Cre-mediated autoexision of selectable marker genes in soybean, cotton, canola and maize transgenic plants

Cre-mediated autoexision of selectable marker genes in soybean, cotton, canola and maize transgenic plants | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Cre-mediated autoexision of selectable marker genes in soybean, cotton, canola and maize transgenic plants Xudong Ye, Zarir Vaghchhipawala, Edwards J. Williams, Changlin Fu, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1731438/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract Selectable marker genes are often required for efficient generation of transgenic plants in tissue culture transformation systems but are not desired once the transgenic events are obtained. We have developed Cre/ loxP autoexcision systems to remove selectable marker genes in soybean, cotton, canola and maize. We tested a set of vectors with diverse promoters and identified promising promoters to drive cre expression for each of the four crops. We evaluated both the efficiency of generating primary transgenic events with low transgene copy numbers, and the frequency of marker-free progeny in the next generation. The best performing vectors gave no obvious decrease in the transformation frequency in each crop and generated homozygous marker-free progeny in the next generation. We found that effective expression of Cre recombinase for marker gene autoexcision can be species dependent. Among the vectors tested, the best autoexcision frequency (41%) in soybean transformation came from using the soybean RSP1 promoter for cre expression. The cre gene expressed by soybean RSP1 promoter with an Arabidopsis AtpE intron delivered the best autoexcision frequency (69%) in cotton transformation. The cre gene expressed by the embryo specific eUSP88 promoter from Vicia faba conferred the best marker excision frequency (32%) in canola transformation. Finally, the cre gene expressed by the rice CDC45-1 promoter resulted in 44% autoexcision in maize transformation. The Cre/ loxP recombinase system enables the generation of selectable marker-free transgenic plants for commercial product development in four agriculturally important crops and provides further improvement opportunities for more specific and better marker excision efficiency. Marker gene removal Cre/loxP autoexcision Agrobacterium-mediated transformation marker-free transgenic plant plant transformation transgenic soybean transgenic cotton transgenic canola transgenic maize Figures Figure 1 Figure 2 Figure 3 Figure 4 Key Message Efficient selectable marker gene autoexcision in transgenic plants of soybean, cotton, canola, and maize is achieved by effective Cre recombinase expression. Introduction Plant transformation has provided a powerful tool for functional genomic research and biotechnology applications by integration of transgenes into chromosomes of a wide range of agriculturally relevant species. Most transgenic plants have been produced through tissue culture processes, in which a selectable marker gene (SMG) is co-transformed with genes of interest (GOI). The SMG confers a growth advantage of transformed cells over non-transformed cells under the corresponding selection reagent in media, which then leads to transgenic shoot regeneration. Approximately 50 SMGs including many that confer antibiotic resistance or herbicide tolerance have been applied for transgenic plant production (Miki and McHugh, 2004 ). The antibiotic selection marker genes are not desirable in commercial seed products due to public perception or regulatory concerns over food safety and some herbicide marker gene may be redundant for trait stacking (Hare &Chua, 2002 ; Rosellini, 2012 ). The SMGs can be removed or segregated away in progeny seeds by using vector designs with two T-DNAs in Agrobacterium (Huang et al., 2004 ), two DNA segment bombardment co-transformation (Shiva Prakash et al., 2009 ), or site-specific recombinase-mediated excision of marker genes (Hare & Chua 2002 ; Gilbertson 2003 ; Miki and McHugh 2004 ; Yau & Stewart 2013 ). Among various recombinase systems, the Cre /loxP recombination system has been widely reported to remove SMGs in many species (Gilbertson 2003 ; Yau & Stewart 2013 ). In the Cre/ loxP recombinase system, the Cre recombinase catalyzes a crossover between directly repeated lox (locus of crossover) recognition sites. To excise a SMG, the lox sites are designed to flank the SMG and any other accessory genes, and after successful recombination-mediated excision, the GOI(s) and one lox site would remain (Gilbertson 2003 , Gidoni et al., 2008 ). The Cre/ loxP -mediated SMG excision can be obtained either by sexual crossing with a Cre - expressing line (Bayley et al., 1992 ; Pradhan et al., 2016 ), or by autoexcision where the cre gene is introduced and removed together with the SMGs. The Cre recombinase expression can be regulated using heat-, cold-, drought- or chemical inducible promoters (Zuo et al., 2001 ; Zhang et al. 2003 ; Wang et al., 2005 ; Ma et al., 2009 , Petri et al., 2012 ; García-Almodóvar et al., 2014 ; Mookkan et al., 2017 ; Éva et al., 2018 ) or developmentally regulated promoters (Li et al., 2007 ; Verweire et al., 2007 ; Moravčı́ková et al., 2008; Kopertekh et al., 2009 ; Luo et al., 2007 ; Van Ex et al., 2007). Autoexcision in which the cre expression is driven by developmentally-regulated promoters is the most efficient application as no additional treatment is required to activate cre expression during tissue culture and plant growth. In contrast, the use of heat-, cold- or chemical treatments for cre expression involves the induction of stress conditions during tissue culture in certain transformation systems, which may impede transgenic plant recovery during early stages of plant regeneration. Most studies on marker gene autoexcision have been performed in model plants such as Arabidopsis thaliana and tobacco, as well as in crops such as maize, rice, soybean and canola (Table S1). Marker excision has been reported during the tissue culture stage from inducible promoters (Sreekala et al., 2005 ; Cuellar et al., 2006 ; Petri et al., 2012 ; Du et al., 2019 ; García-Almodóvar et al., 2014 ; Mookkan et al., 2017 ), embryo-specific promoters (Li et al., 2007 ; Chong-Pe´rez et al., 2013), or constitutive promoter (Zou et al., 2013 ); during meiosis (Bai et al., 2008 ; Kopertekh et al., 2010 ; Polóniová et al., 2015 ); or in progenies (Verweire et al., 2007 ; Van Ex et al., 2007). Plant transformation methods and explant types differ from species to species. Meristem explants excised from mature seeds are used for soybean and cotton transformation using a non-lethal aadA /spectinomycin selection system (Ye et al., 2008 ; Martinell et al., 2011 ; Chen et al., 2014 ). The hypocotyls from germinating seedlings are used for canola transformation (Radke et al. 1992 ). The immature embryos are used for maize transformation (Sidorov & Duncan, 2009 ). Such diverse transformation systems and tissue types require different marker gene excision systems. We have tested several promoters with different expression profiles to develop efficient Cre/ loxP -mediated marker gene autoexcision systems in soybean, cotton, canola and maize, with a goal of high frequency of homozygous marker-free (MF) R1 seed production because hemizygous MF seeds take additional generation to propagate. In this report we disclose results of commercial-level marker gene autoexcision frequencies in these four major crops. Materials And Methods Vector design and construction To search for developmentally regulated expression elements to drive cre specific expression in reproductive tissues, a set of putative meiosis-related Arabidopsis genes were manually identified from GenBank, including Arabidopsis CDC45 . The maize and rice CDC45 homologue sequences were identified by performing BLAST searches in the GenBank genomic sequences against the Arabidopsis CDC45 protein sequence. There were two versions of maize and rice CDC45 promoters identified from GenBank by searching Arabidopsis for CDC45 protein homologues. Two promoters from monocot CDC45 genes, one from maize at chromosome 3 and one from rice at chromosome 11 (Table 1 ), appear to be restricted in reproductive tissue, and were used to drive the cre expression in pMON138232 and pMON243847, respectively. The relevant expression elements of these genes were cloned by PCR. The corresponding species genomic DNA was used as a template for PCR amplification using Q5® Hot Start High-Fidelity DNA polymerase (NEB Cat. No. M0493) according to the manufacturer instructions. The corresponding genomic regions of these expression elements in GenBank and the primers used for amplifying them are listed in Table 1 . Table 1 Primers and DNA sources used for PCR amplification of cre autoexcision promoters and 3’ UTRs Expression element Forward primer Reverse primer Size (bp) GenBank No. / region P-At.CDC45 5’ ctaatacaaaggtgcatgagtagtagtaactg 3’ 5’ ttccgtgaaattgaatcacccagaagg 3’ 1030 CP002686.1 (9143262..9144291) T-At.CDC45 5’ catagtctcattgttcttcgattcagtg 3’ 5’ cacgagcttcaggtcataactctgg 3’ 734 CP002686.1 (9146083..9146816) P-Gm.RSP1 5’ aaataatatataaaaatattacaaaaatc 3’ 5’ tgaagcaaagtggttagagatgagaatg 3’ 720 NC_016091 (44628717..44629436) P-Zm.CDC45-1 5’ agccacatgcagtgaattctatactcg 3’ 5’ tgcctcatcaatcagctaggtcggatc 3’ 2000 CM007649.1 (234291301..234293300) P-Os.CDC45-1 5’ acatacatctgtctagattcattaatat 3’ 5’ tggcgcatcaatcgaagtggtgaattgg 3’ 1957 AP014967.1 (1304410..1306330) Insert Table 1 here The soybean RSP1 promoter ( P-Gm.RSP1 ) was initially nominated as a disease responsive gene promoter ( R esistance S ensitive P rotein 1) based on RNAseq data generated in-house. Upon testing this promoter to express a gusA transgene in soybean, we found that it was active at background levels in multiple tissues, except roots and top of hypocotyls (data not shown). Even though it does not seem to fit the developmental regulation pattern of other promoters that we tested, it was included to avoid a decrease in TF because of its low-level expression in most tissues. The same promoter comes from a gene that belongs to the BURP domain-containing protein family and was reported to be expressed in roots and hypocotyls, and is inducible by ABA, salt, and drought treatments (Gm04.3 gene, Xu et al. 2010 ). pMON263552 with the RSP1 promoter (Fig. 1 ) was constructed to test SMG autoexcision in soybean. The 1.2 kp λ phage segment corresponding to GenBank accession No. J02459.1, region 21042 to 22237, was synthesized in Bio Basic Inc. (Markham, ON, Canada) and used in pMON243107 as a spacer sequence. The 754 bp of Arabidopsis AtpE intron corresponding to GenBank accession No. LR699765.1, region 17923873 to 19152863, was amplified by PCR and cloned into pMON291996 to test enhance P-Gm.RSP1 expression. The 804 bp of maize DnaK intron, which was previously annotated as ZmHSP70 intron and disclosed in GenBank Accession No. KX640115.1, was cloned after P-Zm.CDC45-1 in pMON138232 to enhance expression. The cre coding sequence used is as previously described and is interrupted by 189 bp IV2 intron from the potato ST-LS1 gene (Vancanneyt et al. 1990 ; Zhang et al. 2003 ). The promoters described above were used to drive expression of the cre coding sequence. For 3’UTR, T-At.CDC45 (Table 1 ) was used for soybean, cotton, and canola, and Agrobacterium nos transcription terminator (Depicker et al. 1982 ) was used for corn. All dicotyledonous transformation vectors were built on ori pRi vector backbone with kanamycin resistance gene, and the maize transformation vectors were on RK2 oriV replicon with spectinomycin selection (Ye et al., 2011 ). The right and left borders sequences were described previously (Ye et al., 2008 ). The dicotyledonous gusA cassette driven by the CaMV 35S promoter and terminated by the Agrobacterium nos transcription terminator was described (Vancanneyt et al. 1990 , Ye et al. 2008 ). The gusA cassette in maize vector pMON138232 was driven by the rice actin1 ( Os.Act1 ) promoter with an additional 333 bp CaMV enhancer sequence in front of the Os.Act1 first intron (McElroy et al. 1990 ). The gusA cassette in maize vector pMON243847 was driven by a 2181 bp rice tublin - 3 ( TubA-3 ) promoter (GenBank accession No. MH931401). In dicotyledonous transformation, the aadA gene with the chloroplast target sequence ctp2 (Chen et al. 2014 ) driven by Arabidopsis actin 7 ( At.Act7 ) promoter (GenBank accession No. JN400384) and terminated by the Agrobacterium nos transcription terminator was used with spectinomycin for plant selection. In maize transformation, the cp4 epsps coding sequence with the Os.Act1 promoter and the Agrobacterium nos terminator was used for glyphosate selection as described previously (Ye et al. 2011 ). In some vector designs, the splA (sucrose phosphorylase-like gene, GenBank accession No. AE007871, region 153761..155218) gene derived from Agrobacterium Ti plasmid driven by enhanced USP88 (eUSP88) promoter (Bäumlein et al., 1991 ; Wang et al. 2006 ) and terminated by the nos transcription terminator in three dicotyledonous constructs was included to reduce R1 seed screening due to seed abortion phenotype, similar to the approach taken for 2 T-DNA transformation (Fig S1). Some vector designs were simplified to omit this negative selection. The SMG and cre genes were flanked by lox sites for autoexcision. The genetic elements and the T-DNA structure of all binary vectors are depicted in Fig. 1 . Standard cloning procedures were applied for all binary vector construction (Sambrook et al. 1989 ). For seamless fusion between a promoter and cre elements, the hot fusion cloning protocol was used with PCR products bearing 20–25 bp element junction overlaps (Fu et al. 2014 ). Insert Fig. 1 here Agrobacterium preparation and plant transformation A single binary vector was transfected into a nopaline type of Agrobacterium tumefaciens strain by electroporation as described previously (Ye et al. 2008 ). The ABI strain containing gentamicin and kanamycin resistance was used for maize vector transfection using spectinomycin for Agrobacterium selection. The AB30 strain (Ye et al. 2016 ), which is derived from ABI with deletion of kanamycin resistance gene, was used for soybean and canola binary vector transfection which contains kanamycin-resistant gene in the vector backbone for Agrobacterium selection. The AB33 strain, derived from AB30 with VirG I77V mutation (Ye et al. 2016 ) was used for cotton binary vector transfection with kanamycin for Agrobacterium selection (Chen et al. 2014 ). For soybean ( Glycine max ) transformation, the dry meristem explants from the cultivar A3555 were mechanically excised (Calabotta et al. 2013 ). The explants were imbibed for 30 min in inoculation buffer, inoculated with Agrobacterium AB30 suspension containing corresponding binary vectors at OD 600 = 0.3 and sonicated for 20 seconds (Ye et al. 2008 ). The explant co-culture, plant regeneration and growth in green house were described previously (Martinell et al. 2002; Ye et al. 2008 ), except that 150 mg/L spectinomycin instead of glyphosate was used for selection during shoot elongation. For cotton transformation, the dry meristem explants from cotton cultivar DP393 seeds were excised mechanically (Dersch et al. 2015 ). The explants were imbibed in inoculation buffer for 30 min, inoculated with AB33 strain containing binary vectors, and co-cultured for 3–5 days. Plant regeneration was obtained with 150 mg/L spectinomycin selection, which was described in detail previously (Chen et al. 2014 ). Canola hypocotyls explants from canola ( Brassica napus L.) cultivar Ebony were used for canola transformation (Radke et al. 1992 ; Ye et al. 2011 ). Spectinomycin at 100 mg/L instead of glyphosate in the regeneration media was used to recover transgenic canola shoots. The immature embryos of maize elite cultivar LH244 were used for generating maize transgenic plants with glyphosate selection as previous described (Sidorov & Duncan, 2009 ). Molecular analyses R0 regenerants were analyzed for transgene copy number and vector backbone presence or absence by TaqMan® technology (Applied Biosystems). Leaf samples were collected for DNA extraction (Dellaporta et al. 1983 ). For dicotyledonous transgenic plant analysis, the gusA gene as a GOI, the aadA , as well as cre were analyzed for copy number. For maize transgenic plants, the gusA , cp4 epsps and cre were analyzed for copy number. The T-DNA left border (LB) was also detected in all constructs for T-DNA intactness. The TaqMan® detection probes of the gusA , cp4 epsps , LB, and the backbone oriRi in dicotyledonous vectors or RK2 oriV in maize vectors were described previously (Ye et al. 2011 ). The primers 5’- AGCTAAGCGCGAACTGCAAT-3’ (forward) and 5’- GGCTCGAAGATACCTGCAAGA-3’ (reverse) amplifying the aadA gene in the dicotyledonous binary vectors, and further detected by minor grove binding (MGB) TaqMan® probe 6FAM-TGGAGAATGGCAGCGCAATGACA, were used for the dicotyledonous selectable marker gene copy number assay. The primers 5’-CAAGTGACAGCAATGCTGTTTCA-3’ (forward) and 5’-GTCGAAATCAGTGCGTTCGAA-3’ (reverse) amplifying a cre fragment, and the TaqMan® probe 6FAM-CGGTGAACGTGCAAAA were used for cre cassette presence. R1 plants are defined as the progeny produced from self-pollinating the R0 plant, i.e. the primary transformant derived from tissue culture. For R1 progeny screening, leaf samples from the green house grown plantlets were collected for DNA extraction. The GOI ( gusA ), marker gene ( aadA for dicotyledonous, cp4 epsps for maize) and cre gene were assayed for copy number with TaqMan® analysis. The GOI TaqMan® detection positive, but marker and cre TaqMan® detection negative plants were counted as MF lines, and a subset of these marker free lines were partially verified by Southern blot with DIG-labeled probes (Ye et al. 2011 ; Chen et al. 2014 ). In general, for a population of 100 R1 plants, we project a total 75 R1 plants that are positive for the GOI, either as hemizygotes or homozygotes, and 25 null plants, assuming Mendelian segregation of a single locus (1:3 transmission; 1 null : 2 hemizygous : 1 homozygous transgene segregation). The R1 MF frequency is calculated as percentage of the projected transgenic R1 plants. If all 75 of these hemizygous and homozygous R1 plants are negative for the SMG, the calculated marker gene excision frequency would be 100%. Results 1. Soybean marker gene autoexcision P - At.CDC45 - cre showed severe leaky expression in leaves during plant production in soybean transformation The Arabidopsis CDC45 promoter was the first promoter we tested for marker gene autoexcision in soybean transformation. However, plants with the P - At.CDC45 - cre expression in pMON131703 showed a severe mottled leaf phenotype during spectinomycin selection, which suggested that there was premature SMG excision from leaky expression of cre in vegetative tissues (Fig. S2, B). The mottled leaf phenotype could be recovered in soil after removing spectinomycin selection (Fig. S2, C). A decrease in the transformation frequency (TF) was observed in pMON131703 compared to the control plasmid pMON131702 without cre cassette (average 2.3% vs. 5% in 3 parallel comparison experiments, Table S2). Eighty R0 events from pMON131703 with single copy insertion of the GOI were advanced for R1 seed setting. Only one MF R0 event was found to produce aadA marker negative and gusA positive plants by molecular analysis of R1 seeds. To reduce potential cis element impact from the adjacent P-CaMV - gusA cassette, we inserted a 1.2 kb λ-phage fragment between the P-CaMV 35S - gusA and the aadA SMG cassettes in pMON131703 (Fig. 1 ), which resulted in pMON243107. In total 159 phenotypically normal shoots and 80 mottled shoots were produced with combined TF of 2.36%, which is comparable to pMON131703. Twenty-two single copy, backbone free events were selected for R1 marker analysis. Only 6 out of the 22 analyzed R0 soybean events produced MF progeny (Table 2 ). Table 2 R1 MF progeny from soybean plants transformed with pMON243107 ( P-At.CDC45-cre ) Soybean R0 line R1 plants Total gusA +, MF R1 plants Homozygous gusA + MF R1 plants GM_At.CDC45-1 44 23 3 GM_At.CDC45-2 35 26 5 GM_At.CDC45-3 45 6 2 GM_At.CDC45-4 46 10 5 GM_At.CDC45-5 45 7 3 GM_At.CDC45-6 39 17 6 Note : MF: marker free. GM_At.CDC45: Glycine max plant with cre driven by Arabidopsis CDC45 promoter. If 100% marker gene excision is present in the R1 population, we expect 34.5 gusA + and MF plants from a total of 46 R1 plants (i.e. single locus transmission, 1 null: 2 hemizygous : 1 homozygous), and 11.5 homozygous gusA + MF plants out of the total 46 R1 plants. Insert Table 2 here P-Gm.RSP1 - cre showed efficient marker gene excision in soybean transformation The cre expression driven by P-Gm.RSP1 in pMON263552 (Fig. 1 ) showed no apparent reduction in TF and no abnormal phenotypes in soybean transformation, suggesting a lack of significant premature excision with this promoter. R1 seeds from 49 R0 lines that had germline transmission of a single copy transgene were analyzed for marker segregation by TaqMan® assay. As shown in Table 3 , all 49 events produced aadA negative, gusA positive R1 plants, indicating that efficient SMG excision occurred in this construct. In addition, 30 of the 49 events generated three or more MF, homozygous seeds out of 46 planted seeds. Overall, the frequency of MF R1 transgenic plants is 41% [686/(2226x75%)] out of the total projected gusA positive plants (2226x75%), with the same homozygous MF frequency 41% [228/(2226x25%)] out of the total projected homozygous gusA positive plants (2226x25%). Table 3 R1 MF progeny from soybean plants transformed with pMON263552 ( P-Gm.RSP1-cre ) Soybean R0 line Total R1 analyzed Total gusA + MF R1 plants Homozygous gusA + MF R1 plants GM_RSP-1 46 6 1 GM_RSP-2 41 7 0 GM_RSP-3 46 7 1 GM_RSP-4 39 14 3 GM_RSP-5 46 12 2 GM_RSP-6 43 12 7 GM_RSP-7 46 21 4 GM_RSP-8 42 14 4 GM_RSP-9 46 4 1 GM_RSP-10 43 12 4 GM_RSP-11 46 18 6 GM_RSP-12 45 18 10 GM_RSP-13 46 6 1 GM_RSP-14 40 9 3 GM_RSP-15 46 26 11 GM_RSP-16 41 24 8 GM_RSP-17 46 5 4 GM_RSP-18 44 21 11 GM_RSP-19 46 17 2 GM_RSP-20 45 15 11 GM_RSP-21 45 22 5 GM_RSP-22 43 12 2 GM_RSP-23 46 7 3 GM_RSP-24 45 13 3 GM_RSP-25 46 5 0 GM_RSP-26 44 Epidermal Epidermal GM_RSP-27 46 15 5 GM_RSP-28 44 9 2 GM_RSP-29 44 10 1 GM_RSP-30 44 16 2 GM_RSP-31 46 12 2 GM_RSP-32 44 22 4 GM_RSP-33 46 22 4 GM_RSP-34 44 10 5 GM_RSP-35 45 12 2 GM_RSP-36 42 9 2 GM_RSP-37 46 17 10 GM_RSP-38 45 12 1 GM_RSP-39 46 19 6 GM_RSP-40 43 10 3 GM_RSP-41 46 15 9 GM_RSP-42 41 17 7 GM_RSP-43 46 11 4 GM_RSP-44 43 29 15 GM_RSP-45 46 8 0 GM_RSP-46 45 26 15 GM_RSP-47 45 13 6 GM_RSP-48 45 19 13 GM_RSP-49 46 14 1 GM_RSP-50 46 12 2 Total 2226 686 228 Note : GM_RSP: Glycine max plant with cre driven by soybean RSP1 promoter. Epidermal-all transgene detection negative in all R1 plants, suggesting that only epidermal cells were transformed in R0. If 100% marker gene excision is present in the R1 population, out of a total 46 R1 plants we expect 34.5 MF gusA + plants and 11.5 homozygous gusA + MF plants. Insert Table 3 here The MF progenies in the R1 generation were also further confirmed by Southern blot analysis. Twenty-nine R1 plants from 24 R0 single copy lines were randomly selected for DNA extraction and tested with both aadA and gusA probes . As shown in Fig. 2 , the selected R1 events were further confirmed to be MF by Southern blot. Lanes 5a, 5b, and 21 showed 2 bands, which indicated an error call in R0 TaqMan® copy number assay. We determined that the R0 copy number assay is approximately 90% accuracy as revealed by R1 MF copy number assay, which is more accurate to distinguish hemi- or homozygous transgenic plants in R1 plants. The faint or no signal bands of gusA probe were largely due to uneven DNA loads and were confirmed by extended film exposure. These results further confirm that TaqMan® analyzed R1 plants were aadA marker negative and gusA positive. Insert Fig. 2 here A construct with Arabidopsis AtpE intron at P-Gm.RSP1 3’ showed reduced marker gene excision efficiency in soybean transformation Considering the efficient marker gene autoexcision with P-Gm.RSP1 - cre in pMON263552 (Table 3 ), we hypothesized that adding an intron at 3’ end of the promoter may further increase marker gene excision frequency. The Arabidopsis intron, I - At.AtpE , was selected to enhance the P - Gm.RSP1 expression, and an P-eUSP88 - splA expression cassette, which is a seed lethal cassette, was placed between the gusA and cre cassettes to reduce R1 analysis (Fig. S1, D), which resulted in pMON291996. No obvious TF decrease or any abnormal phenotype was observed in the transgenic shoots from pMON291996 transformation compared to regular constructs. Seeds from 15 R0 single copy events were planted for MF excision to be confirmed by TaqMan® analysis for gusA and aadA transgene probes. In pMON291996, we observed a drastically reduced marker gene excision efficiency compared to pMON263552 (Table 3 ). Only 10 out of 15 R0 events produced marker free progeny, with few hemizygous MF gusA positive R1 plants, and only two of those events produced one homozygous R1 plant (Table 4 ). Overall, the frequency of MF gusA positive R1 plants is 7.6% [37/(651x75%)] out of total 488 projected gusA + plants (homozygous and hemizygous) (651x75%), with a poor homozygous MF frequency of 1.2% [2/(651x25%)] out of the total 162 projected homozygous gusA + plants (651x25%). Table 4 R1 MF progeny from soybean plants transformed with pMON291996 ( P-Gm.RSP1 + I- At.AtpE-cre ) Soybean R0 line Analyzed R1 plants gusA + MF R1 plants Homozygous gusA + MF R1 plants GM_RSP-Int-1 42 4 0 GM_RSP-Int-2 42 0 0 GM_RSP-Int-3 45 11 1 GM_RSP-Int-4 44 1 0 GM_RSP-Int-5 44 1 0 GM_RSP-Int-6 44 1 0 GM_RSP-Int-7 45 0 0 GM_RSP-Int-8 40 0 0 GM_RSP-Int-9 45 6 1 GM_RSP-Int-10 44 4 0 GM_RSP-Int-11 40 1 0 GM_RSP-Int-12 43 0 0 GM_RSP-Int-13 45 0 0 GM_RSP-Int-14 40 4 0 GM_RSP-Int-15 39 4 0 Total 651 37 2 Note : GM_RSP-Int: Glycine max plant with cre driven by soybean RSP1 promoter and Arabidopsis AtpE intron. If 100% marker gene excision presents in R1 population, out of a total 45 R1 plants we expect 33.75 MF gusA + plants and 11.25 homozygous gusA + MF plants. Insert Table 4 here 2. Cotton marker gene autoexcision The Arabidopsis CDC45 promoter enabled efficient marker gene excision in cotton but decreased TF Because of promising marker gene autoexcision result in the initial soybean transformation with P-At.CDC45 - cre (Table 2 ), we tested pMON131703 ( P - At.CDC45 - cre ) with the control binary vector pMON131702 (without the cre cassette) side-by-side in cotton transformation for autoexcision efficiency and TF impact. The autoexcision construct pMON131703 also showed lower transformation frequencies and had mottled leaf phenotypes in some cotton events (Fig. S2, E). On average a TF of 1.25% was observed compared to 4.2% with the control construct in four separate experiments (Fig. S3). Approximately 23% of R0 events are chimeric or epidermal transformation, and 45% (41/91) single copy R0 lines were following the Mendelian segregations (Table S3). Ninety-one R0 events were harvested with seeds. In total, 58 out of 91 R0 events of one or two copy gusA transgene inserts produced MF R1 progeny, among which 41 R0 events produced 55–95% MF gusA positive R1 plants of the projected total gusA positive R1 plants (assuming 75% of total seeds for single locus). The MF autoexcision from pMON131703 in cotton was further verified by Southern blot. Eight R1 events negative for marker and four R1 events positive for marker identified by the TaqMan® assay were selected. The total genomic DNA was digested with HindIII , and hybridized with DIG-labeled aadA (marker) or gusA (GOI) probe. As shown in Fig. 3 , the Southern blot confirmed that all eight events detected to be marker negative by TaqMan® were negative by Southern analysis, and the four control events detected to be marker positive by Taqman® marker positive were also aadA positive by Southern blot, suggesting that the Taqman® assay is accurate and consistent for transgene presence. Overall, the results from pMON131703 in cotton transformation indicate that Arabidopsis CDC45 promoter driving cre expression in cotton was suitable for efficient marker gene removal. Insert Fig. 3 here We tested more constructs using this promoter in cotton with different expression cassette configurations to mitigate the TF reduction, including pMON243107 (with 1.2 kb l phage spacer sequence and marker gene between gusA and cre cassettes) and pMON244545 (no spacer sequence) with the same Arabidopsis CDC45 promoter (Fig. 1 ). Both pMON243107 and pMON244545 still showed reduced transformation frequencies (1.45% and 0.89%, respectively) compared to the control construct pMON131702 or other constructs without the cre cassette (3–5%) (data not shown). Abnormal leaf phenotype was observed in half of the regenerating shoots in the two constructs (Fig. S2, E), suggesting that leaky cre expression can be causing the premature marker excision. All shoots were recovered to normal growth phenotype in soil and set seeds as we used aadA /spectinomycin no-lethal selection system. Fifteen R0 single copy event progeny seeds for either construct were planted to test for marker autoexcision. Leaf samples from 40 R1 plantlets per R0 event were assayed for the gusA and aadA copy number. Efficient marker gene autoexcision was observed in both constructs with the best performance of 50–100% projected gusA + transgenic plants (i.e. 75% of total seeds) showing marker gene absence and high numbers of homozygous MF plants in the R1 generation among the majority of germline transmission events (Table 5 ). On average, 68% total projected gusA + transgenic R1 cotton seedlings [578/(1122 x75%)] are GOI positive, MF, and 67.7% [190/(1122 x25%)] of the projected R1 gusA + homozygous seeds were confirmed as homozygous MF in R1 population. Table 5 R1 MF progeny from cotton plants transformed with pMON243107 (with spacer) and pMON244545 (no spacer) containing P-At.CDC45-cre cassette Construct Cotton R0 event R1 total gusA + MF R1 plants Homozygous gusA + MF R1 plants pMON243107 GH_At.CDC45-1 40 Epidermal Epidermal pMON243107 GH_At.CDC45-2 40 0 0 pMON243107 GH_At.CDC45-3 40 4 1 pMON243107 GH_At.CDC45-4 36 Epidermal Epidermal pMON243107 GH_At.CDC45-5 40 24 6 pMON243107 GH_At.CDC45-6 40 30 8 pMON243107 GH_At.CDC45-7 40 24 7 pMON243107 GH_At.CDC45-8 40 28 9 pMON243107 GH_At.CDC45-9 40 23 5 pMON243107 GH_At.CDC45-10 40 19 6 pMON243107 GH_At.CDC45-11 40 29 8 pMON243107 GH_At.CDC45-12 40 26 7 pMON243107 GH_At.CDC45-13 40 25 7 pMON243107 GH_At.CDC45-14 40 29 8 pMON243107 GH_At.CDC45-15 40 19 4 pMON244545 GH_At.CDC45-16 40 22 7 pMON244545 GH_At.CDC45-17 40 35 14 pMON244545 GH_At.CDC45-18 40 22 8 pMON244545 GH_At.CDC45-19 38 25 9 pMON244545 GH_At.CDC45-20 40 30 8 pMON244545 GH_At.CDC45-21 40 24 10 pMON244545 GH_At.CDC45-22 35 33 17 pMON244545 GH_At.CDC45-23 34 23 5 pMON244545 GH_At.CDC45-24 35 15 3 pMON244545 GH_At.CDC45-25 37 28 8 pMON244545 GH_At.CDC45-26 27 22 18 pMON244545 GH_At.CDC45-27 40 14 5 pMON244545 GH_At.CDC45-28 40 5 2 pMON244545 GH_At.CDC45-29 40 0 0 Total 1122 578 190 Note : GH_At.CDC45: Gossypium herbaceum plant with cre driven by Arabidopsis CDC45 promoter . Epidermal-no R1 germline transgene transmission. If 100% marker gene excision presents in R1 population, we expect total 30 MF R1 plants and 10 homozygous MF R1 plants from total 40 R1 plants. Insert Table 5 here pMON291996 with P-Gm.RSP1 + I-At.AtpE-cre confers highly efficient marker gene excision in cotton transformation We tested pMON291996 which included P-Gm.RSP1 + I-At.AtpE-cre autoexcision cassette and a P-eUSP88 - splA seed abortion expression cassette (Fig. S1) to reduce R1 analysis. While we observed that the reduced soybean marker gene autoexcision in this construct compared to pMON263552, this construct showed the highest efficiency of marker gene excision for cotton that we have tested in this study without obvious negative TF compromise [TF = 5.65%, which was comparable to non-autoexcision control constructs (data not shown)]. On average, 69% of the total projected R1 gusA + transgenic lines [392/(750 x75%)] are GOI positive, MF, and 53% of the projected R1 gusA + homozygous transgenic plants [100/(750 x25%)] were confirmed to be homozygous MF (Table 6 ). Table 6 R1 MF progeny from cotton plants transformed with pMON291996 ( P-Gm.RSP1 + I-At.AtpE-cre ) Cotton R0 event R1 plant sample # gusA + MF R1 plants Homozygous gusA + MF R1 plants GH_RSP-Int-1 50 29 2 GH_RSP-Int-2 50 20 7 GH_RSP-Int-3 50 0 0 GH_RSP-Int-4 50 30 8 GH_RSP-Int-5 50 20 11 GH_RSP-Int-6 50 Epidermal Epidermal GH_RSP-Int-7 50 33 6 GH_RSP-Int-8 50 34 6 GH_RSP-Int-9 50 28 9 GH_RSP-Int-10 50 29 6 GH_RSP-Int-11 50 33 5 GH_RSP-Int-12 50 32 11 GH_RSP-Int-13 50 37 8 GH_RSP-Int-14 50 31 12 GH_RSP-Int-15 50 36 9 Total 750 392 100 Note : GH_RSP-Int: Gossypium herbaceum plant with cre driven by soybean RSP1 promoter and Arabidopsis AtpE intron. If 100% marker gene excision presents in R1 population, we expect total 37.5 MF R1 plants (75%), and 12.5 homozygous MF R1 plants (25%) from total 50 R1 plants. Insert Table 6 here 3. Canola marker gene autoexcision Four cre autoexcision cassettes with P - At.CDC45 , P - Gm.RSP1 , P - Br.nap (canola napin gene), or P-Vf.eUSP88 promoter (Fig. 1 ) were tested in canola transformation for SMG autoexcision based on our promising results from soybean for the CDC45 and RSP1 promoters as well as the embryo specific autoexcision in canola (Kopertekh et. al., 2009 ). The construct with P-At.CDC45 promoter expressing the cre cassette showed a decreased TF and speckling phenotype, while the transformation frequencies for the other three constructs were comparable to our regular construct transformation (data not shown). Eight to 12 single copy R0 events and 88 R1 per event were evaluated for MF progeny for each of the four constructs. Seven out of nine R0 events from the construct containing At.CDC45 promoter produced MF R1 plants. However, on average only 4.8% total projected gusA + seeds (29/(792x75%) were confirmed to be MF by TaqMan® assay (Table 7 ). Table 7 R1 MF progeny from canola plants transformed with pMON243107 ( P-At.CDC45-Cre ) R0 event R1 total Total gusA + MF R1 plants Homozygous gusA + MF R1 plants BN_At.CDC45-1 88 7 2 BN_At.CDC45-2 88 3 0 BN_At.CDC45-3 88 11 6 BN_At.CDC45-4 88 0 0 BN_At.CDC45-5 88 2 3 BN_At.CDC45-6 88 4 0 BN_At.CDC45-7 88 1 0 BN_At.CDC45-8 88 0 0 BN_At.CDC45-9 88 1 0 Total 792 29 11 Note : BN_At.CDC45: Brassica napus plant with Arabidopsis CDC45 promoter driven cre . If 100% marker gene excision presents in R1 population, we expect total 66 MF R1 plants (75%) and 22 homozygous MF plants (25%) from total 88 plantlets Insert Table 7 here Only one out of 12 R0 events from the construct with soybean RSP1 promoter [pMON417179 ( P - Gm.RSP-1 - cre )] generated MF R1 progeny after analyzing 88 plantlets from each R0 event (Table S4). No MF R1 plant was obtained from the construct containing napin promoter [pMON263567 (P- Br.nap - cre -T- Br.nap )] after analyzing R1 progenies from nine single copy R0 events (Table S5). The most effective marker gene excision was recovered from pMON420845 with eUSP88 promoter. Seeds from eight single copy R0 events were planted and sampled for R1 MF progeny screening with GOI and aadA TaqMan® probes. All eight R0 events produced MF R1 progeny with seven R0 events producing homozygous MF plants. On average 32.7% of the projected gusA + transgenic R1 [173/(704x75%)] are verified to be truly MF by TaqMan® assay, among which 37.5% of the projected homozygous gusA + transgenic R1 progenies [66/(704x25%)] were confirmed to be MF by TaqMan® assay (Table 8 ). Table 8 R1 MF progeny from canola plants transformed with pMON420845 ( P-Vf.eUSP88 - cre ) R0 event R1 total Total gusA + MF R1 plants Homozygous gusA + MF R1 plants BN_eUSP88-1 88 12 4 BN_eUSP88-2 88 24 12 BN_eUSP88-3 88 1 0 BN_eUSP88-4 88 33 13 BN_eUSP88-5 88 42 15 BN_eUSP88-6 88 5 4 BN_eUSP88-7 88 32 6 BN_eUSP88-8 88 24 12 Total 704 173 66 Note : BN_eUSP88: Brassica napus plant with Vicia faba enhanced USP88 promoter driven cre . If 100% marker gene excision presents in R1 population, we expect total 66 MF R1 plants (75%) and 22 homozygous MF plants (25%) from total 88 plantlets Insert Table 8 here 4. Marker-gene autoexcision in maize transformation The initial promising SMG autoexcision in soybean transformation with the Arabidopsis CDC45 promoter directly inspired us to search for monocot homologous promoters for maize SMG autoexcision. These vectors showed no obvious impact on maize TF when they were used for marker gene autoexcision in maize. However, other CDC45 promoters tested, including one at maize chromosome 10 (GenBank accession NC_050105.1, region 2024417..2026424) and one at rice chromosome 12 (GenBank accession NC_029267.1, region 1187144..1189143), showed a TF drop when used for marker gene autoexcision in maize transformation, suggesting leaky expression in vegetative tissue (data not shown). The rice and maize CDC45-1 promoters showed similar marker gene autoexcision efficiency in maize LH244 immature embryo transformation. All 9 R0 events from pMON243847 with rice CDC45-1 promoter showed on average 44% marker removal from total projected gusA + transgenic R1 [113/(339x75%)], and 40% [34/(339x25%)] marker removal in the projected homozygous gusA + transgenic R1 plants (Table 9 ). Table 9 R1 MF progeny from maize plants transformed with pMON243847 ( P-Os.CDC45-Cre ) Maize R0 event R1 total Total gusA + MF R1 plant Homozygous gusA + MF R1 plants ZM_Os.CDC45-1 41 14 6 ZM_Os.CDC45-2 18 9 1 ZM_Os.CDC45-3 41 13 2 ZM_Os.CDC45-4 34 19 7 ZM_Os.CDC45-5 41 12 5 ZM_Os.CDC45-6 41 14 4 ZM_Os.CDC45-7 41 10 1 ZM_Os.CDC45-8 41 6 0 ZM_Os.CDC45-9 41 16 8 Total 339 113 34 Note : ZM_Os.CDC45: Zea mays plant with rice CDC45 promoter driven cre . If 100% marker gene excision presents in R1 population, we expect total 30.75 MF R1 plants (75%) and 10.25 homozygous MF plants (25%) from total 41 plantlets (i.e. single locus transmission, 1 null: 2 homozygous: 1 hemizygous). Insert Table 9 here Similarly, R1 seeds from 10 single copy R0 events from pMON138232 with maize CDC45-1 promoter were analyzed for MF segregation (Table 10 ). All 10 R0 events produced MF progeny at 41% [101/(328x75%)] frequency of the total projected gusA + transgenic plants, and 19.5% [16/(328x25%)] of the projected homozygous plants. Table 10 R1 MF progeny from maize plants transformed with pMON138232 ( P-Zm.CDC45-Cre ) Maize R0 event R1 total Total gusA + MF R1 plant Homozygous gusA + MF R1 plants ZM_Zm.CDC45-1 41 9 2 ZM_Zm.CDC45-2 40 8 0 ZM_Zm.CDC45-3 39 10 2 *ZM_Zm.CDC45-4 40 14 3 ZM_Zm.CDC45-5 17 6 0 ZM_Zm.CDC45-6 17 7 1 ZM_Zm.CDC45-7 22 8 3 ZM_Zm.CDC45-8 41 13 3 ZM_Zm.CDC45-9 41 12 0 ZM_Zm.CDC45-10 30 14 2 Total 328 101 16 Note : ZM_Zm.CDC45: Zea mays plant with maize CDC45 promoter driven cre. *ZM_ Zm.CDC45-4 has 45 green plants and 13 albinos dying later. Insert Table 10 here The MF nature in pMON138232 R1 plants was further confirmed by Southern blot. Twenty TaqMan® screened MF R1 plants from Table 10 were sampled for DNA extraction and analyzed by Southern blot. The same Southern blot membrane was hybridized with DIG labeled gusA probe, then stripped and re-hybridized with DIG labeled cre probe. As shown in Fig. 4 , all 20 selected lines did not hybridize with the cre probe, whereas all showed a clear signal with the gusA probe, which is consistent with the TaqMan® screening results. Insert Fig. 4 here Discussion Many efficient transformation systems require tissue culture and plant regeneration under antibiotic or herbicide selection. The Cre /loxP recombination system, which allows for transgenic plant selection under tissue culture conditions followed by selectable marker removal, has been widely reported in many species. The SMG autoexcision to generate MF plants can be obtained by using heat-, cold-, drought- or chemically inducible promoters. An ideal promoter to drive the cre recombinase for marker gene autoexcision should have no leaky expression in vegetative tissues during the tissue culture steps to allow transgenic shoot development under selection. We envisioned that reproductive tissue specific (floral-, meiosis-, microspore-, pollen- or egg-specific) promoters may be the most suitable for this purpose. Since transgenic plants with hemizygous alleles must take one more generation for homozygous line production, floral or meiosis promoters working in both male and female germline cells are highly desirable for marker gene autoexcision. Other promoters, such as soybean RSP1 with background level expression in vegetative tissues but significant expression in germline cells, may be a good option as well if the TF is not impacted due to premature excision. Premature marker gene excision and transformation system The Arabidopsis CDC45 promoter was found to be promising for SMG autoexcision in our soybean transformation system. The CDC45 gene is reported to be required for initiation of DNA replication and mainly upregulated at the G1/S transition and in young meiotic flower buds (Stevens et al., 2004 ). The promoter has enabled us to obtain MF transgenic plants in soybean, cotton, and canola, albeit with decreased TF and mottle leaf phenotype. It is also surprising to see the dicotyledonous CDC45 promoter is active in maize (Table S6) which produced some MF lines without a decrease in the TF, suggesting that a common expression motif may be present in the promoter for both dicotyledonous and monocot expression. We observed a decrease in the TF and mottled phenotype in leaf tissues with the At.CDC45 promoter driving cre expression in our dicotyledonous transformation system. One explanation is that the expression of cre with the At.CDC45 promoter in vegetative tissues could have resulted in premature marker gene removal during plant regeneration under selection. However, we were still able to recover some of the events with the mottled leaf phenotype. We use an aadA/spectinomycin non-lethal selection system for dicotyledonous transformation (Martinell et al., 2011 ; Chen et al., 2014 ). Spectinomycin binds to the 16S rRNA, which blocks translation on the prokaryotic type 70S plastid ribosomes and usually induces albino leaves in dicotyledonous transformation (Svab et al., 1990 ). Premature marker removal during tissue culture in this non-lethal selection system still allows a portion of the chimeric transgenic/non-transgenic tissue to survive for shoot regeneration. The MF areas on leaves are bleached by spectinomycin and produce a mottled phenotype. The transgenic plants with such phenotypes can be fully recovered in soil as chlorophyll biosynthesis resumes after the spectinomycin selection is removed. Therefore, the success of MF seed production with the leaky CDC45 promoter is unique to our non-lethal selection system, which may not be replicated in other lethal selection transformation systems. Several developmentally regulated promoters have been used in floral dip transformation system (Van Ex et al., 2007; Verweire et al., 2007 ). In such a non-tissue culture system, vegetative leaky expression is not a concern as the T1 transformants directly come from the egg cells during flowering. Leaky expression can be an advantage to remove the SMG in T1 during seed germination. The Arabidopsis CLV3 has been reported to generate 100% marker removal in T2 plants (Van Ex et al., 2007), which is not feasible for transformation system based on tissue culture, because the CLV3 gene is expressed mainly in shoot apical meristems, which will lead to marker excision during shoot regeneration under selection. Indeed, when we used the Arabidopsis meristem-specific Erecta promoter (Yokoyama et al., 1998 ) for autoexcision in soybean, the TF dropped greatly (data not shown). The system using BBM/WUS2 for plant transformation is unique, in which plant regeneration depends on BBM/WUS2 expression in initial tissue culture materials after embryo induction followed by removal of both embryogenic genes. Both developmentally regulated and inducible promoters have been used to excise the BBM/WUS2 expression to enable plant regeneration and the excision frequency was counted as R0 MF events (Wang et al. 2020 ). Such a system may not be applied on other tissue culture-based transformation systems as a selectable marker gene is required for transgenic tissue proliferation. Autoexcision activity of a cre promoter may be different among species and germplasms A specific cre promoter often shows very different autoexcision pattern in different species, dependent on the transformation and selection methods. In addition to the At.CDC4 5 promoter mentioned above, the best canola autoexcision promoter from Vicia faba, eUSP88 , produces much less marker gene autoexcision in soybean. The eUSP88 promoter appeared to be highly specific in embryos in soybean and canola, and no expression in callus (Bäumlein et al., 1991 ; Wang et al. 2006 ). In our canola experiments, hypocotyl materials were used for transformation and plant regeneration requires callus formation. When canola embryonic materials were used for transformation, we noticed a large reduction with the same autoexcision construct, suggesting that the eUSP88 drives expression in embryo tissue which caused premature marker gene excision. Previously, an embryo-specific app1 promoter from Arabidopsis pei1 gene was reported to drive marker gene autoexcision in soybean embryogenic culture transformation by particle bombardment and resulted in 30% R0 events with MF progeny (Li et al., 2007 ). The eUSP88 promoter expression is similar to the app1 promoter in the early heart stage to the late cotyledon stage of embryo development (Bäumlein et al., 1991 ). The Gm.RSP1 promoter showed the best marker autoexcision frequency among the tested promoters in soybean transformation. However, it performed poorly in canola, suggesting that the expression is limited to the species or the transformation system. The construct with the Gm.RSP1 promoter and At.AtpE intron has very different excision frequency in soybean and cotton. It gave poor autoexcision in soybean (Table 4 ) but showed the best autoexcision frequency in cotton transformation (Table 6 ). It is plausible that the cre cassette with the Arabidopsis intron is poorly expressed in soybean by not properly splicing. A napin promoter has been reported to enable efficient marker gene excision in Brassica napus (Kopertekh et al., 2009 ). We tested a seed-specific napin promoter (Fig. S1, A, B) in canola for marker autoexcision and did not observe any marker gene excision in R1 progeny. Sequence BLAST analysis revealed different napin promoters in GenBank are highly similar in the last 300 bp (data not shown). The marker excision difference in the two napin promoters may be due to different germplasms being used in the experiments or different expression patterns between the two similar embryo-specific napin promoters. Chimera marker gene excision may occur in R0 and but not in progeny Non-specific cre expression in vegetative tissues and non-germline cell expression may be the major reason for chimeric marker excision in R0 plants, which is often associated with a decrease in TF and potential phenotypes such as mottle leaves in our soybean and cotton transformation systems with non-lethal aadA selectable marker. In addition to reported strong meiotic cell expression, the At.CDC45 promoter appears to be leaky in leaf tissue in all three dicotyledonous species we tested, which formed chimera leaves in R0 events (Fig. S2 B, E). However, the R1 seeds are derived from single reproductive cells, in which the marker is excised either in vegetative tissues or during flowering due to the strong activity at meiosis (Stevens et al., 2004 ), and for this reason, no chimera excision has been observed in R1 MF plants. Cre driven by embryo-specific promoters are more likely to form chimeric R0 events. Li et al. ( 2007 ) reported that the 13% complete excision and 31% chimeric excision were observed in R0 soybean plants when the app1 promoter was used for autoexcision. Moravcíková et al. ( 2008 ) reported that the cre driven by Arabidopsis cruciferin C promoter regenerated chimeric T0 plant, only 10.2% T1 plant showed complete marker excision, and the excision rate was increased by repeated cre activation in T2 plants, which may indicate that the cruciferin promoter is expressed in late embryo stage and not a vegetative or germline preferred promoter. We did not observe chimeric marker excision in canola plants from eUSP88-cre autoexcision after two generation observation, indicating earlier embryo expression present in this promoter as confirmed in Fig S1, D, which caused embryo complete abortion when splA is expressed. Conclusion remark The Cre/ loxP system is an effective tool for removal of SMGs in transgenic plants. Efficient marker gene autoexcision by a developmentally regulated promoter is often species dependent. We tested a diverse set of promoters in multiple agriculturally important crop species, and identified promising promoters for soybean, cotton, canola and maize marker gene autoexcision. Testing of specific promoters for good marker excision efficiency remains an option for many plant species. Declarations Author contribution statement XY nominated promoters, constructed plasmids, collected data, coordinated work, and drafted the manuscript. ZV nominated promoters, constructed plasmids, did all Southern blot analyses. EJW performed portion of soybean transformation. FC constructed plasmids. LJ conducted maize progeny molecular analyses. FL performed canola transformation. ELH and SXG organized canola experiments. LF designed TaqMan ® assays. LG introduced Cre/ loxP technology to us and critically revised the manuscript. All authors reviewed and approved the manuscript. Acknowledgment We sincerely thank numerous former Monsanto colleagues in Middleton, Wisconsin; Davis, California; Mystic, Connecticut and St. Louis, Missouri for transgenic plant production, greenhouse care and molecular analyses. Special thanks to Drs. David Somers and Doug Boyes for supporting this research and Drs. Jenn To, Miguel Vega-Sanchez, Bertho Lieselot and Julie Francois for critical review of the manuscript. Conflict of interest The authors are employees of Bayer Crop Science, a manufacturer of seeds produced by conventional and biotechnology methods. A relevant US patent application has been submitted and assigned to Bayer Crop Science. References Bai X, Wang Q, Chu C (2008) Excision of a selective marker in transgenic rice using a novel Cre/ loxP system controlled by a floral specific promoter. Transgenic Res 17:1035–1043. https://doi:10.1007/s11248-008-9182-7 Bäumlein H, Boerjan W, Nagy I, Bassüner R, Van Montagu M, Inzé D, Wobus U (1991) A novel seed protein gene from Vicia faba is developmentally regulated in transgenic tobacco and Arabidopsis plants. Mol Gen Genet 225:459–467. https://doi:10.1007/BF00261688 Bayley CC, Morgan M, Dale EC, Ow DW (1992) Exchange of gene activity in transgenic plants catalyzed by the Cre- lox site-specific recombination system. Plant Mol Biol 18(2):353–361. https:// doi: 10.1007/BF00034962 Calabotta BJ, Deppermann KL, Dersch E, Heise JD, Koestel AR, Ludwig CL, Martinell BJ, Williams E (2013) Preparation and use of plant embryo explants for transformation. US Pat. US8362317B2 Chen Y, Rivlin A, Lange A, Ye X, Vaghchhipawala Z, Eisinger E, Dersch E, Paris M, Martinell B, Wan Y (2014) High throughput Agrobacterium tumefaciens -mediated germline transformation of mechanically isolated meristem explants of cotton ( Gossypium hirsutum L .). Plant Cell Rep 33(1):153–164. https:// doi: 10.1007/s00299-013-1519-x Chong-Pérez B, Reyes M, Rojas L, Ocaña B, Ramos A, Kosky RG, Angenon G (2013) Excision of a selectable marker gene in transgenic banana using a Cre/ lox system controlled by an embryo specific promoter. Plant Mol Biol 83(1–2):143–152. https:// doi: 10.1007/s11103-013-0058-8 Cuellar W, Gaudin A, Solórzano D, Casas A, Nopo L, Chudalayandi P, Medrano G, Kreuze J, Ghislain M (2006) Self-excision of the antibiotic resistance gene nptII using a heat inducible Cre- loxP system from transgenic potato. Plant Mol Biol 62(1–2):71–82. https://doi:10.1007/s11103-006-9004-3 Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation: version II. Plant Mol Biol Rep 1:19–21. https://doi.org/10.1007/BF02712670 Depicker A, Stachel S, Dhaese P, Zambryski P, Goodman HM (1982) Nopaline synthase: transcript mapping and DNA sequence. J Mol Appl Genet 1:561–573 Dersch E, Heinzen RJ, Martinell BJ, Rivlin A, Wan Y, Ye X (2015) Method of meristem excision and transformation. US Pat. No. US8937216B2 Du D, Jin R, Guo J, Zhang F (2019) Construction of marker-free genetically modified maize using a heat-inducible autoexcision vector. Genes 10:374. https://doi:10.3390/genes10050374 Éva C, Téglás F, Zelenyánszki H, Tamás C, Juhász A, Mészáros K, Tamás L (2018) Cold inducible promoter driven Cre- lox system proved to be highly efficient for marker gene excision in transgenic barley. J Biotechnol 265:15–24. https://doi:10.1016/j.jbiotec.2017.10.016 Fu C, Donovan WP, Shikapwashya-Hasser O, Ye X, Cole RH (2014) Hot Fusion: an efficient method to clone multiple DNA fragments as well as inverted repeats without ligase. PLoS One 9(12):e115318. https://doi.org/10.1371/journal.pone.0115318 García-Almodóvar RC, Petri C, Padilla IMG, Burgos L (2014) Combination of site-specific recombination and a conditional selective marker gene allows for the production of marker-free tobacco plants. Plant Cell Tiss Organ Cult 116:205–215. https://doi.org/10.1007/s11240-013-0396-x Gidoni D, Srivastava V, Carmi N (2008) Site-specific excisional recombination strategies for elimination of undesirable transgenes from crop plants. In Vitro Cell Dev Biol Plant 44:457–467. https://doi.org/10.1007/s11627-008-9140-3 Gilbertson L (2003) Cre- lox recombination: Cre-ative tools for plant biotechnology. Trends Biotechnol 21:550–555. https://. doi Hare P, Chua NH (2002) Excision of selectable marker genes from transgenic plants. Nat Biotechnol 20(6):575–580. https:// doi: 10.1038/nbt0602-575 Huang S, Gilbertson LA, Adams TH, Malloy KP, Reisenbigler EK, Birr DH, Snyder MW, Zhang Q, Luethy MH (2004) Generation of marker-free transgenic maize by regular two-border Agrobacterium transformation vectors. Transgenic Res 13:451–461. https://doi:10.1007/s11248-004-1453-3 Kopertekh L, Broer I, Schiemann J (2009) Developmentally regulated site-specific marker gene excision in transgenic B. napus plants. Plant Cell Rep 28:1075–1083. https://doi:10.1007/s00299-009-0711-5 Kopertekh L, Schulze K, Frolov A, Strack D, Broer I, Schiemann J (2010) Cre-mediated seed-specific transgene excision in tobacco. Plant Mol Biol 72:597–605. https://doi:10.1007/s11103-009-9595-6 Li Z, Xing A, Moon BP, Burgoyne SA, Guida AD, Liang H, Lee C, Caster CS, Barton JE, Klein TM, Falco SC (2007) A Cre/ loxP -mediated self-activating gene excision system to produce marker gene free transgenic soybean plants. Plant Mol Biol 65:329–341. https://doi:10.1007/s11103-007-9223-2 Luo K, Duan H, Zhao D, Zheng X, Deng W, Chen Y, Stewart CN Jr, McAvoy R, Jiang X, Wu Y, He A, Pei Y, Li Y (2007) 'GM-gene-deletor': fused loxP-FRT recognition sequences dramatically improve the efficiency of FLP or CRE recombinase on transgene excision from pollen and seed of tobacco plants. Plant Biotechnol J 5:263–274. https://doi:10.1111/j.1467-7652.2006.00237.x Ma BG, Duan XY, Niu JX, Ma C, Hao QN, Zhang LX, Zhang HP (2009) Expression of stilbene synthase gene in transgenic tomato using salicylic acid-inducible Cre/ loxP recombination system with self-excision of selectable marker. Biotechnol Lett 31:163–169. https://doi:10.1007/s10529-008-9843-x Martinell BJ, Julson LS, Emler CA, Huang Y, McCabe DE, Williams EJ (2022) Soybean agrobacterium transformation method. US Patent No. US6384301B1 Martinell BJ, Petersen MW, Somers DA, Wan Y, Williams E, Ye X (2011) Methods for plant transformation using spectinomycin selection. US Patent No. US8030544B2 McElroy D, Zhang W, Cao J, Wu R (1990) Isolation of an efficient actin promoter for use in rice transformation. Plant Cell 2:163–171. https://doi:10.1105/tpc.2.2.163 Miki B, McHugh S (2004) Selectable marker genes in transgenic plants: applications, alternatives and biosafety. J Biotech 107:193–232. https://doi:10.1016/j.jbiotec.2003.10.011 Mookkan M, Nelson-Vasilchik K, Hague J, Zhang ZJ, Kausch AP (2017) Selectable marker independent transformation of recalcitrant maize inbred B73 and sorghum P898012 mediated by morphogenic regulators BABY BOOM and WUSCHEL2. Plant Cell Rep 36:1477–1491. https://doi:10.1007/s00299-017-2169-1 Moravcíková J, Vaculková E, Bauer M, Libantová J (2008) Feasibility of the seed specific cruciferin C promoter in the self excision Cre/ loxP strategy focused on generation of marker-free transgenic plants. Theor Appl Genet 117:1325–1334. https://doi:10.1007/s00122-008-0866-4 Petri C, López-Noguera S, Wang H, García-Almodóvar C, Alburquerque N, Burgos L (2012) A chemical-inducible Cre- LoxP system allows for elimination of selection marker genes in transgenic apricot. Plant Cell Tiss Organ Cult 110:337–346. https://doi.org/10.1007/s11240-012-0155-4 Polóniová Z, Jopčík M, Matušíková I, Libantová J, Moravčíková J (2015) The pollen- and embryo-specific Arabidopsis DLL promoter bears good potential for application in marker-free Cre/ loxP self-excision strategy. Plant Cell Rep 34:469–481. https://doi:10.1007/s00299-014-1726-0 Pradhan S, Chakraborty A, Sikdar N, Chakraborty S, Bhattacharyya J, Mitra J, Manna A, Dutta Gupta S, Sen SK (2016) Marker-free transgenic rice expressing the vegetative insecticidal protein (Vip) of Bacillus thuringiensis shows broad insecticidal properties. Planta 244:789–804. https://doi:10.1007/s00425-016-2535-1 Radke SE, Turner JC, Facciotti D (1992) Transformation and regeneration of Brassica rapa using Agrobacterium tumefaciens . Plant Cell Rep 11:499–505. https://doi:10.1007/BF00236265 Rosellini D (2012) Selectable markers and reporter genes: a well furnished toolbox for plant science and genetic engineering. Crit Rev Plant Sci 31:401–453. https://doi.org/10.1080/07352689.2012.683373 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor Sidorov V, Duncan D (2009) Agrobacterium -mediated maize transformation: immature embryos versus callus. Methods Mol Biol 526:47–58. https://doi:10.1007/978-1-59745-494-0_4 Shiva Prakash N, Bhojaraja R, Shivbachan SK, Hari Priya GG, Nagraj TK, Prasad V, Srikanth Babu V, Jayaprakash TL, Dasgupta S, Spencer TM, Boddupalli RS (2009) Marker-free transgenic corn plant production through co-bombardment. Plant Cell Rep 28:1655–1668. https://doi:10.1007/s00299-009-0765-4 Sreekala C, Wu L, Gu K, Wang D, Tian D, Yin Z (2005) Excision of a selectable marker in transgenic rice ( Oryza sativa L .) using a chemically regulated Cre/ loxP system. Plant Cell Rep 24:86–94. https://doi:10.1007/s00299-004-0909-5 Stevens R, Grelon M, Vezon D, Oh J, Meyer P, Perennes C, Domenichini S, Bergounioux C (2004) A CDC45 homolog in Arabidopsis is essential for meiosis, as shown by RNA interference-induced gene silencing. Plant Cell 16:99–113. https://doi:10.1105/tpc.016865 Svab Z, Hajdukiewicz P, Maliga P (1990) Stable transformation of plastids in higher plants. Proc Natl Acad Sci USA 87:8526–8530. https://doi:10.1073/pnas.87.21.8526 Van Ex F, Verweire D, Claeys M, Depicker A, Angenon G (2009) Evaluation of seven promoters to achieve germline directed Cre- lox recombination in Arabidopsis thaliana . Plant Cell Rep 28:1509–1520. https://doi:10.1007/s00299-009-0750-y Vancanneyt G, Schmidt R, O’Connor-Sanchez A, Willmitzer L, Rocha-Sosa M (1990) Construction of an intron-containing marker gene: splicing of the intron in transgenic plants and its use in monitoring early events in Agrobacterium -mediated plant transformation. Mol Genet Gen 220:245–250. https://doi:10.1007/BF00260489 Verweire D, Verleyen K, De Buck S, Claeys M, Angenon G (2007) Marker-free transgenic plants through genetically programmed autoexcision. Plant Physiol 145:1220–1231. https://doi:10.1104/pp.107.106526 Wang N, Arling M, Hoerster G, Ryan L, Wu E, Lowe K, Gordon-Kamm W, Jones TJ, Chilcoat ND, Anand A (2020) An Efficient Gene Excision System in Maize. Front Plant Sci 11:1298. https://doi:10.3389/fpls.2020.01298 Wang Y, Chen B, Hu Y, Li J, Lin Z (2005) Inducible excision of selectable marker gene from transgenic plants by the cre/ lox site-specific recombination system. Transgenic Res 14:605–614. https:// doi: 10.1007/s11248-005-0884-9 Wang Q, Fagaly T, Bassuner R, Liang J, Oulmassov TN, Dabrowski J (2006) Seed specific USP promoters for expressing genes in plants. US patent No. US7078588B2. Xu H, Li Y, Yan Y, Wang K, Yai Y, Hu Y (2010) Genome-scale identification of Soybean BURP domain-containing genes and their expression under stress treatments. BMC Plant Biol 10:197. https://doi:10.1186/1471-2229-10-197 Yau Y, Stewart CN (2013) Less is more: strategies to remove marker genes from transgenic plants. BMC Biotechnol 13:36. https://doi:10.1186/1472-6750-13-36 Ye X, Williams EJ, Shen J, Esser JA, Nichols AM, Petersen MW, Gilbertson LA (2008) Plant development inhibitory genes in binary vector backbone improve quality event efficiency in soybean transformation. Transgenic Res 17(5):827–838. https:// doi: 10.1007/s11248-008-9169-4 Ye X, Williams EJ, Shen J, Johnson S, Lowe B, Radke S, Strickland S, Esser JA, Petersen MW, Gilbertson LA (2011) Enhanced production of single copy backbone-free transgenic plants in multiple crop species using binary vectors with a pRi replication origin in Agrobacterium tumefaciens . Transgenic Res 20:773–786. https://doi:10.1007/s11248-010-9458-6 Ye X, Chen Y, Wan Y, Hong YJ, Ruebelt MC, Gilbertson LA (2016) Constitutive expression of the tzs gene from Agrobacterium tumefaciens virG mutant strains is responsible for improved transgenic plant regeneration in cotton meristem transformation. Plant Cell Rep 35:601–611. https://doi:10.1007/s00299-015-1906-6 Yokoyama R, Takahashi T, Kato A, Torii KU, Komeda Y (1998) The Arabidopsis ERECTA gene is expressed in the shoot apical meristem and organ primordia. Plant J 15(3):301–310. https://doi:10.1046/j.1365-313x Zhang W, Subbarao S, Addae P, Shen A, Armstrong C, Peschke V, Gilbertson L (2003) Cre/ lox -mediated marker gene excision in transgenic maize ( Zea mays L.) plants. Theor Appl Genet 107:1157–1168. https://doi:10.1007/s00122-003-1368-z Zuo J, Niu QW, Møller SG, Chua NH (2001) Chemical-regulated, site-specific DNA excision in transgenic plants. Nat Biotechnol 19:157–161. https:// doi: 10.1038/84428 Zou X, Peng A, Xu L, Liu X, Lei T, Yao L, He Y, Chen S (2013) Efficient autoexcision of a selectable marker gene from transgenic citrus by combining the Cre/ loxP system and ipt selection. Plant Cell Rep 32:1601–1613. https://doi:10.1007/s00299-013-1470-x Supplementary Files Supplementary.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Minor revisions 24 Jul, 2022 Reviewers agreed at journal 29 Jun, 2022 Reviewers invited by journal 13 Jun, 2022 Editor assigned by journal 07 Jun, 2022 First submitted to journal 06 Jun, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1731438","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":113202054,"identity":"88bfeea3-e3e9-4ee5-844a-04b6954fb543","order_by":0,"name":"Xudong Ye","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0UlEQVRIiWNgGAWjYHACAwjF3kOyFp4zJGuRyCFW/Y3kjY8LfjEk9ku+PfiZp+IeA397dwJeLZIz0oqNZ/YxJM6cnZcszXOmmEHizNkNeLXwS+SYSfP2MCRuuJ1jIM3blsBgIJGLXwsbTMv+m2eMf/P+I0IL2BaeH0BbJHiAehuI0CLZ86zYmLdBwnjGmbw0yznHEngI+sXgODDEeP7YyPa3nz18401Nghx/ey9+LWDA2Cbh2ACkmXiAMUpYORj8YbAHa/1BpPpRMApGwSgYWQAASTdD09WWwOoAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-5104-6947","institution":"Bayer Crop Science United States: Bayer CropScience LP","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Xudong","middleName":"","lastName":"Ye","suffix":""},{"id":113202055,"identity":"99295756-340d-419a-be8e-2cd41e6f0377","order_by":1,"name":"Zarir Vaghchhipawala","email":"","orcid":"","institution":"Monsanto Chesterfield Village Research Center: Monsanto Co","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zarir","middleName":"","lastName":"Vaghchhipawala","suffix":""},{"id":113202056,"identity":"bfaa45b1-8524-4846-8166-ff1d78861742","order_by":2,"name":"Edwards J. Williams","email":"","orcid":"","institution":"University of Wisconsin-Madison","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Edwards","middleName":"J.","lastName":"Williams","suffix":""},{"id":113202057,"identity":"47453f18-44a1-4c60-ada8-d90a0f21e027","order_by":3,"name":"Changlin Fu","email":"","orcid":"","institution":"Bayer Crop Science United States: Bayer CropScience LP","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Changlin","middleName":"","lastName":"Fu","suffix":""},{"id":113202058,"identity":"ad7a0ee1-9bba-4b9f-8146-4fa05b875035","order_by":4,"name":"Jinyuan Liu","email":"","orcid":"","institution":"Bayer Crop Science United States: Bayer CropScience LP","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jinyuan","middleName":"","lastName":"Liu","suffix":""},{"id":113202059,"identity":"cb459793-3a3f-433d-90c3-54157fde048f","order_by":5,"name":"Fengming Lu","email":"","orcid":"","institution":"Bayer Crop Science United States: Bayer CropScience LP","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fengming","middleName":"","lastName":"Lu","suffix":""},{"id":113202060,"identity":"30c8c479-3ae8-4664-bd93-511866737767","order_by":6,"name":"Erin L. Hall","email":"","orcid":"","institution":"Bayer Crop Science United States: Bayer CropScience LP","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Erin","middleName":"L.","lastName":"Hall","suffix":""},{"id":113202061,"identity":"1eec833c-fc3f-47a3-9c38-9d7f152b3a4c","order_by":7,"name":"Shirley X. Guo","email":"","orcid":"","institution":"Bayer Crop Science United States: Bayer CropScience LP","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shirley","middleName":"X.","lastName":"Guo","suffix":""},{"id":113202062,"identity":"88075aee-5f6d-44d2-bd0f-9ec3fe9a0048","order_by":8,"name":"LaRee Frank","email":"","orcid":"","institution":"Bayer Crop Science United States: Bayer CropScience LP","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"LaRee","middleName":"","lastName":"Frank","suffix":""},{"id":113202063,"identity":"c12c5895-488e-4fcd-a2b1-d924e2e9ff44","order_by":9,"name":"Larry A. Gilbertson","email":"","orcid":"","institution":"Bayer Crop Science United States: Bayer CropScience LP","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Larry","middleName":"A.","lastName":"Gilbertson","suffix":""}],"badges":[],"createdAt":"2022-06-06 18:58:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1731438/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1731438/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":22736370,"identity":"d4fdc6a1-4244-4155-956d-1939467d673e","added_by":"auto","created_at":"2022-06-16 15:58:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":83657,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eT-DNA structure between right and left borders of the autoexcision constructs.\u003c/strong\u003e The arrows indicate cassette orientations from a promoter to a terminator. The genetic elements have been described in M\u0026amp;M, and Table 1.\u0026nbsp;\u003c/p\u003e","description":"","filename":"Slide1.png","url":"https://assets-eu.researchsquare.com/files/rs-1731438/v1/e6f237cf1226fe968ef6088a.png"},{"id":22736372,"identity":"9abb5c3d-8d24-40be-898f-ed94d0f1c2bd","added_by":"auto","created_at":"2022-06-16 15:58:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":547520,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMarker free soybean R1 plants from pMON263552 (P-\u003cem\u003eGmRsp1-cre\u003c/em\u003e) confirmed by Southern blot\u003cem\u003e.\u003c/em\u003e \u003c/strong\u003eThe same membrane was detected sequentially by \u003cem\u003egusA\u003c/em\u003e and \u003cem\u003eaadA\u003c/em\u003e probes according to DIG Southern blot instruction. M: l-\u003cem\u003eHindIII\u003c/em\u003e DIG labeled marker, the band size is indicated on the left side as kb; Lane No. 1-29: 29 TaqMan\u003csup\u003e®\u003c/sup\u003e \u003cem\u003eaadA\u003c/em\u003e negative and \u003cem\u003egusA\u003c/em\u003e positive R1 plants from 24 soybean R0 transgenic events, a and b indicate 2 R1 plants from the same R0 events; A: Soybean A3555 genomic DNA as a positive control; P1: 5 mg soybean genomic DNA from an \u003cem\u003eaadA\u003c/em\u003e transgenic plant as a positive control; P2: 10 pg plasmid digested with \u003cem\u003eHindIII\u003c/em\u003e as a positive control.\u003c/p\u003e","description":"","filename":"Slide2.png","url":"https://assets-eu.researchsquare.com/files/rs-1731438/v1/4e5f9651ed35695a88701b02.png"},{"id":22736369,"identity":"b2a3c34f-0231-42d5-926a-b25be41576bd","added_by":"auto","created_at":"2022-06-16 15:58:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":278740,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSouthern analysis of the events from pMON131703 (P-\u003cem\u003eAt.CDC45-cre\u003c/em\u003e) with \u003cem\u003egusA\u003c/em\u003e and \u003cem\u003eaadA\u003c/em\u003e probes\u003c/strong\u003e. The \u003cem\u003eaadA\u003c/em\u003e probe detected 5.56 kb fragment; the \u003cem\u003egusA\u003c/em\u003e probe detected minimal 3 kb fragment depending on inserts. The same membrane was detected sequentially by \u003cem\u003egusA\u003c/em\u003e and \u003cem\u003eaadA\u003c/em\u003e probes, respectively, according to DIG Southern blot instruction for hybridization and probe stripping. M: l-\u003cem\u003eHindIII\u003c/em\u003e DIG labeled marker, the band size is indicated on the left side as kb; D: 10 mg cotton DP393 genomic DNA as a negative control, B: blank lane; Lane No. 1-8: 8 TaqMan \u003cem\u003eaadA\u003c/em\u003e negative and \u003cem\u003egusA\u003c/em\u003e positive R1 plants from 8 R0 transgenic cotton events; Lane No. 9-12: 4 TaqMan \u003cem\u003eaadA\u003c/em\u003e positive R1 plants from 4 R0 transgenic cotton events as positive controls.\u003c/p\u003e","description":"","filename":"Slide3.png","url":"https://assets-eu.researchsquare.com/files/rs-1731438/v1/bb0223f97cfff3ebb28b16dc.png"},{"id":22736905,"identity":"c31b7669-8972-4aa5-9194-54bd56326279","added_by":"auto","created_at":"2022-06-16 16:03:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":504403,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMF confirmation by Southern blot from maize R1 plants transformed with pMON138232 (maize \u003cem\u003eCDC45\u003c/em\u003e promoter).\u003c/strong\u003e The same membrane was detected sequentially by \u003cem\u003egusA\u003c/em\u003e and \u003cem\u003ecre\u003c/em\u003e probes, respectively, according to DIG Southern blot instruction for hybridization and probe stripping. M: l-\u003cem\u003eHindIII\u003c/em\u003e DIG labeled marker, the band size is indicated on the left side as kb; L: 10 mg maize genomic DNA as a negative control; Lane No. 1-20: 20 TaqMan\u003csup\u003e®\u003c/sup\u003e \u003cem\u003eCP4\u003c/em\u003e negative, \u003cem\u003egusA\u003c/em\u003e positive R1 plants from 20 R0 transgenic maize events; P1: 10 mg maize genomic DNA from a plant transformed by \u003cem\u003eCP4\u003c/em\u003e and \u003cem\u003egusA\u003c/em\u003e construct without \u003cem\u003ecre\u003c/em\u003e as a positive control; P2: 10 pg pMON138232 plasmid digested with \u003cem\u003eHindIII\u003c/em\u003e as a positive control.\u003c/p\u003e","description":"","filename":"Slide4.png","url":"https://assets-eu.researchsquare.com/files/rs-1731438/v1/99be35ab27542af48bcb7757.png"},{"id":22736906,"identity":"04faa5a1-2857-49a1-b3da-bf1d462cd81f","added_by":"auto","created_at":"2022-06-16 16:04:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2291287,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1731438/v1/f5dc0850-7d09-47c3-80f5-9ff479400390.pdf"},{"id":22736373,"identity":"8d8bfd79-0b73-4a64-bf21-5a9d093d0fd4","added_by":"auto","created_at":"2022-06-16 15:58:56","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":3193989,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementary.docx","url":"https://assets-eu.researchsquare.com/files/rs-1731438/v1/bf91550a14e4861d36c62554.docx"}],"financialInterests":"","formattedTitle":"Cre-mediated autoexision of selectable marker genes in soybean, cotton, canola and maize transgenic plants","fulltext":[{"header":"Key Message ","content":"\u003cp\u003eEfficient selectable marker gene autoexcision in transgenic plants of soybean, cotton, canola, and maize is achieved by effective Cre recombinase expression.\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003ePlant transformation has provided a powerful tool for functional genomic research and biotechnology applications by integration of transgenes into chromosomes of a wide range of agriculturally relevant species. Most transgenic plants have been produced through tissue culture processes, in which a selectable marker gene (SMG) is co-transformed with genes of interest (GOI). The SMG confers a growth advantage of transformed cells over non-transformed cells under the corresponding selection reagent in media, which then leads to transgenic shoot regeneration. Approximately 50 SMGs including many that confer antibiotic resistance or herbicide tolerance have been applied for transgenic plant production (Miki and McHugh, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). The antibiotic selection marker genes are not desirable in commercial seed products due to public perception or regulatory concerns over food safety and some herbicide marker gene may be redundant for trait stacking (Hare \u0026amp;Chua, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Rosellini, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). The SMGs can be removed or segregated away in progeny seeds by using vector designs with two T-DNAs in \u003cem\u003eAgrobacterium\u003c/em\u003e (Huang et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2004\u003c/span\u003e), two DNA segment bombardment co-transformation (Shiva Prakash et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2009\u003c/span\u003e), or site-specific recombinase-mediated excision of marker genes (Hare \u0026amp; Chua \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Gilbertson \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Miki and McHugh \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Yau \u0026amp; Stewart \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAmong various recombinase systems, the Cre\u003cem\u003e/loxP\u003c/em\u003e recombination system has been widely reported to remove SMGs in many species (Gilbertson \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Yau \u0026amp; Stewart \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). In the Cre/\u003cem\u003eloxP\u003c/em\u003e recombinase system, the Cre recombinase catalyzes a crossover between directly repeated \u003cem\u003elox\u003c/em\u003e (locus of crossover) recognition sites. To excise a SMG, the \u003cem\u003elox\u003c/em\u003e sites are designed to flank the SMG and any other accessory genes, and after successful recombination-mediated excision, the GOI(s) and one \u003cem\u003elox\u003c/em\u003e site would remain (Gilbertson \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2003\u003c/span\u003e, Gidoni et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The Cre/\u003cem\u003eloxP\u003c/em\u003e-mediated SMG excision can be obtained either by sexual crossing with a Cre\u003cem\u003e-\u003c/em\u003eexpressing line (Bayley et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1992\u003c/span\u003e; Pradhan et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), or by autoexcision where the \u003cem\u003ecre\u003c/em\u003e gene is introduced and removed together with the SMGs. The Cre recombinase expression can be regulated using heat-, cold-, drought- or chemical inducible promoters (Zuo et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Ma et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2009\u003c/span\u003e, Petri et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Garc\u0026iacute;a-Almod\u0026oacute;var et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Mookkan et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; \u0026Eacute;va et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) or developmentally regulated promoters (Li et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Verweire et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Moravčı́kov\u0026aacute; et al., 2008; Kopertekh et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Luo et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Van Ex et al., 2007). Autoexcision in which the \u003cem\u003ecre\u003c/em\u003e expression is driven by developmentally-regulated promoters is the most efficient application as no additional treatment is required to activate \u003cem\u003ecre\u003c/em\u003e expression during tissue culture and plant growth. In contrast, the use of heat-, cold- or chemical treatments for \u003cem\u003ecre\u003c/em\u003e expression involves the induction of stress conditions during tissue culture in certain transformation systems, which may impede transgenic plant recovery during early stages of plant regeneration.\u003c/p\u003e \u003cp\u003eMost studies on marker gene autoexcision have been performed in model plants such as \u003cem\u003eArabidopsis thaliana\u003c/em\u003e and tobacco, as well as in crops such as maize, rice, soybean and canola (Table S1). Marker excision has been reported during the tissue culture stage from inducible promoters (Sreekala et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Cuellar et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Petri et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Du et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Garc\u0026iacute;a-Almod\u0026oacute;var et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Mookkan et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), embryo-specific promoters (Li et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Chong-Pe\u0026acute;rez et al., 2013), or constitutive promoter (Zou et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2013\u003c/span\u003e); during meiosis (Bai et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Kopertekh et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Pol\u0026oacute;niov\u0026aacute; et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2015\u003c/span\u003e); or in progenies (Verweire et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Van Ex et al., 2007).\u003c/p\u003e \u003cp\u003ePlant transformation methods and explant types differ from species to species. Meristem explants excised from mature seeds are used for soybean and cotton transformation using a non-lethal \u003cem\u003eaadA\u003c/em\u003e/spectinomycin selection system (Ye et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Martinell et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Chen et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The hypocotyls from germinating seedlings are used for canola transformation (Radke et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e1992\u003c/span\u003e). The immature embryos are used for maize transformation (Sidorov \u0026amp; Duncan, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Such diverse transformation systems and tissue types require different marker gene excision systems. We have tested several promoters with different expression profiles to develop efficient Cre/\u003cem\u003eloxP\u003c/em\u003e-mediated marker gene autoexcision systems in soybean, cotton, canola and maize, with a goal of high frequency of homozygous marker-free (MF) R1 seed production because hemizygous MF seeds take additional generation to propagate. In this report we disclose results of commercial-level marker gene autoexcision frequencies in these four major crops.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eVector design and construction\u003c/h2\u003e \u003cp\u003eTo search for developmentally regulated expression elements to drive \u003cem\u003ecre\u003c/em\u003e specific expression in reproductive tissues, a set of putative meiosis-related \u003cem\u003eArabidopsis\u003c/em\u003e genes were manually identified from GenBank, including \u003cem\u003eArabidopsis CDC45\u003c/em\u003e. The maize and rice \u003cem\u003eCDC45\u003c/em\u003e homologue sequences were identified by performing BLAST searches in the GenBank genomic sequences against the \u003cem\u003eArabidopsis\u003c/em\u003e CDC45 protein sequence. There were two versions of maize and rice \u003cem\u003eCDC45\u003c/em\u003e promoters identified from GenBank by searching \u003cem\u003eArabidopsis\u003c/em\u003e for CDC45 protein homologues. Two promoters from monocot \u003cem\u003eCDC45\u003c/em\u003e genes, one from maize at chromosome 3 and one from rice at chromosome 11 (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), appear to be restricted in reproductive tissue, and were used to drive the \u003cem\u003ecre\u003c/em\u003e expression in pMON138232 and pMON243847, respectively. The relevant expression elements of these genes were cloned by PCR. The corresponding species genomic DNA was used as a template for PCR amplification using Q5\u0026reg; Hot Start High-Fidelity DNA polymerase (NEB Cat. No. M0493) according to the manufacturer instructions. The corresponding genomic regions of these expression elements in GenBank and the primers used for amplifying them are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers and DNA sources used for PCR amplification of \u003cem\u003ecre\u003c/em\u003e autoexcision promoters and 3\u0026rsquo; UTRs\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExpression element\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSize (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGenBank No. / region\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eP-At.CDC45\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; ctaatacaaaggtgcatgagtagtagtaactg 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo; ttccgtgaaattgaatcacccagaagg 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1030\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eCP002686.1\u003c/b\u003e (9143262..9144291)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eT-At.CDC45\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; catagtctcattgttcttcgattcagtg 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo; cacgagcttcaggtcataactctgg 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e734\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eCP002686.1\u003c/b\u003e (9146083..9146816)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eP-Gm.RSP1\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; aaataatatataaaaatattacaaaaatc 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo; tgaagcaaagtggttagagatgagaatg 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e720\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eNC_016091\u003c/b\u003e (44628717..44629436)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eP-Zm.CDC45-1\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; agccacatgcagtgaattctatactcg 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo; tgcctcatcaatcagctaggtcggatc 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eCM007649.1\u003c/b\u003e (234291301..234293300)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eP-Os.CDC45-1\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; acatacatctgtctagattcattaatat 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026rsquo; tggcgcatcaatcgaagtggtgaattgg 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1957\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eAP014967.1\u003c/b\u003e (1304410..1306330)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eInsert\u003c/b\u003e Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003cb\u003ehere\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe soybean \u003cem\u003eRSP1\u003c/em\u003e promoter (\u003cem\u003eP-Gm.RSP1\u003c/em\u003e) was initially nominated as a disease responsive gene promoter (\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eR\u003c/span\u003eesistance \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eS\u003c/span\u003eensitive \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eP\u003c/span\u003erotein 1) based on RNAseq data generated in-house. Upon testing this promoter to express a \u003cem\u003egusA\u003c/em\u003e transgene in soybean, we found that it was active at background levels in multiple tissues, except roots and top of hypocotyls (data not shown). Even though it does not seem to fit the developmental regulation pattern of other promoters that we tested, it was included to avoid a decrease in TF because of its low-level expression in most tissues. The same promoter comes from a gene that belongs to the BURP domain-containing protein family and was reported to be expressed in roots and hypocotyls, and is inducible by ABA, salt, and drought treatments (Gm04.3 gene, Xu et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). pMON263552 with the \u003cem\u003eRSP1\u003c/em\u003e promoter (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) was constructed to test SMG autoexcision in soybean.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe 1.2 kp λ phage segment corresponding to GenBank accession No. J02459.1, region 21042 to 22237, was synthesized in Bio Basic Inc. (Markham, ON, Canada) and used in pMON243107 as a spacer sequence. The 754 bp of \u003cem\u003eArabidopsis AtpE\u003c/em\u003e intron corresponding to GenBank accession No. LR699765.1, region 17923873 to 19152863, was amplified by PCR and cloned into pMON291996 to test enhance \u003cem\u003eP-Gm.RSP1\u003c/em\u003e expression. The 804 bp of maize \u003cem\u003eDnaK\u003c/em\u003e intron, which was previously annotated as \u003cem\u003eZmHSP70\u003c/em\u003e intron and disclosed in GenBank Accession No. KX640115.1, was cloned after \u003cem\u003eP-Zm.CDC45-1\u003c/em\u003e in pMON138232 to enhance expression.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003ecre\u003c/em\u003e coding sequence used is as previously described and is interrupted by 189 bp IV2 intron from the potato \u003cem\u003eST-LS1\u003c/em\u003e gene (Vancanneyt et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e1990\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). The promoters described above were used to drive expression of the \u003cem\u003ecre\u003c/em\u003e coding sequence. For 3\u0026rsquo;UTR, \u003cem\u003eT-At.CDC45\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) was used for soybean, cotton, and canola, and \u003cem\u003eAgrobacterium nos\u003c/em\u003e transcription terminator (Depicker et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e1982\u003c/span\u003e) was used for corn.\u003c/p\u003e \u003cp\u003eAll dicotyledonous transformation vectors were built on \u003cem\u003eori\u003c/em\u003e pRi vector backbone with kanamycin resistance gene, and the maize transformation vectors were on RK2 \u003cem\u003eoriV\u003c/em\u003e replicon with spectinomycin selection (Ye et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The right and left borders sequences were described previously (Ye et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The dicotyledonous \u003cem\u003egusA\u003c/em\u003e cassette driven by the CaMV 35S promoter and terminated by the \u003cem\u003eAgrobacterium nos\u003c/em\u003e transcription terminator was described (Vancanneyt et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e1990\u003c/span\u003e, Ye et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The \u003cem\u003egusA\u003c/em\u003e cassette in maize vector pMON138232 was driven by the rice actin1 (\u003cem\u003eOs.Act1\u003c/em\u003e) promoter with an additional 333 bp CaMV enhancer sequence in front of the \u003cem\u003eOs.Act1\u003c/em\u003e first intron (McElroy et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e1990\u003c/span\u003e). The \u003cem\u003egusA\u003c/em\u003e cassette in maize vector pMON243847 was driven by a 2181 bp rice tublin\u003cem\u003e-\u003c/em\u003e3 (\u003cem\u003eTubA-3\u003c/em\u003e) promoter (GenBank accession No. MH931401). In dicotyledonous transformation, the \u003cem\u003eaadA\u003c/em\u003e gene with the chloroplast target sequence \u003cem\u003ectp2\u003c/em\u003e (Chen et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) driven by \u003cem\u003eArabidopsis\u003c/em\u003e actin 7 (\u003cem\u003eAt.Act7\u003c/em\u003e) promoter (GenBank accession No. JN400384) and terminated by the \u003cem\u003eAgrobacterium nos\u003c/em\u003e transcription terminator was used with spectinomycin for plant selection. In maize transformation, the \u003cem\u003ecp4 epsps\u003c/em\u003e coding sequence with the \u003cem\u003eOs.Act1\u003c/em\u003e promoter and the \u003cem\u003eAgrobacterium nos\u003c/em\u003e terminator was used for glyphosate selection as described previously (Ye et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). In some vector designs, the \u003cem\u003esplA\u003c/em\u003e (sucrose phosphorylase-like gene, GenBank accession No. AE007871, region 153761..155218) gene derived from \u003cem\u003eAgrobacterium\u003c/em\u003e Ti plasmid driven by enhanced USP88 (eUSP88) promoter (B\u0026auml;umlein et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e1991\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2006\u003c/span\u003e) and terminated by the \u003cem\u003enos\u003c/em\u003e transcription terminator in three dicotyledonous constructs was included to reduce R1 seed screening due to seed abortion phenotype, similar to the approach taken for 2 T-DNA transformation (Fig S1). Some vector designs were simplified to omit this negative selection. The SMG and \u003cem\u003ecre\u003c/em\u003e genes were flanked by \u003cem\u003elox\u003c/em\u003e sites for autoexcision. The genetic elements and the T-DNA structure of all binary vectors are depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003eStandard cloning procedures were applied for all binary vector construction (Sambrook et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e1989\u003c/span\u003e). For seamless fusion between a promoter and \u003cem\u003ecre\u003c/em\u003e elements, the hot fusion cloning protocol was used with PCR products bearing 20\u0026ndash;25 bp element junction overlaps (Fu et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003e\u003cb\u003eInsert\u003c/b\u003e Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003cb\u003ehere\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eAgrobacterium\u003c/span\u003e \u003cb\u003epreparation and plant transformation\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA single binary vector was transfected into a nopaline type of \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e strain by electroporation as described previously (Ye et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The ABI strain containing gentamicin and kanamycin resistance was used for maize vector transfection using spectinomycin for \u003cem\u003eAgrobacterium\u003c/em\u003e selection. The AB30 strain (Ye et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), which is derived from ABI with deletion of kanamycin resistance gene, was used for soybean and canola binary vector transfection which contains kanamycin-resistant gene in the vector backbone for \u003cem\u003eAgrobacterium\u003c/em\u003e selection. The AB33 strain, derived from AB30 with VirG\u003csup\u003eI77V\u003c/sup\u003e mutation (Ye et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) was used for cotton binary vector transfection with kanamycin for \u003cem\u003eAgrobacterium\u003c/em\u003e selection (Chen et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFor soybean (\u003cem\u003eGlycine max\u003c/em\u003e) transformation, the dry meristem explants from the cultivar A3555 were mechanically excised (Calabotta et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The explants were imbibed for 30 min in inoculation buffer, inoculated with \u003cem\u003eAgrobacterium\u003c/em\u003e AB30 suspension containing corresponding binary vectors at OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.3 and sonicated for 20 seconds (Ye et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The explant co-culture, plant regeneration and growth in green house were described previously (Martinell et al. 2002; Ye et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), except that 150 mg/L spectinomycin instead of glyphosate was used for selection during shoot elongation.\u003c/p\u003e \u003cp\u003eFor cotton transformation, the dry meristem explants from cotton cultivar DP393 seeds were excised mechanically (Dersch et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The explants were imbibed in inoculation buffer for 30 min, inoculated with AB33 strain containing binary vectors, and co-cultured for 3\u0026ndash;5 days. Plant regeneration was obtained with 150 mg/L spectinomycin selection, which was described in detail previously (Chen et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCanola hypocotyls explants from canola (\u003cem\u003eBrassica napus\u003c/em\u003e L.) cultivar Ebony were used for canola transformation (Radke et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e1992\u003c/span\u003e; Ye et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Spectinomycin at 100 mg/L instead of glyphosate in the regeneration media was used to recover transgenic canola shoots.\u003c/p\u003e \u003cp\u003eThe immature embryos of maize elite cultivar LH244 were used for generating maize transgenic plants with glyphosate selection as previous described (Sidorov \u0026amp; Duncan, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e \u003cdiv id=\"Sec4\" class=\"Section3\"\u003e \u003ch2\u003eMolecular analyses\u003c/h2\u003e \u003cp\u003eR0 regenerants were analyzed for transgene copy number and vector backbone presence or absence by TaqMan\u0026reg; technology (Applied Biosystems). Leaf samples were collected for DNA extraction (Dellaporta et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1983\u003c/span\u003e). For dicotyledonous transgenic plant analysis, the \u003cem\u003egusA\u003c/em\u003e gene as a GOI, the \u003cem\u003eaadA\u003c/em\u003e, as well as \u003cem\u003ecre\u003c/em\u003e were analyzed for copy number. For maize transgenic plants, the \u003cem\u003egusA\u003c/em\u003e, \u003cem\u003ecp4 epsps\u003c/em\u003e and \u003cem\u003ecre\u003c/em\u003e were analyzed for copy number. The T-DNA left border (LB) was also detected in all constructs for T-DNA intactness. The TaqMan\u0026reg; detection probes of the \u003cem\u003egusA\u003c/em\u003e, \u003cem\u003ecp4 epsps\u003c/em\u003e, LB, and the backbone oriRi in dicotyledonous vectors or RK2 oriV in maize vectors were described previously (Ye et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe primers 5\u0026rsquo;- AGCTAAGCGCGAACTGCAAT-3\u0026rsquo; (forward) and 5\u0026rsquo;- GGCTCGAAGATACCTGCAAGA-3\u0026rsquo; (reverse) amplifying the \u003cem\u003eaadA\u003c/em\u003e gene in the dicotyledonous binary vectors, and further detected by minor grove binding (MGB) TaqMan\u0026reg; probe 6FAM-TGGAGAATGGCAGCGCAATGACA, were used for the dicotyledonous selectable marker gene copy number assay. The primers 5\u0026rsquo;-CAAGTGACAGCAATGCTGTTTCA-3\u0026rsquo; (forward) and 5\u0026rsquo;-GTCGAAATCAGTGCGTTCGAA-3\u0026rsquo; (reverse) amplifying a \u003cem\u003ecre\u003c/em\u003e fragment, and the TaqMan\u0026reg; probe 6FAM-CGGTGAACGTGCAAAA were used for \u003cem\u003ecre\u003c/em\u003e cassette presence.\u003c/p\u003e \u003cp\u003eR1 plants are defined as the progeny produced from self-pollinating the R0 plant, i.e. the primary transformant derived from tissue culture. For R1 progeny screening, leaf samples from the green house grown plantlets were collected for DNA extraction. The GOI (\u003cem\u003egusA\u003c/em\u003e), marker gene (\u003cem\u003eaadA\u003c/em\u003e for dicotyledonous, \u003cem\u003ecp4 epsps\u003c/em\u003e for maize) and \u003cem\u003ecre\u003c/em\u003e gene were assayed for copy number with TaqMan\u0026reg; analysis. The GOI TaqMan\u0026reg; detection positive, but marker and \u003cem\u003ecre\u003c/em\u003e TaqMan\u0026reg; detection negative plants were counted as MF lines, and a subset of these marker free lines were partially verified by Southern blot with DIG-labeled probes (Ye et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Chen et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). In general, for a population of 100 R1 plants, we project a total 75 R1 plants that are positive for the GOI, either as hemizygotes or homozygotes, and 25 null plants, assuming Mendelian segregation of a single locus (1:3 transmission; 1 null : 2 hemizygous : 1 homozygous transgene segregation). The R1 MF frequency is calculated as percentage of the projected transgenic R1 plants. If all 75 of these hemizygous and homozygous R1 plants are negative for the SMG, the calculated marker gene excision frequency would be 100%.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e1. Soybean marker gene autoexcision\u003c/h2\u003e \u003cp\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eP\u003c/span\u003e \u003cb\u003e-\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eAt.CDC45\u003c/span\u003e \u003cb\u003e-\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003ecre\u003c/span\u003e \u003cb\u003eshowed severe leaky expression in leaves during plant production in soybean transformation\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eArabidopsis CDC45\u003c/em\u003e promoter was the first promoter we tested for marker gene autoexcision in soybean transformation. However, plants with the \u003cem\u003eP\u003c/em\u003e-\u003cem\u003eAt.CDC45\u003c/em\u003e-\u003cem\u003ecre\u003c/em\u003e expression in pMON131703 showed a severe mottled leaf phenotype during spectinomycin selection, which suggested that there was premature SMG excision from leaky expression of \u003cem\u003ecre\u003c/em\u003e in vegetative tissues (Fig. S2, B). The mottled leaf phenotype could be recovered in soil after removing spectinomycin selection (Fig. S2, C). A decrease in the transformation frequency (TF) was observed in pMON131703 compared to the control plasmid pMON131702 without \u003cem\u003ecre\u003c/em\u003e cassette (average 2.3% vs. 5% in 3 parallel comparison experiments, Table S2).\u003c/p\u003e \u003cp\u003eEighty R0 events from pMON131703 with single copy insertion of the GOI were advanced for R1 seed setting. Only one MF R0 event was found to produce \u003cem\u003eaadA\u003c/em\u003e marker negative and \u003cem\u003egusA\u003c/em\u003e positive plants by molecular analysis of R1 seeds.\u003c/p\u003e \u003cp\u003eTo reduce potential \u003cem\u003ecis\u003c/em\u003e element impact from the adjacent \u003cem\u003eP-CaMV\u003c/em\u003e-\u003cem\u003egusA\u003c/em\u003e cassette, we inserted a 1.2 kb λ-phage fragment between the \u003cem\u003eP-CaMV 35S\u003c/em\u003e-\u003cem\u003egusA\u003c/em\u003e and the \u003cem\u003eaadA\u003c/em\u003e SMG cassettes in pMON131703 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), which resulted in pMON243107. In total 159 phenotypically normal shoots and 80 mottled shoots were produced with combined TF of 2.36%, which is comparable to pMON131703. Twenty-two single copy, backbone free events were selected for R1 marker analysis. Only 6 out of the 22 analyzed R0 soybean events produced MF progeny (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eR1 MF progeny from soybean plants transformed with pMON243107 (\u003cem\u003eP-At.CDC45-cre\u003c/em\u003e)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean R0 line\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR1 plants\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTotal \u003cem\u003egusA\u003c/em\u003e+, MF R1 plants\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHomozygous \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plants\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_At.CDC45-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_At.CDC45-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_At.CDC45-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_At.CDC45-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_At.CDC45-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_At.CDC45-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cb\u003eNote\u003c/b\u003e: MF: marker free. GM_At.CDC45: \u003cem\u003eGlycine max\u003c/em\u003e plant with \u003cem\u003ecre\u003c/em\u003e driven by \u003cem\u003eArabidopsis CDC45\u003c/em\u003e promoter. If 100% marker gene excision is present in the R1 population, we expect 34.5 \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;and MF plants from a total of 46 R1 plants (i.e. single locus transmission, 1 null: 2 hemizygous : 1 homozygous), and 11.5 homozygous \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF plants out of the total 46 R1 plants.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eInsert\u003c/b\u003e Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u003cb\u003ehere\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eP-Gm.RSP1\u003c/span\u003e \u003cb\u003e-\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003ecre\u003c/span\u003e \u003cb\u003eshowed efficient marker gene excision in soybean transformation\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe \u003cem\u003ecre\u003c/em\u003e expression driven by \u003cem\u003eP-Gm.RSP1\u003c/em\u003e in pMON263552 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) showed no apparent reduction in TF and no abnormal phenotypes in soybean transformation, suggesting a lack of significant premature excision with this promoter. R1 seeds from 49 R0 lines that had germline transmission of a single copy transgene were analyzed for marker segregation by TaqMan\u0026reg; assay. As shown in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, all 49 events produced \u003cem\u003eaadA\u003c/em\u003e negative, \u003cem\u003egusA\u003c/em\u003e positive R1 plants, indicating that efficient SMG excision occurred in this construct. In addition, 30 of the 49 events generated three or more MF, homozygous seeds out of 46 planted seeds. Overall, the frequency of MF R1 transgenic plants is 41% [686/(2226x75%)] out of the total projected \u003cem\u003egusA\u003c/em\u003e positive plants (2226x75%), with the same homozygous MF frequency 41% [228/(2226x25%)] out of the total projected homozygous \u003cem\u003egusA\u003c/em\u003e positive plants (2226x25%).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eR1 MF progeny from soybean plants transformed with pMON263552 (\u003cem\u003eP-Gm.RSP1-cre\u003c/em\u003e)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean\u003c/p\u003e \u003cp\u003eR0 line\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal R1 analyzed\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTotal \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plants\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHomozygous \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plants\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEpidermal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eEpidermal\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2226\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e686\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e228\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cb\u003eNote\u003c/b\u003e: GM_RSP: \u003cem\u003eGlycine max\u003c/em\u003e plant with \u003cem\u003ecre\u003c/em\u003e driven by soybean \u003cem\u003eRSP1\u003c/em\u003e promoter. Epidermal-all transgene detection negative in all R1 plants, suggesting that only epidermal cells were transformed in R0. If 100% marker gene excision is present in the R1 population, out of a total 46 R1 plants we expect 34.5 MF \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;plants and 11.5 homozygous \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF plants.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eInsert\u003c/b\u003e Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u003cb\u003ehere\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe MF progenies in the R1 generation were also further confirmed by Southern blot analysis. Twenty-nine R1 plants from 24 R0 single copy lines were randomly selected for DNA extraction and tested with both \u003cem\u003eaadA\u003c/em\u003e and \u003cem\u003egusA probes\u003c/em\u003e. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, the selected R1 events were further confirmed to be MF by Southern blot. Lanes 5a, 5b, and 21 showed 2 bands, which indicated an error call in R0 TaqMan\u0026reg; copy number assay. We determined that the R0 copy number assay is approximately 90% accuracy as revealed by R1 MF copy number assay, which is more accurate to distinguish hemi- or homozygous transgenic plants in R1 plants. The faint or no signal bands of \u003cem\u003egusA\u003c/em\u003e probe were largely due to uneven DNA loads and were confirmed by extended film exposure. These results further confirm that TaqMan\u0026reg; analyzed R1 plants were \u003cem\u003eaadA\u003c/em\u003e marker negative and \u003cem\u003egusA\u003c/em\u003e positive.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eInsert\u003c/b\u003e Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u003cb\u003ehere\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eA construct with\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eArabidopsis AtpE\u003c/span\u003e \u003cb\u003eintron at\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eP-Gm.RSP1\u003c/span\u003e \u003cb\u003e3\u0026rsquo; showed reduced marker gene excision efficiency in soybean transformation\u003c/b\u003e\u003c/p\u003e \u003cp\u003eConsidering the efficient marker gene autoexcision with \u003cem\u003eP-Gm.RSP1\u003c/em\u003e-\u003cem\u003ecre\u003c/em\u003e in pMON263552 (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), we hypothesized that adding an intron at 3\u0026rsquo; end of the promoter may further increase marker gene excision frequency. The \u003cem\u003eArabidopsis\u003c/em\u003e intron, \u003cem\u003eI\u003c/em\u003e-\u003cem\u003eAt.AtpE\u003c/em\u003e, was selected to enhance the \u003cem\u003eP\u003c/em\u003e-\u003cem\u003eGm.RSP1\u003c/em\u003e expression, and an \u003cem\u003eP-eUSP88\u003c/em\u003e-\u003cem\u003esplA\u003c/em\u003e expression cassette, which is a seed lethal cassette, was placed between the \u003cem\u003egusA\u003c/em\u003e and \u003cem\u003ecre\u003c/em\u003e cassettes to reduce R1 analysis (Fig. S1, D), which resulted in pMON291996.\u003c/p\u003e \u003cp\u003eNo obvious TF decrease or any abnormal phenotype was observed in the transgenic shoots from pMON291996 transformation compared to regular constructs. Seeds from 15 R0 single copy events were planted for MF excision to be confirmed by TaqMan\u0026reg; analysis for \u003cem\u003egusA\u003c/em\u003e and \u003cem\u003eaadA\u003c/em\u003e transgene probes. In pMON291996, we observed a drastically reduced marker gene excision efficiency compared to pMON263552 (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Only 10 out of 15 R0 events produced marker free progeny, with few hemizygous MF \u003cem\u003egusA\u003c/em\u003e positive R1 plants, and only two of those events produced one homozygous R1 plant (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Overall, the frequency of MF \u003cem\u003egusA\u003c/em\u003e positive R1 plants is 7.6% [37/(651x75%)] out of total 488 projected \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;plants (homozygous and hemizygous) (651x75%), with a poor homozygous MF frequency of 1.2% [2/(651x25%)] out of the total 162 projected homozygous \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;plants (651x25%).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cb\u003eR1 MF progeny from soybean plants transformed with pMON291996 (\u003c/b\u003e\u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eP-Gm.RSP1\u0026thinsp;+\u0026thinsp;I- At.AtpE-cre\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean R0 line\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAnalyzed R1 plants\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plants\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHomozygous \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plants\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-Int-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-Int-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-Int-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-Int-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-Int-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-Int-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-Int-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-Int-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-Int-9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-Int-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-Int-11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-Int-12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-Int-13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-Int-14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGM_RSP-Int-15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e651\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cb\u003eNote\u003c/b\u003e: GM_RSP-Int: \u003cem\u003eGlycine max\u003c/em\u003e plant with \u003cem\u003ecre\u003c/em\u003e driven by soybean \u003cem\u003eRSP1\u003c/em\u003e promoter and \u003cem\u003eArabidopsis AtpE\u003c/em\u003e intron.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003eIf 100% marker gene excision presents in R1 population, out of a total 45 R1 plants we expect 33.75 MF \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;plants and 11.25 homozygous \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF plants.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eInsert\u003c/b\u003e Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u003cb\u003ehere\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2. Cotton marker gene autoexcision\u003c/h2\u003e \u003cp\u003e \u003cb\u003eThe\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eArabidopsis CDC45\u003c/span\u003e \u003cb\u003epromoter enabled efficient marker gene excision in cotton but decreased TF\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBecause of promising marker gene autoexcision result in the initial soybean transformation with \u003cem\u003eP-At.CDC45\u003c/em\u003e-\u003cem\u003ecre\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), we tested pMON131703 (\u003cem\u003eP\u003c/em\u003e-\u003cem\u003eAt.CDC45\u003c/em\u003e-\u003cem\u003ecre\u003c/em\u003e) with the control binary vector pMON131702 (without the \u003cem\u003ecre\u003c/em\u003e cassette) side-by-side in cotton transformation for autoexcision efficiency and TF impact. The autoexcision construct pMON131703 also showed lower transformation frequencies and had mottled leaf phenotypes in some cotton events (Fig. S2, E). On average a TF of 1.25% was observed compared to 4.2% with the control construct in four separate experiments (Fig. S3). Approximately 23% of R0 events are chimeric or epidermal transformation, and 45% (41/91) single copy R0 lines were following the Mendelian segregations (Table S3).\u003c/p\u003e \u003cp\u003eNinety-one R0 events were harvested with seeds. In total, 58 out of 91 R0 events of one or two copy \u003cem\u003egusA\u003c/em\u003e transgene inserts produced MF R1 progeny, among which 41 R0 events produced 55\u0026ndash;95% MF \u003cem\u003egusA\u003c/em\u003e positive R1 plants of the projected total \u003cem\u003egusA\u003c/em\u003e positive R1 plants (assuming 75% of total seeds for single locus).\u003c/p\u003e \u003cp\u003eThe MF autoexcision from pMON131703 in cotton was further verified by Southern blot. Eight R1 events negative for marker and four R1 events positive for marker identified by the TaqMan\u0026reg; assay were selected. The total genomic DNA was digested with \u003cem\u003eHindIII\u003c/em\u003e, and hybridized with DIG-labeled \u003cem\u003eaadA\u003c/em\u003e (marker) or \u003cem\u003egusA\u003c/em\u003e (GOI) probe.\u003c/p\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, the Southern blot confirmed that all eight events detected to be marker negative by TaqMan\u0026reg; were negative by Southern analysis, and the four control events detected to be marker positive by Taqman\u0026reg; marker positive were also \u003cem\u003eaadA\u003c/em\u003e positive by Southern blot, suggesting that the Taqman\u0026reg; assay is accurate and consistent for transgene presence. Overall, the results from pMON131703 in cotton transformation indicate that \u003cem\u003eArabidopsis CDC45\u003c/em\u003e promoter driving \u003cem\u003ecre\u003c/em\u003e expression in cotton was suitable for efficient marker gene removal.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eInsert\u003c/b\u003e Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u003cb\u003ehere\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003eWe tested more constructs using this promoter in cotton with different expression cassette configurations to mitigate the TF reduction, including pMON243107 (with 1.2 kb l phage spacer sequence and marker gene between \u003cem\u003egusA\u003c/em\u003e and \u003cem\u003ecre\u003c/em\u003e cassettes) and pMON244545 (no spacer sequence) with the same \u003cem\u003eArabidopsis CDC45\u003c/em\u003e promoter (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Both pMON243107 and pMON244545 still showed reduced transformation frequencies (1.45% and 0.89%, respectively) compared to the control construct pMON131702 or other constructs without the \u003cem\u003ecre\u003c/em\u003e cassette (3\u0026ndash;5%) (data not shown). Abnormal leaf phenotype was observed in half of the regenerating shoots in the two constructs (Fig. S2, E), suggesting that leaky \u003cem\u003ecre\u003c/em\u003e expression can be causing the premature marker excision. All shoots were recovered to normal growth phenotype in soil and set seeds as we used \u003cem\u003eaadA\u003c/em\u003e/spectinomycin no-lethal selection system.\u003c/p\u003e \u003cp\u003eFifteen R0 single copy event progeny seeds for either construct were planted to test for marker autoexcision. Leaf samples from 40 R1 plantlets per R0 event were assayed for the \u003cem\u003egusA\u003c/em\u003e and \u003cem\u003eaadA\u003c/em\u003e copy number. Efficient marker gene autoexcision was observed in both constructs with the best performance of 50\u0026ndash;100% projected \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;transgenic plants (i.e. 75% of total seeds) showing marker gene absence and high numbers of homozygous MF plants in the R1 generation among the majority of germline transmission events (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). On average, 68% total projected \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;transgenic R1 cotton seedlings [578/(1122 x75%)] are GOI positive, MF, and 67.7% [190/(1122 x25%)] of the projected R1 \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;homozygous seeds were confirmed as homozygous MF in R1 population.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eR1 MF progeny from cotton plants transformed with pMON243107 (with spacer) and pMON244545 (no spacer) containing \u003cem\u003eP-At.CDC45-cre\u003c/em\u003e cassette\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eConstruct\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCotton R0 event\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR1 total\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plants\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHomozygous \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plants\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON243107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eEpidermal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEpidermal\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON243107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON243107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON243107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eEpidermal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEpidermal\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON243107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON243107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON243107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON243107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON243107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON243107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON243107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON243107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON243107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON243107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON243107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON244545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON244545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON244545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON244545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON244545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON244545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON244545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON244545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON244545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON244545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON244545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON244545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON244545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMON244545\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGH_At.CDC45-29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1122\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e578\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e190\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003cb\u003eNote\u003c/b\u003e: GH_At.CDC45: \u003cem\u003eGossypium herbaceum\u003c/em\u003e plant with \u003cem\u003ecre\u003c/em\u003e driven by \u003cem\u003eArabidopsis CDC45 promoter\u003c/em\u003e. Epidermal-no R1 germline transgene transmission. If 100% marker gene excision presents in R1 population, we expect total 30 MF R1 plants and 10 homozygous MF R1 plants from total 40 R1 plants.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eInsert\u003c/b\u003e Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u003cb\u003ehere\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003epMON291996 with\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eP-Gm.RSP1\u0026thinsp;+\u0026thinsp;I-At.AtpE-cre\u003c/span\u003e \u003cb\u003econfers highly efficient marker gene excision in cotton transformation\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe tested pMON291996 which included \u003cem\u003eP-Gm.RSP1\u0026thinsp;+\u0026thinsp;I-At.AtpE-cre\u003c/em\u003e autoexcision cassette and a \u003cem\u003eP-eUSP88\u003c/em\u003e-\u003cem\u003esplA\u003c/em\u003e seed abortion expression cassette (Fig. S1) to reduce R1 analysis. While we observed that the reduced soybean marker gene autoexcision in this construct compared to pMON263552, this construct showed the highest efficiency of marker gene excision for cotton that we have tested in this study without obvious negative TF compromise [TF\u0026thinsp;=\u0026thinsp;5.65%, which was comparable to non-autoexcision control constructs (data not shown)]. On average, 69% of the total projected R1 \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;transgenic lines [392/(750 x75%)] are GOI positive, MF, and 53% of the projected R1 \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;homozygous transgenic plants [100/(750 x25%)] were confirmed to be homozygous MF (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eR1 MF progeny from cotton plants transformed with pMON291996 (\u003cem\u003eP-Gm.RSP1\u0026thinsp;+\u0026thinsp;I-At.AtpE-cre\u003c/em\u003e)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCotton\u003c/p\u003e \u003cp\u003eR0 event\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR1 plant sample #\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plants\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHomozygous \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plants\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH_RSP-Int-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH_RSP-Int-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH_RSP-Int-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH_RSP-Int-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH_RSP-Int-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH_RSP-Int-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEpidermal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eEpidermal\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH_RSP-Int-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH_RSP-Int-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH_RSP-Int-9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH_RSP-Int-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH_RSP-Int-11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH_RSP-Int-12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH_RSP-Int-13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH_RSP-Int-14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH_RSP-Int-15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e750\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e392\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cb\u003eNote\u003c/b\u003e: GH_RSP-Int: \u003cem\u003eGossypium herbaceum\u003c/em\u003e plant with \u003cem\u003ecre\u003c/em\u003e driven by soybean \u003cem\u003eRSP1\u003c/em\u003e promoter and \u003cem\u003eArabidopsis AtpE\u003c/em\u003e intron. If 100% marker gene excision presents in R1 population, we expect total 37.5 MF R1 plants (75%), and 12.5 homozygous MF R1 plants (25%) from total 50 R1 plants.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eInsert\u003c/b\u003e Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cb\u003ehere\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e3. Canola marker gene autoexcision\u003c/h2\u003e \u003cp\u003eFour \u003cem\u003ecre\u003c/em\u003e autoexcision cassettes with \u003cem\u003eP\u003c/em\u003e-\u003cem\u003eAt.CDC45\u003c/em\u003e, \u003cem\u003eP\u003c/em\u003e-\u003cem\u003eGm.RSP1\u003c/em\u003e, \u003cem\u003eP\u003c/em\u003e-\u003cem\u003eBr.nap\u003c/em\u003e (canola napin gene), or \u003cem\u003eP-Vf.eUSP88\u003c/em\u003e promoter (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were tested in canola transformation for SMG autoexcision based on our promising results from soybean for the \u003cem\u003eCDC45\u003c/em\u003e and \u003cem\u003eRSP1\u003c/em\u003e promoters as well as the embryo specific autoexcision in canola (Kopertekh et. al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The construct with \u003cem\u003eP-At.CDC45\u003c/em\u003e promoter expressing the \u003cem\u003ecre\u003c/em\u003e cassette showed a decreased TF and speckling phenotype, while the transformation frequencies for the other three constructs were comparable to our regular construct transformation (data not shown). Eight to 12 single copy R0 events and 88 R1 per event were evaluated for MF progeny for each of the four constructs.\u003c/p\u003e \u003cp\u003eSeven out of nine R0 events from the construct containing \u003cem\u003eAt.CDC45\u003c/em\u003e promoter produced MF R1 plants. However, on average only 4.8% total projected \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;seeds (29/(792x75%) were confirmed to be MF by TaqMan\u0026reg; assay (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab7\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 7\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eR1 MF progeny from canola plants transformed with pMON243107 (\u003cem\u003eP-At.CDC45-Cre\u003c/em\u003e)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eR0 event\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR1 total\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTotal \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plants\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHomozygous \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plants\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_At.CDC45-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_At.CDC45-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_At.CDC45-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_At.CDC45-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_At.CDC45-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_At.CDC45-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_At.CDC45-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_At.CDC45-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_At.CDC45-9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e792\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cb\u003eNote\u003c/b\u003e: BN_At.CDC45: \u003cem\u003eBrassica napus\u003c/em\u003e plant with \u003cem\u003eArabidopsis CDC45\u003c/em\u003e promoter driven \u003cem\u003ecre\u003c/em\u003e. If 100% marker gene excision presents in R1 population, we expect total 66 MF R1 plants (75%) and 22 homozygous MF plants (25%) from total 88 plantlets\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eInsert\u003c/b\u003e Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e\u003cb\u003ehere\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003eOnly one out of 12 R0 events from the construct with soybean \u003cem\u003eRSP1\u003c/em\u003e promoter [pMON417179 (\u003cem\u003eP\u003c/em\u003e-\u003cem\u003eGm.RSP-1\u003c/em\u003e-\u003cem\u003ecre\u003c/em\u003e)] generated MF R1 progeny after analyzing 88 plantlets from each R0 event (Table S4). No MF R1 plant was obtained from the construct containing napin promoter [pMON263567 (P-\u003cem\u003eBr.nap\u003c/em\u003e-\u003cem\u003ecre\u003c/em\u003e-T-\u003cem\u003eBr.nap\u003c/em\u003e)] after analyzing R1 progenies from nine single copy R0 events (Table S5).\u003c/p\u003e \u003cp\u003eThe most effective marker gene excision was recovered from pMON420845 with \u003cem\u003eeUSP88\u003c/em\u003e promoter. Seeds from eight single copy R0 events were planted and sampled for R1 MF progeny screening with GOI and \u003cem\u003eaadA\u003c/em\u003e TaqMan\u0026reg; probes. All eight R0 events produced MF R1 progeny with seven R0 events producing homozygous MF plants. On average 32.7% of the projected \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;transgenic R1 [173/(704x75%)] are verified to be truly MF by TaqMan\u0026reg; assay, among which 37.5% of the projected homozygous \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;transgenic R1 progenies [66/(704x25%)] were confirmed to be MF by TaqMan\u0026reg; assay (Table\u0026nbsp;\u003cspan refid=\"Tab8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab8\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 8\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eR1 MF progeny from canola plants transformed with pMON420845 (\u003cem\u003eP-Vf.eUSP88\u003c/em\u003e-\u003cem\u003ecre\u003c/em\u003e)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eR0 event\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR1 total\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTotal \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plants\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHomozygous \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plants\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_eUSP88-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_eUSP88-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_eUSP88-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_eUSP88-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_eUSP88-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_eUSP88-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_eUSP88-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBN_eUSP88-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e704\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e173\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e66\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cb\u003eNote\u003c/b\u003e: BN_eUSP88: \u003cem\u003eBrassica napus\u003c/em\u003e plant with \u003cem\u003eVicia faba\u003c/em\u003e enhanced \u003cem\u003eUSP88\u003c/em\u003e promoter driven \u003cem\u003ecre\u003c/em\u003e. If 100% marker gene excision presents in R1 population, we expect total 66 MF R1 plants (75%) and 22 homozygous MF plants (25%) from total 88 plantlets\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eInsert\u003c/b\u003e Table\u0026nbsp;\u003cspan refid=\"Tab8\" class=\"InternalRef\"\u003e8\u003c/span\u003e\u003cb\u003ehere\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e4. Marker-gene autoexcision in maize transformation\u003c/h2\u003e \u003cp\u003eThe initial promising SMG autoexcision in soybean transformation with the \u003cem\u003eArabidopsis CDC45\u003c/em\u003e promoter directly inspired us to search for monocot homologous promoters for maize SMG autoexcision. These vectors showed no obvious impact on maize TF when they were used for marker gene autoexcision in maize. However, other \u003cem\u003eCDC45\u003c/em\u003e promoters tested, including one at maize chromosome 10 (GenBank accession NC_050105.1, region 2024417..2026424) and one at rice chromosome 12 (GenBank accession NC_029267.1, region 1187144..1189143), showed a TF drop when used for marker gene autoexcision in maize transformation, suggesting leaky expression in vegetative tissue (data not shown).\u003c/p\u003e \u003cp\u003eThe rice and maize \u003cem\u003eCDC45-1\u003c/em\u003e promoters showed similar marker gene autoexcision efficiency in maize LH244 immature embryo transformation. All 9 R0 events from pMON243847 with rice \u003cem\u003eCDC45-1\u003c/em\u003e promoter showed on average 44% marker removal from total projected \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;transgenic R1 [113/(339x75%)], and 40% [34/(339x25%)] marker removal in the projected homozygous \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;transgenic R1 plants (Table\u0026nbsp;\u003cspan refid=\"Tab9\" class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab9\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 9\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eR1 MF progeny from maize plants transformed with pMON243847 (\u003cem\u003eP-Os.CDC45-Cre\u003c/em\u003e)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMaize R0 event\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR1 total\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTotal \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plant\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHomozygous \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plants\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Os.CDC45-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Os.CDC45-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Os.CDC45-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Os.CDC45-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Os.CDC45-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Os.CDC45-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Os.CDC45-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Os.CDC45-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Os.CDC45-9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e339\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e113\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e34\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cb\u003eNote\u003c/b\u003e: ZM_Os.CDC45: \u003cem\u003eZea mays\u003c/em\u003e plant with rice \u003cem\u003eCDC45\u003c/em\u003e promoter driven \u003cem\u003ecre\u003c/em\u003e. If 100% marker gene excision presents in R1 population, we expect total 30.75 MF R1 plants (75%) and 10.25 homozygous MF plants (25%) from total 41 plantlets (i.e. single locus transmission, 1 null: 2 homozygous: 1 hemizygous).\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eInsert\u003c/b\u003e Table\u0026nbsp;\u003cspan refid=\"Tab9\" class=\"InternalRef\"\u003e9\u003c/span\u003e\u003cb\u003ehere\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003eSimilarly, R1 seeds from 10 single copy R0 events from pMON138232 with maize \u003cem\u003eCDC45-1\u003c/em\u003e promoter were analyzed for MF segregation (Table\u0026nbsp;\u003cspan refid=\"Tab10\" class=\"InternalRef\"\u003e10\u003c/span\u003e). All 10 R0 events produced MF progeny at 41% [101/(328x75%)] frequency of the total projected \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;transgenic plants, and 19.5% [16/(328x25%)] of the projected homozygous plants.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab10\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 10\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eR1 MF progeny from maize plants transformed with pMON138232 (\u003cem\u003eP-Zm.CDC45-Cre\u003c/em\u003e)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMaize R0 event\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR1 total\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTotal \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plant\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHomozygous \u003cem\u003egusA\u003c/em\u003e\u0026thinsp;+\u0026thinsp;MF R1 plants\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Zm.CDC45-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Zm.CDC45-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Zm.CDC45-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e*ZM_Zm.CDC45-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Zm.CDC45-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Zm.CDC45-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Zm.CDC45-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Zm.CDC45-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Zm.CDC45-9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZM_Zm.CDC45-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e328\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e101\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cb\u003eNote\u003c/b\u003e: ZM_Zm.CDC45: \u003cem\u003eZea mays\u003c/em\u003e plant with maize \u003cem\u003eCDC45\u003c/em\u003e promoter driven \u003cem\u003ecre.\u003c/em\u003e *ZM_ Zm.CDC45-4 has 45 green plants and 13 albinos dying later.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eInsert\u003c/b\u003e Table\u0026nbsp;\u003cspan refid=\"Tab10\" class=\"InternalRef\"\u003e10\u003c/span\u003e\u003cb\u003ehere\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe MF nature in pMON138232 R1 plants was further confirmed by Southern blot. Twenty TaqMan\u0026reg; screened MF R1 plants from Table\u0026nbsp;\u003cspan refid=\"Tab10\" class=\"InternalRef\"\u003e10\u003c/span\u003e were sampled for DNA extraction and analyzed by Southern blot. The same Southern blot membrane was hybridized with DIG labeled \u003cem\u003egusA\u003c/em\u003e probe, then stripped and re-hybridized with DIG labeled \u003cem\u003ecre\u003c/em\u003e probe. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, all 20 selected lines did not hybridize with the \u003cem\u003ecre\u003c/em\u003e probe, whereas all showed a clear signal with the \u003cem\u003egusA\u003c/em\u003e probe, which is consistent with the TaqMan\u0026reg; screening results.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eInsert\u003c/b\u003e Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u003cb\u003ehere\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eMany efficient transformation systems require tissue culture and plant regeneration under antibiotic or herbicide selection. The Cre\u003cem\u003e/loxP\u003c/em\u003e recombination system, which allows for transgenic plant selection under tissue culture conditions followed by selectable marker removal, has been widely reported in many species. The SMG autoexcision to generate MF plants can be obtained by using heat-, cold-, drought- or chemically inducible promoters. An ideal promoter to drive the \u003cem\u003ecre\u003c/em\u003e recombinase for marker gene autoexcision should have no leaky expression in vegetative tissues during the tissue culture steps to allow transgenic shoot development under selection. We envisioned that reproductive tissue specific (floral-, meiosis-, microspore-, pollen- or egg-specific) promoters may be the most suitable for this purpose. Since transgenic plants with hemizygous alleles must take one more generation for homozygous line production, floral or meiosis promoters working in both male and female germline cells are highly desirable for marker gene autoexcision. Other promoters, such as soybean \u003cem\u003eRSP1\u003c/em\u003e with background level expression in vegetative tissues but significant expression in germline cells, may be a good option as well if the TF is not impacted due to premature excision.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePremature marker gene excision and transformation system\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eArabidopsis CDC45\u003c/em\u003e promoter was found to be promising for SMG autoexcision in our soybean transformation system. The \u003cem\u003eCDC45\u003c/em\u003e gene is reported to be required for initiation of DNA replication and mainly upregulated at the G1/S transition and in young meiotic flower buds (Stevens et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). The promoter has enabled us to obtain MF transgenic plants in soybean, cotton, and canola, albeit with decreased TF and mottle leaf phenotype. It is also surprising to see the dicotyledonous \u003cem\u003eCDC45\u003c/em\u003e promoter is active in maize (Table S6) which produced some MF lines without a decrease in the TF, suggesting that a common expression motif may be present in the promoter for both dicotyledonous and monocot expression.\u003c/p\u003e \u003cp\u003eWe observed a decrease in the TF and mottled phenotype in leaf tissues with the \u003cem\u003eAt.CDC45\u003c/em\u003e promoter driving \u003cem\u003ecre\u003c/em\u003e expression in our dicotyledonous transformation system. One explanation is that the expression of \u003cem\u003ecre\u003c/em\u003e with the \u003cem\u003eAt.CDC45\u003c/em\u003e promoter in vegetative tissues could have resulted in premature marker gene removal during plant regeneration under selection.\u003c/p\u003e \u003cp\u003eHowever, we were still able to recover some of the events with the mottled leaf phenotype. We use an \u003cem\u003eaadA/spectinomycin\u003c/em\u003e non-lethal selection system for dicotyledonous transformation (Martinell et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Chen et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Spectinomycin binds to the 16S rRNA, which blocks translation on the prokaryotic type 70S plastid ribosomes and usually induces albino leaves in dicotyledonous transformation (Svab et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e1990\u003c/span\u003e). Premature marker removal during tissue culture in this non-lethal selection system still allows a portion of the chimeric transgenic/non-transgenic tissue to survive for shoot regeneration. The MF areas on leaves are bleached by spectinomycin and produce a mottled phenotype. The transgenic plants with such phenotypes can be fully recovered in soil as chlorophyll biosynthesis resumes after the spectinomycin selection is removed. Therefore, the success of MF seed production with the leaky \u003cem\u003eCDC45\u003c/em\u003e promoter is unique to our non-lethal selection system, which may not be replicated in other lethal selection transformation systems.\u003c/p\u003e \u003cp\u003eSeveral developmentally regulated promoters have been used in floral dip transformation system (Van Ex et al., 2007; Verweire et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). In such a non-tissue culture system, vegetative leaky expression is not a concern as the T1 transformants directly come from the egg cells during flowering. Leaky expression can be an advantage to remove the SMG in T1 during seed germination. The \u003cem\u003eArabidopsis CLV3\u003c/em\u003e has been reported to generate 100% marker removal in T2 plants (Van Ex et al., 2007), which is not feasible for transformation system based on tissue culture, because the \u003cem\u003eCLV3\u003c/em\u003e gene is expressed mainly in shoot apical meristems, which will lead to marker excision during shoot regeneration under selection. Indeed, when we used the \u003cem\u003eArabidopsis\u003c/em\u003e meristem-specific \u003cem\u003eErecta\u003c/em\u003e promoter (Yokoyama et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e1998\u003c/span\u003e) for autoexcision in soybean, the TF dropped greatly (data not shown).\u003c/p\u003e \u003cp\u003eThe system using BBM/WUS2 for plant transformation is unique, in which plant regeneration depends on BBM/WUS2 expression in initial tissue culture materials after embryo induction followed by removal of both embryogenic genes. Both developmentally regulated and inducible promoters have been used to excise the BBM/WUS2 expression to enable plant regeneration and the excision frequency was counted as R0 MF events (Wang et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Such a system may not be applied on other tissue culture-based transformation systems as a selectable marker gene is required for transgenic tissue proliferation.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAutoexcision activity of a\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003ecre\u003c/span\u003e \u003cb\u003epromoter may be different among species and germplasms\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA specific \u003cem\u003ecre\u003c/em\u003e promoter often shows very different autoexcision pattern in different species, dependent on the transformation and selection methods. In addition to the \u003cem\u003eAt.CDC4\u003c/em\u003e5 promoter mentioned above, the best canola autoexcision promoter from \u003cem\u003eVicia faba, eUSP88\u003c/em\u003e, produces much less marker gene autoexcision in soybean. The \u003cem\u003eeUSP88\u003c/em\u003e promoter appeared to be highly specific in embryos in soybean and canola, and no expression in callus (B\u0026auml;umlein et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e1991\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). In our canola experiments, hypocotyl materials were used for transformation and plant regeneration requires callus formation. When canola embryonic materials were used for transformation, we noticed a large reduction with the same autoexcision construct, suggesting that the \u003cem\u003eeUSP88\u003c/em\u003e drives expression in embryo tissue which caused premature marker gene excision. Previously, an embryo-specific \u003cem\u003eapp1\u003c/em\u003e promoter from \u003cem\u003eArabidopsis pei1\u003c/em\u003e gene was reported to drive marker gene autoexcision in soybean embryogenic culture transformation by particle bombardment and resulted in 30% R0 events with MF progeny (Li et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). The \u003cem\u003eeUSP88\u003c/em\u003e promoter expression is similar to the \u003cem\u003eapp1\u003c/em\u003e promoter in the early heart stage to the late cotyledon stage of embryo development (B\u0026auml;umlein et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e1991\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eGm.RSP1\u003c/em\u003e promoter showed the best marker autoexcision frequency among the tested promoters in soybean transformation. However, it performed poorly in canola, suggesting that the expression is limited to the species or the transformation system. The construct with the \u003cem\u003eGm.RSP1\u003c/em\u003e promoter and \u003cem\u003eAt.AtpE\u003c/em\u003e intron has very different excision frequency in soybean and cotton. It gave poor autoexcision in soybean (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) but showed the best autoexcision frequency in cotton transformation (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). It is plausible that the \u003cem\u003ecre\u003c/em\u003e cassette with the \u003cem\u003eArabidopsis\u003c/em\u003e intron is poorly expressed in soybean by not properly splicing.\u003c/p\u003e \u003cp\u003eA napin promoter has been reported to enable efficient marker gene excision in \u003cem\u003eBrassica napus\u003c/em\u003e (Kopertekh et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). We tested a seed-specific napin promoter (Fig. S1, A, B) in canola for marker autoexcision and did not observe any marker gene excision in R1 progeny. Sequence BLAST analysis revealed different napin promoters in GenBank are highly similar in the last 300 bp (data not shown). The marker excision difference in the two napin promoters may be due to different germplasms being used in the experiments or different expression patterns between the two similar embryo-specific napin promoters.\u003c/p\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003eChimera marker gene excision may occur in R0 and but not in progeny\u003c/h2\u003e \u003cp\u003eNon-specific \u003cem\u003ecre\u003c/em\u003e expression in vegetative tissues and non-germline cell expression may be the major reason for chimeric marker excision in R0 plants, which is often associated with a decrease in TF and potential phenotypes such as mottle leaves in our soybean and cotton transformation systems with non-lethal \u003cem\u003eaadA\u003c/em\u003e selectable marker.\u003c/p\u003e \u003cp\u003eIn addition to reported strong meiotic cell expression, the \u003cem\u003eAt.CDC45\u003c/em\u003e promoter appears to be leaky in leaf tissue in all three dicotyledonous species we tested, which formed chimera leaves in R0 events (Fig. S2 B, E). However, the R1 seeds are derived from single reproductive cells, in which the marker is excised either in vegetative tissues or during flowering due to the strong activity at meiosis (Stevens et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2004\u003c/span\u003e), and for this reason, no chimera excision has been observed in R1 MF plants.\u003c/p\u003e \u003cp\u003e \u003cem\u003eCre\u003c/em\u003e driven by embryo-specific promoters are more likely to form chimeric R0 events. Li et al. (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) reported that the 13% complete excision and 31% chimeric excision were observed in R0 soybean plants when the \u003cem\u003eapp1\u003c/em\u003e promoter was used for autoexcision. Moravc\u0026iacute;kov\u0026aacute; et al. (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2008\u003c/span\u003e) reported that the \u003cem\u003ecre\u003c/em\u003e driven by \u003cem\u003eArabidopsis\u003c/em\u003e cruciferin C promoter regenerated chimeric T0 plant, only 10.2% T1 plant showed complete marker excision, and the excision rate was increased by repeated \u003cem\u003ecre\u003c/em\u003e activation in T2 plants, which may indicate that the cruciferin promoter is expressed in late embryo stage and not a vegetative or germline preferred promoter. We did not observe chimeric marker excision in canola plants from \u003cem\u003eeUSP88-cre\u003c/em\u003e autoexcision after two generation observation, indicating earlier embryo expression present in this promoter as confirmed in Fig S1, D, which caused embryo complete abortion when \u003cem\u003esplA\u003c/em\u003e is expressed.\u003c/p\u003e \u003c/div\u003e "},{"header":"Conclusion remark","content":"\u003cp\u003eThe Cre/\u003cem\u003eloxP\u003c/em\u003e system is an effective tool for removal of SMGs in transgenic plants. Efficient marker gene autoexcision by a developmentally regulated promoter is often species dependent. We tested a diverse set of promoters in multiple agriculturally important crop species, and identified promising promoters for soybean, cotton, canola and maize marker gene autoexcision. Testing of specific promoters for good marker excision efficiency remains an option for many plant species.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXY nominated promoters, constructed plasmids, collected data, coordinated work, and drafted the manuscript. ZV nominated promoters, constructed plasmids, did all Southern blot analyses.\u0026nbsp;EJW performed portion of soybean transformation.\u0026nbsp;FC constructed plasmids. LJ conducted maize progeny molecular analyses. FL performed canola transformation. ELH and SXG organized canola experiments. LF designed TaqMan\u003csup\u003e\u0026reg;\u003c/sup\u003e assays. LG introduced Cre/\u003cem\u003eloxP\u003c/em\u003e technology to us and critically revised the manuscript. All authors reviewed and approved the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe sincerely thank numerous former Monsanto colleagues in Middleton, Wisconsin; Davis, California; Mystic, Connecticut and St. Louis, Missouri for transgenic plant production, greenhouse care and molecular analyses. Special thanks to Drs. David Somers and Doug Boyes for supporting this research and Drs.\u0026nbsp;Jenn To, Miguel Vega-Sanchez, Bertho Lieselot and Julie Francois\u0026nbsp;for critical review of the manuscript.\u003c/p\u003e\n\u003ch4\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/h4\u003e\n\u003cp\u003eThe authors are employees of Bayer Crop Science, a manufacturer of seeds produced by conventional and biotechnology methods. A relevant US patent application has been submitted and assigned to Bayer Crop Science.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBai X, Wang Q, Chu C (2008) Excision of a selective marker in transgenic rice using a novel Cre/\u003cem\u003eloxP\u003c/em\u003e system controlled by a floral specific promoter. Transgenic Res 17:1035\u0026ndash;1043. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s11248-008-9182-7\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s11248-008-9182-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eB\u0026auml;umlein H, Boerjan W, Nagy I, Bass\u0026uuml;ner R, Van Montagu M, Inz\u0026eacute; D, Wobus U (1991) A novel seed protein gene from \u003cem\u003eVicia faba\u003c/em\u003e is developmentally regulated in transgenic tobacco and \u003cem\u003eArabidopsis\u003c/em\u003e plants. Mol Gen Genet 225:459\u0026ndash;467. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/BF00261688\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/BF00261688\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBayley CC, Morgan M, Dale EC, Ow DW (1992) Exchange of gene activity in transgenic plants catalyzed by the Cre-\u003cem\u003elox\u003c/em\u003e site-specific recombination system. Plant Mol Biol 18(2):353\u0026ndash;361. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://\u003c/span\u003e\u003cspan address=\"https://\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/BF00034962\u003c/span\u003e\u003cspan address=\"10.1007/BF00034962\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCalabotta BJ, Deppermann KL, Dersch E, Heise JD, Koestel AR, Ludwig CL, Martinell BJ, Williams E (2013) Preparation and use of plant embryo explants for transformation. US Pat. US8362317B2\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y, Rivlin A, Lange A, Ye X, Vaghchhipawala Z, Eisinger E, Dersch E, Paris M, Martinell B, Wan Y (2014) High throughput \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e-mediated germline transformation of mechanically isolated meristem explants of cotton (\u003cem\u003eGossypium hirsutum L\u003c/em\u003e.). Plant Cell Rep 33(1):153\u0026ndash;164. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://\u003c/span\u003e\u003cspan address=\"https://\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00299-013-1519-x\u003c/span\u003e\u003cspan address=\"10.1007/s00299-013-1519-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChong-P\u0026eacute;rez B, Reyes M, Rojas L, Oca\u0026ntilde;a B, Ramos A, Kosky RG, Angenon G (2013) Excision of a selectable marker gene in transgenic banana using a Cre/\u003cem\u003elox\u003c/em\u003e system controlled by an embryo specific promoter. Plant Mol Biol 83(1\u0026ndash;2):143\u0026ndash;152. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://\u003c/span\u003e\u003cspan address=\"https://\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11103-013-0058-8\u003c/span\u003e\u003cspan address=\"10.1007/s11103-013-0058-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCuellar W, Gaudin A, Sol\u0026oacute;rzano D, Casas A, Nopo L, Chudalayandi P, Medrano G, Kreuze J, Ghislain M (2006) Self-excision of the antibiotic resistance gene \u003cem\u003enptII\u003c/em\u003e using a heat inducible Cre-\u003cem\u003eloxP\u003c/em\u003e system from transgenic potato. Plant Mol Biol 62(1\u0026ndash;2):71\u0026ndash;82. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s11103-006-9004-3\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s11103-006-9004-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation: version II. Plant Mol Biol Rep 1:19\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/BF02712670\u003c/span\u003e\u003cspan address=\"10.1007/BF02712670\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDepicker A, Stachel S, Dhaese P, Zambryski P, Goodman HM (1982) Nopaline synthase: transcript mapping and DNA sequence. J Mol Appl Genet 1:561\u0026ndash;573\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDersch E, Heinzen RJ, Martinell BJ, Rivlin A, Wan Y, Ye X (2015) Method of meristem excision and transformation. US Pat. No. US8937216B2\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu D, Jin R, Guo J, Zhang F (2019) Construction of marker-free genetically modified maize using a heat-inducible autoexcision vector. Genes 10:374. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.3390/genes10050374\u003c/span\u003e\u003cspan address=\"https://doi:10.3390/genes10050374\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u0026Eacute;va C, T\u0026eacute;gl\u0026aacute;s F, Zeleny\u0026aacute;nszki H, Tam\u0026aacute;s C, Juh\u0026aacute;sz A, M\u0026eacute;sz\u0026aacute;ros K, Tam\u0026aacute;s L (2018) Cold inducible promoter driven Cre-\u003cem\u003elox\u003c/em\u003e system proved to be highly efficient for marker gene excision in transgenic barley. J Biotechnol 265:15\u0026ndash;24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1016/j.jbiotec.2017.10.016\u003c/span\u003e\u003cspan address=\"https://doi:10.1016/j.jbiotec.2017.10.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu C, Donovan WP, Shikapwashya-Hasser O, Ye X, Cole RH (2014) Hot Fusion: an efficient method to clone multiple DNA fragments as well as inverted repeats without ligase. PLoS One 9(12):e115318. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0115318\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0115318\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarc\u0026iacute;a-Almod\u0026oacute;var RC, Petri C, Padilla IMG, Burgos L (2014) Combination of site-specific recombination and a conditional selective marker gene allows for the production of marker-free tobacco plants. Plant Cell Tiss Organ Cult 116:205\u0026ndash;215. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11240-013-0396-x\u003c/span\u003e\u003cspan address=\"10.1007/s11240-013-0396-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGidoni D, Srivastava V, Carmi N (2008) Site-specific excisional recombination strategies for elimination of undesirable transgenes from crop plants. In Vitro Cell Dev Biol Plant 44:457\u0026ndash;467. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11627-008-9140-3\u003c/span\u003e\u003cspan address=\"10.1007/s11627-008-9140-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGilbertson L (2003) Cre-\u003cem\u003elox\u003c/em\u003e recombination: Cre-ative tools for plant biotechnology. Trends Biotechnol 21:550\u0026ndash;555. https://. doi\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHare P, Chua NH (2002) Excision of selectable marker genes from transgenic plants. Nat Biotechnol 20(6):575\u0026ndash;580. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://\u003c/span\u003e\u003cspan address=\"https://\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nbt0602-575\u003c/span\u003e\u003cspan address=\"10.1038/nbt0602-575\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang S, Gilbertson LA, Adams TH, Malloy KP, Reisenbigler EK, Birr DH, Snyder MW, Zhang Q, Luethy MH (2004) Generation of marker-free transgenic maize by regular two-border \u003cem\u003eAgrobacterium\u003c/em\u003e transformation vectors. Transgenic Res 13:451\u0026ndash;461. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s11248-004-1453-3\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s11248-004-1453-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKopertekh L, Broer I, Schiemann J (2009) Developmentally regulated site-specific marker gene excision in transgenic \u003cem\u003eB. napus\u003c/em\u003e plants. Plant Cell Rep 28:1075\u0026ndash;1083. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s00299-009-0711-5\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s00299-009-0711-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKopertekh L, Schulze K, Frolov A, Strack D, Broer I, Schiemann J (2010) Cre-mediated seed-specific transgene excision in tobacco. Plant Mol Biol 72:597\u0026ndash;605. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s11103-009-9595-6\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s11103-009-9595-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Z, Xing A, Moon BP, Burgoyne SA, Guida AD, Liang H, Lee C, Caster CS, Barton JE, Klein TM, Falco SC (2007) A Cre/\u003cem\u003eloxP\u003c/em\u003e-mediated self-activating gene excision system to produce marker gene free transgenic soybean plants. Plant Mol Biol 65:329\u0026ndash;341. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s11103-007-9223-2\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s11103-007-9223-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo K, Duan H, Zhao D, Zheng X, Deng W, Chen Y, Stewart CN Jr, McAvoy R, Jiang X, Wu Y, He A, Pei Y, Li Y (2007) 'GM-gene-deletor': fused \u003cem\u003eloxP-FRT\u003c/em\u003e recognition sequences dramatically improve the efficiency of FLP or CRE recombinase on transgene excision from pollen and seed of tobacco plants. Plant Biotechnol J 5:263\u0026ndash;274. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1111/j.1467-7652.2006.00237.x\u003c/span\u003e\u003cspan address=\"https://doi:10.1111/j.1467-7652.2006.00237.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa BG, Duan XY, Niu JX, Ma C, Hao QN, Zhang LX, Zhang HP (2009) Expression of stilbene synthase gene in transgenic tomato using salicylic acid-inducible Cre/\u003cem\u003eloxP\u003c/em\u003e recombination system with self-excision of selectable marker. Biotechnol Lett 31:163\u0026ndash;169. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s10529-008-9843-x\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s10529-008-9843-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartinell BJ, Julson LS, Emler CA, Huang Y, McCabe DE, Williams EJ (2022) Soybean agrobacterium transformation method. US Patent No. US6384301B1\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartinell BJ, Petersen MW, Somers DA, Wan Y, Williams E, Ye X (2011) Methods for plant transformation using spectinomycin selection. US Patent No. US8030544B2\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcElroy D, Zhang W, Cao J, Wu R (1990) Isolation of an efficient actin promoter for use in rice transformation. Plant Cell 2:163\u0026ndash;171. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1105/tpc.2.2.163\u003c/span\u003e\u003cspan address=\"https://doi:10.1105/tpc.2.2.163\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiki B, McHugh S (2004) Selectable marker genes in transgenic plants: applications, alternatives and biosafety. J Biotech 107:193\u0026ndash;232. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1016/j.jbiotec.2003.10.011\u003c/span\u003e\u003cspan address=\"https://doi:10.1016/j.jbiotec.2003.10.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMookkan M, Nelson-Vasilchik K, Hague J, Zhang ZJ, Kausch AP (2017) Selectable marker independent transformation of recalcitrant maize inbred B73 and sorghum P898012 mediated by morphogenic regulators BABY BOOM and WUSCHEL2. Plant Cell Rep 36:1477\u0026ndash;1491. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s00299-017-2169-1\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s00299-017-2169-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoravc\u0026iacute;kov\u0026aacute; J, Vaculkov\u0026aacute; E, Bauer M, Libantov\u0026aacute; J (2008) Feasibility of the seed specific cruciferin C promoter in the self excision Cre/\u003cem\u003eloxP\u003c/em\u003e strategy focused on generation of marker-free transgenic plants. Theor Appl Genet 117:1325\u0026ndash;1334. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s00122-008-0866-4\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s00122-008-0866-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePetri C, L\u0026oacute;pez-Noguera S, Wang H, Garc\u0026iacute;a-Almod\u0026oacute;var C, Alburquerque N, Burgos L (2012) A chemical-inducible Cre-\u003cem\u003eLoxP\u003c/em\u003e system allows for elimination of selection marker genes in transgenic apricot. Plant Cell Tiss Organ Cult 110:337\u0026ndash;346. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11240-012-0155-4\u003c/span\u003e\u003cspan address=\"10.1007/s11240-012-0155-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePol\u0026oacute;niov\u0026aacute; Z, Jopč\u0026iacute;k M, Matuš\u0026iacute;kov\u0026aacute; I, Libantov\u0026aacute; J, Moravč\u0026iacute;kov\u0026aacute; J (2015) The pollen- and embryo-specific \u003cem\u003eArabidopsis DLL\u003c/em\u003e promoter bears good potential for application in marker-free Cre/\u003cem\u003eloxP\u003c/em\u003e self-excision strategy. Plant Cell Rep 34:469\u0026ndash;481. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s00299-014-1726-0\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s00299-014-1726-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePradhan S, Chakraborty A, Sikdar N, Chakraborty S, Bhattacharyya J, Mitra J, Manna A, Dutta Gupta S, Sen SK (2016) Marker-free transgenic rice expressing the vegetative insecticidal protein (Vip) of \u003cem\u003eBacillus thuringiensis\u003c/em\u003e shows broad insecticidal properties. Planta 244:789\u0026ndash;804. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s00425-016-2535-1\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s00425-016-2535-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRadke SE, Turner JC, Facciotti D (1992) Transformation and regeneration of \u003cem\u003eBrassica rapa\u003c/em\u003e using \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e. Plant Cell Rep 11:499\u0026ndash;505. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/BF00236265\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/BF00236265\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosellini D (2012) Selectable markers and reporter genes: a well furnished toolbox for plant science and genetic engineering. Crit Rev Plant Sci 31:401\u0026ndash;453. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/07352689.2012.683373\u003c/span\u003e\u003cspan address=\"10.1080/07352689.2012.683373\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSidorov V, Duncan D (2009) \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated maize transformation: immature embryos versus callus. Methods Mol Biol 526:47\u0026ndash;58. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/978-1-59745-494-0_4\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/978-1-59745-494-0_4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShiva Prakash N, Bhojaraja R, Shivbachan SK, Hari Priya GG, Nagraj TK, Prasad V, Srikanth Babu V, Jayaprakash TL, Dasgupta S, Spencer TM, Boddupalli RS (2009) Marker-free transgenic corn plant production through co-bombardment. Plant Cell Rep 28:1655\u0026ndash;1668. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s00299-009-0765-4\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s00299-009-0765-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSreekala C, Wu L, Gu K, Wang D, Tian D, Yin Z (2005) Excision of a selectable marker in transgenic rice (\u003cem\u003eOryza sativa L\u003c/em\u003e.) using a chemically regulated Cre/\u003cem\u003eloxP\u003c/em\u003e system. Plant Cell Rep 24:86\u0026ndash;94. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s00299-004-0909-5\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s00299-004-0909-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStevens R, Grelon M, Vezon D, Oh J, Meyer P, Perennes C, Domenichini S, Bergounioux C (2004) A \u003cem\u003eCDC45\u003c/em\u003e homolog in \u003cem\u003eArabidopsis\u003c/em\u003e is essential for meiosis, as shown by RNA interference-induced gene silencing. Plant Cell 16:99\u0026ndash;113. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1105/tpc.016865\u003c/span\u003e\u003cspan address=\"https://doi:10.1105/tpc.016865\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSvab Z, Hajdukiewicz P, Maliga P (1990) Stable transformation of plastids in higher plants. Proc Natl Acad Sci USA 87:8526\u0026ndash;8530. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1073/pnas.87.21.8526\u003c/span\u003e\u003cspan address=\"https://doi:10.1073/pnas.87.21.8526\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Ex F, Verweire D, Claeys M, Depicker A, Angenon G (2009) Evaluation of seven promoters to achieve germline directed Cre-\u003cem\u003elox\u003c/em\u003e recombination in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e. Plant Cell Rep 28:1509\u0026ndash;1520. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s00299-009-0750-y\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s00299-009-0750-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVancanneyt G, Schmidt R, O\u0026rsquo;Connor-Sanchez A, Willmitzer L, Rocha-Sosa M (1990) Construction of an intron-containing marker gene: splicing of the intron in transgenic plants and its use in monitoring early events in \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated plant transformation. Mol Genet Gen 220:245\u0026ndash;250. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/BF00260489\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/BF00260489\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerweire D, Verleyen K, De Buck S, Claeys M, Angenon G (2007) Marker-free transgenic plants through genetically programmed autoexcision. Plant Physiol 145:1220\u0026ndash;1231. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1104/pp.107.106526\u003c/span\u003e\u003cspan address=\"https://doi:10.1104/pp.107.106526\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang N, Arling M, Hoerster G, Ryan L, Wu E, Lowe K, Gordon-Kamm W, Jones TJ, Chilcoat ND, Anand A (2020) An Efficient Gene Excision System in Maize. Front Plant Sci 11:1298. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.3389/fpls.2020.01298\u003c/span\u003e\u003cspan address=\"https://doi:10.3389/fpls.2020.01298\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Chen B, Hu Y, Li J, Lin Z (2005) Inducible excision of selectable marker gene from transgenic plants by the cre/\u003cem\u003elox\u003c/em\u003e site-specific recombination system. Transgenic Res 14:605\u0026ndash;614. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://\u003c/span\u003e\u003cspan address=\"https://\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11248-005-0884-9\u003c/span\u003e\u003cspan address=\"10.1007/s11248-005-0884-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Q, Fagaly T, Bassuner R, Liang J, Oulmassov TN, Dabrowski J (2006) Seed specific USP promoters for expressing genes in plants. US patent No. US7078588B2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu H, Li Y, Yan Y, Wang K, Yai Y, Hu Y (2010) Genome-scale identification of Soybean BURP domain-containing genes and their expression under stress treatments. BMC Plant Biol 10:197. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1186/1471-2229-10-197\u003c/span\u003e\u003cspan address=\"https://doi:10.1186/1471-2229-10-197\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYau Y, Stewart CN (2013) Less is more: strategies to remove marker genes from transgenic plants. BMC Biotechnol 13:36. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1186/1472-6750-13-36\u003c/span\u003e\u003cspan address=\"https://doi:10.1186/1472-6750-13-36\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe X, Williams EJ, Shen J, Esser JA, Nichols AM, Petersen MW, Gilbertson LA (2008) Plant development inhibitory genes in binary vector backbone improve quality event efficiency in soybean transformation. Transgenic Res 17(5):827\u0026ndash;838. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://\u003c/span\u003e\u003cspan address=\"https://\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11248-008-9169-4\u003c/span\u003e\u003cspan address=\"10.1007/s11248-008-9169-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe X, Williams EJ, Shen J, Johnson S, Lowe B, Radke S, Strickland S, Esser JA, Petersen MW, Gilbertson LA (2011) Enhanced production of single copy backbone-free transgenic plants in multiple crop species using binary vectors with a pRi replication origin in \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e. Transgenic Res 20:773\u0026ndash;786. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s11248-010-9458-6\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s11248-010-9458-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe X, Chen Y, Wan Y, Hong YJ, Ruebelt MC, Gilbertson LA (2016) Constitutive expression of the \u003cem\u003etzs\u003c/em\u003e gene from \u003cem\u003eAgrobacterium tumefaciens virG\u003c/em\u003e mutant strains is responsible for improved transgenic plant regeneration in cotton meristem transformation. Plant Cell Rep 35:601\u0026ndash;611. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s00299-015-1906-6\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s00299-015-1906-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYokoyama R, Takahashi T, Kato A, Torii KU, Komeda Y (1998) The \u003cem\u003eArabidopsis ERECTA\u003c/em\u003e gene is expressed in the shoot apical meristem and organ primordia. Plant J 15(3):301\u0026ndash;310. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1046/j.1365-313x\u003c/span\u003e\u003cspan address=\"https://doi:10.1046/j.1365-313x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang W, Subbarao S, Addae P, Shen A, Armstrong C, Peschke V, Gilbertson L (2003) Cre/\u003cem\u003elox\u003c/em\u003e-mediated marker gene excision in transgenic maize (\u003cem\u003eZea mays\u003c/em\u003e L.) plants. Theor Appl Genet 107:1157\u0026ndash;1168. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s00122-003-1368-z\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s00122-003-1368-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZuo J, Niu QW, M\u0026oslash;ller SG, Chua NH (2001) Chemical-regulated, site-specific DNA excision in transgenic plants. Nat Biotechnol 19:157\u0026ndash;161. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://\u003c/span\u003e\u003cspan address=\"https://\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/84428\u003c/span\u003e\u003cspan address=\"10.1038/84428\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZou X, Peng A, Xu L, Liu X, Lei T, Yao L, He Y, Chen S (2013) Efficient autoexcision of a selectable marker gene from transgenic citrus by combining the Cre/\u003cem\u003eloxP\u003c/em\u003e system and \u003cem\u003eipt\u003c/em\u003e selection. Plant Cell Rep 32:1601\u0026ndash;1613. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1007/s00299-013-1470-x\u003c/span\u003e\u003cspan address=\"https://doi:10.1007/s00299-013-1470-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"plant-cell-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pcre","sideBox":"Learn more about [Plant Cell Reports](https://www.springer.com/journal/299)","snPcode":"299","submissionUrl":"https://submission.nature.com/new-submission/299/3","title":"Plant Cell Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Marker gene removal, Cre/loxP autoexcision, Agrobacterium-mediated transformation, marker-free transgenic plant, plant transformation, transgenic soybean, transgenic cotton, transgenic canola, transgenic maize","lastPublishedDoi":"10.21203/rs.3.rs-1731438/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1731438/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSelectable marker genes are often required for efficient generation of transgenic plants in tissue culture transformation systems but are not desired once the transgenic events are obtained. We have developed Cre/\u003cem\u003eloxP\u003c/em\u003e autoexcision systems to remove selectable marker genes in soybean, cotton, canola and maize. We tested a set of vectors with diverse promoters and identified promising promoters to drive \u003cem\u003ecre\u003c/em\u003e expression for each of the four crops. We evaluated both the efficiency of generating primary transgenic events with low transgene copy numbers, and the frequency of marker-free progeny in the next generation. The best performing vectors gave no obvious decrease in the transformation frequency in each crop and generated homozygous marker-free progeny in the next generation. We found that effective expression of Cre recombinase for marker gene autoexcision can be species dependent. Among the vectors tested, the best autoexcision frequency (41%) in soybean transformation came from using the soybean \u003cem\u003eRSP1\u003c/em\u003e promoter for \u003cem\u003ecre\u003c/em\u003e expression. The \u003cem\u003ecre\u003c/em\u003e gene expressed by soybean \u003cem\u003eRSP1\u003c/em\u003e promoter with an \u003cem\u003eArabidopsis AtpE\u003c/em\u003e intron delivered the best autoexcision frequency (69%) in cotton transformation. The \u003cem\u003ecre\u003c/em\u003e gene expressed by the embryo specific \u003cem\u003eeUSP88\u003c/em\u003e promoter from \u003cem\u003eVicia faba\u003c/em\u003e conferred the best marker excision frequency (32%) in canola transformation. Finally, the \u003cem\u003ecre\u003c/em\u003e gene expressed by the rice \u003cem\u003eCDC45-1\u003c/em\u003e promoter resulted in 44% autoexcision in maize transformation. The Cre/\u003cem\u003eloxP\u003c/em\u003e recombinase system enables the generation of selectable marker-free transgenic plants for commercial product development in four agriculturally important crops and provides further improvement opportunities for more specific and better marker excision efficiency.\u003c/p\u003e","manuscriptTitle":"Cre-mediated autoexision of selectable marker genes in soybean, cotton, canola and maize transgenic plants","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-06-16 15:58:54","doi":"10.21203/rs.3.rs-1731438/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Minor revisions","date":"2022-07-24T04:27:07+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2022-06-29T05:27:36+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-06-13T13:04:30+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-06-07T05:37:58+00:00","index":"","fulltext":""},{"type":"submitted","content":"Plant Cell Reports","date":"2022-06-06T14:56:35+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"plant-cell-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pcre","sideBox":"Learn more about [Plant Cell Reports](https://www.springer.com/journal/299)","snPcode":"299","submissionUrl":"https://submission.nature.com/new-submission/299/3","title":"Plant Cell Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"8676cf78-be33-476d-8145-a2fb57205f40","owner":[],"postedDate":"June 16th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2022-10-10T14:02:25+00:00","versionOfRecord":[],"versionCreatedAt":"2022-06-16 15:58:54","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1731438","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1731438","identity":"rs-1731438","version":["v1"]},"buildId":"oE6Zbj460LM0Up2FdVbMZ","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}