bafilomycin A1 (MCE, HY-100558).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eImmunoprecipitation (IP)\u003c/h2\u003e \u003cp\u003ePierce\u0026trade; IP lysis buffer (Thermo Fisher Scientific, USA) containing protease inhibitors was used to lyse cells. Protein concentrations were determined using the BCA Protein Quantification Kit (Beyotime Biotechnology). Cell lysates were pre-cleared with protein A/G-agarose beads (Beyotime) for 1h and immunoprecipitated with the indicated antibodies at 4\u0026deg;C overnight. After that, the lysates were collected and incubated with protein A/G-agarose beads for 2h and the immunocomplexes were washed five times with IP lysis buffer and the bound proteins were then eluted by boiling and subjected to SDS-PAGE for Western blot analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eAnimal experiments\u003c/h2\u003e \u003cp\u003e All animal experiments were performed in accordance with a protocol approved by the Institutional Animal Care and Use Committee of the Nanjing Medical University. Four-week-old nude mice (BALB/c mice) were obtained from GemPharmatech\u0026trade; (Nanjing, China) and used for in vivo assays. The nude mice were randomly divided into several groups according to the experimental requirements. Stably transfected pancreatic cancer cells (1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells) in 50\u0026micro;L of medium were subcutaneously injected into the left side of the posterior flank of the nude mice. For the tumor metastasis assay, medium containing 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells were injected through the tail vein. The development of metastases was imaged and evaluated using an IVIS200 imaging system (Caliper Life Science, USA). The investigators were blinded to the experimental groups and the outcome evaluations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD and contain at least three independent biological replicates. Statistical analyses were performed using GraphPad Prism, version 8 (GraphPad Software, USA). For two-group comparisons, the unpaired two-tailed Student\u0026rsquo;s t-test was performed. For comparisons between more than two groups, one-way or two-way ANOVA followed by Tukey\u0026rsquo;s post-hoc test was performed. Kaplan-Meier curves and log-rank tests were performed to compare survival difference. \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eUSP19 is downregulated in pancreatic cancer and related with a worse prognosis\u003c/h2\u003e \u003cp\u003eBased on four published datasets (TCGA, GSE71729, ICGC-CA, and ICGC-AU) and our cohort obtained from pancreatic tumor samples, the expression of USP19 was first examined, and the analyzed data suggested that USP19 was significantly downregulated in tumor specimens compared with non-tumor tissues and further decreased with tumor progression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-B). Kaplan-Meier analysis showed that patients with high USP19 expression had a better prognosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). In addition, the downregulation of USP19 expression in tumor tissues compared to that in adjacent non-tumor tissues was confirmed by immunohistochemical staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-E). Moreover, results from a published dataset (GSE71729) and western blot results showed that USP19 expression was lower in human pancreatic cancer cell lines than that in normal pancreatic ductal cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF-G). Therefore, these results indicate that USP19 may play an inhibitory role in pancreatic cancer progression and is associated with a better prognosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eInhibitory effects of USP19 on proliferation and metastasis of pancreatic cancer\u003c/h2\u003e \u003cp\u003eTo investigate the functional role of USP19 in pancreatic cancer, CFPAC-1 and MiaPaca-2 cells were stably overexpressed USP19. Results from CCK-8, EdU and colony formation assay indicated that cell proliferation was markedly inhibited after USP19 overexpression in both cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-C). Furthermore, flow cytometric analysis of cell apoptosis indicated that USP19 overexpression in both cell lines promoted cell apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). In vivo, the USP19-overexpressing xenografted tumors grew much more slowly than the tumors in the vector control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE-G). Furthermore, the IHC assay showed a decreased expression of Ki67 and an increased expression of cleaved caspase 3 in USP19 overexpressed xenografts (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). We further performed a series of functional experiments to investigate whether USP19 is associated with metastasis of pancreatic cancer cells. The wound healing assay suggested that USP19 overexpression significantly inhibited the migration of CFPAC-1 and MiaPaca-2 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI). In addition, the transwell assay also revealed that overexpression of USP19 attenuated the aggressiveness and migration of both cell types (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ-K). In vivo, we found that lung metastasis was remarkably suppressed in the USP19 overexpression group compared to that in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eL-M). In conclusion, these results demonstrated that USP19 plays an inhibitory role in proliferation and metastasis of pancreatic cancer.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eUSP19 binds to and inhibits NEK9 degradation\u003c/h2\u003e \u003cp\u003eTo further investigate the potential mechanism by which USP19 inhibits pancreatic cancer proliferation and metastasis, we used immunoprecipitation coupled mass spectrometry (IP/MS) to determine the proteins that interact with USP19. NIMA-related kinase 9 (NEK9) was identified as a protein that interacts with USP19. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B, we found that endogenous USP19 co-precipitated with NEK9 in both pancreatic cancer cells. Complementarily, we also confirmed an interaction between ectopically expressed Flag-tagged NEK9 and Myc-tagged USP19 in HEK293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-D). Mapping USP19-NEK9 interaction motifs revealed that the U domain (497\u0026ndash;1318) of USP19 as well as the R domain (347\u0026ndash;726) of NEK9 were required for their interaction (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE\u0026ndash;G).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAs USP19 interacts with NEK9, the effects of USP19 overexpression on NEK9 expression levels in pancreatic cancer cells were subsequently investigated. Overexpression of USP19 significantly increased NEK9 protein levels but had no influence on transcription (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH-I). Furthermore, addition of the proteasome inhibitor MG132 reversed the decline in NEK9 protein levels after silencing USP19 in HEK293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ). We also conducted experiments to see if NEK9 is stabilized by USP19. It was found that NEK9 protein levels were significantly increased after overexpression of USP19, but were not influenced by the enzymatically inactive C607S variant of USP19 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eK).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eUSP19 catalyzes K48-linked deubiquitination of NEK9 at K525\u003c/h2\u003e \u003cp\u003eWe then explored the effect of USP19 expression on the protein stability of endogenous NEK9 in the presence of the protein synthesis inhibitor cycloheximide (CHX). It was shown that overexpression of USP19 markedly suppressed NEK9 degradation, whereas silencing USP19 significantly promoted NEK9 degradation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B). Next, we sought to determine the effect of USP19 on the ubiquitination of NEK9. Forced expression of USP19 WT, but not the C607S mutant, significantly decreased the ubiquitination of NEK9. Meanwhile, USP19 knockdown significantly increased NEK9 ubiquitination (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC-G). These results suggest that USP19 regulates the stability of NEK9 by regulating its proteasomal degradation via deubiquitination. We also performed a ubiquitination assay on two major forms of ubiquitin (K48 and K63), to investigate which type of ubiquitin chain of NEK9 was deubiquitylated by USP19. The result indicated that USP19 could efficiently remove the K48-linked ubiquitin chain from the NEK9 protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). To confirm that Lys48-linked polyubiquitination is essential for USP19-regulated degradation of NEK9, we expressed a Lys48-resistant (Lys48R) form of ubiquitin in USP19-knockdown HEK293T cells and found that the expression of Lys48R ubiquitin abolished the USP19 knockdown-induced decrease in NEK9 levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI). To determine the specific sites of NEK9 protein that are deubiquitinated by USP19, we mutated the lysine residues of NEK9. A ubiquitination assay indicated that K525 was the key site on NEK9 deubiquitinated by USP19 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ). Taken together, these data indicate that USP19 regulates the stability of NEK9 by deubiquitinating it in pancreatic cancer cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eUSP19 inhibits pancreatic tumorigenicity through interacting with NEK9\u003c/h2\u003e \u003cp\u003eWe then analyzed the correlation between USP19 and NEK9 in pancreatic cancer. The results suggested that NEK9 expression was significantly decreased in pancreatic cancer specimens and cancer cell lines (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA-D). Furthermore, a significant positive correlation was observed between the expression of USP19 and NEK9 proteins (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eE). Survival analysis revealed that high expression of NEK9 was related to poor prognosis (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eF). We also conducted a series of in vitro experiments to elucidate the role of NEK9 in pancreatic cancer progression. The results showed that NEK9 overexpression significantly diminished tumorigenicity of pancreatic cancer cells (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eG-M). These results indicate that NEK9 is positively correlated with USP19 and may act as a tumor suppressor protein.\u003c/p\u003e \u003cp\u003eIn vitro and in vivo rescue experiments were performed to investigate the role of NEK9 in the mechanism by which USP19 inhibits the progression of pancreatic cancer. The results showed that the diminished tumorigenicity, including proliferation, migration, and invasion in USP19-overexpressed pancreatic cancer cells were reversed when NEK9 was knocked down (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) or USP19 was enzymatically inactivated (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). Overall, these results revealed that NEK9 is the downstream target of USP19 and mediates the role of USP19 in inhibiting pancreatic tumor progression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eUSP19/NEK9 axis inhibits Warburg effect and activates autophagy via inhibiting mTORC1 signaling\u003c/h2\u003e \u003cp\u003eTo further explore the mechanism by which USP19 inhibits pancreatic cancer progression, transcriptome analysis by high-throughput RNA sequencing (RNA-Seq) was performed in MiaPaca-2 cells transfected with the vector and USP19. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, 1488 DEGs were upregulated, whereas 1369 DEGs were downregulated in USP19-overexpressed MiaPaca-2 cells. Subsequently, gene set enrichment analysis (GSEA) showed that USP19 overexpression was positively correlated with mTORC1 signaling, glycolysis/gluconeogenesis inhibition and oxidative phosphorylation, and positive regulation of autophagy activation, suggesting a potential regulatory role of USP19 in mTORC1/Autophagy signaling (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Western blot analysis confirmed that overexpression of USP19 decreased the phosphorylation levels of mTOR, whereas downregulation of NEK9 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC) or deubiquitinating enzyme inactivation of USP19 (Fig. S3A) showed the opposite results, independent of phosphorylated AKT.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe Warburg effect refers to the phenomenon in which cancer cells produce energy mainly through aerobic glycolysis, rather than oxidative phosphorylation, which contributes to cancer cell survival and inhibits apoptosis[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Importantly, mTORC1 signaling is closely related to cellular energy homeostasis, and its activation significantly promote the shift of the Warburg effect in cancer cells. Conversely, inhibition of mTORC1 signaling is associated with autophagy activation[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Metabolic analysis showed that overexpression of USP19 resulted in a decrease in the glycolytic rate (ECAR) and an increase in the mitochondrial respiration (OCR) in pancreatic cancer cells. Western blot analysis of LC3 and p62 expression and detection of autophagosomes confirmed that USP19 overexpression significantly activated autophagy. We found that silencing of NEK9 or deubiquitinating enzyme inactivation of USP19 partially rescued these effects (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e and S3). Overall, these results indicate that USP19/NEK9 cascade inhibits Warburg effect and activates autophagy via inhibiting mTORC1 signaling.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eUSP19/NEK9 axis inhibits mTORC1 signaling via Raptor\u003csup\u003eSer792\u003c/sup\u003e phosphorylation\u003c/h2\u003e \u003cp\u003eThis study further explored the mechanism of NEK9 inhibiting pancreatic cancer progression, separately. Consistently, overexpression of NEK9 significantly inhibited mTOR phosphorylation, the Warburg effect, and promoted autophagy (Fig. S3D-F). We found that Raptor, an important molecule regulating the activation of the mTORC1 pathway, was identified as a substrate that interacts with NEK9 but not USP19 via IP/MS analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC-E, endogenous Raptor was co-precipitated with NEK9 in both pancreatic cancer cells. NEK9 is a member of the NEK family of serine/threonine-protein kinases. We speculated that NEK9 may serve as an intermediary signaling molecule between USP19 and the mTOR pathway by regulating Raptor activation. Western blot analysis confirmed that overexpression of USP19 or NEK9 both increased the expression level of phosphorylated Raptor\u003csup\u003eSer792\u003c/sup\u003e in pancreatic cell lines, and NEK9 knockdown inhibited the elevated phosphorylation level of Raptor\u003csup\u003eSer792\u003c/sup\u003e caused by USP19 overexpression (Fig. S3D and 7E). In addition, we performed multiple-color immunohistochemistry to detect the colocalization of genes in tumor tissues, and found that USP19 was positively correlated with NEK9 and negatively correlated with p-mTOR\u003csup\u003eSer2448\u003c/sup\u003e in CK19\u003csup\u003e+\u003c/sup\u003e pancreatic cancer lesions (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF-G). These results indicate that USP19/NEK9 axis inhibits mTORC1 signaling via Raptor\u003csup\u003eSer792\u003c/sup\u003e phosphorylation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eAutophagy inhibition diminishes the inhibitory role of USP19 in pancreatic cancer progression\u003c/h2\u003e \u003cp\u003eTo determine the role of USP19/NEK9-mediated autophagy activation in pancreatic cancer progression, we knocked down Atg5 or applied the autophagy inhibitor BafA1 in USP19 and NEK9 overexpressed pancreatic cancer cells, respectively. The results suggested that inhibition of autophagy by Atg5 knockdown or BafA1 significantly reversed the decreased malignant phenotypes in USP19- and NEK9-overexpressing cells (Fig. S4 and S5). Overall, these results suggest that USP19 inhibits pancreatic cancer progression by stabilizing NEK9 and activating Raptor/mTOR/autophagy signaling.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eUbiquitin-specific proteases can remove ubiquitin or ubiquitin-like peptides from substrates to alter the stability or state of proteins and dynamically regulate cellular biological processes[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The existing studies suggest that USP19 plays distinct roles in the regulation of biological processes in different tissues. Several targets including p53, survivin, and ME1 have been implicated in USP19-mediated tumorigenesis[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. USP19 promoted the migration and proliferation of cervical cancer cells through negatively regulating p53 protein levels[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Meanwhile, USP19 accelerated colorectal tumorigenesis via enhancing surviving-mediated signaling pathway[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Additionally, USP19 enhances lipogenesis by stabilizing ME1, which in turn promotes colorectal carcinogenesis[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. However, several studies have identified different biological functions of USP19. A study showed that USP19 exerts its inhibitory effect on clear cell renal cell carcinoma proliferation and migration by suppressing the ERK signaling pathway[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In another study, USP19 inhibited proliferation by deubiquitinating BAG6 in triple-negative breast cancer[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Herein, through a series of in vitro and vivo experiments, we elucidated the role of USP19 in inhibiting pancreatic cancer progression. USP19 was found to be significantly downregulated in pancreatic tumor specimens, and low USP19 expression was associated with a worse prognosis. Multiple functional experiments were performed to investigate the role of USP19 in the proliferation, invasion, and migration of pancreatic cancer cells. USP19 is negatively associated with malignant tumor phenotypes by stabilizing and decreasing the degradation of NEK9, a well-known serine/threonine protein kinase. A series of rescue functional experiments was performed to verify the role of the USP19/NEK9 axis in inhibiting pancreatic cancer progression. Metabolic flux analysis and autophagy were measured, and it was found that the USP19/NEK9 axis could inhibit the Warburg effect and promote autophagic cell death in pancreatic cancers by activating the Raptor/mTOR/autophagy signaling pathway.\u003c/p\u003e \u003cp\u003eNEK9 has been identified as a potential protein that interacts with USP19 in pancreatic cancer cells. NEK9 has previously been reported to play an important role in spindle assembly and centrosome separation[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Moreover, as a well-known serine/threonine protein kinase, its function in tumor progression has also been revealed in several studies. NEK9 was upregulated in gastric cancer cells and was correlated with a worse prognosis via activation of the TRIM28/NF-κB and STAT3 signaling pathways[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Also, as a downstream of the IL-6/STAT3 pathway, NEK9 could promote the metastasis of gastric cancer by phosphorylating ARHGEF2[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. However, in pancreatic and breast cancer, high expression of NEK9 suggested a better prognosis[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. NEK9 links the short isoform of PRLR to the activation of the Hippo signaling pathway and suppression of the pentose phosphate pathway and nucleotide synthesis in pancreatic cancer[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In our study, we also found a significantly downregulated expression of NEK9 in pancreatic cancer specimens, which was associated with worse prognosis. We found that NEK9 phosphorylates Raptor and is involved in the inhibition of the mTOR signaling pathway in pancreatic cancer. These data provide new evidence for the downstream signaling of NEK9 in tumor development, suggesting that NEK9 regulates cellular malignant features through the mTOR pathway, in addition to its role in spindle assembly and centrosome separation.\u003c/p\u003e \u003cp\u003eSeveral studies have suggested that autophagy plays an essential role in various biological processes. However, the exact functional role of autophagy in tumor biology remains controversial[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. On the one hand, many studies have shown the cytoprotective role of autophagy in the development of malignant tumors via promoting cancer cell survival, metastasis as well as drug resistance[\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. On the other hand, other studies have shown that autophagy can inhibit tumorigenesis due to autophagic cell death in cancer cells[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In our study, we found that USP19- and NEK9-activated autophagy induced autophagic cell death in pancreatic cancer cells. Previous studies have suggested that USP19 and NEK9 are involved in autophagy. BECN1, a key protein in autophagy initiation and progression, is deubiquitinated by USP19 to promote the formation of autophagosomes[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Furthermore, USP19 also can promote TBK1 degradation through chaperone-mediated autophagy in addition to its deubiquitination function[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In our study, we found that USP19 promoted autophagy activation through inhibition of the mTOR signaling pathway. These data further confirmed the diverse roles of USP19 in autophagy progression. In contrast to USP19, which plays a relatively clear role in promoting autophagy, NEK9 has shown different effects in different studies. A study revealed that NEK9 promotes primary cilia formation by acting as a selective autophagy adaptor for myosin IIA through its LC3-interacting region (LIR)[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Moreover, Behrends et al. identified NEK9 as a positive regulator of autophagosome formation based on the reduced formation of LC3-positive puncta upon downregulation of NEK9[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. However, another study suggested that NEK9 suppresses LC3B-mediated autophagy of p62 by phosphorylating LC3B[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. These results suggest that the autophagy regulation and protein kinase function of NEK9 may be dynamic and tissue specific. Although we found that NEK9 can phosphorylate Raptor via its protein kinase function, the underlying mechanism requires further exploration.\u003c/p\u003e \u003cp\u003eIn conclusion, this study showed that USP19 inhibits pancreatic cancer progression by interacting with and inhibiting ubiquitination and degradation of NEK9. The USP19/NEK9 axis further activates Raptor/mTOR/autophagy signaling, leading to autophagic cell death in pancreatic cancer. Therefore, these findings indicate that the USP19/NEK9 axis may be a promising therapeutic target for treating pancreatic cancer.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSiegel, R.L., et al., \u003cem\u003eCancer statistics, 2023.\u003c/em\u003e CA Cancer J Clin, 2023. \u003cstrong\u003e73\u003c/strong\u003e(1): p. 17-48.\u003c/li\u003e\n\u003cli\u003eKitamura, H., \u003cem\u003eUbiquitin-Specific Proteases (USPs) and Metabolic Disorders.\u003c/em\u003e Int J Mol Sci, 2023. \u003cstrong\u003e24\u003c/strong\u003e(4).\u003c/li\u003e\n\u003cli\u003eBonacci, T. and M.J. Emanuele, \u003cem\u003eDissenting degradation: Deubiquitinases in cell cycle and cancer.\u003c/em\u003e Semin Cancer Biol, 2020. \u003cstrong\u003e67\u003c/strong\u003e(Pt 2): p. 145-158.\u003c/li\u003e\n\u003cli\u003eJin, S., et al., \u003cem\u003eUSP19 modulates autophagy and antiviral immune responses by deubiquitinating Beclin-1.\u003c/em\u003e EMBO J, 2016. \u003cstrong\u003e35\u003c/strong\u003e(8): p. 866-80.\u003c/li\u003e\n\u003cli\u003eZhu, Y., et al., \u003cem\u003eUSP19 exacerbates lipogenesis and colorectal carcinogenesis by stabilizing ME1.\u003c/em\u003e Cell Rep, 2021. \u003cstrong\u003e37\u003c/strong\u003e(13): p. 110174.\u003c/li\u003e\n\u003cli\u003eZhang, X., et al., \u003cem\u003eDeubiquitinase USP19 modulates apoptotic calcium release and endoplasmic reticulum stress by deubiquitinating BAG6 in triple negative breast cancer.\u003c/em\u003e Clin Transl Med, 2023. \u003cstrong\u003e13\u003c/strong\u003e(9): p. e1398.\u003c/li\u003e\n\u003cli\u003eWang, G., et al., \u003cem\u003eMetformin inhibits neutrophil extracellular traps-promoted pancreatic carcinogenesis in obese mice.\u003c/em\u003e Cancer Lett, 2023. \u003cstrong\u003e562\u003c/strong\u003e: p. 216155.\u003c/li\u003e\n\u003cli\u003eWang, G., et al., \u003cem\u003eInsulin promotes invasion and migration of KRAS(G12D) mutant HPNE cells by upregulating MMP-2 gelatinolytic activity via ERK- and PI3K-dependent signalling.\u003c/em\u003e Cell Prolif, 2019. \u003cstrong\u003e52\u003c/strong\u003e(3): p. e12575.\u003c/li\u003e\n\u003cli\u003eBononi, G., et al., \u003cem\u003eHistorical perspective of tumor glycolysis: A century with Otto Warburg.\u003c/em\u003e Semin Cancer Biol, 2022. \u003cstrong\u003e86\u003c/strong\u003e(Pt 2): p. 325-333.\u003c/li\u003e\n\u003cli\u003ePerl, A., \u003cem\u003emTOR activation is a biomarker and a central pathway to autoimmune disorders, cancer, obesity, and aging.\u003c/em\u003e Ann N Y Acad Sci, 2015. \u003cstrong\u003e1346\u003c/strong\u003e(1): p. 33-44.\u003c/li\u003e\n\u003cli\u003eFan, H., et al., \u003cem\u003eCritical role of mTOR in regulating aerobic glycolysis in carcinogenesis (Review).\u003c/em\u003e Int J Oncol, 2021. \u003cstrong\u003e58\u003c/strong\u003e(1): p. 9-19.\u003c/li\u003e\n\u003cli\u003eChandrasekaran, A.P., et al., \u003cem\u003eDual role of deubiquitinating enzyme USP19 regulates mitotic progression and tumorigenesis by stabilizing survivin.\u003c/em\u003e Mol Ther, 2022. \u003cstrong\u003e30\u003c/strong\u003e(11): p. 3414-3429.\u003c/li\u003e\n\u003cli\u003eTyagi, A., et al., \u003cem\u003eUSP19 Negatively Regulates p53 and Promotes Cervical Cancer Progression.\u003c/em\u003e Mol Biotechnol, 2023.\u003c/li\u003e\n\u003cli\u003eHu, W., et al., \u003cem\u003eUbiquitin specific peptidase 19 is a prognostic biomarker and affect the proliferation and migration of clear cell renal cell carcinoma.\u003c/em\u003e Oncol Rep, 2020. \u003cstrong\u003e43\u003c/strong\u003e(6): p. 1964-1974.\u003c/li\u003e\n\u003cli\u003eBertran, M.T., et al., \u003cem\u003eNek9 is a Plk1-activated kinase that controls early centrosome separation through Nek6/7 and Eg5.\u003c/em\u003e EMBO J, 2011. \u003cstrong\u003e30\u003c/strong\u003e(13): p. 2634-47.\u003c/li\u003e\n\u003cli\u003eLu, G., et al., \u003cem\u003eCancer associated fibroblast derived SLIT2 drives gastric cancer cell metastasis by activating NEK9.\u003c/em\u003e Cell Death Dis, 2023. \u003cstrong\u003e14\u003c/strong\u003e(7): p. 421.\u003c/li\u003e\n\u003cli\u003eLu, G., et al., \u003cem\u003eNEK9, a novel effector of IL-6/STAT3, regulates metastasis of gastric cancer by targeting ARHGEF2 phosphorylation.\u003c/em\u003e Theranostics, 2021. \u003cstrong\u003e11\u003c/strong\u003e(5): p. 2460-2474.\u003c/li\u003e\n\u003cli\u003eGao, W.L., et al., \u003cem\u003eIntegrative Analysis of the Expression Levels and Prognostic Values for NEK Family Members in Breast Cancer.\u003c/em\u003e Front Genet, 2022. \u003cstrong\u003e13\u003c/strong\u003e: p. 798170.\u003c/li\u003e\n\u003cli\u003eNie, H., et al., \u003cem\u003eThe short isoform of PRLR suppresses the pentose phosphate pathway and nucleotide synthesis through the NEK9-Hippo axis in pancreatic cancer.\u003c/em\u003e Theranostics, 2021. \u003cstrong\u003e11\u003c/strong\u003e(8): p. 3898-3915.\u003c/li\u003e\n\u003cli\u003eLevy, J.M.M., C.G. Towers, and A. Thorburn, \u003cem\u003eTargeting autophagy in cancer.\u003c/em\u003e Nat Rev Cancer, 2017. \u003cstrong\u003e17\u003c/strong\u003e(9): p. 528-542.\u003c/li\u003e\n\u003cli\u003eLiu, Y., et al., \u003cem\u003eTRPML1-induced autophagy inhibition triggers mitochondrial mediated apoptosis.\u003c/em\u003e Cancer Lett, 2022. \u003cstrong\u003e541\u003c/strong\u003e: p. 215752.\u003c/li\u003e\n\u003cli\u003eSang, J., et al., \u003cem\u003eJolkinolide B sensitizes bladder cancer to mTOR inhibitors via dual inhibition of Akt signaling and autophagy.\u003c/em\u003e Cancer Lett, 2022. \u003cstrong\u003e526\u003c/strong\u003e: p. 352-362.\u003c/li\u003e\n\u003cli\u003eLi, Y.J., et al., \u003cem\u003eAutophagy and multidrug resistance in cancer.\u003c/em\u003e Chin J Cancer, 2017. \u003cstrong\u003e36\u003c/strong\u003e(1): p. 52.\u003c/li\u003e\n\u003cli\u003eDenton, D. and S. Kumar, \u003cem\u003eAutophagy-dependent cell death.\u003c/em\u003e Cell Death Differ, 2019. \u003cstrong\u003e26\u003c/strong\u003e(4): p. 605-616.\u003c/li\u003e\n\u003cli\u003eCui, J., S. Jin, and R.F. Wang, \u003cem\u003eThe BECN1-USP19 axis plays a role in the crosstalk between autophagy and antiviral immune responses.\u003c/em\u003e Autophagy, 2016. \u003cstrong\u003e12\u003c/strong\u003e(7): p. 1210-1.\u003c/li\u003e\n\u003cli\u003eZhao, X., et al., \u003cem\u003eUSP19 (ubiquitin specific peptidase 19) promotes TBK1 (TANK-binding kinase 1) degradation via chaperone-mediated autophagy.\u003c/em\u003e Autophagy, 2022. \u003cstrong\u003e18\u003c/strong\u003e(4): p. 891-908.\u003c/li\u003e\n\u003cli\u003eYamamoto, Y., et al., \u003cem\u003eNEK9 regulates primary cilia formation by acting as a selective autophagy adaptor for MYH9/myosin IIA.\u003c/em\u003e Nat Commun, 2021. \u003cstrong\u003e12\u003c/strong\u003e(1): p. 3292.\u003c/li\u003e\n\u003cli\u003eBehrends, C., et al., \u003cem\u003eNetwork organization of the human autophagy system.\u003c/em\u003e Nature, 2010. \u003cstrong\u003e466\u003c/strong\u003e(7302): p. 68-76.\u003c/li\u003e\n\u003cli\u003eShrestha, B.K., et al., \u003cem\u003eNIMA-related kinase 9-mediated phosphorylation of the microtubule-associated LC3B protein at Thr-50 suppresses selective autophagy of p62/sequestosome 1.\u003c/em\u003e J Biol Chem, 2020. \u003cstrong\u003e295\u003c/strong\u003e(5): p. 1240-1260.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-differentiation","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cdd","sideBox":"Learn more about [Cell Death \u0026 Differentiation](http://www.nature.com/cdd/)","snPcode":"41418","submissionUrl":"https://mts-cdd.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Differentiation","twitterHandle":"@cddpress","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Pancreatic cancer, USP19/NKE9, Autophagic cell death, Warburg effect","lastPublishedDoi":"10.21203/rs.3.rs-4512791/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4512791/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe ubiquitin-specific protease (USP) family is the largest and most diverse deubiquitinase (DUBs) family and plays a significant role in maintaining cell homeostasis. Dysregulation of USPs has been associated with carcinogenesis of various tumors. We identified that USP19 was downregulated in pancreatic tumor tissues and forced expression of USP19 diminished tumorigenicity of pancreatic cancer. Mechanistically, USP19 directly interacts with and stabilized NEK9 via inhibiting K48-specific poly-ubiquitination process on NEK9 protein at K525 site through its USP domain. Moreover, NEK9 phosphorylates the regulatory associated protein of mTOR (Raptor) at Ser792 and links USP19 to the inhibition of mTOR signaling pathway, which further leads to autophagic cell death of pancreatic cancer cells. Inhibition of autophagy by Atg5 knockdown or lysosome inhibitor bafilomycin A1 abolished the decreased malignant phenotype of USP19 and NEK9 overexpressed cancer cells. Importantly, USP19 expression exhibits a positive correlation with NEK9 expression in clinical samples, and low USP19 or NEK9 expression is associated with a worse prognosis. This study revealed that USP19-mediated NEK9 deubiquitylation is a regulatory mechanism for mTORC1 inhibition and provides a therapeutic target for diseases involving mTORC1 dysregulation.\u003c/p\u003e","manuscriptTitle":"USP19 potentiates autophagic cell death via inhibiting mTOR pathway through deubiquitinating NEK9 in pancreatic cancer","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-28 14:57:37","doi":"10.21203/rs.3.rs-4512791/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2024-06-30T12:06:31+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-06-29T09:38:32+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-06-24T17:30:51+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-06-13T00:10:01+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-06-12T19:42:13+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2024-06-12T19:41:51+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-09T13:09:22+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death \u0026 Differentiation","date":"2024-06-03T14:30:48+00:00","index":"","fulltext":""},{"type":"checksFailed","content":"","date":"2024-06-03T09:43:16+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-01T08:53:23+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-differentiation","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cdd","sideBox":"Learn more about [Cell Death \u0026 Differentiation](http://www.nature.com/cdd/)","snPcode":"41418","submissionUrl":"https://mts-cdd.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Differentiation","twitterHandle":"@cddpress","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"be2b240c-d2e1-4ade-8684-cfba4740496f","owner":[],"postedDate":"June 28th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-12-04T08:08:56+00:00","versionOfRecord":{"articleIdentity":"rs-4512791","link":"https://doi.org/10.1038/s41418-024-01426-y","journal":{"identity":"cell-death-and-differentiation","isVorOnly":false,"title":"Cell Death \u0026 Differentiation"},"publishedOn":"2024-12-03 05:00:00","publishedOnDateReadable":"December 3rd, 2024"},"versionCreatedAt":"2024-06-28 14:57:37","video":"","vorDoi":"10.1038/s41418-024-01426-y","vorDoiUrl":"https://doi.org/10.1038/s41418-024-01426-y","workflowStages":[]},"version":"v1","identity":"rs-4512791","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4512791","identity":"rs-4512791","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00