Multiparatopic antibodies overcome tyrosine kinase inhibitor resistance by inducing lysosomal degradation of EGFR mutants

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Acquired resistance to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) remains a major challenge in the treatment of non-small cell lung cancer (NSCLC). To address this issue, we developed a novel therapeutic strategy based on multiparatopic antibodies that induce targeted degradation of EGFR, independent of driver mutations typically residing in the cytosolic domain. We engineered nanobodies (Nbs) recognizing four distinct epitopes within the EGFR extracellular domain into biparatopic and triparatopic antibody formats. These antibodies effectively promoted EGFR clustering, endocytosis, and lysosomal degradation, resulting in potent suppression of downstream signaling and cell proliferation in NSCLC cell lines carrying diverse EGFR mutations, including those resistant to osimertinib. The degradation process was epitope-dependent and mediated through a dynamin-dependent endocytic pathway. Triparatopic antibodies exhibited superior antitumor efficacy compared to both biparatopic antibodies and osimertinib in xenograft models of TKI-sensitive and TKI-resistant NSCLC cells. Moreover, these antibodies displayed additive effects when combined with osimertinib. We further demonstrated that this degradation mechanism extends beyond EGFR, as antibody-mediated crosslinking similarly triggered PD-L1 degradation. Collectively, this study indicates multiparatopic antibodies as a potent and mechanistically distinct strategy to overcome TKI resistance by directly degrading the target oncoprotein, with broad applicability to other pathogenic cell surface proteins. Main Text:
Full text 174,620 characters · extracted from preprint-html · click to expand
Multiparatopic antibodies overcome tyrosine kinase inhibitor resistance by inducing lysosomal degradation of EGFR mutants | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Multiparatopic antibodies overcome tyrosine kinase inhibitor resistance by inducing lysosomal degradation of EGFR mutants Deli Huang, Yaoji Liang, Chunjie Lin, Jie Liu, Jiacheng Ni, Dingrui Chen, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8437918/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Acquired resistance to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) remains a major challenge in the treatment of non-small cell lung cancer (NSCLC). To address this issue, we developed a novel therapeutic strategy based on multiparatopic antibodies that induce targeted degradation of EGFR, independent of driver mutations typically residing in the cytosolic domain. We engineered nanobodies (Nbs) recognizing four distinct epitopes within the EGFR extracellular domain into biparatopic and triparatopic antibody formats. These antibodies effectively promoted EGFR clustering, endocytosis, and lysosomal degradation, resulting in potent suppression of downstream signaling and cell proliferation in NSCLC cell lines carrying diverse EGFR mutations, including those resistant to osimertinib. The degradation process was epitope-dependent and mediated through a dynamin-dependent endocytic pathway. Triparatopic antibodies exhibited superior antitumor efficacy compared to both biparatopic antibodies and osimertinib in xenograft models of TKI-sensitive and TKI-resistant NSCLC cells. Moreover, these antibodies displayed additive effects when combined with osimertinib. We further demonstrated that this degradation mechanism extends beyond EGFR, as antibody-mediated crosslinking similarly triggered PD-L1 degradation. Collectively, this study indicates multiparatopic antibodies as a potent and mechanistically distinct strategy to overcome TKI resistance by directly degrading the target oncoprotein, with broad applicability to other pathogenic cell surface proteins. Main Text: Biological sciences/Cancer/Lung cancer/Non-small-cell lung cancer Biological sciences/Drug discovery/Business strategy in drug development/Pharmacoeconomics Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction The epidermal growth factor receptor (EGFR), a member of the erythroblastic leukemia oncogene B (ErbB) family—also known as the human epidermal growth factor receptor (HER) family—is a transmembrane receptor tyrosine kinase (RTK) [ 1 , 2 ]. EGFR (ErbB1 or HER1) regulates key cellular processes, including proliferation, survival, and differentiation, and acts as a critical driver of tumorigenesis across multiple cancer types [ 3 , 4 ]. Lung cancer is the second most commonly diagnosed cancer and accounts for over 25% of all cancer-related deaths [ 5 , 6 ], with non-small cell lung cancer (NSCLC) representing approximately 85% of cases [ 7 ]. EGFR overexpression occurs in 40–80% of NSCLC tumors in Asians [ 8 ]. Hyperactivating mutations within the EGFR tyrosine kinase domain most commonly include the L858R point substitution in exon 21 and the exon 19 deletion ΔE746–A750 [ 6 , 9 , 10 ], both of which confer sensitivity to first- and second-generation tyrosine kinase inhibitors (TKIs) [ 11 , 12 ]. However, approximately half of TKI-treated NSCLC patients develop a secondary T790M gatekeeper mutation in exon 20, which confers resistance to early-generation EGFR TKIs [ 9 , 13 – 15 ]. Third-generation TKIs, which irreversibly bind to Cys797, were developed to overcome T790M-mediated resistance [ 16 – 18 ], yet resistance frequently re-emerges through additional mutations such as C797S [ 19 – 22 ]. Although fourth-generation TKIs designed to counter these mechanisms are under development [ 23 , 24 ], acquired resistance remains inevitable due to tumor heterogeneity and adaptive evolution. This persistent challenge underscores the urgent need for alternative therapeutic strategies with distinct mechanisms of action to overcome EGFR-driven resistance. Targeted protein degradation (TPD) has emerged as a transformative therapeutic modality over the past two decades. By inducing the selective degradation of proteins of interest (POIs) through proteasomal or lysosomal pathways, TPD eliminates rather than inhibits disease-driving proteins. Proteolysis-targeting chimeras (PROTACs), the most established class of TPD agents, are bispecific molecules that bring a POI into proximity with an E3 ubiquitin ligase, promoting ubiquitination and subsequent proteasomal degradation [ 25 – 28 ]. Alternatively, lysosomal degradation can be achieved by clustering POIs with lysosome-targeting receptors using ligands or binders, as demonstrated by lysosome-targeting chimaeras (LYTACs) [ 29 , 30 ], cytokine receptor-targeting chimeras (KineTACs) [ 31 ], and endocytosis-triggering binding proteins (EndoTags) [ 32 ]. However, a shared limitation among these adaptor-dependent systems is the concomitant degradation or depletion of the E3 ligase or lysosomal receptor, which may compromise long-term efficacy. Strategies that induce degradation exclusively of the target protein are therefore highly desirable. The endocytic pathway represents a natural mechanism for RTKs downregulation, involving receptor clustering, internalization, intracellular trafficking, and lysosomal degradation [ 33 ], including that of EGFR [ 34 ]. Notably, biparatopic antibodies targeting RTKs such as EGFR or HER2 can exploit this pathway to drive receptor clustering and degradation [ 35 – 37 ]. We thus hypothesized that multiparatopic EGFR antibodies could more efficiently promote endocytosis and lysosomal degradation, offering a mechanistically distinct and potentially superior antitumor strategy compared to TKIs and other adaptor-dependent TPD platforms. We generated nanobodies (Nbs) targeting four non-overlapping epitopes of EGFR from immunized alpacas and engineered them into a series of biparatopic and triparatopic antibody formats. These multiparatopic antibodies efficiently induce degradation of clinically relevant EGFR variants and phosphorylated EGFR (pEGFR), including the third-generation TKI-resistant mutation C797S. Additionally, triparatopic constructs exhibiting enhanced endocytic activity demonstrated superior efficacy in mediating receptor degradation and inhibiting lung cancer cell proliferation across in vitro and in vivo models. Furthermore, combining EGFR-targeting multiparatopic antibodies with the third-generation TKI osimertinib resulted in additive antitumor effects. This mechanistically distinct degradation-based strategy offers a promising avenue to enhance therapeutic responses and extend the efficacy window of TKIs in EGFR-driven cancers. Results Biparatopic tetravalent nanobodies induce EGFR degradation As Nbs are more flexible for constructing multispecific formats than conventional antibodies, we generated Nbs targeting EGFR extracellular domains through alpaca immunization (Supplementary Fig. S1 A, B). These EGFR-specific Nbs were fused to the N-terminus of a Fc fragment to form homodimeric antibodies and expressed in mammalian Expi293F cells. Epitope mapping by competition ELISA indicated that these Nbs recognize four non-overlapping epitopes (defined as A, B, C, and D) in EGFR extracellular domains (Supplementary Fig. S1 C). Cell surface staining showed that these Nbs bind to H1975 (EGFR-L858R&T790M), PC9 (EGFR-ΔE746-A750), and mouse MC38 cells expressing wild-type EGFR, with variable intensity (Supplementary Fig. S1 D). We also assessed the affinity of all Nbs for soluble EGFR using surface plasmon resonance (SPR), which revealed dissociation constants (KD) ranging from 10 − 7 to 10 − 8 M (Supplementary Fig. S2A, B). When H1975 cells were treated with these Nbs and cetuximab [ 38 ], Nb-A6, B3-B5, C and D, as well as cetuximab, slightly mediated the degradation of EGFR (Supplementary Fig. S2C). Moreover, Nbs C and D potently inhibited EGF-induced Y1068 phosphorylation of wild-type EGFR (pEGFR Y1068 ) in A549 cells, similar to that of cetuximab (Supplementary Fig. S2D). In summary, we have developed a suite of anti-EGFR Nbs with distinct epitopes and affinities, several of which are functionally active in degrading EGFR and inhibiting its phosphorylation. To assess whether multiparatopic EGFR-targeting antibodies trigger endocytosis and degradation of EGFR by crosslinking the ectodomain of EGFR (Fig. 1 A), we selected Nbs, with high affinity and EGFR degradation potential, from distinct epitope groups-A1, A2, A6 (epitope A); B4, B5, B6 (epitope B); nanobody C; and D to construct a panel of biparatopic antibodies. These Nbs were tandemly linked in various configurations via a (G4S) 4 linker and fused to the N-terminus of a Fc fragment to generate homodimeric, biparatopic tetravalent EGFR-targeting antibodies (Fig. 1 B).In both H1975 and PC9 cells, these biparatopic antibodies elicited variable EGFR degradation, which correlated with reduced Y1068 phosphorylation and suppressed cell proliferation. (Fig. 1 C-E). Conversely, the tyrosine kinase inhibitor osimertinib inhibited EGFR phosphorylation and cell growth without causing its degradation (Fig. 1 C-E). Further analysis indicated that steric hindrance should be considered, as DC and CB5 exhibited better efficacy than CD and B5C, implying that Nbs D and C are preferably located at the N-terminus for optimal binding or EGFR crosslinking. Optimized triparatopic hexameric antibodies induce efficient EGFR degradation To further enhance the efficiency of antibody-mediated EGFR degradation, we constructed triparatopic antibodies following the biparatopic format by tandemly linking Nbs targeting three distinct epitopes to the N-terminus of the Fc fragment (Fig. 2 A). Among the constructs tested, DB5A1 demonstrated the greatest efficacy, driving degradation of both EGFR and pEGFR and potently suppressing proliferation of H1975 and PC9 cells (Fig. 2 B-D, Supplementary Fig. S3A-C). Consistent with our predictions, the third-generation TKI inhibitor osimertinib effectively suppressed EGFR phosphorylation and cell proliferation, confirming the sensitivity of the EGFR mutants in these cell lines, but did not induce EGFR degradation. The continuous synthesis of new EGFR, coupled with the co-degradation of antibodies with the receptor, suggests that antibody concentration may be a critical determinant for achieving sustained degradation. Therefore, we assessed the efficacy of DB5A1 over time and across a range of concentrations (Supplementary Fig. S4A). The degradation capacity of DB5A1 was both time- and dose-dependent and was inversely correlated with EGFR baseline expression levels at a fixed concentration (Supplementary Fig. S4B). Notably, treatment with 200 µg/mL DB5A1 inhibited cell proliferation by approximately 90% in PC9 cells and 80% in H1975 cells (Fig. 2 E, F). To further optimize DB5A1, we fused Nb-D and the B5A1 construct to the N- and C-terminus of Fc fragment, respectively, to potentially alleviate steric hindrance and promote EGFR degradation. However, these modified constructs failed to further enhance efficacy, suggesting that DB5A1 is inherently tolerant to spatial configuration and operates efficiently in its original structure (Fig. 2 G, I). Because cetuximab has a superior affinity and binds to a non-overlapping epitope relative to our Nbs (Supplementary Fig. S1 B, Fig. S2A, B and Fig. S5A-C), we next constructed triparatopic antibodies based on the cetuximab scaffold (Fig. 2 A). We initially constructed these by fusing Nbs to the N-terminus of the heavy chain or light chain of cetuximab. Although these constructs improved the capacity for EGFR degradation (Supplementary Fig. S3A-C), they also caused a significant decrease in the yield (data not shown) and showed a tendency to aggregate, which could pose pharmacokinetic problems in vivo . In addition, this design might diminish cetuximab's binding ability, as Nbs fused to the N-terminus of cetuximab heavy chain yielded poorer results, when comparing CB4Ce to CeCB4 (Supplementary Fig. S3A-C). Consequently, we constructed triparatopic antibodies by fusing the Nb constructs B6A1, CB4 or B5A1 to the C-terminus of the Fc fragment of cetuximab. The cetuximab-based triparatopic antibodies exhibited a stronger capacity for EGFR degradation than the parental triparatopic antibodies and DB5A1 (Fig. 2 G). Among them, Ce-Fc-B6A1 mediated the degradation of almost 80% of both total and phosphorylated EGFR and inhibited nearly 50% of cell proliferation in both H1975 and PC9 cells at a concentration of 5µg/mL (Fig. 2 G-I). The superior efficacy of Ce-Fc-B6A1 was also observed in the wild-type EGFR cell line A431 (Fig. 2 J, K). This effect might be attributed to its approximately eight-fold higher binding avidity to EGFR compared to DB5A1 (Supplementary Fig. S5B). However, avidity alone could not account for the strong degradation capacity, as parental cetuximab, which has minimal degradation activity, has an avidity approximately two-fold greater than that of DB5A1 (Supplementary Fig. S5B). Thus, we concluded that avidity and architecture (valency and paratope arrangement) interactively affect the capacity for antibody-mediated EGFR degradation. The multiparatopic antibodies maintain potent activity against EGFR mutants that confer resistance to third-generation TKIs As EGFR multiparatopic antibodies target the extracellular domain, we hypothesized that third-generation TKI-resistant on-target mutants, which primarily occur in the cytosolic kinase domain, might remain vulnerable to these antibodies. To test this, we established stable PC9 and H1975 cell lines overexpressing the most common acquired resistance EGFR mutant, C797S, based on their original mutational backgrounds. Our findings demonstrated that triparatopic antibodies effectively induced degradation of both total and phosphorylated EGFR, thereby inhibiting the growth of both PC9 C797S and H1975 C797S cell lines. As expected, osimertinib was unable to achieve similar results, given the C797S mutant's resistance to TKIs (Fig. 3 A-C). Interestingly, triparatopic antibodies efficiently mediated the degradation of EGFR but did not inhibit growth of H1975 C797S cells, whereas both effects were observed in the parental H1975 cells (Fig. 2 B, C, and Fig. 3 A, B). This unexpected phenomenon might be attributed to the artificial experimental conditions, particularly the high levels of EGFR overexpression. To evaluate antibody efficacy under more physiologically relevant settings, we generated PC9 cells carrying the endogenous EGFR C797S mutant using CRISPR/Cas9-mediated recombination into the EGFR locus and isolated osimertinib-resistant clones by dose-escalated osimertinib exposure (300 nM to 2 µM). In one validated clone 10B1 (Supplementary Fig. S6A, B), multiparatopic antibodies retained their ability to induce EGFR and pEGFR degradation, concomitantly inhibiting cell proliferation (Fig. 3 D, E). However, their efficacy was moderately reduced in the 10B1 clone relative to that of the parental PC9 cells. This reduction is likely a consequence of compensatory mutations in alternative metabolic pathways acquired during prolonged TKI exposure and selection [ 39 , 40 ]. These compensatory pathways may have diminished cellular reliance on EGFR signaling. Overall, these findings demonstrated that EGFR multiparatopic antibodies remain effective against tumors harboring the C797S mutation, a major driver of third-generation TKI resistance. Unlike conventional TKIs that competitively inhibit the kinase domain, multiparatopic antibodies operate through a distinct mechanism by inducing endocytic degradation of EGFR, suggesting their potential for combination therapy. Given that TKIs remain the first-line clinical agents for EGFR-mutant cancers, we hypothesized that combining them with multiparatopic antibodies might enhance overall treatment efficacy and mitigate EGFR on-target resistance. We evaluated this by combining a fixed concentration (5 µg/mL) of multiparatopic antibodies with a concentration gradient of osimertinib. Notably, as the inhibitory efficacy of osimertinib diminished at lower concentrations, the antiproliferative effect of the multiparatopic antibodies became increasingly prominent (Fig. 3 F, G). This suggests an additive effect, whereby the antibodies compensate for suboptimal TKI activity. A synergy analysis conducted using gradient concentrations of DB5A1 and osimertinib revealed combination index (CI) scores predominantly within the additive range (approximately − 10 to 10), indicating complementary activity between the multiparatopic antibody and TKI without evidence of strong antagonism or synergy (Supplementary Fig. S7A, B). Epitope-specific mechanism of multiparatopic antibodies in promoting efficient EGFR internalization and degradation To directly track the process of EGFR endocytosis induced by antibodies, we labeled multiparatopic antibodies, cetuximab, and a control antibody, CC6.30, targeting SARS-CoV2 spike protein [ 41 ], with a pH-sensitive fluorescent probe, pHrode™ Deep Red, through an NHS ester reaction with antibody amine groups. This probe shows increased fluorescence in acidic environments (pH < 6), allowing tracking of antibody-receptor complex internalization and subsequent acidification. When cells were treated with these labeled antibodies, multiparatopic antibodies induced faster and more efficient endocytosis than cetuximab, as indicated by the gradually enhanced fluoresence over time (Fig. 4 A, B, Supplementary Fig. S8A, B). This phenomenon was further confirmed by confocal imaging of PC9 cells treated with AF647-conjugated multiparatopic antibodies or cetuximab (Fig. 4 C-E, Supplementary Fig. S9A). As antibody internalization indirectly reflects receptor trafficking, we directly quantified the remaining surface EGFR using non-competing antibodies after incubation (Fig. 4 F, G). Multiparatopic antibodies caused a significant reduction in surface EGFR, with Ce-Fc-B6A1 yielding the lowest surface EGFR levels but lower endocytic fluorescence, indicating higher efficiency with reduced antibody consumption. This property was associated with enhanced degradation of EGFR and pEGFR and reduced cell proliferation. Collectively, these data indicated that multiparatopic antibodies accelerate and enhance EGFR endocytosis for degradation. To delineate the endocytic pathway responsible for antibody-mediated EGFR downregulation, we employed a panel of pharmacological inhibitors. Ammonium chloride (NH₄Cl), which neutralizes the pH of acidic cellular compartments, including endosome, efficiently abolished DB5A1-mediated degradation of both EGFR and pEGFR. The dynamin inhibitor prochlorperazine (PCZ) also significantly reduced degradation, whereas the clathrin inhibitor chlorpromazine (CPZ) exhibited a mild inhibitory effect (Fig. 5 A, Supplementary Fig. S10A-C). This differential inhibition pattern suggests a dynamin-dependent but largely clathrin-independent endocytic process, which requires further validation using genetic knockout approaches. The co-localization of endocytosed antibodies with the lysosomal marker LAMP2 further supports the conclusion that DB5A1 facilitates EGFR trafficking to the lysosome for subsequent degradation. (Fig. 5 B). To investigate the mechanism of multiparatopic antibody-induced EGFR degradation, anti-IgG (H + L) divalent F(ab')₂ fragments were used to mimic the clustering of EGFR induced by these multiparatopic antibodies. Intriguingly, we found that dimeric Nbs targeting epitopes C or D triggered endocytosis independently of F(ab')₂-mediated crosslinking, although F(ab')₂ crosslinking further enhanced the efficacy (Fig. 5 C). In contrast, cetuximab, despite its superior affinity, required F(ab')₂-mediated crosslinking to induce endocytosis (Fig. 5 C). These findings collectively demonstrated that the initiation of endocytosis is determined primarily by epitope specificity and multiparatopic architecture, rather than by binding affinity alone. Nbs targeting epitopes C and D likely possess intrinsic activity to promote endocytosis, which is further potentiated by multivalent binding (Fig. 5 C). This epitope-specific mechanism highlights the functional advantage of multiparatopic antibody designs in promoting efficient receptor internalization and degradation pathways. The triparatopic antibodies demonstrate superior antitumor efficacy in xenograft models To assess the in vivo efficacy of these multiparatopic antibodies, we employed a xenograft model in immunodeficient nude mice to investigate their direct antitumor effects. Nude mice lack a functional adaptive immune response but retain key components of their innate immune system, including phagocytic cells such as neutrophils and macrophages, and natural killer (NK) cells, which are able to mediate antibody-dependent cellular cytotoxicity (ADCC) and antibody-dependent cellular phagocytosis (ADCP). To minimize immune-related variables, we engineered the multiparatopic antibodies with human IgG1 Fc domains containing L234A, L235A, P329G (LALAPG) mutations, which abrogate Fcγ receptor binding, thereby largely abolishing ADCC and ADCP [ 42 ]. The experimental design for the in vivo study is shown in Fig. 6 A. For tumor establishment, H1975 and PC9 cells were subcutaneously implanted into the dorsal flank of 6-8-week-old nude mice. Treatment commenced on day 5 after cell inoculation, once tumors reached a volume of approximately 20–50 mm³. Mice received either 200 µg of antibody or 5 mg/kg osimertinib, administered intraperitoneally every two days. The results showed that the biparatopic antibody CB4 induced moderate tumor growth inhibition in H1975 xenografts, while cetuximab exhibited minimal and statistically insignificant effects. Notably, triparatopic antibodies DB5A1 and Ce-Fc-B6A1 demonstrated superior efficacy compared with CB4 and Ce-Fc-CB4, significantly outperforming osimertinib in H1975 models and leading to near-complete suppression of tumor growth (Fig. 6 B, E). While efficacy varied among xenograft models, Ce-Fc-B6A1 consistently inhibited PC9 tumor growth in vivo with potency comparable to that of osimertinib (Fig. 6 C, E). To address the pressing challenge of TKI resistance in clinical treatments for NSCLC driven by EGFR mutations, we evaluated the antibodies against PC9-10B1 xenografts, which express the TKI-resistant EGFR-C797S mutation. Under the same treatment conditions, Ce-Fc-B6A1 exhibited the strongest inhibitory effect on tumor growth, while osimertinib failed to show any efficacy (Fig. 6 D, E). Other tested antibodies displayed moderate antitumor activity. These findings collectively demonstrated that multiparatopic antibodies effectively suppress EGFR-driven lung tumor growth in vivo , including in models of TKI resistance. Antibody-mediated receptor clustering as a universal mechanism for triggering endocytosis and enhancing therapeutic targeting of EGFR and PD-L1 Receptor endocytosis triggered by clustering represents a fundamental mechanism of cellular regulation [ 43 – 47 ]. To evaluate the broad applicability of this strategy, we employed divalent F(ab') 2 anti-IgG (H + L) fragments to crosslink monoclonal antibodies targeting various cell surface receptors. Primary antibodies were conjugated to pH-sensitive fluorescent probes to monitor receptor internalization. Our results revealed that multiple receptors, including CD3, CD4, CD40, CD45, and MHC class I, undergo antibody-mediated endocytosis upon F(ab') 2 crosslinking in Jurkat T cells or Ramos B cells, (Fig. 7 A, B). In contrast, monovalent Fab fragments broadly inhibited internalization, likely due to steric interference with receptor clustering, a mechanism that requires further validation. Notably, antibodies with intrinsic endocytosis-inducing activiy, such as UCHT1 (anti-CD3) and rituximab (anti-CD20), exhibited reduced internalization when treated with either F(ab') 2 or Fab fragments, suggesting that their native bivalency is sufficient to drive clustering and receptor endocytosis. We next examined whether this mechanism extends to programmed death-ligand 1 (PD-L1), a key immune checkpoint that modulates tumor immune responses [ 48 – 51 ]. PD-L1 suppresses antigen-specific T cell activity through engagement of PD-1 on activated T cells [ 52 ]. Overexpression of PD-L1 in the tumor microenvironment has driven therapeutic development of antibodies that disrupt PD-1/PD-L1 interactions. We found that PD-L1 endocytosis increased in a time-dependent manner following F(ab') 2 crosslinking (Fig. 7 C). Importantly, this internalization led to PD-L1 degradation, implying that multiparatopic anti-PD-L1 antibodies could be designed to modulate immune function through target removal. Furthermore, co-crosslinking EGFR-targeted multiparatopic antibodies with PD-L1-directed monoclonal antibodies promoted concurrent degradation of PD-L1 in MDA-MB-231 and HCC827 cells (Fig. 7 D). these findings highlight the therapeutic potential of bispecific multiparatopic antibodies designed to concurrently target EGFR and PD-L1. Discussion Acquired resistance to EGFR tyrosine kinase inhibitors (TKIs) is a significant hurdle in the treatment of non-small cell lung cancer (NSCLC) [ 22 , 53 , 54 ]. While third-generation TKIs like osimertinib are effective against driver mutations, resistance inevitably emerges, often through secondary on-target mutations, tumor heterogeneity, and adaptive bypass mechanisms [ 54 – 58 ]. To combat the resistance arising from on-target EGFR secondary mutations and atypical mutations that are insensitive to TKIs, we developed a novel therapeutic strategy using multiparatopic antibodies that promote EGFR degradation by leveraging the cell’s natural endocytic pathway, a process independent of kinase-domain mutations that confer TKI resistance. Our strategy leverages the cellular homeostasis system, which internalizes and degrades aggregated membrane proteins via lysosomes to preserve plasma membrane fluidity and integrity [ 59 , 60 ]. We hypothesized that multiparatopic antibodies, by simultaneously engaging multiple distinct epitopes on EGFR, could induce receptor clustering, thereby accelerating endocytosis and ultimately driving lysosomal degradation. We validated this hypothesis by constructing a panel of biparatopic and triparatopic antibody formats. A key finding was that, unlike cetuximab, which requires secondary crosslinking for robust internalization, the multiparatopic antibodies intrinsically promoted efficient receptor clustering through spatially optimized paratope arrangements. This multivalency enhanced the innate ability of certain epitopes, such as recognized by Nb-C and D, to trigger endocytosis, highlighting that optimal nanobody placement is crucial for maximizing receptor degradation and suppression of downstream signaling, including phosphorylation at Y1068. Thus, it would be highly informative to determine the precise structural epitopes recognized by Nb- C and D through X-ray crystallography or cryo-EM in further study. The most potent construct, Ce-Fc-B6A1, was engineered by fusing the biparatopic Nb-B6A1 to the C-terminus of the cetuximab Fc scaffold. This construct induced robust degradation of both total and phosphorylated EGFR, resulting in significant inhibition of tumor cell proliferation in xenograft models of both TKI-sensitive and TKI-resistant NSCLC, including those harboring the C797S mutation. Notably, Ce-Fc-B6A1 also demonstrated superior efficacy in degrading wild-type EGFR and inhibiting tumor growth in models dependent on EGFR signaling. The structural format of Ce-Fc-B6A1 resembles that of clinically validated bispecific antibodies such as ivonescimab and cadonilimab, which have demonstrated favorable manufacturability and stability, suggesting that Ce-Fc-B6A1 is likely amenable to large-scale production [ 61 – 64 ]. Given cetuximab's approval and efficacy in treating EGFR-amplified, RAS wild-type metastatic colorectal cancer, and head and neck squamous cell carcinoma [ 65 – 68 ], an optimized version of Ce-Fc-B6A1 could also represent a promising therapeutic candidate for these malignancies, potentially offering enhanced efficacy through its potent degradation mechanism. The function of Ce-Fc-B6A1 in targeted EGFR degradation is reminiscent of lysosome-targeting chimeras (LYTACs), a type of targeted-protein degradation (TPD) technology that uses lysosomal-targeting receptors (LTRs) such as cation-independent mannose-6-phosphate receptor (CI-M6PR) [ 29 ], asialoglycoprotein receptor (ASGPR) [ 30 ], membrane-anchored E3 ubiquitin ligases [ 69 , 70 ], or cytokine receptors [ 31 ] to direct proteins toward lysosomal degradation. However, unlike LYTACs, our approach leverages multiparatopic antibodies, such as Ce-Fc-B6A1 or DB5A1, that bind multiple epitopes on the target protein, thereby inducing receptor clustering and triggering internalization and lysosomal degradation without relying on external LTRs. By excluding an external adaptor, our platform avoids challenges like adaptor co-degradation or receptor saturation, which may limit the efficacy of LYTAC systems. Additionally, LYTACs require complex engineering to achieve stable LTR binding, creating hurdles for scalability and cost-effective manufacturing. Relative to PROTACs, which degrade intracellular proteins via the ubiquitin-proteasome system and require both cell permeability and E3 ligase recruitment, our method specifically targets cell-surface proteins and bypasses the need for intracellular delivery mechanisms. A limitation of our approach is its restriction to cell-surface proteins that undergo active endocytosis, an issue less relevant for LYTACs. In addition, Unlike PROTACs, which can target a broad range of intracellular proteins, the success of our multiparatopic antibody strategy hinges on epitope specificity and the susceptibility of the target protein to clustering-induced internalization and degradation. This dependency requires extensive screening, which may not be practical for all targets. In summary, the multiparatopic antibody-mediated lysosomal degradation mechanism offers a streamlined and complementary option for targeting cell-surface proteins. By functioning independently of LTRs, our approach likely mitigates challenges observed with LYTAC and PROTAC systems while providing a focused solution for receptor-driven degradation. Unlike conventional TKIs, which inhibit EGFR kinase activity but leave the receptor intact, the multiparatopic antibodies exploit the natural receptor-mediated endocytosis pathway to achieve efficient lysosomal degradation of EGFR. This mechanistic difference enables broad-spectrum signaling suppression and targets diverse kinase-domain mutations, as validated both in engineered overexpression systems and, more importantly, in an endogenous C797S mutant model derived under TKI selection pressure, closely mirroring the clinical scenario of acquired resistance. The additive effect observed when combined with standard-of-care TKIs, such as osimertinib, suggests a promising clinical strategy to enhance depth of response and delay or prevent resistance. Furthermore, our results indicated that antibody-mediated crosslinking also induces the endocytosis and degradation of other cell-surface proteins, most notably PD-L1. These findings underscore the potential for developing bispecific multiparatopic antibodies capable of simultaneously degrading oncogenic drivers such as EGFR and immunosuppressive proteins like PD-L1, offering a synergistic strategy to target both the tumor and its immunosuppressive microenvironment. For clinical translation, future work will focus on humanizing the lead nanobodies and performing affinity maturation to optimize pharmacokinetic properties and safety profiles. Given that several HER2 biparatopic antibody-drug conjugates (ADCs) are in clinical developments that exploit rapid internalization for enhanced tumor-specific payload delivery [ 71 , 72 ], Ce-Fc-B6A1-based ADCs may similarly leverage this mechanism to improve therapeutic efficacy for EGFR-driven cancers. Collectively, we have established a versatile and potent antibody-based degradation platform that overcomes on-target TKI resistance by directly eliminating the oncoprotein. This mechanistically distinct approach, which is likely effective across a broad spectrum of EGFR mutants and synergizes with existing TKIs, represents a promising alternative strategy for treating EGFR-driven cancers. Materials and methods Cell culture H1975, PC9, HCC827 cells were maintained in RPMI 1640 medium (Thermofisher) containing 10% (v/v) heat-inactivated foetal bovine serum (FBS, Bio-Channel, BC-SE-FBS07), 1% (v/v) of Penicillin-Streptomycin (Thermofisher, 15140122); MC38, A431, A549, MDA-MB-231 cells were maintained in Dulbecco’s modified Eagle’s medium (Thermofisher, C11995500CP) with 10% (v/v) of FBS and 1% (v/v) of Penicillin-Streptomycin. Jurkat, Ramos cells were maintained in RPMI 1640 medium containing 10% (v/v) FBS, 1% (v/v) Penicillin-Streptomycin and 50 µM 2-Mercaptoethanol. Expi293F were culture in serum free 293F Hi-exp medium (OPM Biosciences, AC601501). Phage display–based discovery of EGFR nanobodies Immunization and sample collection:To generate EGFR-specific nanobodies (VHHs), two adult alpacas were immunized with recombinant human EGFR extracellular domain (EGFR-ECD, His-tagged). The antigen was emulsified with complete Freund’s adjuvant for the primary immunization and with incomplete Freund’s adjuvant for subsequent boosts. Animals received 5 injections at 2–3 week intervals. Peripheral blood was collected 7 days after the final boost, and peripheral blood mononuclear cells (PBMCs) were isolated by density gradient centrifugation for RNA extraction. (2) VHH library construction: Total RNA was extracted from PBMCs using TRIzol reagent, and first-strand cDNA was synthesized using oligo(dT) primers. The VHH fragments were amplified by nested PCR with framework-specific primers. Purified PCR products were cloned into a phagemid vector (pComb-3XSS) downstream of the gene encoding the minor coat protein pIII, enabling display of VHHs on M13 filamentous phage particles. The recombinant plasmids were electroporated into E. coli TG1 cells, generating a library with a complexity of approximately 10 8 -10 9 independent transformants. The library was rescued by superinfection with M13KO7 helper phage to produce VHH-displaying phage particles. (3) Biopanning and enrichment of EGFR binders: Recombinant EGFR-ECD-His protein was used as the target antigen for phage display selection. The antigen (50 µg per tube for the first round, gradually reduced to 10–30 µg per tube in later rounds) was immobilized on high-binding Immuno Tubes. After blocking with 3% BSA or Milk, the phage library was incubated with the immobilized antigen, followed by extensive washing with PBST (PBS + 0.1% Tween-20) to remove nonspecific binders. Bound phages were eluted with 0.1 M triethylamine solution, neutralized by 1 M Tris-HCl(pH7.5), and used to infect E. coli TG1 cells for amplification and subsequent pannings. Negative selection using BSA- or irrelevant protein–coated Immuno Tubes was included to eliminate nonspecific binders. Typically, two to three rounds of biopanning were performed, progressively increasing washing stringency. (4) Screening and sequence analysis of positive clones: After the final panning round, individual bacterial colonies were screened by monoclonal phage ELISA against immobilized EGFR-ECD-His protein, using irrelevant proteins as controls. Positive clones were sequenced to identify unique VHH genes, and sequence alignment was performed to analyze framework regions and complementarity-determining regions (CDRs). Nonredundant clones representing distinct sequence families were selected for further characterization. Protein expression and purification All antibodies and EGFR-ECD-His protein were expressed in Expi293F cells. Briefly, plasmids encoding antibodies or EGFR-HIS were mixed with (PEI, BIOHUB, 49553-93-7) at a 3:1 mass ratio and incubated for 15 mins at room temperature before adding to Expi293F cells. Then, fresh medium (20% of total volume) and valproic acid (final concentration 3 mM) were added to the transfected Expi293F cells 24 hours post transfection. The culture supernatants containing the secreted recombinant proteins were harvested and purified with either Protein G Resin (GenScript, L00209-50) or Ni-NTA Resin (GenScript, L00885-50) for IgGs or His taged proteins, respectively. The culture supernatants containing antibodies were incubated with Protein G Resin at 4 ℃ for 1 hr before loading into the columns, then washed with wash buffer (25 mM Tris, 150 mM NaCl, pH 7.2) and eluted with elution buffer (0.1 M glycine, pH 2.5) into 10% volume of neutralization buffer (1 M Tris, pH 9). The culture supernatants containing EGFR-ECD-His protein were incubated with Ni-NTA Resin, washed with wash buffer (100mM NaH 2 PO 4 , 10mM Tris, 10mM Imidazole) and eluted with elution buffer (100mM NaH 2 PO 4 , 10mM Tris, 550mM Imidazole). The buffer of the proteins was exchanged into 1× PBS, stored in fridge at 4°C, or immediately frozen in liquid nitrogen and stored in a freezer at -80°C Flow cytometry analysis Tumor cells were harvested and single-cell suspensions were generated for staining with indicated antibodies at 5 µg/mL for 20 min at 4 ℃. After further staining with FITC-anti-mouse IgG(H + L) (Thermofisher, A16091), cells were performed on a Cytek Aurora (Cytek Biosciences) equipment, and analyzed with FlowJo software. Enzyme-linked immunosorbent assay EGFR-ECD-His protein was coated onto high-binding 96-well plates (BIOFIL, FEP100096) at 2 µg/mL diluted in 1×PBS overnight at 4 ℃. After washing 3 times with 1×PBS + 0.05% Tween-20 (PBST), plates were blocked with 3% (w/v) BSA in 1×PBS at room temperature for 1 h, then washed 3 times with PBST. For standard ELISA, serially diluted antibodies (starting at 10 µg/mL, 3× down, 50 µL/well diluted in PBST + 1% (w/v) BSA) were added into wells and incubated at room temperature for 1 h. For competitive ELISA, unconjugated blocking antibodies (20 µg/mL, 50 µL/well diluted in PBST + 1% (w/v) BSA) were added into wells and incubated at room temperature for 1 h before adding the biotin-conjugated detection antibodies (2 µg/mL, 50 µL/well diluted in PBST + 1% (w/v) BSA) into wells and incubated at room temperature for 1 h. After washing 3 times with PBST, alkaline phosphatase (AP)-conjugated goat anti-mouse IgG(H + L) (Jackson ImmunoResearch, 115-055-146, 1:5,000 dilution) or horseradish peroxidase (HRP) conjugated Streptavidin (Jackson ImmunoResearch, 016-030-084, 1:2,0000 dilution) was diluted in PBST + 1% (w/v) BSA and then added into wells at room temperature for 1 h. Plates were washed 3 times with PBST. For standard ELISA, phosphatase substrate (ThermoFisher, 34047) was added into wells and plates were read for absorbance at 405 nm. For competitive ELISA, enhanced chemiluminescence (ECL, NCM Biotech, P10300) solution was added into wells and plates were read for chemiluminescence. Western blotting Cells were lysed in RIPA (Beyotime, P0013B) lysis buffer supplemented with 1mM PMSF (Sangon Biotech, A100754) for 30 min on ice. After centrifugation at 13,000 rpm for 20 min at 4 ℃, the supernatants were collected and protein concentrations were determined using Pierce BCA protein assay kit (ThermoFisher, 23227) according to the manufacturer’s protocol. Samples were mixed with 6×SDS-PAGE loading buffer, then 5 µg of samples were subjected to 10% SDS-PAGE gels and transferred to PVDF membrane (Millipore, IPVH00010). The membranes were blocked for 1 h in TBST buffer (20 mM Tris-HCl, 150 mM NaCl, 0.1% (v/v) Tween-20) containing 5% (w/v) milk, and then incubated with primary antibodies (diluted in TBST with 3% BSA) on a shaker at 4 ℃ overnight. The membranes were washed 3 times with TBST buffer before incubating with HRP-conjugated secondary antibodies for 1 h at room temperature with shaking. All secondary antibodies, either HRP-conjugated goat anti-mouse IgG(H + L) (Jackson ImmunoResearch, 115-035-003) or HRP-conjugated goat anti-rabbit IgG(H + L) (Jackson ImmunoResearch, 115-035-144) were diluted in TBST buffer with 5% (w/v) milk at a dilution of 1:5,000 to 1:10,000. The membranes were washed 3 times with TBST before visualizing using enhanced chemiluminescence (ECL) on Amersham ImageQuant™ 800 (Cytiva). The relative expression of specific protein was determined following quantification of band intensities by using ImageJ, normalized to GAPDH after normalizing to the nontreated group as control. Following primary antibodies were used: EGF Receptor Rabbit mAb (Cell Signaling Technology, 4267), Phospho-EGF Receptor (Tyr1068) Rabbit mAb (Cell Signaling Technology, 3777), PD-L1 Rabbit mAb (Cell Signaling Technology, 13684), GAPDH Mouse mAb (Proteintech, 60004-1-Ig). Cell proliferation assay All H1975 or PC9 cells were seeded at a density of 1,000 cells/well in 96-well white plates, incubated with the antibodies or osimertinib in incubator at 37 ℃ under 5% CO 2 . Cell viability was assessed on day 5 using ATP luminescent cell viability assay kit (YEASEN Biotechnology, 40210ES60) according to the manufacturer’s protocol. Briefly, the plates were washed with 1×PBS after dumping medium. Then, 100 µL reagent per well was added and incubated for 10 min at room temperature, and then plates were read for luminescence. pH-sensitive probe labeling and endocytosis assay According to the manufacturer’s instructions, antibodies were conjugated with pHrodo Deep Red TFP Ester (Thermo Fisher, P35359), a pH-sensitive dye that exhibits strong fluorescence only in acidic compartments such as lysosomes and late endosomes. In endocytosis assays, cells were treated with the pHrodo-labeled antibodies at a concentration of 5 µg/mL and incubated at 37°C under 5% CO₂ for the specified durations. In crosslinking-induced endocytosis assays, 5 µg/mL of either monovalent Fab (Jackson ImmunoResearch, 115-007-003) or divalent F(ab') 2 anti-IgG (H + L) fragments (Jackson ImmunoResearch, 115-006-003) were added. To assess the left surface EGFR levels, cells were incubated with unlabeled antibodies for varying times, followed by staining with a non-competing AF647-conjugated anti-EGFR antibody. Cells were then harvested and analyzed by flow cytometry. The percentage of surface EGFR was normalized to that of the untreated control group. Generation of the osimertinib-resistant cell line The osimertinib-resistant cell lines were established using the CRISPR/Cas9 genome editing system to introduce the EGFR C797S mutation into the PC9 cell line. A previously validated EGFR-specific guide RNA (sgRNA: GTTCCCGGACATAGTCC AGG)[ 73 ] was used and co-expressed with Cas9 protein from an all-in-one CRISPR/Cas9 vector. The single-stranded DNA (ssDNA) donor template (C*C*T*C*CACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTCTCTCCTGGACTATGTCCGGGAACACAAAGACAATATTGGCTCCCAGTACCTG*C*T*C*A, synthesized in GenScript, * indicating phosphorothioate modification to prevent degradation by cytosolic nucleases) was co-transfected with the CRISPR/Cas9-sgRNA plasmid into PC9 cells using PEI. Following transfection, cells were selected with puromycin and osimertinib to enrich successfully edited populations. Surviving cells were then single-cell sorted via flow cytometry into 96-well plates. Individual clones were expanded and screened for EGFR phosphorylation status by western blot. To confirm the mutation genotype, genomic DNA was amplified by PCR using a primer pair (forward: CAGCTCATGCCCTTCGGCAGTTTA; reverse: GACATCACTCTGG TGGGTATAGATTC). The PCR products were cloned into a vector, transformed into E. coli , and multiple single colonies were picked up for Sanger sequencing. Antibody binding kinetics measured by Surface Plasmon Resonance (SPR) The binding kinetics of antibodies to EGFR-ECD-His proteinwere analyzed using SPR (Biacore 8K, Cytiva). Specifically, antibody was dissolved to 4 ug/mL with PBS-P + running buffer (0.2 M phosphate buffer, 27 mM KCl and 1.37 M NaCl, 0.5% Surfactant P20) and captured by protein A chip (contact time 30s), and then serial dilutions of EGFR-ECD-His protein with highest concentration of 400 nM were run at a flow rate of 30 µL/min in PBS-P + buffer (flow rate: 30 µL/min; contact time: 180 s; dissociation time: 300 s). The resulting data were fitted to a 1:1 binding model using the Biacore 8K Evaluation software (Cytiva). Confocal microscope imaging PC9 cells were seeded in a 35 mm glass-bottomed microwell dish (Cellvis, D35C4-20-1.5-N) and cultured for 24 hours. Then, the cells were incubated with AF647-conjugated antibodies (5 µg/mL) and Abflo594-labeled LAMP2 antibody (1:200 dilution; Abclonal, A24189) at 37°C for varying durations. After incubation, the cells were washed with PBS and fixed with 4% paraformaldehyde (PFA). Nuclei were stained with DAPI (BioFroxx, 1155MG010) for 15 minutes at 4°C, followed by additional PBS washes. Fluorescence imaging was performed using a confocal microscope (Olympus IXplore SpinSR). Tumor xenograft mouse models H1975 cells (2 × 10 6 ), PC9 cells (1 × 10 6 ) or 10B1 cells (1 × 10 6 ) were suspended in 200 µL of RPMI 1640 medium (ThermoFisher) and injected subcutaneously into the right flank of 6-week-old sterile female nude mice (GemPharmatech). When tumor volumes reached approximately 20–50 mm³ at day 5, the animals were randomly divided into 6 or 7 groups (for each group, n ≥ 7). The following treatments were administered intraperitoneally (i.p.) every two days for a total of nine injections: antibodies (200 µg per mouse in 200 µL PBS) or osimertinib (5 mg/kg) dissolved in a vehicle containing 5% DMSO, 40% PEG300, and 5% Tween-80 in ddH₂O (200 µL per injection). Tumor dimensions were measured every two days from day 5 to 23, and tumor volumes were calculated using the formula: volume = ½ × length × width². Throughout the study, no tumor volume exceeded 2000 mm³. Declarations Ethics statement All animal experiments complied with relevant ethical regulations and were approved by the Committee for Animal Welfare at Zhejiang University (ZJU20220455). Competing interests: Authors declare no competing interests. Funding: The Ministry of Science and Technology of China 2022YFA1305800 (WJS, DLH, XLZ ) The Ministry of Science and Technology of China 2022YFA1206400 (YHY, DLH, XJP ) The Eleventh Batch of the “Double Hundred Talent Program for Innovation and Entrepreneurship” of Xiamen City (YJL) Author Contributions: C.L. designed the study, performed experiments, analyzed data, and wrote the manuscript. J.L. wrote the manuscript. J.N. performed experiments and andanalyzed data. D.C., Y.L., W.Z. and Y.S. provided key reagents and advice. Y.W., Y.G. and S.Z. performed experiments. W.M. provided key reagents, equipment and advice. D.H. and Y.L. conceived and supervised the study, wrote the manuscript, and provided funding. Acknowledgments: We thank the core facility of the Life Sciences Institute for technical assistance. We gratefully acknowledge the support of Sanling Wu, YiLin Sun for SPR experiment assistance and omics platform from Analysis Center of Agrobiology and Environmental Sciences, Zhejiang University. Data Availability Statement: All data is available in the main text or the supplementary materials. References Herbst RS. Review of epidermal growth factor receptor biology. Int J Radiat Oncol Biol Phys 2004; 59: 21–26. Sabbah DA, Hajjo R, Sweidan K. Review on Epidermal Growth Factor Receptor (EGFR) Structure, Signaling Pathways, Interactions, and Recent Updates of EGFR Inhibitors. Sigismund S, Avanzato D, Lanzetti L. Emerging functions of the EGFR in cancer. Mol Oncol 2018; 12: 3–20. Kumagai S, Koyama S, Nishikawa H. Antitumour immunity regulated by aberrant ERBB family signalling. Nature Reviews Cancer 2021; 21: 181–197. Leonetti A, Assaraf YG, Veltsista PD, El Hassouni B, Tiseo M, Giovannetti E. MicroRNAs as a drug resistance mechanism to targeted therapies in EGFR-mutated NSCLC: Current implications and future directions. Drug Resistance Updates 2019; 42: 1–11. Pao W, Chmielecki J. Rational, biologically based treatment of EGFR-mutant non-small-cell lung cancer. Nature Reviews Cancer 2010; 10: 760–774. Gridelli C, Rossi A, Carbone DP, Guarize J, Karachaliou N, Mok T et al . Non-small-cell lung cancer. Nature Reviews Disease Primers 2015; 1: 15009. Fujino S, Enokibori T, Tezuka N, Asada Y, Inoue S, Kato H et al . A comparison of epidermal growth factor receptor levels and other prognostic parameters in non-small cell lung cancer. European Journal of Cancer 1996; 32: 2070–2074. Sharma SV, Bell DW, Settleman J, Haber DA. Epidermal growth factor receptor mutations in lung cancer. Nature Reviews Cancer 2007; 7: 169–181. Robichaux JP, Le X, Vijayan RSK, Hicks JK, Heeke S, Elamin YY et al . Structure-based classification predicts drug response in EGFR-mutant NSCLC. Nature 2021; 597: 732–737. Cataldo Vince D, Gibbons Don L, Pérez-Soler R, Quintás-Cardama A. Treatment of Non–Small-Cell Lung Cancer with Erlotinib or Gefitinib. New England Journal of Medicine 364: 947–955. Yang JC-H, Wu Y-L, Schuler M, Sebastian M, Popat S, Yamamoto N et al . Afatinib versus cisplatin-based chemotherapy for EGFR mutation-positive lung adenocarcinoma (LUX-Lung 3 and LUX-Lung 6): analysis of overall survival data from two randomised, phase 3 trials. The Lancet Oncology 2015; 16: 141–151. Berz D, Raymond VM, Garst JH, Erlander MG. Non-invasive urine testing of EGFR activating mutation and T790M resistance mutation in non-small cell lung cancer. Experimental Hematology & Oncology 2016; 5: 24. Huang L, Fu L. Mechanisms of resistance to EGFR tyrosine kinase inhibitors. Acta Pharmaceutica Sinica B 2015; 5: 390–401. Kobayashi S, Boggon Titus J, Dayaram T, Jänne Pasi A, Kocher O, Meyerson M et al . EGFR Mutation and Resistance of Non–Small-Cell Lung Cancer to Gefitinib. New England Journal of Medicine 352: 786–792. Ramalingam Suresh S, Vansteenkiste J, Planchard D, Cho Byoung C, Gray Jhanelle E, Ohe Y et al . Overall Survival with Osimertinib in Untreated, EGFR-Mutated Advanced NSCLC. New England Journal of Medicine 2020; 382: 41–50. Soria J-C, Ohe Y, Vansteenkiste J, Reungwetwattana T, Chewaskulyong B, Lee Ki H et al . Osimertinib in Untreated EGFR-Mutated Advanced Non–Small-Cell Lung Cancer. New England Journal of Medicine 2018; 378: 113–125. Zhou W, Ercan D, Chen L, Yun C-H, Li D, Capelletti M et al . Novel mutant-selective EGFR kinase inhibitors against EGFR T790M. Nature 2009; 462: 1070–1074. Thress KS, Paweletz CP, Felip E, Cho BC, Stetson D, Dougherty B et al . Acquired EGFR C797S mutation mediates resistance to AZD9291 in non–small cell lung cancer harboring EGFR T790M. Nature Medicine 2015; 21: 560–562. Yu HA, Tian SK, Drilon AE, Borsu L, Riely GJ, Arcila ME et al . Acquired Resistance of EGFR-Mutant Lung Cancer to a T790M-Specific EGFR Inhibitor: Emergence of a Third Mutation (C797S) in the EGFR Tyrosine Kinase Domain. JAMA Oncology 2015; 1: 982–984. Niederst MJ, Hu H, Mulvey HE, Lockerman EL, Garcia AR, Piotrowska Z et al . The Allelic Context of the C797S Mutation Acquired upon Treatment with Third-Generation EGFR Inhibitors Impacts Sensitivity to Subsequent Treatment Strategies. Planchard D, Loriot Y, André F, Gobert A, Auger N, Lacroix L et al . EGFR-independent mechanisms of acquired resistance to AZD9291 in EGFR T790M-positive NSCLC patients. Annals of Oncology 2015; 26: 2073–2078. Su C, Sun SY. Fourth-generation epidermal growth factor receptor-tyrosine kinases inhibitors: hope and challenges. Corvaja C, Passaro A, Attili I, Aliaga PT, Spitaleri G, Signore ED et al . Advancements in fourth-generation EGFR TKIs in EGFR-mutant NSCLC: Bridging biological insights and therapeutic development. Cancer Treatment Reviews 2024; 130. Békés M, Langley DR, Crews CM. PROTAC targeted protein degraders: the past is prologue. Nature Reviews Drug Discovery 2022; 21: 181–200. Hinterndorfer M, Spiteri VA, Ciulli A, Winter GE. Targeted protein degradation for cancer therapy. Nature Reviews Cancer 2025. Sakamoto KM, Kim Kb Fau - Kumagai A, Kumagai A Fau - Mercurio F, Mercurio F Fau - Crews CM, Crews Cm Fau - Deshaies RJ, Deshaies RJ. Protacs: chimeric molecules that target proteins to the Skp1-Cullin-F box complex for ubiquitination and degradation. Clift D, McEwan WA, Labzin LI, Konieczny V, Mogessie B, James LC et al . A Method for the Acute and Rapid Degradation of Endogenous Proteins. Cell 2017; 171: 1692–1706.e1618. Banik SM, Pedram K, Wisnovsky S, Ahn G, Riley NM, Bertozzi CR. Lysosome-targeting chimaeras for degradation of extracellular proteins. Nature 2020; 584: 291–297. Ahn G, Banik SM, Miller CL, Riley NM, Cochran JR, Bertozzi CR. LYTACs that engage the asialoglycoprotein receptor for targeted protein degradation. Nature Chemical Biology 2021; 17: 937–946. Pance K, Gramespacher JA, Byrnes JR, Salangsang F, Serrano J-AC, Cotton AD et al . Modular cytokine receptor-targeting chimeras for targeted degradation of cell surface and extracellular proteins. Nature Biotechnology 2023; 41: 273–281. Huang B, Abedi M, Ahn G, Coventry B, Sappington I, Tang C et al . Designed endocytosis-inducing proteins degrade targets and amplify signals. Nature 2025; 638: 796–804. Abella JV, Park M. Breakdown of endocytosis in the oncogenic activation of receptor tyrosine kinases. Wells A, Welsh Jb Fau - Lazar CS, Lazar Cs Fau - Wiley HS, Wiley Hs Fau - Gill GN, Gill Gn Fau - Rosenfeld MG, Rosenfeld MG. Ligand-induced transformation by a noninternalizing epidermal growth factor receptor. Li JY, Perry SR, Muniz-Medina V, Wang X, Wetzel LK, Rebelatto MC et al . A Biparatopic HER2-Targeting Antibody-Drug Conjugate Induces Tumor Regression in Primary Models Refractory to or Ineligible for HER2-Targeted Therapy. Cancer Cell 2016; 29: 117–129. Kast F, Schwill M, Stüber JC, Pfundstein S, Nagy-Davidescu G, Rodríguez JMM et al . Engineering an anti-HER2 biparatopic antibody with a multimodal mechanism of action. Nature Communications 2021; 12: 3790. Kelton C, Wesolowski JS, Soloviev M, Schweickhardt R, Fischer D, Kurosawa E et al . Anti-EGFR biparatopic-SEED antibody has enhanced combination-activity in a single molecule. Archives of Biochemistry and Biophysics 2012; 526: 219–225. Sunada H, Magun BE, Mendelsohn J, MacLeod CL. Monoclonal antibody against epidermal growth factor receptor is internalized without stimulating receptor phosphorylation. Proceedings of the National Academy of Sciences 1986; 83: 3825–3829. Nishihara S, Yamaoka T, Ishikawa F, Ohmori T, Ando K, Kusumoto S et al . Diverse Mechanisms of Resistance against Osimertinib, a Third-Generation EGFR-TKI, in Lung Adenocarcinoma Cells with an EGFR-Activating Mutation. Cells 2022; doi: 10.3390/cells11142201 . Ríos-Hoyo A, Moliner L, Arriola E. Acquired Mechanisms of Resistance to Osimertinib—The Next Challenge. Cancers 2022; doi: 10.3390/cancers14081931 . Rogers TF, Zhao F, Huang D, Beutler N, Burns A, He W-t et al . Isolation of potent SARS-CoV-2 neutralizing antibodies and protection from disease in a small animal model. Science 2020; 369: 956–963. Schlothauer T, Herter S, Koller CF, Grau-Richards S, Steinhart V, Spick C et al . Novel human IgG1 and IgG4 Fc-engineered antibodies with completely abolished immune effector functions. Protein Engineering, Design and Selection 2016; 29: 457–466. von Zastrow M, Sorkin A. Mechanisms for Regulating and Organizing Receptor Signaling by Endocytosis. Annual Review of Biochemistry 2021; 90: 709–737. Sigismund S, Confalonieri S, Ciliberto A, Polo S, Scita G, Di Fiore PP. Endocytosis and Signaling: Cell Logistics Shape the Eukaryotic Cell Plan. Physiological Reviews 2012; 92: 273–366. Li M, Yu Y. Innate immune receptor clustering and its role in immune regulation. Journal of Cell Science 2021; 134: jcs249318. Domínguez CM, Niemeyer CM. Clustering of Membrane Receptors: Insights from DNA Origami-Based Approaches. Small 2025; 21: 2503543. Paul D, Stern O, Vallis Y, Dhillon J, Buchanan A, McMahon H. Cell surface protein aggregation triggers endocytosis to maintain plasma membrane proteostasis. Nature Communications 2023; 14: 947. Keir ME, Butte MJ, Freeman GJ, Sharpe AH. PD-1 and Its Ligands in Tolerance and Immunity. Annual Review of Immunology 2008; 26: 677–704. Zou W, Chen L. Inhibitory B7-family molecules in the tumour microenvironment. Nature Reviews Immunology 2008; 8: 467–477. Cherif B, Triki H, Charfi S, Bouzidi L, Kridis WB, Khanfir A et al . Immune checkpoint molecules B7-H6 and PD-L1 co-pattern the tumor inflammatory microenvironment in human breast cancer. Scientific Reports 2021; 11: 7550. Smit EF, van den Heuvel MM. PD-L1 in non-small-cell lung cancer: the third target for immunotherapy. The Lancet 2016; 387: 1795–1796. Liu R, Li H-F, Li S. PD-1-mediated inhibition of T cell activation: Mechanisms and strategies for cancer combination immunotherapy. Cell Insight 2024; 3: 100146. Jackman D, Pao W, Riely GJ, Engelman JA, Kris MG, Jänne PA et al . Clinical Definition of Acquired Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Non–Small-Cell Lung Cancer. Journal of Clinical Oncology 2009; 28: 357–360. Liu Q, Yu S, Zhao W, Qin S, Chu Q, Wu K. EGFR-TKIs resistance via EGFR-independent signaling pathways. Molecular Cancer 2018; 17: 53. Ou X, Gao G, Habaz IA, Wang Y. Mechanisms of resistance to tyrosine kinase inhibitor-targeted therapy and overcoming strategies. MedComm 2024; 5: e694. Wu D, Sun Q, Tang H, Xiao H, Luo J, Ouyang L et al . Acquired resistance to tyrosine kinase targeted therapy: mechanism and tackling strategies. Drug Resistance Updates 2025; 78: 101176. Zhang J, Vokes N, Li M, Xu J, Bai H, Wang J et al . Overcoming EGFR-TKI resistance by targeting the tumor microenvironment. Chinese Medical Journal Pulmonary and Critical Care Medicine 2024; 2: 151–161. Leonetti A, Sharma S, Minari R, Perego P, Giovannetti E, Tiseo M. Resistance mechanisms to osimertinib in EGFR-mutated non-small cell lung cancer. British Journal of Cancer 2019; 121: 725–737. Radulovic M, Yang C, Stenmark H. Lysosomal membrane homeostasis and its importance in physiology and disease. Nature Reviews Molecular Cell Biology 2025. Jackson Matthew P, Hewitt Eric W. Cellular proteostasis: degradation of misfolded proteins by lysosomes. Essays in Biochemistry 2016; 60: 173–180. Shan KS, Musleh Ud Din S, Dalal S, Gonzalez T, Dalal M, Ferraro P et al . Bispecific Antibodies in Solid Tumors: Advances and Challenges. International Journal of Molecular Sciences 2025; doi: 10.3390/ijms26125838 . Wang C, Huang H, Song Z, Li Z, Huang J, Cao L et al . A novel bispecific antibody CVL006 superior to AK112 for dual targeting of PD-L1 and VEGF in cancer therapy. Antibody Therapeutics 2025; 8: 189–196. Zhong T, Zhang L, Huang Z, Pang X, Jin C, Liu W et al . Design of a fragment crystallizable-engineered tetravalent bispecific antibody targeting programmed cell death-1 and vascular endothelial growth factor with cooperative biological effects. iScience 2025; 28: 111722. Pang X, Huang Z, Zhong T, Zhang P, Wang ZM, Xia M et al . Cadonilimab, a tetravalent PD-1/CTLA-4 bispecific antibody with trans-binding and enhanced target binding avidity. mAbs 2023; 15: 2180794. Blick SKA, Scott LJ. Cetuximab. Drugs 2007; 67: 2585–2607. Zheng B, Wang X, Wei M, Wang Q, Li J, Bi L et al . First-line cetuximab versus bevacizumab for RAS and BRAF wild-type metastatic colorectal cancer: a systematic review and meta-analysis. BMC Cancer 2019; 19: 280. Jonker Derek J, O'Callaghan Chris J, Karapetis Christos S, Zalcberg John R, Tu D, Au H-J et al . Cetuximab for the Treatment of Colorectal Cancer. New England Journal of Medicine 357: 2040–2048. Muraro E, Fanetti G, Lupato V, Giacomarra V, Steffan A, Gobitti C et al . Cetuximab in locally advanced head and neck squamous cell carcinoma: Biological mechanisms involved in efficacy, toxicity and resistance. Critical Reviews in Oncology/Hematology 2021; 164: 103424. Marei H, Tsai W-TK, Kee Y-S, Ruiz K, He J, Cox C et al . Antibody targeting of E3 ubiquitin ligases for receptor degradation. Nature 2022; 610: 182–189. Cotton AD, Nguyen DP, Gramespacher JA, Seiple IB, Wells JA. Development of Antibody-Based PROTACs for the Degradation of the Cell-Surface Immune Checkpoint Protein PD-L1. Journal of the American Chemical Society 2021; 143: 593–598. Lewis GD, Li G, Guo J, Yu S-F, Fields CT, Lee G et al . The HER2-directed antibody-drug conjugate DHES0815A in advanced and/or metastatic breast cancer: preclinical characterization and phase 1 trial results. Nature Communications 2024; 15: 466. Liu D, Liu B, Li Z, Gao B, Zhang X, Ruan J et al . A pooled analysis of JSKN003, a biparatopic anti-HER2 antibody conjugate (ADC), in patients with advanced HER2-overexpressing (IHC 3+) gastrointestinal tumors. Journal of Clinical Oncology 2025; 43: 3022–3022. Wang T-H, Wu C-C, Huang K-Y, Leu Y-L, Yang S-C, Chen C-L et al . Integrated Omics Analysis of Non-Small-Cell Lung Cancer Cells Harboring the EGFR C797S Mutation Reveals the Potential of AXL as a Novel Therapeutic Target in TKI-Resistant Lung Cancer. Cancers 2021; doi: 10.3390/cancers13010111 . Additional Declarations There is NO conflict of interest to disclose. Supplementary Files SupplementaryInformation.pdf Supplementary Information Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: revise 29 Jan, 2026 Review # 1 received at journal 23 Jan, 2026 Review # 2 received at journal 16 Jan, 2026 Reviewer # 2 agreed at journal 12 Jan, 2026 Reviewer # 1 agreed at journal 12 Jan, 2026 Reviewers invited by journal 12 Jan, 2026 Submission checks completed at journal 04 Jan, 2026 Editor assigned by journal 23 Dec, 2025 First submitted to journal 23 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8437918","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":573408443,"identity":"ccaca2a3-8b9e-4e16-bb29-aa8b4a8d3eba","order_by":0,"name":"Deli Huang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAv0lEQVRIiWNgGAWjYDCCA8wNhxkqGJhBbAkitTACtZwhVQszYxuETZwWvuONjYcL59WxGxxgPnibh8Euj6AWyTMHGw7P3MbGbHCALdmahyG5mKAWgxuJDYd5t/EAtfCYSfMwHEhsIKjl/kOgljkSQC3834jUcgMYYrwNBiBb2IjTInkG6DCeYwnMkofZjC3nGCQT1sJ3/PDhzzw1dcl8x5sf3nhTYUdYCwwkQyLTgFj1QGBHgtpRMApGwSgYaQAAV1Y70Y2vSLoAAAAASUVORK5CYII=","orcid":"https://orcid.org/0009-0006-7040-6104","institution":"Life Sciences Institute, Zhejiang University","correspondingAuthor":true,"prefix":"","firstName":"Deli","middleName":"","lastName":"Huang","suffix":""},{"id":573408444,"identity":"7acd4008-1c96-40e2-8fa0-145ab4fd18af","order_by":1,"name":"Yaoji Liang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yaoji","middleName":"","lastName":"Liang","suffix":""},{"id":573408445,"identity":"43899176-2c07-43fb-8013-6b2a5f15562b","order_by":2,"name":"Chunjie Lin","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Chunjie","middleName":"","lastName":"Lin","suffix":""},{"id":573408446,"identity":"6767e2be-6c20-4402-81ee-55dbdeeabca6","order_by":3,"name":"Jie Liu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Liu","suffix":""},{"id":573408447,"identity":"9a78f102-294c-4ca1-8d31-ec47be6a70af","order_by":4,"name":"Jiacheng Ni","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Jiacheng","middleName":"","lastName":"Ni","suffix":""},{"id":573408448,"identity":"55e17916-4a06-4108-afdc-3b7c52a2d33d","order_by":5,"name":"Dingrui Chen","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Dingrui","middleName":"","lastName":"Chen","suffix":""},{"id":573408449,"identity":"455d234c-6dd7-44be-ba65-f235ae79edf8","order_by":6,"name":"Yafei Liu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yafei","middleName":"","lastName":"Liu","suffix":""},{"id":573408450,"identity":"50c9137a-d7f5-4cee-b829-1232546e0033","order_by":7,"name":"Wanyinhui Zhu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Wanyinhui","middleName":"","lastName":"Zhu","suffix":""},{"id":573408451,"identity":"5f3ba578-83a6-4a83-ae7c-329f5a23d166","order_by":8,"name":"Yinuo Sheng","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yinuo","middleName":"","lastName":"Sheng","suffix":""},{"id":573408452,"identity":"3cd21f46-1b5c-4edb-820b-3937f15705bd","order_by":9,"name":"Yunling Wang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yunling","middleName":"","lastName":"Wang","suffix":""},{"id":573408453,"identity":"cc1eb63e-6bd1-47ab-95e6-96dc1f406a03","order_by":10,"name":"Yingbin Gao","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yingbin","middleName":"","lastName":"Gao","suffix":""},{"id":573408454,"identity":"68597015-d911-4cd8-899b-f399ea845bfc","order_by":11,"name":"Sitong Zhang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Sitong","middleName":"","lastName":"Zhang","suffix":""},{"id":573408455,"identity":"7480e94d-fc18-4a56-82a8-d462264fa693","order_by":12,"name":"Weirui Ma","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Weirui","middleName":"","lastName":"Ma","suffix":""}],"badges":[],"createdAt":"2025-12-24 02:00:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8437918/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8437918/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":100242689,"identity":"627e88d9-bd5c-44e8-8179-6d0db54dd991","added_by":"auto","created_at":"2026-01-14 13:40:33","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":119649,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-8437918/v1/e745bb861515377e0cddafb3.docx"},{"id":100242701,"identity":"a8f77615-bbb0-430a-ade3-91bbd3054c02","added_by":"auto","created_at":"2026-01-14 13:40:37","extension":"json","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13539,"visible":true,"origin":"","legend":"","description":"","filename":"ONC202504077.json","url":"https://assets-eu.researchsquare.com/files/rs-8437918/v1/9daf83469356afa29701f87b.json"},{"id":100242700,"identity":"9af2e604-2ac6-466a-ac58-8b2969460c9d","added_by":"auto","created_at":"2026-01-14 13:40:35","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":100475909,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8437918/v1/7b50202e63495310d5042876.pdf"},{"id":100242692,"identity":"b5c30303-8500-44a6-a97b-4c1a92623575","added_by":"auto","created_at":"2026-01-14 13:40:33","extension":"xml","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":177405,"visible":true,"origin":"","legend":"","description":"","filename":"ONC2025040770enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8437918/v1/4b8d9e322207b7da541a006a.xml"},{"id":100242697,"identity":"72daf6ab-4066-4b8f-9d6c-6e58347a96d0","added_by":"auto","created_at":"2026-01-14 13:40:34","extension":"pdf","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":37540500,"visible":true,"origin":"","legend":"","description":"","filename":"Figures.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8437918/v1/bd16bda932c3e23425dab24b.pdf"},{"id":100242696,"identity":"33852594-61b7-40d3-9be9-3a4e7f739101","added_by":"auto","created_at":"2026-01-14 13:40:34","extension":"xml","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":173312,"visible":true,"origin":"","legend":"","description":"","filename":"ONC2025040770structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8437918/v1/0647b7e4a8bd299338ff6472.xml"},{"id":100242695,"identity":"2548c621-4c2d-4be7-9152-7a74415bee4f","added_by":"auto","created_at":"2026-01-14 13:40:34","extension":"html","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":191107,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8437918/v1/20d6c59c4e41dbedf4ac3260.html"},{"id":100242687,"identity":"636a23b9-2d62-4830-9cae-ebd8d8238d34","added_by":"auto","created_at":"2026-01-14 13:40:33","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":250108,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNanobody based biparatopic antibodies induce EGFR degradation in NSCLC tumor cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003eSchematic model of multiparatopic antibody-mediated EGFR endocytosis and degradation. \u003cstrong\u003eB\u003c/strong\u003e Schematic diagram and nomenclature of bitiparatopic antibody constructs. Nbs were tandemly linked via a (G\u003csub\u003e4\u003c/sub\u003eS)\u003csub\u003e4\u003c/sub\u003e linker and fused to the N-terminus of a Fc domain. The nanobody sequence in each name reflects its order in the construct. \u003cstrong\u003eC\u003c/strong\u003e Western blot analysis of total EGFR and phospho-EGFR (Y1068) levels in H1975 (left) or PC9 cells (right) following 24-hour treatment with 5 μg/mL biparatopic antibodies or 300 nM osimertinib. \u003cstrong\u003eD\u003c/strong\u003e,\u003cstrong\u003e E\u003c/strong\u003e Proliferation of H1975 (\u003cstrong\u003eD\u003c/strong\u003e) or PC9 (\u003cstrong\u003eE\u003c/strong\u003e) cells after 5-day treatment with 5 μg/mL biparatopic antibodies or 300 nM osimertinib (n = 6 independent biological samples). Data are presented as mean ± S.D. Statistical analyses: Two-tailed unpaired t-test for (\u003cstrong\u003eD\u003c/strong\u003e) and (\u003cstrong\u003eE\u003c/strong\u003e). **P \u0026lt; 0.01, ****P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figures1.png","url":"https://assets-eu.researchsquare.com/files/rs-8437918/v1/acbc8249021caca1654885b1.png"},{"id":100242688,"identity":"4620ab46-83ba-40e5-9db8-9f841c0318c1","added_by":"auto","created_at":"2026-01-14 13:40:33","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":385103,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOptimized triparatopic antibodies potently induce EGFR degradation and suppress EGFR-dependent cell growth with enhanced efficacy.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003eSchematic diagram and nomenclature of all triparatopic antibody constructs. Each multiparatopic antibody is assigned a name based on each module’s location within the construct sequence. “Fc” indicates fusion to the Fc region, with names before or after “Fc” denoting N- or C-terminal linkage, respectively. “Ce” indicates a cetuximab-based construct, with names before or after “Ce” indicating fusion to the heavy or light chain.\u003cstrong\u003eB\u003c/strong\u003e Western blot analysis of total EGFR and phospho-EGFR (Y1068) levels in H1975 (left) or PC9 cells (right) following 24-hour treatment with 5 μg/mL of the indicated antibodies or 300 nM osimertinib. \u003cstrong\u003eC\u003c/strong\u003e,\u003cstrong\u003e D\u003c/strong\u003e Proliferation of H1975 (\u003cstrong\u003eC\u003c/strong\u003e) or PC9 (\u003cstrong\u003eD\u003c/strong\u003e) cells after 5-day treatment with 5 μg/mL of the indicated antibodies or 300 nM osimertinib (n = 6 independent biological samples). \u003cstrong\u003eE\u003c/strong\u003e,\u003cstrong\u003e F\u003c/strong\u003e Proliferation of H1975 (\u003cstrong\u003eE\u003c/strong\u003e) or PC9 (\u003cstrong\u003eF\u003c/strong\u003e) cells after 5-day treatment with a concentration gradient of the indicated antibodies (n = 6 independent biological samples). \u003cstrong\u003eG\u003c/strong\u003e Western blot analysis of total EGFR and phospho-EGFR (Y1068) levels in H1975 (left) or PC9 cells (right) following 24-hour treatment with 5 μg/mL triparatopic antibodies or 300 nM osimertinib. \u003cstrong\u003eH\u003c/strong\u003e,\u003cstrong\u003eI\u003c/strong\u003e Proliferation of H1975 (\u003cstrong\u003eH\u003c/strong\u003e) or PC9 (\u003cstrong\u003eI\u003c/strong\u003e) cells after 5-day treatment with 5 μg/mL triparatopic antibodies or 300 nM osimertinib (n = 3 independent biological samples). \u003cstrong\u003eJ\u003c/strong\u003e Western blot analysis of the effects of multiparatopic antibodies on total EGFR and phospho-EGFR (Y1068) levels in A431 cells. Cells were treated with 5 μg/mL of the indicated antibodies for 24 hours. \u003cstrong\u003eK\u003c/strong\u003e Proliferation of A431 cells after 5-day treatment with 5 μg/mL of the indicated antibodies or osimertinib (n = 6 independent biological samples). Data are presented as mean ± S.D. Statistical analyses: Two-tailed unpaired t-test for (\u003cstrong\u003eC\u003c/strong\u003e), (\u003cstrong\u003eD\u003c/strong\u003e) and (\u003cstrong\u003eK\u003c/strong\u003e). Two-way ANOVA for (\u003cstrong\u003eF\u003c/strong\u003e). ****P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figures2.png","url":"https://assets-eu.researchsquare.com/files/rs-8437918/v1/b936814210fb9000b2666087.png"},{"id":100242698,"identity":"081c721d-4fd7-4d4d-8051-541277477fc4","added_by":"auto","created_at":"2026-01-14 13:40:34","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":205155,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe combination of multiparatopic antibodies and osimertinib additively inhibits EGFR-driven cell growth.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003eWestern blot analysis of total EGFR and phospho-EGFR (Y1068) levels in EGFR-C797S-overexpressing H1975 (left, H1975-oe) or PC9 cells (right, PC9-oe) following 24-hour treatment with 5 μg/mL of the indicated multiparatopic antibodies or osimertinib. \u003cstrong\u003eB\u003c/strong\u003e,\u003cstrong\u003e C\u003c/strong\u003e Proliferation of H1975-oe (\u003cstrong\u003eB\u003c/strong\u003e) or PC9-oe (\u003cstrong\u003eC\u003c/strong\u003e) cells after 5 days of treatment with 5 μg/mL of the indicated multiparatopic antibodies or osimertinib (n = 6 independent biological samples). \u003cstrong\u003eD\u003c/strong\u003e Western blot analysis of total EGFR and phospho-EGFR (Y1068) levels in EGFR-C797S knock-in PC9 single-clone cell line(10B1) following 24-hour treatment with 5 μg/mL of the indicated multiparatopic antibodies or osimertinib. \u003cstrong\u003eE\u003c/strong\u003e Proliferation of 10B1 cells after 5 days of treatment with 5 μg/mL of the indicated multiparatopic antibodies or osimertinib (n = 6 independent biological samples). \u003cstrong\u003eF\u003c/strong\u003e,\u003cstrong\u003e G\u003c/strong\u003e Proliferation of H1975 (\u003cstrong\u003eF\u003c/strong\u003e) or PC9 (\u003cstrong\u003eG\u003c/strong\u003e) cells after 5 days of treatment with a concentration gradient of osimertinib alone or in combination with 5 μg/mL of the indicated multiparatopic antibodies or cetuximab (n = 3 independent biological samples). Data are presented as mean ± S.D. Statistical analyses: Two-tailed unpaired t-test for (\u003cstrong\u003eB\u003c/strong\u003e), (\u003cstrong\u003eC\u003c/strong\u003e) and (\u003cstrong\u003eE\u003c/strong\u003e). Two-way ANOVA for (\u003cstrong\u003eF\u003c/strong\u003e) and (\u003cstrong\u003eG\u003c/strong\u003e). **P \u0026lt; 0.01, ****P \u0026lt; 0.0001, and n.s., not significant.\u003c/p\u003e","description":"","filename":"Figures3.png","url":"https://assets-eu.researchsquare.com/files/rs-8437918/v1/470f4f01c1cbc5914d23072f.png"},{"id":100242702,"identity":"1b2bbaad-ea1b-486a-8108-be26c1efb039","added_by":"auto","created_at":"2026-01-14 13:40:38","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":60707,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMultiparatopic antibodies efficiently mediate the endocytosis and degradation of EGFR.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e,\u003cstrong\u003eB\u003c/strong\u003e The mean fluorescence intensity (MFI) of PHrodo deep red in H1975 (\u003cstrong\u003eA\u003c/strong\u003e) or PC9 (\u003cstrong\u003eB\u003c/strong\u003e) cells treated with 5 μg/mL of pHrodo-conjugated multiparatopic antibodies or cetuximab\u003cstrong\u003e \u003c/strong\u003e(n = 3 independent biological samples) for up to 60 minutes. \u003cstrong\u003eC\u003c/strong\u003e-\u003cstrong\u003eE\u003c/strong\u003eImages (n=20) acquired at the 60-minute timepoint with Z-axis scanning were subjected to 3D reconstruction. The total fluorescence intensity (\u003cstrong\u003eC\u003c/strong\u003e), volume (\u003cstrong\u003eD\u003c/strong\u003e), and count (\u003cstrong\u003eE\u003c/strong\u003e) of AF647-conjugated antibodies were quantified and normalized to the number of cells in each image. \u003cstrong\u003eF\u003c/strong\u003e,\u003cstrong\u003e G\u003c/strong\u003e Residual surface EGFR levels were measured by flow cytometry of H1975 (\u003cstrong\u003eF\u003c/strong\u003e) or PC9 (\u003cstrong\u003eG\u003c/strong\u003e) cells stained with a non-competing AF647-conjugated anti-EGFR antibody following treatment with 5 μg/mL of indicated multiparatopic antibodies or cetuximab for the indicated time points\u003cstrong\u003e \u003c/strong\u003e(n = 3 independent biological samples). Data are presented as mean ± S.D. Statistical analyses: Two-way ANOVA for (\u003cstrong\u003eA\u003c/strong\u003e), (\u003cstrong\u003eB\u003c/strong\u003e), (\u003cstrong\u003eF\u003c/strong\u003e) and (\u003cstrong\u003eG\u003c/strong\u003e). One-way ANOVA for (\u003cstrong\u003eC\u003c/strong\u003e), (\u003cstrong\u003eD\u003c/strong\u003e) and (\u003cstrong\u003eE\u003c/strong\u003e). *P \u0026lt; 0.05, **P \u0026lt; 0.01, ****P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figures4.png","url":"https://assets-eu.researchsquare.com/files/rs-8437918/v1/cb07b4ecf7a458ce6adc3c1b.png"},{"id":100242690,"identity":"df117973-07c9-4bb9-a1c9-b8bdbdebc0b6","added_by":"auto","created_at":"2026-01-14 13:40:33","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":697549,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMultiparatopic antibodies induce a dynamin-dependent endocytosis and lysosomal degradation of EGFR in an epitope-specific manner.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e Western blot analysis of total EGFR and phospho-EGFR (Y1068) levels in H1975 (left) or PC9 cells (right) following 24-hour of treatment with 5 μg/mL DB5A1 in combination with the indicated inhibitors. \u003cstrong\u003eB\u003c/strong\u003e Flow cytometry analysis of H1975 cells treated with 5 μg/mL of the indicated nanobodies with or without 5 μg/mL of either monovalent Fab or divalent F(ab')\u003csub\u003e2\u003c/sub\u003e anti-IgG (H+L) fragments. \u003cstrong\u003eC\u003c/strong\u003e Confocal imaging of PC9 cells following 1h of treatment with 5 μg/mL AF647-conjugated multiparatopic antibodies or cetuximab. The ABflo594-LAMP2 antibody was used to assess colocalization (indicated by yellow arrows).\u003c/p\u003e","description":"","filename":"Figures5.png","url":"https://assets-eu.researchsquare.com/files/rs-8437918/v1/b5b8ce8c4721ac58d65ecfdc.png"},{"id":100242691,"identity":"0e975e2f-77bc-417a-8359-07a6f99a7652","added_by":"auto","created_at":"2026-01-14 13:40:33","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":68549,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTriparatopic antibodies efficiently inhibit tumor growth in xenograft mouse models.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e Schematic overview of the tumor xenograft mouse model. H1975 cells (2 × 10\u003csup\u003e6\u003c/sup\u003e), PC9 cells (1 × 10\u003csup\u003e6\u003c/sup\u003e) or 10B1 cells (1 × 10\u003csup\u003e6\u003c/sup\u003e) were subcutaneously (s.c.) injected into nude mice (n ≥7) on day 0. Antibodies (200 μg) or osimertinib (5 mg/kg) were administered intraperitoneally (i.p.) every two days for a total of nine injections. \u003cstrong\u003eB\u003c/strong\u003e-\u003cstrong\u003eD\u003c/strong\u003e Tumour growth curves of H1975 (\u003cstrong\u003eB\u003c/strong\u003e), PC9 (\u003cstrong\u003eC\u003c/strong\u003e) or 10B1 (\u003cstrong\u003eD\u003c/strong\u003e) xenografts. Tumor dimensions were measured every two days from day 5 to 23. \u003cstrong\u003eE\u003c/strong\u003e Individual tumor growth curves. Data are presented as mean ± S.D. Statistical analyses: Two-way ANOVA for (\u003cstrong\u003eB\u003c/strong\u003e), (\u003cstrong\u003eC\u003c/strong\u003e) and (\u003cstrong\u003eD\u003c/strong\u003e). **P \u0026lt; 0.01, ****P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figures6.png","url":"https://assets-eu.researchsquare.com/files/rs-8437918/v1/1c224b1231f2e373a7da703f.png"},{"id":100242693,"identity":"66903e4d-1d03-47a2-9d9c-ffeb93ac3a9c","added_by":"auto","created_at":"2026-01-14 13:40:34","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":364061,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAntibody-mediated PD-L1 and other receptor clustering and endocytosis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e Flow cytometry analysis of Jurkat T cells or Ramos B cells treated with 5 μg/mL of the indicated antibodies conjugated with pH-sensitive fluorescent probes for 1 hour, with or without 5 μg/mL monovalent Fab or divalent F(ab′)\u003csub\u003e2\u003c/sub\u003e anti-IgG (H+L) fragments. \u003cstrong\u003eB\u003c/strong\u003e Fold changes in mean fluorescence intensity (MFI) of Fab or F(ab′)\u003csub\u003e2\u003c/sub\u003e fragment-treated groups were normalized to those of the corresponding groups without the secondary antibody control for each marker. \u003cstrong\u003eC\u003c/strong\u003e Flow cytometry analysis of MDA-MB-231 cells treated with 5 μg/mL of pH-sensitive fluorescent probes-conjugated anti-PDL1 antibody in combination with 5 μg/mL monovalent Fab or divalent F(ab′)\u003csub\u003e2\u003c/sub\u003e fragments (n = 3 independent biological samples). Data are presented as mean ± S.D. Statistical analyses: Two-way ANOVA. ****P \u0026lt; 0.0001. \u003cstrong\u003eD\u003c/strong\u003e Western blot analysis of total EGFR and PD-L1 levels in MDA-MB-231 (left) or HCC827 cells (right) following 24-hour treatment with anti-PD-L1 antibody in combination with 10 μg/mL monovalent Fab or divalent F(ab′)\u003csub\u003e2\u003c/sub\u003e fragments, or in combination with DB5A1 or Ce-Fc-B6A1.\u003c/p\u003e","description":"","filename":"Figures7.png","url":"https://assets-eu.researchsquare.com/files/rs-8437918/v1/89b6c80be45afd964a8f9986.png"},{"id":100370756,"identity":"e7a7c67f-5f91-4ec2-addf-862394d98153","added_by":"auto","created_at":"2026-01-16 08:07:50","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3230540,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8437918/v1/e4df1200-af6b-428c-82eb-d6ac40722fad.pdf"},{"id":100242699,"identity":"d6fed583-5c3e-4c6c-b236-169fcebd70fb","added_by":"auto","created_at":"2026-01-14 13:40:35","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":100475909,"visible":true,"origin":"","legend":"Supplementary Information","description":"","filename":"SupplementaryInformation.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8437918/v1/40bcce2875eba414fc42cfe4.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.","formattedTitle":"Multiparatopic antibodies overcome tyrosine kinase inhibitor resistance by inducing lysosomal degradation of EGFR mutants","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe epidermal growth factor receptor (EGFR), a member of the erythroblastic leukemia oncogene B (ErbB) family\u0026mdash;also known as the human epidermal growth factor receptor (HER) family\u0026mdash;is a transmembrane receptor tyrosine kinase (RTK) [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. EGFR (ErbB1 or HER1) regulates key cellular processes, including proliferation, survival, and differentiation, and acts as a critical driver of tumorigenesis across multiple cancer types [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Lung cancer is the second most commonly diagnosed cancer and accounts for over 25% of all cancer-related deaths [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], with non-small cell lung cancer (NSCLC) representing approximately 85% of cases [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. EGFR overexpression occurs in 40\u0026ndash;80% of NSCLC tumors in Asians [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Hyperactivating mutations within the EGFR tyrosine kinase domain most commonly include the L858R point substitution in exon 21 and the exon 19 deletion ΔE746\u0026ndash;A750 [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], both of which confer sensitivity to first- and second-generation tyrosine kinase inhibitors (TKIs) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. However, approximately half of TKI-treated NSCLC patients develop a secondary T790M gatekeeper mutation in exon 20, which confers resistance to early-generation EGFR TKIs [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Third-generation TKIs, which irreversibly bind to Cys797, were developed to overcome T790M-mediated resistance [\u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], yet resistance frequently re-emerges through additional mutations such as C797S [\u003cspan additionalcitationids=\"CR20 CR21\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Although fourth-generation TKIs designed to counter these mechanisms are under development [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], acquired resistance remains inevitable due to tumor heterogeneity and adaptive evolution. This persistent challenge underscores the urgent need for alternative therapeutic strategies with distinct mechanisms of action to overcome EGFR-driven resistance.\u003c/p\u003e \u003cp\u003eTargeted protein degradation (TPD) has emerged as a transformative therapeutic modality over the past two decades. By inducing the selective degradation of proteins of interest (POIs) through proteasomal or lysosomal pathways, TPD eliminates rather than inhibits disease-driving proteins. Proteolysis-targeting chimeras (PROTACs), the most established class of TPD agents, are bispecific molecules that bring a POI into proximity with an E3 ubiquitin ligase, promoting ubiquitination and subsequent proteasomal degradation [\u003cspan additionalcitationids=\"CR26 CR27\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Alternatively, lysosomal degradation can be achieved by clustering POIs with lysosome-targeting receptors using ligands or binders, as demonstrated by lysosome-targeting chimaeras (LYTACs) [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], cytokine receptor-targeting chimeras (KineTACs) [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], and endocytosis-triggering binding proteins (EndoTags) [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. However, a shared limitation among these adaptor-dependent systems is the concomitant degradation or depletion of the E3 ligase or lysosomal receptor, which may compromise long-term efficacy. Strategies that induce degradation exclusively of the target protein are therefore highly desirable. The endocytic pathway represents a natural mechanism for RTKs downregulation, involving receptor clustering, internalization, intracellular trafficking, and lysosomal degradation [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], including that of EGFR [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Notably, biparatopic antibodies targeting RTKs such as EGFR or HER2 can exploit this pathway to drive receptor clustering and degradation [\u003cspan additionalcitationids=\"CR36\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. We thus hypothesized that multiparatopic EGFR antibodies could more efficiently promote endocytosis and lysosomal degradation, offering a mechanistically distinct and potentially superior antitumor strategy compared to TKIs and other adaptor-dependent TPD platforms.\u003c/p\u003e \u003cp\u003eWe generated nanobodies (Nbs) targeting four non-overlapping epitopes of EGFR from immunized alpacas and engineered them into a series of biparatopic and triparatopic antibody formats. These multiparatopic antibodies efficiently induce degradation of clinically relevant EGFR variants and phosphorylated EGFR (pEGFR), including the third-generation TKI-resistant mutation C797S. Additionally, triparatopic constructs exhibiting enhanced endocytic activity demonstrated superior efficacy in mediating receptor degradation and inhibiting lung cancer cell proliferation across \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e models. Furthermore, combining EGFR-targeting multiparatopic antibodies with the third-generation TKI osimertinib resulted in additive antitumor effects. This mechanistically distinct degradation-based strategy offers a promising avenue to enhance therapeutic responses and extend the efficacy window of TKIs in EGFR-driven cancers.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eBiparatopic tetravalent nanobodies induce EGFR degradation\u003c/h2\u003e \u003cp\u003eAs Nbs are more flexible for constructing multispecific formats than conventional antibodies, we generated Nbs targeting EGFR extracellular domains through alpaca immunization (Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA, B). These EGFR-specific Nbs were fused to the N-terminus of a Fc fragment to form homodimeric antibodies and expressed in mammalian Expi293F cells. Epitope mapping by competition ELISA indicated that these Nbs recognize four non-overlapping epitopes (defined as A, B, C, and D) in EGFR extracellular domains (Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC). Cell surface staining showed that these Nbs bind to H1975 (EGFR-L858R\u0026amp;T790M), PC9 (EGFR-ΔE746-A750), and mouse MC38 cells expressing wild-type EGFR, with variable intensity (Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eD). We also assessed the affinity of all Nbs for soluble EGFR using surface plasmon resonance (SPR), which revealed dissociation constants (KD) ranging from 10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e to 10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e M (Supplementary Fig. S2A, B). When H1975 cells were treated with these Nbs and cetuximab [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], Nb-A6, B3-B5, C and D, as well as cetuximab, slightly mediated the degradation of EGFR (Supplementary Fig. S2C). Moreover, Nbs C and D potently inhibited EGF-induced Y1068 phosphorylation of wild-type EGFR (pEGFR\u003csup\u003eY1068\u003c/sup\u003e) in A549 cells, similar to that of cetuximab (Supplementary Fig. S2D). In summary, we have developed a suite of anti-EGFR Nbs with distinct epitopes and affinities, several of which are functionally active in degrading EGFR and inhibiting its phosphorylation.\u003c/p\u003e \u003cp\u003eTo assess whether multiparatopic EGFR-targeting antibodies trigger endocytosis and degradation of EGFR by crosslinking the ectodomain of EGFR (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA), we selected Nbs, with high affinity and EGFR degradation potential, from distinct epitope groups-A1, A2, A6 (epitope A); B4, B5, B6 (epitope B); nanobody C; and D to construct a panel of biparatopic antibodies. These Nbs were tandemly linked in various configurations \u003cem\u003evia\u003c/em\u003e a (G4S)\u003csub\u003e4\u003c/sub\u003e linker and fused to the N-terminus of a Fc fragment to generate homodimeric, biparatopic tetravalent EGFR-targeting antibodies (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).In both H1975 and PC9 cells, these biparatopic antibodies elicited variable EGFR degradation, which correlated with reduced Y1068 phosphorylation and suppressed cell proliferation. (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC-E). Conversely, the tyrosine kinase inhibitor osimertinib inhibited EGFR phosphorylation and cell growth without causing its degradation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC-E). Further analysis indicated that steric hindrance should be considered, as DC and CB5 exhibited better efficacy than CD and B5C, implying that Nbs D and C are preferably located at the N-terminus for optimal binding or EGFR crosslinking.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eOptimized triparatopic hexameric antibodies induce efficient EGFR degradation\u003c/h3\u003e\n\u003cp\u003eTo further enhance the efficiency of antibody-mediated EGFR degradation, we constructed triparatopic antibodies following the biparatopic format by tandemly linking Nbs targeting three distinct epitopes to the N-terminus of the Fc fragment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Among the constructs tested, DB5A1 demonstrated the greatest efficacy, driving degradation of both EGFR and pEGFR and potently suppressing proliferation of H1975 and PC9 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB-D, Supplementary Fig. S3A-C). Consistent with our predictions, the third-generation TKI inhibitor osimertinib effectively suppressed EGFR phosphorylation and cell proliferation, confirming the sensitivity of the EGFR mutants in these cell lines, but did not induce EGFR degradation. The continuous synthesis of new EGFR, coupled with the co-degradation of antibodies with the receptor, suggests that antibody concentration may be a critical determinant for achieving sustained degradation. Therefore, we assessed the efficacy of DB5A1 over time and across a range of concentrations (Supplementary Fig. S4A). The degradation capacity of DB5A1 was both time- and dose-dependent and was inversely correlated with EGFR baseline expression levels at a fixed concentration (Supplementary Fig. S4B). Notably, treatment with 200 \u0026micro;g/mL DB5A1 inhibited cell proliferation by approximately 90% in PC9 cells and 80% in H1975 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE, F). To further optimize DB5A1, we fused Nb-D and the B5A1 construct to the N- and C-terminus of Fc fragment, respectively, to potentially alleviate steric hindrance and promote EGFR degradation. However, these modified constructs failed to further enhance efficacy, suggesting that DB5A1 is inherently tolerant to spatial configuration and operates efficiently in its original structure (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG, I).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBecause cetuximab has a superior affinity and binds to a non-overlapping epitope relative to our Nbs (Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB, Fig. S2A, B and Fig. S5A-C), we next constructed triparatopic antibodies based on the cetuximab scaffold (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). We initially constructed these by fusing Nbs to the N-terminus of the heavy chain or light chain of cetuximab. Although these constructs improved the capacity for EGFR degradation (Supplementary Fig. S3A-C), they also caused a significant decrease in the yield (data not shown) and showed a tendency to aggregate, which could pose pharmacokinetic problems \u003cem\u003ein vivo\u003c/em\u003e. In addition, this design might diminish cetuximab's binding ability, as Nbs fused to the N-terminus of cetuximab heavy chain yielded poorer results, when comparing CB4Ce to CeCB4 (Supplementary Fig. S3A-C). Consequently, we constructed triparatopic antibodies by fusing the Nb constructs B6A1, CB4 or B5A1 to the C-terminus of the Fc fragment of cetuximab. The cetuximab-based triparatopic antibodies exhibited a stronger capacity for EGFR degradation than the parental triparatopic antibodies and DB5A1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). Among them, Ce-Fc-B6A1 mediated the degradation of almost 80% of both total and phosphorylated EGFR and inhibited nearly 50% of cell proliferation in both H1975 and PC9 cells at a concentration of 5\u0026micro;g/mL (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG-I). The superior efficacy of Ce-Fc-B6A1 was also observed in the wild-type EGFR cell line A431 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ, K). This effect might be attributed to its approximately eight-fold higher binding avidity to EGFR compared to DB5A1 (Supplementary Fig. S5B). However, avidity alone could not account for the strong degradation capacity, as parental cetuximab, which has minimal degradation activity, has an avidity approximately two-fold greater than that of DB5A1 (Supplementary Fig. S5B). Thus, we concluded that avidity and architecture (valency and paratope arrangement) interactively affect the capacity for antibody-mediated EGFR degradation.\u003c/p\u003e\n\u003ch3\u003eThe multiparatopic antibodies maintain potent activity against EGFR mutants that confer resistance to third-generation TKIs\u003c/h3\u003e\n\u003cp\u003eAs EGFR multiparatopic antibodies target the extracellular domain, we hypothesized that third-generation TKI-resistant on-target mutants, which primarily occur in the cytosolic kinase domain, might remain vulnerable to these antibodies. To test this, we established stable PC9 and H1975 cell lines overexpressing the most common acquired resistance EGFR mutant, C797S, based on their original mutational backgrounds. Our findings demonstrated that triparatopic antibodies effectively induced degradation of both total and phosphorylated EGFR, thereby inhibiting the growth of both PC9\u003csup\u003eC797S\u003c/sup\u003e and H1975\u003csup\u003eC797S\u003c/sup\u003e cell lines. As expected, osimertinib was unable to achieve similar results, given the C797S mutant's resistance to TKIs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-C). Interestingly, triparatopic antibodies efficiently mediated the degradation of EGFR but did not inhibit growth of H1975\u003csup\u003eC797S\u003c/sup\u003e cells, whereas both effects were observed in the parental H1975 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, C, and Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B). This unexpected phenomenon might be attributed to the artificial experimental conditions, particularly the high levels of EGFR overexpression. To evaluate antibody efficacy under more physiologically relevant settings, we generated PC9 cells carrying the endogenous EGFR\u003csup\u003eC797S\u003c/sup\u003e mutant using CRISPR/Cas9-mediated recombination into the EGFR locus and isolated osimertinib-resistant clones by dose-escalated osimertinib exposure (300 nM to 2 \u0026micro;M). In one validated clone 10B1 (Supplementary Fig. S6A, B), multiparatopic antibodies retained their ability to induce EGFR and pEGFR degradation, concomitantly inhibiting cell proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD, E). However, their efficacy was moderately reduced in the 10B1 clone relative to that of the parental PC9 cells. This reduction is likely a consequence of compensatory mutations in alternative metabolic pathways acquired during prolonged TKI exposure and selection [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. These compensatory pathways may have diminished cellular reliance on EGFR signaling. Overall, these findings demonstrated that EGFR multiparatopic antibodies remain effective against tumors harboring the C797S mutation, a major driver of third-generation TKI resistance.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eUnlike conventional TKIs that competitively inhibit the kinase domain, multiparatopic antibodies operate through a distinct mechanism by inducing endocytic degradation of EGFR, suggesting their potential for combination therapy. Given that TKIs remain the first-line clinical agents for EGFR-mutant cancers, we hypothesized that combining them with multiparatopic antibodies might enhance overall treatment efficacy and mitigate EGFR on-target resistance. We evaluated this by combining a fixed concentration (5 \u0026micro;g/mL) of multiparatopic antibodies with a concentration gradient of osimertinib. Notably, as the inhibitory efficacy of osimertinib diminished at lower concentrations, the antiproliferative effect of the multiparatopic antibodies became increasingly prominent (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF, G). This suggests an additive effect, whereby the antibodies compensate for suboptimal TKI activity. A synergy analysis conducted using gradient concentrations of DB5A1 and osimertinib revealed combination index (CI) scores predominantly within the additive range (approximately \u0026minus;\u0026thinsp;10 to 10), indicating complementary activity between the multiparatopic antibody and TKI without evidence of strong antagonism or synergy (Supplementary Fig. S7A, B).\u003c/p\u003e\n\u003ch3\u003eEpitope-specific mechanism of multiparatopic antibodies in promoting efficient EGFR internalization and degradation\u003c/h3\u003e\n\u003cp\u003eTo directly track the process of EGFR endocytosis induced by antibodies, we labeled multiparatopic antibodies, cetuximab, and a control antibody, CC6.30, targeting SARS-CoV2 spike protein [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], with a pH-sensitive fluorescent probe, pHrode\u0026trade; Deep Red, through an NHS ester reaction with antibody amine groups. This probe shows increased fluorescence in acidic environments (pH\u0026thinsp;\u0026lt;\u0026thinsp;6), allowing tracking of antibody-receptor complex internalization and subsequent acidification. When cells were treated with these labeled antibodies, multiparatopic antibodies induced faster and more efficient endocytosis than cetuximab, as indicated by the gradually enhanced fluoresence over time (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B, Supplementary Fig. S8A, B). This phenomenon was further confirmed by confocal imaging of PC9 cells treated with AF647-conjugated multiparatopic antibodies or cetuximab (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC-E, Supplementary Fig. S9A). As antibody internalization indirectly reflects receptor trafficking, we directly quantified the remaining surface EGFR using non-competing antibodies after incubation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF, G). Multiparatopic antibodies caused a significant reduction in surface EGFR, with Ce-Fc-B6A1 yielding the lowest surface EGFR levels but lower endocytic fluorescence, indicating higher efficiency with reduced antibody consumption. This property was associated with enhanced degradation of EGFR and pEGFR and reduced cell proliferation. Collectively, these data indicated that multiparatopic antibodies accelerate and enhance EGFR endocytosis for degradation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo delineate the endocytic pathway responsible for antibody-mediated EGFR downregulation, we employed a panel of pharmacological inhibitors. Ammonium chloride (NH₄Cl), which neutralizes the pH of acidic cellular compartments, including endosome, efficiently abolished DB5A1-mediated degradation of both EGFR and pEGFR. The dynamin inhibitor prochlorperazine (PCZ) also significantly reduced degradation, whereas the clathrin inhibitor chlorpromazine (CPZ) exhibited a mild inhibitory effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, Supplementary Fig. S10A-C). This differential inhibition pattern suggests a dynamin-dependent but largely clathrin-independent endocytic process, which requires further validation using genetic knockout approaches. The co-localization of endocytosed antibodies with the lysosomal marker LAMP2 further supports the conclusion that DB5A1 facilitates EGFR trafficking to the lysosome for subsequent degradation. (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo investigate the mechanism of multiparatopic antibody-induced EGFR degradation, anti-IgG (H\u0026thinsp;+\u0026thinsp;L) divalent F(ab')₂ fragments were used to mimic the clustering of EGFR induced by these multiparatopic antibodies. Intriguingly, we found that dimeric Nbs targeting epitopes C or D triggered endocytosis independently of F(ab')₂-mediated crosslinking, although F(ab')₂ crosslinking further enhanced the efficacy (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). In contrast, cetuximab, despite its superior affinity, required F(ab')₂-mediated crosslinking to induce endocytosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). These findings collectively demonstrated that the initiation of endocytosis is determined primarily by epitope specificity and multiparatopic architecture, rather than by binding affinity alone. Nbs targeting epitopes C and D likely possess intrinsic activity to promote endocytosis, which is further potentiated by multivalent binding (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). This epitope-specific mechanism highlights the functional advantage of multiparatopic antibody designs in promoting efficient receptor internalization and degradation pathways.\u003c/p\u003e\n\u003ch3\u003eThe triparatopic antibodies demonstrate superior antitumor efficacy in xenograft models\u003c/h3\u003e\n\u003cp\u003eTo assess the \u003cem\u003ein vivo\u003c/em\u003e efficacy of these multiparatopic antibodies, we employed a xenograft model in immunodeficient nude mice to investigate their direct antitumor effects. Nude mice lack a functional adaptive immune response but retain key components of their innate immune system, including phagocytic cells such as neutrophils and macrophages, and natural killer (NK) cells, which are able to mediate antibody-dependent cellular cytotoxicity (ADCC) and antibody-dependent cellular phagocytosis (ADCP). To minimize immune-related variables, we engineered the multiparatopic antibodies with human IgG1 Fc domains containing L234A, L235A, P329G (LALAPG) mutations, which abrogate Fcγ receptor binding, thereby largely abolishing ADCC and ADCP [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. The experimental design for the \u003cem\u003ein vivo\u003c/em\u003e study is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA. For tumor establishment, H1975 and PC9 cells were subcutaneously implanted into the dorsal flank of 6-8-week-old nude mice. Treatment commenced on day 5 after cell inoculation, once tumors reached a volume of approximately 20\u0026ndash;50 mm\u0026sup3;. Mice received either 200 \u0026micro;g of antibody or 5 mg/kg osimertinib, administered intraperitoneally every two days. The results showed that the biparatopic antibody CB4 induced moderate tumor growth inhibition in H1975 xenografts, while cetuximab exhibited minimal and statistically insignificant effects. Notably, triparatopic antibodies DB5A1 and Ce-Fc-B6A1 demonstrated superior efficacy compared with CB4 and Ce-Fc-CB4, significantly outperforming osimertinib in H1975 models and leading to near-complete suppression of tumor growth (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, E). While efficacy varied among xenograft models, Ce-Fc-B6A1 consistently inhibited PC9 tumor growth \u003cem\u003ein vivo\u003c/em\u003e with potency comparable to that of osimertinib (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC, E).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo address the pressing challenge of TKI resistance in clinical treatments for NSCLC driven by EGFR mutations, we evaluated the antibodies against PC9-10B1 xenografts, which express the TKI-resistant EGFR-C797S mutation. Under the same treatment conditions, Ce-Fc-B6A1 exhibited the strongest inhibitory effect on tumor growth, while osimertinib failed to show any efficacy (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD, E). Other tested antibodies displayed moderate antitumor activity. These findings collectively demonstrated that multiparatopic antibodies effectively suppress EGFR-driven lung tumor growth \u003cem\u003ein vivo\u003c/em\u003e, including in models of TKI resistance.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAntibody-mediated receptor clustering as a universal mechanism for triggering endocytosis and enhancing therapeutic targeting of EGFR and PD-L1\u003c/b\u003e \u003c/p\u003e \u003cp\u003eReceptor endocytosis triggered by clustering represents a fundamental mechanism of cellular regulation [\u003cspan additionalcitationids=\"CR44 CR45 CR46\" citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. To evaluate the broad applicability of this strategy, we employed divalent F(ab')\u003csub\u003e2\u003c/sub\u003e anti-IgG (H\u0026thinsp;+\u0026thinsp;L) fragments to crosslink monoclonal antibodies targeting various cell surface receptors. Primary antibodies were conjugated to pH-sensitive fluorescent probes to monitor receptor internalization. Our results revealed that multiple receptors, including CD3, CD4, CD40, CD45, and MHC class I, undergo antibody-mediated endocytosis upon F(ab')\u003csub\u003e2\u003c/sub\u003e crosslinking in Jurkat T cells or Ramos B cells, (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, B). In contrast, monovalent Fab fragments broadly inhibited internalization, likely due to steric interference with receptor clustering, a mechanism that requires further validation. Notably, antibodies with intrinsic endocytosis-inducing activiy, such as UCHT1 (anti-CD3) and rituximab (anti-CD20), exhibited reduced internalization when treated with either F(ab')\u003csub\u003e2\u003c/sub\u003e or Fab fragments, suggesting that their native bivalency is sufficient to drive clustering and receptor endocytosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe next examined whether this mechanism extends to programmed death-ligand 1 (PD-L1), a key immune checkpoint that modulates tumor immune responses [\u003cspan additionalcitationids=\"CR49 CR50\" citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. PD-L1 suppresses antigen-specific T cell activity through engagement of PD-1 on activated T cells [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Overexpression of PD-L1 in the tumor microenvironment has driven therapeutic development of antibodies that disrupt PD-1/PD-L1 interactions. We found that PD-L1 endocytosis increased in a time-dependent manner following F(ab')\u003csub\u003e2\u003c/sub\u003e crosslinking (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). Importantly, this internalization led to PD-L1 degradation, implying that multiparatopic anti-PD-L1 antibodies could be designed to modulate immune function through target removal. Furthermore, co-crosslinking EGFR-targeted multiparatopic antibodies with PD-L1-directed monoclonal antibodies promoted concurrent degradation of PD-L1 in MDA-MB-231 and HCC827 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD). these findings highlight the therapeutic potential of bispecific multiparatopic antibodies designed to concurrently target EGFR and PD-L1.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAcquired resistance to EGFR tyrosine kinase inhibitors (TKIs) is a significant hurdle in the treatment of non-small cell lung cancer (NSCLC) [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. While third-generation TKIs like osimertinib are effective against driver mutations, resistance inevitably emerges, often through secondary on-target mutations, tumor heterogeneity, and adaptive bypass mechanisms [\u003cspan additionalcitationids=\"CR55 CR56 CR57\" citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. To combat the resistance arising from on-target EGFR secondary mutations and atypical mutations that are insensitive to TKIs, we developed a novel therapeutic strategy using multiparatopic antibodies that promote EGFR degradation by leveraging the cell\u0026rsquo;s natural endocytic pathway, a process independent of kinase-domain mutations that confer TKI resistance.\u003c/p\u003e \u003cp\u003eOur strategy leverages the cellular homeostasis system, which internalizes and degrades aggregated membrane proteins \u003cem\u003evia\u003c/em\u003e lysosomes to preserve plasma membrane fluidity and integrity [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. We hypothesized that multiparatopic antibodies, by simultaneously engaging multiple distinct epitopes on EGFR, could induce receptor clustering, thereby accelerating endocytosis and ultimately driving lysosomal degradation. We validated this hypothesis by constructing a panel of biparatopic and triparatopic antibody formats. A key finding was that, unlike cetuximab, which requires secondary crosslinking for robust internalization, the multiparatopic antibodies intrinsically promoted efficient receptor clustering through spatially optimized paratope arrangements. This multivalency enhanced the innate ability of certain epitopes, such as recognized by Nb-C and D, to trigger endocytosis, highlighting that optimal nanobody placement is crucial for maximizing receptor degradation and suppression of downstream signaling, including phosphorylation at Y1068. Thus, it would be highly informative to determine the precise structural epitopes recognized by Nb- C and D through X-ray crystallography or cryo-EM in further study.\u003c/p\u003e \u003cp\u003eThe most potent construct, Ce-Fc-B6A1, was engineered by fusing the biparatopic Nb-B6A1 to the C-terminus of the cetuximab Fc scaffold. This construct induced robust degradation of both total and phosphorylated EGFR, resulting in significant inhibition of tumor cell proliferation in xenograft models of both TKI-sensitive and TKI-resistant NSCLC, including those harboring the C797S mutation. Notably, Ce-Fc-B6A1 also demonstrated superior efficacy in degrading wild-type EGFR and inhibiting tumor growth in models dependent on EGFR signaling. The structural format of Ce-Fc-B6A1 resembles that of clinically validated bispecific antibodies such as ivonescimab and cadonilimab, which have demonstrated favorable manufacturability and stability, suggesting that Ce-Fc-B6A1 is likely amenable to large-scale production [\u003cspan additionalcitationids=\"CR62 CR63\" citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]. Given cetuximab's approval and efficacy in treating EGFR-amplified, RAS wild-type metastatic colorectal cancer, and head and neck squamous cell carcinoma [\u003cspan additionalcitationids=\"CR66 CR67\" citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e], an optimized version of Ce-Fc-B6A1 could also represent a promising therapeutic candidate for these malignancies, potentially offering enhanced efficacy through its potent degradation mechanism.\u003c/p\u003e \u003cp\u003eThe function of Ce-Fc-B6A1 in targeted EGFR degradation is reminiscent of lysosome-targeting chimeras (LYTACs), a type of targeted-protein degradation (TPD) technology that uses lysosomal-targeting receptors (LTRs) such as cation-independent mannose-6-phosphate receptor (CI-M6PR) [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], asialoglycoprotein receptor (ASGPR) [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], membrane-anchored E3 ubiquitin ligases [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e, \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e], or cytokine receptors [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] to direct proteins toward lysosomal degradation. However, unlike LYTACs, our approach leverages multiparatopic antibodies, such as Ce-Fc-B6A1 or DB5A1, that bind multiple epitopes on the target protein, thereby inducing receptor clustering and triggering internalization and lysosomal degradation without relying on external LTRs. By excluding an external adaptor, our platform avoids challenges like adaptor co-degradation or receptor saturation, which may limit the efficacy of LYTAC systems. Additionally, LYTACs require complex engineering to achieve stable LTR binding, creating hurdles for scalability and cost-effective manufacturing. Relative to PROTACs, which degrade intracellular proteins \u003cem\u003evia\u003c/em\u003e the ubiquitin-proteasome system and require both cell permeability and E3 ligase recruitment, our method specifically targets cell-surface proteins and bypasses the need for intracellular delivery mechanisms.\u003c/p\u003e \u003cp\u003eA limitation of our approach is its restriction to cell-surface proteins that undergo active endocytosis, an issue less relevant for LYTACs. In addition, Unlike PROTACs, which can target a broad range of intracellular proteins, the success of our multiparatopic antibody strategy hinges on epitope specificity and the susceptibility of the target protein to clustering-induced internalization and degradation. This dependency requires extensive screening, which may not be practical for all targets. In summary, the multiparatopic antibody-mediated lysosomal degradation mechanism offers a streamlined and complementary option for targeting cell-surface proteins. By functioning independently of LTRs, our approach likely mitigates challenges observed with LYTAC and PROTAC systems while providing a focused solution for receptor-driven degradation.\u003c/p\u003e \u003cp\u003eUnlike conventional TKIs, which inhibit EGFR kinase activity but leave the receptor intact, the multiparatopic antibodies exploit the natural receptor-mediated endocytosis pathway to achieve efficient lysosomal degradation of EGFR. This mechanistic difference enables broad-spectrum signaling suppression and targets diverse kinase-domain mutations, as validated both in engineered overexpression systems and, more importantly, in an endogenous C797S mutant model derived under TKI selection pressure, closely mirroring the clinical scenario of acquired resistance. The additive effect observed when combined with standard-of-care TKIs, such as osimertinib, suggests a promising clinical strategy to enhance depth of response and delay or prevent resistance. Furthermore, our results indicated that antibody-mediated crosslinking also induces the endocytosis and degradation of other cell-surface proteins, most notably PD-L1. These findings underscore the potential for developing bispecific multiparatopic antibodies capable of simultaneously degrading oncogenic drivers such as EGFR and immunosuppressive proteins like PD-L1, offering a synergistic strategy to target both the tumor and its immunosuppressive microenvironment.\u003c/p\u003e \u003cp\u003eFor clinical translation, future work will focus on humanizing the lead nanobodies and performing affinity maturation to optimize pharmacokinetic properties and safety profiles. Given that several HER2 biparatopic antibody-drug conjugates (ADCs) are in clinical developments that exploit rapid internalization for enhanced tumor-specific payload delivery [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e, \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e], Ce-Fc-B6A1-based ADCs may similarly leverage this mechanism to improve therapeutic efficacy for EGFR-driven cancers. Collectively, we have established a versatile and potent antibody-based degradation platform that overcomes on-target TKI resistance by directly eliminating the oncoprotein. This mechanistically distinct approach, which is likely effective across a broad spectrum of EGFR mutants and synergizes with existing TKIs, represents a promising alternative strategy for treating EGFR-driven cancers.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eH1975, PC9, HCC827 cells were maintained in RPMI 1640 medium (Thermofisher) containing 10% (v/v) heat-inactivated foetal bovine serum (FBS, Bio-Channel, BC-SE-FBS07), 1% (v/v) of Penicillin-Streptomycin (Thermofisher, 15140122); MC38, A431, A549, MDA-MB-231 cells were maintained in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (Thermofisher, C11995500CP) with 10% (v/v) of FBS and 1% (v/v) of Penicillin-Streptomycin. Jurkat, Ramos cells were maintained in RPMI 1640 medium containing 10% (v/v) FBS, 1% (v/v) Penicillin-Streptomycin and 50 \u0026micro;M 2-Mercaptoethanol. Expi293F were culture in serum free 293F Hi-exp medium (OPM Biosciences, AC601501).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePhage display\u0026ndash;based discovery of EGFR nanobodies\u003c/h2\u003e \u003cp\u003e \u003col\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eImmunization and sample collection:To generate EGFR-specific nanobodies (VHHs), two adult alpacas were immunized with recombinant human EGFR extracellular domain (EGFR-ECD, His-tagged). The antigen was emulsified with complete Freund\u0026rsquo;s adjuvant for the primary immunization and with incomplete Freund\u0026rsquo;s adjuvant for subsequent boosts. Animals received 5 injections at 2\u0026ndash;3 week intervals. Peripheral blood was collected 7 days after the final boost, and peripheral blood mononuclear cells (PBMCs) were isolated by density gradient centrifugation for RNA extraction. (2) VHH library construction: Total RNA was extracted from PBMCs using TRIzol reagent, and first-strand cDNA was synthesized using oligo(dT) primers. The VHH fragments were amplified by nested PCR with framework-specific primers. Purified PCR products were cloned into a phagemid vector (pComb-3XSS) downstream of the gene encoding the minor coat protein pIII, enabling display of VHHs on M13 filamentous phage particles. The recombinant plasmids were electroporated into E. coli TG1 cells, generating a library with a complexity of approximately 10\u003csup\u003e8\u003c/sup\u003e-10\u003csup\u003e9\u003c/sup\u003e independent transformants. The library was rescued by superinfection with M13KO7 helper phage to produce VHH-displaying phage particles. (3) Biopanning and enrichment of EGFR binders: Recombinant EGFR-ECD-His protein was used as the target antigen for phage display selection. The antigen (50 \u0026micro;g per tube for the first round, gradually reduced to 10\u0026ndash;30 \u0026micro;g per tube in later rounds) was immobilized on high-binding Immuno Tubes. After blocking with 3% BSA or Milk, the phage library was incubated with the immobilized antigen, followed by extensive washing with PBST (PBS\u0026thinsp;+\u0026thinsp;0.1% Tween-20) to remove nonspecific binders. Bound phages were eluted with 0.1 M triethylamine solution, neutralized by 1 M Tris-HCl(pH7.5), and used to infect E. coli TG1 cells for amplification and subsequent pannings. Negative selection using BSA- or irrelevant protein\u0026ndash;coated Immuno Tubes was included to eliminate nonspecific binders. Typically, two to three rounds of biopanning were performed, progressively increasing washing stringency. (4) Screening and sequence analysis of positive clones: After the final panning round, individual bacterial colonies were screened by monoclonal phage ELISA against immobilized EGFR-ECD-His protein, using irrelevant proteins as controls. Positive clones were sequenced to identify unique VHH genes, and sequence alignment was performed to analyze framework regions and complementarity-determining regions (CDRs). Nonredundant clones representing distinct sequence families were selected for further characterization.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eProtein expression and purification\u003c/h2\u003e \u003cp\u003eAll antibodies and EGFR-ECD-His protein were expressed in Expi293F cells. Briefly, plasmids encoding antibodies or EGFR-HIS were mixed with (PEI, BIOHUB, 49553-93-7) at a 3:1 mass ratio and incubated for 15 mins at room temperature before adding to Expi293F cells. Then, fresh medium (20% of total volume) and valproic acid (final concentration 3 mM) were added to the transfected Expi293F cells 24 hours post transfection. The culture supernatants containing the secreted recombinant proteins were harvested and purified with either Protein G Resin (GenScript, L00209-50) or Ni-NTA Resin (GenScript, L00885-50) for IgGs or His taged proteins, respectively. The culture supernatants containing antibodies were incubated with Protein G Resin at 4 ℃ for 1 hr before loading into the columns, then washed with wash buffer (25 mM Tris, 150 mM NaCl, pH 7.2) and eluted with elution buffer (0.1 M glycine, pH 2.5) into 10% volume of neutralization buffer (1 M Tris, pH 9). The culture supernatants containing EGFR-ECD-His protein were incubated with Ni-NTA Resin, washed with wash buffer (100mM NaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 10mM Tris, 10mM Imidazole) and eluted with elution buffer (100mM NaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 10mM Tris, 550mM Imidazole). The buffer of the proteins was exchanged into 1\u0026times; PBS, stored in fridge at 4\u0026deg;C, or immediately frozen in liquid nitrogen and stored in a freezer at -80\u0026deg;C\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry analysis\u003c/h2\u003e \u003cp\u003eTumor cells were harvested and single-cell suspensions were generated for staining with indicated antibodies at 5 \u0026micro;g/mL for 20 min at 4 ℃. After further staining with FITC-anti-mouse IgG(H\u0026thinsp;+\u0026thinsp;L) (Thermofisher, A16091), cells were performed on a Cytek Aurora (Cytek Biosciences) equipment, and analyzed with FlowJo software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme-linked immunosorbent assay\u003c/h2\u003e \u003cp\u003eEGFR-ECD-His protein was coated onto high-binding 96-well plates (BIOFIL, FEP100096) at 2 \u0026micro;g/mL diluted in 1\u0026times;PBS overnight at 4 ℃. After washing 3 times with 1\u0026times;PBS\u0026thinsp;+\u0026thinsp;0.05% Tween-20 (PBST), plates were blocked with 3% (w/v) BSA in 1\u0026times;PBS at room temperature for 1 h, then washed 3 times with PBST. For standard ELISA, serially diluted antibodies (starting at 10 \u0026micro;g/mL, 3\u0026times; down, 50 \u0026micro;L/well diluted in PBST\u0026thinsp;+\u0026thinsp;1% (w/v) BSA) were added into wells and incubated at room temperature for 1 h. For competitive ELISA, unconjugated blocking antibodies (20 \u0026micro;g/mL, 50 \u0026micro;L/well diluted in PBST\u0026thinsp;+\u0026thinsp;1% (w/v) BSA) were added into wells and incubated at room temperature for 1 h before adding the biotin-conjugated detection antibodies (2 \u0026micro;g/mL, 50 \u0026micro;L/well diluted in PBST\u0026thinsp;+\u0026thinsp;1% (w/v) BSA) into wells and incubated at room temperature for 1 h. After washing 3 times with PBST, alkaline phosphatase (AP)-conjugated goat anti-mouse IgG(H\u0026thinsp;+\u0026thinsp;L) (Jackson ImmunoResearch, 115-055-146, 1:5,000 dilution) or horseradish peroxidase (HRP) conjugated Streptavidin (Jackson ImmunoResearch, 016-030-084, 1:2,0000 dilution) was diluted in PBST\u0026thinsp;+\u0026thinsp;1% (w/v) BSA and then added into wells at room temperature for 1 h. Plates were washed 3 times with PBST. For standard ELISA, phosphatase substrate (ThermoFisher, 34047) was added into wells and plates were read for absorbance at 405 nm. For competitive ELISA, enhanced chemiluminescence (ECL, NCM Biotech, P10300) solution was added into wells and plates were read for chemiluminescence.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eCells were lysed in RIPA (Beyotime, P0013B) lysis buffer supplemented with 1mM PMSF (Sangon Biotech, A100754) for 30 min on ice. After centrifugation at 13,000 rpm for 20 min at 4 ℃, the supernatants were collected and protein concentrations were determined using Pierce BCA protein assay kit (ThermoFisher, 23227) according to the manufacturer\u0026rsquo;s protocol. Samples were mixed with 6\u0026times;SDS-PAGE loading buffer, then 5 \u0026micro;g of samples were subjected to 10% SDS-PAGE gels and transferred to PVDF membrane (Millipore, IPVH00010). The membranes were blocked for 1 h in TBST buffer (20 mM Tris-HCl, 150 mM NaCl, 0.1% (v/v) Tween-20) containing 5% (w/v) milk, and then incubated with primary antibodies (diluted in TBST with 3% BSA) on a shaker at 4 ℃ overnight. The membranes were washed 3 times with TBST buffer before incubating with HRP-conjugated secondary antibodies for 1 h at room temperature with shaking. All secondary antibodies, either HRP-conjugated goat anti-mouse IgG(H\u0026thinsp;+\u0026thinsp;L) (Jackson ImmunoResearch, 115-035-003) or HRP-conjugated goat anti-rabbit IgG(H\u0026thinsp;+\u0026thinsp;L) (Jackson ImmunoResearch, 115-035-144) were diluted in TBST buffer with 5% (w/v) milk at a dilution of 1:5,000 to 1:10,000. The membranes were washed 3 times with TBST before visualizing using enhanced chemiluminescence (ECL) on Amersham ImageQuant\u0026trade; 800 (Cytiva). The relative expression of specific protein was determined following quantification of band intensities by using ImageJ, normalized to GAPDH after normalizing to the nontreated group as control. Following primary antibodies were used: EGF Receptor Rabbit mAb (Cell Signaling Technology, 4267), Phospho-EGF Receptor (Tyr1068) Rabbit mAb (Cell Signaling Technology, 3777), PD-L1 Rabbit mAb (Cell Signaling Technology, 13684), GAPDH Mouse mAb (Proteintech, 60004-1-Ig).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eCell proliferation assay\u003c/h2\u003e \u003cp\u003eAll H1975 or PC9 cells were seeded at a density of 1,000 cells/well in 96-well white plates, incubated with the antibodies or osimertinib in incubator at 37 ℃ under 5% CO\u003csub\u003e2\u003c/sub\u003e. Cell viability was assessed on day 5 using ATP luminescent cell viability assay kit (YEASEN Biotechnology, 40210ES60) according to the manufacturer\u0026rsquo;s protocol. Briefly, the plates were washed with 1\u0026times;PBS after dumping medium. Then, 100 \u0026micro;L reagent per well was added and incubated for 10 min at room temperature, and then plates were read for luminescence.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003epH-sensitive probe labeling and endocytosis assay\u003c/h2\u003e \u003cp\u003eAccording to the manufacturer\u0026rsquo;s instructions, antibodies were conjugated with pHrodo Deep Red TFP Ester (Thermo Fisher, P35359), a pH-sensitive dye that exhibits strong fluorescence only in acidic compartments such as lysosomes and late endosomes. In endocytosis assays, cells were treated with the pHrodo-labeled antibodies at a concentration of 5 \u0026micro;g/mL and incubated at 37\u0026deg;C under 5% CO₂ for the specified durations. In crosslinking-induced endocytosis assays, 5 \u0026micro;g/mL of either monovalent Fab (Jackson ImmunoResearch, 115-007-003) or divalent F(ab')\u003csub\u003e2\u003c/sub\u003e anti-IgG (H\u0026thinsp;+\u0026thinsp;L) fragments (Jackson ImmunoResearch, 115-006-003) were added. To assess the left surface EGFR levels, cells were incubated with unlabeled antibodies for varying times, followed by staining with a non-competing AF647-conjugated anti-EGFR antibody. Cells were then harvested and analyzed by flow cytometry. The percentage of surface EGFR was normalized to that of the untreated control group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eGeneration of the osimertinib-resistant cell line\u003c/h2\u003e \u003cp\u003eThe osimertinib-resistant cell lines were established using the CRISPR/Cas9 genome editing system to introduce the EGFR C797S mutation into the PC9 cell line. A previously validated EGFR-specific guide RNA (sgRNA: GTTCCCGGACATAGTCC AGG)[\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e] was used and co-expressed with Cas9 protein from an all-in-one CRISPR/Cas9 vector. The single-stranded DNA (ssDNA) donor template (C*C*T*C*CACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTCTCTCCTGGACTATGTCCGGGAACACAAAGACAATATTGGCTCCCAGTACCTG*C*T*C*A, synthesized in GenScript, * indicating phosphorothioate modification to prevent degradation by cytosolic nucleases) was co-transfected with the CRISPR/Cas9-sgRNA plasmid into PC9 cells using PEI. Following transfection, cells were selected with puromycin and osimertinib to enrich successfully edited populations. Surviving cells were then single-cell sorted via flow cytometry into 96-well plates. Individual clones were expanded and screened for EGFR phosphorylation status by western blot. To confirm the mutation genotype, genomic DNA was amplified by PCR using a primer pair (forward: CAGCTCATGCCCTTCGGCAGTTTA; reverse: GACATCACTCTGG TGGGTATAGATTC). The PCR products were cloned into a vector, transformed into \u003cem\u003eE. coli\u003c/em\u003e, and multiple single colonies were picked up for Sanger sequencing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eAntibody binding kinetics measured by Surface Plasmon Resonance (SPR)\u003c/h2\u003e \u003cp\u003eThe binding kinetics of antibodies to EGFR-ECD-His proteinwere analyzed using SPR (Biacore 8K, Cytiva). Specifically, antibody was dissolved to 4 ug/mL with PBS-P\u003csup\u003e+\u003c/sup\u003e running buffer (0.2 M phosphate buffer, 27 mM KCl and 1.37 M NaCl, 0.5% Surfactant P20) and captured by protein A chip (contact time 30s), and then serial dilutions of EGFR-ECD-His protein with highest concentration of 400 nM were run at a flow rate of 30 \u0026micro;L/min in PBS-P\u003csup\u003e+\u003c/sup\u003e buffer (flow rate: 30 \u0026micro;L/min; contact time: 180 s; dissociation time: 300 s). The resulting data were fitted to a 1:1 binding model using the Biacore 8K Evaluation software (Cytiva).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eConfocal microscope imaging\u003c/h2\u003e \u003cp\u003ePC9 cells were seeded in a 35 mm glass-bottomed microwell dish (Cellvis, D35C4-20-1.5-N) and cultured for 24 hours. Then, the cells were incubated with AF647-conjugated antibodies (5 \u0026micro;g/mL) and Abflo594-labeled LAMP2 antibody (1:200 dilution; Abclonal, A24189) at 37\u0026deg;C for varying durations. After incubation, the cells were washed with PBS and fixed with 4% paraformaldehyde (PFA). Nuclei were stained with DAPI (BioFroxx, 1155MG010) for 15 minutes at 4\u0026deg;C, followed by additional PBS washes. Fluorescence imaging was performed using a confocal microscope (Olympus IXplore SpinSR).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eTumor xenograft mouse models\u003c/h2\u003e \u003cp\u003eH1975 cells (2 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e), PC9 cells (1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e) or 10B1 cells (1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e) were suspended in 200 \u0026micro;L of RPMI 1640 medium (ThermoFisher) and injected subcutaneously into the right flank of 6-week-old sterile female nude mice (GemPharmatech). When tumor volumes reached approximately 20\u0026ndash;50 mm\u0026sup3; at day 5, the animals were randomly divided into 6 or 7 groups (for each group, n\u0026thinsp;\u0026ge;\u0026thinsp;7). The following treatments were administered intraperitoneally (i.p.) every two days for a total of nine injections: antibodies (200 \u0026micro;g per mouse in 200 \u0026micro;L PBS) or osimertinib (5 mg/kg) dissolved in a vehicle containing 5% DMSO, 40% PEG300, and 5% Tween-80 in ddH₂O (200 \u0026micro;L per injection). Tumor dimensions were measured every two days from day 5 to 23, and tumor volumes were calculated using the formula: volume = \u0026frac12; \u0026times; length \u0026times; width\u0026sup2;. Throughout the study, no tumor volume exceeded 2000 mm\u0026sup3;.\u003c/p\u003e \u003c/div\u003e "},{"header":"Declarations","content":"\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eEthics statement\u003c/h2\u003e \u003cp\u003e All animal experiments complied with relevant ethical regulations and were approved by the Committee for Animal Welfare at Zhejiang University (ZJU20220455).\u003c/p\u003e \u003cp\u003e \u003ch2\u003eCompeting interests:\u003c/h2\u003e \u003cp\u003eAuthors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding:\u003c/h2\u003e \u003cp\u003eThe Ministry of Science and Technology of China 2022YFA1305800 (WJS, DLH, XLZ\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe Ministry of Science and Technology of China 2022YFA1206400 (YHY, DLH, XJP\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe Eleventh Batch of the \u0026ldquo;Double Hundred Talent Program for Innovation and Entrepreneurship\u0026rdquo; of Xiamen City (YJL)\u003c/p\u003e\u003ch2\u003eAuthor Contributions:\u003c/h2\u003e \u003cp\u003eC.L. designed the study, performed experiments, analyzed data, and wrote the manuscript. J.L. wrote the manuscript. J.N. performed experiments and andanalyzed data. D.C., Y.L., W.Z. and Y.S. provided key reagents and advice. Y.W., Y.G. and S.Z. performed experiments. W.M. provided key reagents, equipment and advice. D.H. and Y.L. conceived and supervised the study, wrote the manuscript, and provided funding.\u003c/p\u003e\u003ch2\u003eAcknowledgments:\u003c/h2\u003e \u003cp\u003eWe thank the core facility of the Life Sciences Institute for technical assistance. We gratefully acknowledge the support of Sanling Wu, YiLin Sun for SPR experiment assistance and omics platform from Analysis Center of Agrobiology and Environmental Sciences, Zhejiang University.\u003c/p\u003e\u003ch2\u003eData Availability Statement:\u003c/h2\u003e \u003cp\u003eAll data is available in the main text or the supplementary materials.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHerbst RS. Review of epidermal growth factor receptor biology. \u003cem\u003eInt J Radiat Oncol Biol Phys\u003c/em\u003e 2004; 59: 21\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSabbah DA, Hajjo R, Sweidan K. Review on Epidermal Growth Factor Receptor (EGFR) Structure, Signaling Pathways, Interactions, and Recent Updates of EGFR Inhibitors.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSigismund S, Avanzato D, Lanzetti L. Emerging functions of the EGFR in cancer. \u003cem\u003eMol Oncol\u003c/em\u003e 2018; 12: 3\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumagai S, Koyama S, Nishikawa H. Antitumour immunity regulated by aberrant ERBB family signalling. \u003cem\u003eNature Reviews Cancer\u003c/em\u003e 2021; 21: 181\u0026ndash;197.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeonetti A, Assaraf YG, Veltsista PD, El Hassouni B, Tiseo M, Giovannetti E. MicroRNAs as a drug resistance mechanism to targeted therapies in EGFR-mutated NSCLC: Current implications and future directions. \u003cem\u003eDrug Resistance Updates\u003c/em\u003e 2019; 42: 1\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePao W, Chmielecki J. Rational, biologically based treatment of EGFR-mutant non-small-cell lung cancer. \u003cem\u003eNature Reviews Cancer\u003c/em\u003e 2010; 10: 760\u0026ndash;774.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGridelli C, Rossi A, Carbone DP, Guarize J, Karachaliou N, Mok T \u003cem\u003eet al\u003c/em\u003e. Non-small-cell lung cancer. \u003cem\u003eNature Reviews Disease Primers\u003c/em\u003e 2015; 1: 15009.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFujino S, Enokibori T, Tezuka N, Asada Y, Inoue S, Kato H \u003cem\u003eet al\u003c/em\u003e. A comparison of epidermal growth factor receptor levels and other prognostic parameters in non-small cell lung cancer. \u003cem\u003eEuropean Journal of Cancer\u003c/em\u003e 1996; 32: 2070\u0026ndash;2074.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma SV, Bell DW, Settleman J, Haber DA. Epidermal growth factor receptor mutations in lung cancer. \u003cem\u003eNature Reviews Cancer\u003c/em\u003e 2007; 7: 169\u0026ndash;181.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRobichaux JP, Le X, Vijayan RSK, Hicks JK, Heeke S, Elamin YY \u003cem\u003eet al\u003c/em\u003e. Structure-based classification predicts drug response in EGFR-mutant NSCLC. \u003cem\u003eNature\u003c/em\u003e 2021; 597: 732\u0026ndash;737.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCataldo Vince D, Gibbons Don L, P\u0026eacute;rez-Soler R, Quint\u0026aacute;s-Cardama A. Treatment of Non\u0026ndash;Small-Cell Lung Cancer with Erlotinib or Gefitinib. \u003cem\u003eNew England Journal of Medicine\u003c/em\u003e 364: 947\u0026ndash;955.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang JC-H, Wu Y-L, Schuler M, Sebastian M, Popat S, Yamamoto N \u003cem\u003eet al\u003c/em\u003e. Afatinib versus cisplatin-based chemotherapy for EGFR mutation-positive lung adenocarcinoma (LUX-Lung 3 and LUX-Lung 6): analysis of overall survival data from two randomised, phase 3 trials. \u003cem\u003eThe Lancet Oncology\u003c/em\u003e 2015; 16: 141\u0026ndash;151.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerz D, Raymond VM, Garst JH, Erlander MG. Non-invasive urine testing of EGFR activating mutation and T790M resistance mutation in non-small cell lung cancer. \u003cem\u003eExperimental Hematology \u0026amp; Oncology\u003c/em\u003e 2016; 5: 24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang L, Fu L. Mechanisms of resistance to EGFR tyrosine kinase inhibitors. \u003cem\u003eActa Pharmaceutica Sinica B\u003c/em\u003e 2015; 5: 390\u0026ndash;401.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKobayashi S, Boggon Titus J, Dayaram T, J\u0026auml;nne Pasi A, Kocher O, Meyerson M \u003cem\u003eet al\u003c/em\u003e. EGFR Mutation and Resistance of Non\u0026ndash;Small-Cell Lung Cancer to Gefitinib. \u003cem\u003eNew England Journal of Medicine\u003c/em\u003e 352: 786\u0026ndash;792.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamalingam Suresh S, Vansteenkiste J, Planchard D, Cho Byoung C, Gray Jhanelle E, Ohe Y \u003cem\u003eet al\u003c/em\u003e. Overall Survival with Osimertinib in Untreated, EGFR-Mutated Advanced NSCLC. \u003cem\u003eNew England Journal of Medicine\u003c/em\u003e 2020; 382: 41\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoria J-C, Ohe Y, Vansteenkiste J, Reungwetwattana T, Chewaskulyong B, Lee Ki H \u003cem\u003eet al\u003c/em\u003e. Osimertinib in Untreated EGFR-Mutated Advanced Non\u0026ndash;Small-Cell Lung Cancer. \u003cem\u003eNew England Journal of Medicine\u003c/em\u003e 2018; 378: 113\u0026ndash;125.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou W, Ercan D, Chen L, Yun C-H, Li D, Capelletti M \u003cem\u003eet al\u003c/em\u003e. Novel mutant-selective EGFR kinase inhibitors against EGFR T790M. \u003cem\u003eNature\u003c/em\u003e 2009; 462: 1070\u0026ndash;1074.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThress KS, Paweletz CP, Felip E, Cho BC, Stetson D, Dougherty B \u003cem\u003eet al\u003c/em\u003e. Acquired EGFR C797S mutation mediates resistance to AZD9291 in non\u0026ndash;small cell lung cancer harboring EGFR T790M. \u003cem\u003eNature Medicine\u003c/em\u003e 2015; 21: 560\u0026ndash;562.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu HA, Tian SK, Drilon AE, Borsu L, Riely GJ, Arcila ME \u003cem\u003eet al\u003c/em\u003e. Acquired Resistance of EGFR-Mutant Lung Cancer to a T790M-Specific EGFR Inhibitor: Emergence of a Third Mutation (C797S) in the EGFR Tyrosine Kinase Domain. \u003cem\u003eJAMA Oncology\u003c/em\u003e 2015; 1: 982\u0026ndash;984.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiederst MJ, Hu H, Mulvey HE, Lockerman EL, Garcia AR, Piotrowska Z \u003cem\u003eet al\u003c/em\u003e. The Allelic Context of the C797S Mutation Acquired upon Treatment with Third-Generation EGFR Inhibitors Impacts Sensitivity to Subsequent Treatment Strategies.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePlanchard D, Loriot Y, Andr\u0026eacute; F, Gobert A, Auger N, Lacroix L \u003cem\u003eet al\u003c/em\u003e. EGFR-independent mechanisms of acquired resistance to AZD9291 in EGFR T790M-positive NSCLC patients. \u003cem\u003eAnnals of Oncology\u003c/em\u003e 2015; 26: 2073\u0026ndash;2078.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu C, Sun SY. Fourth-generation epidermal growth factor receptor-tyrosine kinases inhibitors: hope and challenges.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCorvaja C, Passaro A, Attili I, Aliaga PT, Spitaleri G, Signore ED \u003cem\u003eet al\u003c/em\u003e. Advancements in fourth-generation EGFR TKIs in EGFR-mutant NSCLC: Bridging biological insights and therapeutic development. \u003cem\u003eCancer Treatment Reviews\u003c/em\u003e 2024; 130.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eB\u0026eacute;k\u0026eacute;s M, Langley DR, Crews CM. PROTAC targeted protein degraders: the past is prologue. \u003cem\u003eNature Reviews Drug Discovery\u003c/em\u003e 2022; 21: 181\u0026ndash;200.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHinterndorfer M, Spiteri VA, Ciulli A, Winter GE. Targeted protein degradation for cancer therapy. \u003cem\u003eNature Reviews Cancer\u003c/em\u003e 2025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSakamoto KM, Kim Kb Fau - Kumagai A, Kumagai A Fau - Mercurio F, Mercurio F Fau - Crews CM, Crews Cm Fau - Deshaies RJ, Deshaies RJ. Protacs: chimeric molecules that target proteins to the Skp1-Cullin-F box complex for ubiquitination and degradation.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClift D, McEwan WA, Labzin LI, Konieczny V, Mogessie B, James LC \u003cem\u003eet al\u003c/em\u003e. A Method for the Acute and Rapid Degradation of Endogenous Proteins. \u003cem\u003eCell\u003c/em\u003e 2017; 171: 1692\u0026ndash;1706.e1618.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBanik SM, Pedram K, Wisnovsky S, Ahn G, Riley NM, Bertozzi CR. Lysosome-targeting chimaeras for degradation of extracellular proteins. \u003cem\u003eNature\u003c/em\u003e 2020; 584: 291\u0026ndash;297.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhn G, Banik SM, Miller CL, Riley NM, Cochran JR, Bertozzi CR. LYTACs that engage the asialoglycoprotein receptor for targeted protein degradation. \u003cem\u003eNature Chemical Biology\u003c/em\u003e 2021; 17: 937\u0026ndash;946.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePance K, Gramespacher JA, Byrnes JR, Salangsang F, Serrano J-AC, Cotton AD \u003cem\u003eet al\u003c/em\u003e. Modular cytokine receptor-targeting chimeras for targeted degradation of cell surface and extracellular proteins. \u003cem\u003eNature Biotechnology\u003c/em\u003e 2023; 41: 273\u0026ndash;281.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang B, Abedi M, Ahn G, Coventry B, Sappington I, Tang C \u003cem\u003eet al\u003c/em\u003e. Designed endocytosis-inducing proteins degrade targets and amplify signals. \u003cem\u003eNature\u003c/em\u003e 2025; 638: 796\u0026ndash;804.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbella JV, Park M. Breakdown of endocytosis in the oncogenic activation of receptor tyrosine kinases.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWells A, Welsh Jb Fau - Lazar CS, Lazar Cs Fau - Wiley HS, Wiley Hs Fau - Gill GN, Gill Gn Fau - Rosenfeld MG, Rosenfeld MG. Ligand-induced transformation by a noninternalizing epidermal growth factor receptor.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi JY, Perry SR, Muniz-Medina V, Wang X, Wetzel LK, Rebelatto MC \u003cem\u003eet al\u003c/em\u003e. A Biparatopic HER2-Targeting Antibody-Drug Conjugate Induces Tumor Regression in Primary Models Refractory to or Ineligible for HER2-Targeted Therapy. \u003cem\u003eCancer Cell\u003c/em\u003e 2016; 29: 117\u0026ndash;129.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKast F, Schwill M, St\u0026uuml;ber JC, Pfundstein S, Nagy-Davidescu G, Rodr\u0026iacute;guez JMM \u003cem\u003eet al\u003c/em\u003e. Engineering an anti-HER2 biparatopic antibody with a multimodal mechanism of action. \u003cem\u003eNature Communications\u003c/em\u003e 2021; 12: 3790.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKelton C, Wesolowski JS, Soloviev M, Schweickhardt R, Fischer D, Kurosawa E \u003cem\u003eet al\u003c/em\u003e. Anti-EGFR biparatopic-SEED antibody has enhanced combination-activity in a single molecule. \u003cem\u003eArchives of Biochemistry and Biophysics\u003c/em\u003e 2012; 526: 219\u0026ndash;225.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSunada H, Magun BE, Mendelsohn J, MacLeod CL. Monoclonal antibody against epidermal growth factor receptor is internalized without stimulating receptor phosphorylation. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e 1986; 83: 3825\u0026ndash;3829.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNishihara S, Yamaoka T, Ishikawa F, Ohmori T, Ando K, Kusumoto S \u003cem\u003eet al\u003c/em\u003e. Diverse Mechanisms of Resistance against Osimertinib, a Third-Generation EGFR-TKI, in Lung Adenocarcinoma Cells with an EGFR-Activating Mutation. \u003cem\u003eCells\u003c/em\u003e 2022; doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cells11142201\u003c/span\u003e\u003cspan address=\"10.3390/cells11142201\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR\u0026iacute;os-Hoyo A, Moliner L, Arriola E. Acquired Mechanisms of Resistance to Osimertinib\u0026mdash;The Next Challenge. \u003cem\u003eCancers\u003c/em\u003e 2022; doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cancers14081931\u003c/span\u003e\u003cspan address=\"10.3390/cancers14081931\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRogers TF, Zhao F, Huang D, Beutler N, Burns A, He W-t \u003cem\u003eet al\u003c/em\u003e. Isolation of potent SARS-CoV-2 neutralizing antibodies and protection from disease in a small animal model. \u003cem\u003eScience\u003c/em\u003e 2020; 369: 956\u0026ndash;963.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchlothauer T, Herter S, Koller CF, Grau-Richards S, Steinhart V, Spick C \u003cem\u003eet al\u003c/em\u003e. Novel human IgG1 and IgG4 Fc-engineered antibodies with completely abolished immune effector functions. \u003cem\u003eProtein Engineering, Design and Selection\u003c/em\u003e 2016; 29: 457\u0026ndash;466.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evon Zastrow M, Sorkin A. Mechanisms for Regulating and Organizing Receptor Signaling by Endocytosis. \u003cem\u003eAnnual Review of Biochemistry\u003c/em\u003e 2021; 90: 709\u0026ndash;737.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSigismund S, Confalonieri S, Ciliberto A, Polo S, Scita G, Di Fiore PP. Endocytosis and Signaling: Cell Logistics Shape the Eukaryotic Cell Plan. \u003cem\u003ePhysiological Reviews\u003c/em\u003e 2012; 92: 273\u0026ndash;366.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi M, Yu Y. Innate immune receptor clustering and its role in immune regulation. \u003cem\u003eJournal of Cell Science\u003c/em\u003e 2021; 134: jcs249318.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDom\u0026iacute;nguez CM, Niemeyer CM. Clustering of Membrane Receptors: Insights from DNA Origami-Based Approaches. \u003cem\u003eSmall\u003c/em\u003e 2025; 21: 2503543.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaul D, Stern O, Vallis Y, Dhillon J, Buchanan A, McMahon H. Cell surface protein aggregation triggers endocytosis to maintain plasma membrane proteostasis. \u003cem\u003eNature Communications\u003c/em\u003e 2023; 14: 947.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKeir ME, Butte MJ, Freeman GJ, Sharpe AH. PD-1 and Its Ligands in Tolerance and Immunity. \u003cem\u003eAnnual Review of Immunology\u003c/em\u003e 2008; 26: 677\u0026ndash;704.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZou W, Chen L. Inhibitory B7-family molecules in the tumour microenvironment. \u003cem\u003eNature Reviews Immunology\u003c/em\u003e 2008; 8: 467\u0026ndash;477.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCherif B, Triki H, Charfi S, Bouzidi L, Kridis WB, Khanfir A \u003cem\u003eet al\u003c/em\u003e. Immune checkpoint molecules B7-H6 and PD-L1 co-pattern the tumor inflammatory microenvironment in human breast cancer. \u003cem\u003eScientific Reports\u003c/em\u003e 2021; 11: 7550.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmit EF, van den Heuvel MM. PD-L1 in non-small-cell lung cancer: the third target for immunotherapy. \u003cem\u003eThe Lancet\u003c/em\u003e 2016; 387: 1795\u0026ndash;1796.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu R, Li H-F, Li S. PD-1-mediated inhibition of T cell activation: Mechanisms and strategies for cancer combination immunotherapy. \u003cem\u003eCell Insight\u003c/em\u003e 2024; 3: 100146.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJackman D, Pao W, Riely GJ, Engelman JA, Kris MG, J\u0026auml;nne PA \u003cem\u003eet al\u003c/em\u003e. Clinical Definition of Acquired Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Non\u0026ndash;Small-Cell Lung Cancer. \u003cem\u003eJournal of Clinical Oncology\u003c/em\u003e 2009; 28: 357\u0026ndash;360.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Q, Yu S, Zhao W, Qin S, Chu Q, Wu K. EGFR-TKIs resistance via EGFR-independent signaling pathways. \u003cem\u003eMolecular Cancer\u003c/em\u003e 2018; 17: 53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOu X, Gao G, Habaz IA, Wang Y. Mechanisms of resistance to tyrosine kinase inhibitor-targeted therapy and overcoming strategies. \u003cem\u003eMedComm\u003c/em\u003e 2024; 5: e694.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu D, Sun Q, Tang H, Xiao H, Luo J, Ouyang L \u003cem\u003eet al\u003c/em\u003e. Acquired resistance to tyrosine kinase targeted therapy: mechanism and tackling strategies. \u003cem\u003eDrug Resistance Updates\u003c/em\u003e 2025; 78: 101176.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang J, Vokes N, Li M, Xu J, Bai H, Wang J \u003cem\u003eet al\u003c/em\u003e. Overcoming EGFR-TKI resistance by targeting the tumor microenvironment. \u003cem\u003eChinese Medical Journal Pulmonary and Critical Care Medicine\u003c/em\u003e 2024; 2: 151\u0026ndash;161.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeonetti A, Sharma S, Minari R, Perego P, Giovannetti E, Tiseo M. Resistance mechanisms to osimertinib in EGFR-mutated non-small cell lung cancer. \u003cem\u003eBritish Journal of Cancer\u003c/em\u003e 2019; 121: 725\u0026ndash;737.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRadulovic M, Yang C, Stenmark H. Lysosomal membrane homeostasis and its importance in physiology and disease. \u003cem\u003eNature Reviews Molecular Cell Biology\u003c/em\u003e 2025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJackson Matthew P, Hewitt Eric W. Cellular proteostasis: degradation of misfolded proteins by lysosomes. \u003cem\u003eEssays in Biochemistry\u003c/em\u003e 2016; 60: 173\u0026ndash;180.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShan KS, Musleh Ud Din S, Dalal S, Gonzalez T, Dalal M, Ferraro P \u003cem\u003eet al\u003c/em\u003e. Bispecific Antibodies in Solid Tumors: Advances and Challenges. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e 2025; doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms26125838\u003c/span\u003e\u003cspan address=\"10.3390/ijms26125838\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang C, Huang H, Song Z, Li Z, Huang J, Cao L \u003cem\u003eet al\u003c/em\u003e. A novel bispecific antibody CVL006 superior to AK112 for dual targeting of PD-L1 and VEGF in cancer therapy. \u003cem\u003eAntibody Therapeutics\u003c/em\u003e 2025; 8: 189\u0026ndash;196.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhong T, Zhang L, Huang Z, Pang X, Jin C, Liu W \u003cem\u003eet al\u003c/em\u003e. Design of a fragment crystallizable-engineered tetravalent bispecific antibody targeting programmed cell death-1 and vascular endothelial growth factor with cooperative biological effects. \u003cem\u003eiScience\u003c/em\u003e 2025; 28: 111722.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePang X, Huang Z, Zhong T, Zhang P, Wang ZM, Xia M \u003cem\u003eet al\u003c/em\u003e. Cadonilimab, a tetravalent PD-1/CTLA-4 bispecific antibody with trans-binding and enhanced target binding avidity. \u003cem\u003emAbs\u003c/em\u003e 2023; 15: 2180794.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlick SKA, Scott LJ. Cetuximab. \u003cem\u003eDrugs\u003c/em\u003e 2007; 67: 2585\u0026ndash;2607.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng B, Wang X, Wei M, Wang Q, Li J, Bi L \u003cem\u003eet al\u003c/em\u003e. First-line cetuximab versus bevacizumab for RAS and BRAF wild-type metastatic colorectal cancer: a systematic review and meta-analysis. \u003cem\u003eBMC Cancer\u003c/em\u003e 2019; 19: 280.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJonker Derek J, O'Callaghan Chris J, Karapetis Christos S, Zalcberg John R, Tu D, Au H-J \u003cem\u003eet al\u003c/em\u003e. Cetuximab for the Treatment of Colorectal Cancer. \u003cem\u003eNew England Journal of Medicine\u003c/em\u003e 357: 2040\u0026ndash;2048.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuraro E, Fanetti G, Lupato V, Giacomarra V, Steffan A, Gobitti C \u003cem\u003eet al\u003c/em\u003e. Cetuximab in locally advanced head and neck squamous cell carcinoma: Biological mechanisms involved in efficacy, toxicity and resistance. \u003cem\u003eCritical Reviews in Oncology/Hematology\u003c/em\u003e 2021; 164: 103424.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarei H, Tsai W-TK, Kee Y-S, Ruiz K, He J, Cox C \u003cem\u003eet al\u003c/em\u003e. Antibody targeting of E3 ubiquitin ligases for receptor degradation. \u003cem\u003eNature\u003c/em\u003e 2022; 610: 182\u0026ndash;189.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCotton AD, Nguyen DP, Gramespacher JA, Seiple IB, Wells JA. Development of Antibody-Based PROTACs for the Degradation of the Cell-Surface Immune Checkpoint Protein PD-L1. \u003cem\u003eJournal of the American Chemical Society\u003c/em\u003e 2021; 143: 593\u0026ndash;598.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLewis GD, Li G, Guo J, Yu S-F, Fields CT, Lee G \u003cem\u003eet al\u003c/em\u003e. The HER2-directed antibody-drug conjugate DHES0815A in advanced and/or metastatic breast cancer: preclinical characterization and phase 1 trial results. \u003cem\u003eNature Communications\u003c/em\u003e 2024; 15: 466.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu D, Liu B, Li Z, Gao B, Zhang X, Ruan J \u003cem\u003eet al\u003c/em\u003e. A pooled analysis of JSKN003, a biparatopic anti-HER2 antibody conjugate (ADC), in patients with advanced HER2-overexpressing (IHC 3+) gastrointestinal tumors. \u003cem\u003eJournal of Clinical Oncology\u003c/em\u003e 2025; 43: 3022\u0026ndash;3022.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang T-H, Wu C-C, Huang K-Y, Leu Y-L, Yang S-C, Chen C-L \u003cem\u003eet al\u003c/em\u003e. Integrated Omics Analysis of Non-Small-Cell Lung Cancer Cells Harboring the EGFR C797S Mutation Reveals the Potential of AXL as a Novel Therapeutic Target in TKI-Resistant Lung Cancer. \u003cem\u003eCancers\u003c/em\u003e 2021; doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cancers13010111\u003c/span\u003e\u003cspan address=\"10.3390/cancers13010111\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"oncogene","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"onc","sideBox":"Learn more about [Oncogene](http://www.nature.com/onc/)","snPcode":"41388","submissionUrl":"https://mts-onc.nature.com/cgi-bin/main.plex","title":"Oncogene","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8437918/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8437918/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAcquired resistance to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) remains a major challenge in the treatment of non-small cell lung cancer (NSCLC). To address this issue, we developed a novel therapeutic strategy based on multiparatopic antibodies that induce targeted degradation of EGFR, independent of driver mutations typically residing in the cytosolic domain. We engineered nanobodies (Nbs) recognizing four distinct epitopes within the EGFR extracellular domain into biparatopic and triparatopic antibody formats. These antibodies effectively promoted EGFR clustering, endocytosis, and lysosomal degradation, resulting in potent suppression of downstream signaling and cell proliferation in NSCLC cell lines carrying diverse EGFR mutations, including those resistant to osimertinib. The degradation process was epitope-dependent and mediated through a dynamin-dependent endocytic pathway. Triparatopic antibodies exhibited superior antitumor efficacy compared to both biparatopic antibodies and osimertinib in xenograft models of TKI-sensitive and TKI-resistant NSCLC cells. Moreover, these antibodies displayed additive effects when combined with osimertinib. We further demonstrated that this degradation mechanism extends beyond EGFR, as antibody-mediated crosslinking similarly triggered PD-L1 degradation. Collectively, this study indicates multiparatopic antibodies as a potent and mechanistically distinct strategy to overcome TKI resistance by directly degrading the target oncoprotein, with broad applicability to other pathogenic cell surface proteins.\u003c/p\u003e \u003cp\u003eMain Text:\u003c/p\u003e","manuscriptTitle":"Multiparatopic antibodies overcome tyrosine kinase inhibitor resistance by inducing lysosomal degradation of EGFR mutants","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-14 13:40:28","doi":"10.21203/rs.3.rs-8437918/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2026-01-29T13:28:30+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-01-23T23:14:36+00:00","index":1,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-01-17T03:55:55+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-01-12T23:07:55+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-01-12T16:48:49+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2026-01-12T16:19:01+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-04T14:56:59+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-24T01:55:27+00:00","index":"","fulltext":""},{"type":"submitted","content":"Oncogene","date":"2025-12-24T01:55:26+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"oncogene","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"onc","sideBox":"Learn more about [Oncogene](http://www.nature.com/onc/)","snPcode":"41388","submissionUrl":"https://mts-onc.nature.com/cgi-bin/main.plex","title":"Oncogene","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"516fba73-e111-4101-92ac-d63ac2b11569","owner":[],"postedDate":"January 14th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":61012027,"name":"Biological sciences/Cancer/Lung cancer/Non-small-cell lung cancer"},{"id":61012028,"name":"Biological sciences/Drug discovery/Business strategy in drug development/Pharmacoeconomics"}],"tags":[],"updatedAt":"2026-04-20T10:22:29+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-14 13:40:28","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8437918","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8437918","identity":"rs-8437918","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00