Shexiang baoxin pill protects against myocardial infarction induced chronic heart failure by activating energy metabolism via modulating mitochondrial biogenesis

Shexiang baoxin pill protects against myocardial infarction induced chronic heart failure by activating energy metabolism via modulating mitochondrial biogenesis | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 15 October 2025 V1 Latest version Share on Shexiang baoxin pill protects against myocardial infarction induced chronic heart failure by activating energy metabolism via modulating mitochondrial biogenesis Authors : kefa Xiang 0009-0004-8547-8296 , Shuai Zhang , Yimin Zheng , Jing Zeng , Feng Yu , and Feng Wu [email protected] Authors Info & Affiliations https://doi.org/10.22541/au.176054600.00720329/v1 129 views 70 downloads Contents Abstract Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract Background The disease known as myocardial infarction (MI)-induced chronic heart failure (CHF) is actually brought on by an imbalance in the energy metabolism of the heart’s supply and demand, which eventually leads to aberrant cardiac cell function and structure. An imbalance in energy metabolism is a major contributor to the pathological process of MI-induced CHF. Strengthening myocardial energy metabolism is a novel approach to treating CHF caused by MI. One well-known traditional Chinese medicine recipe, shexiang baoxin pill (SBP), offers good clinical therapeutic effects on cardiovascular disorders. Uncertainty exists regarding SBP’s impact on CHF’s energy metabolism following MI. In this work, we investigated the regulatory effects of SBP on energy metabolism in mice with CHF caused by MI using a variety of research strategies. Methods By ligating the left anterior descending coronary artery with silk thread, a mouse model of acute myocardial infarction (MI) was created. The success of the MI-induced HF model was verified by collecting the chocardiographic data. Afterwards, four distinct groups of mice were randomly assigned: HF, SBP, sham, and positive control (enalapril) groups. The technique utilized to assess heart function was echocardiography. Cardiac tissue necrosis and myocardial fibrosis were examined using H&E and Masson taining. Myocardial ATP levels were measured using colorimetry. The levels of NT-proBNP, MDA, and SOD were estimated by ELISA. Lastly, the expression levels of PGCα, NRF1, and TFAM in the myocardium were investigated using Western blotting and real-time fluorescence quantitative PCR (RT-qPCR). Results Treatment with SBP decreased oxidative stress and myocardial cell damage brought on by MI-induced CHF, while also improving remodeling of ventricular and cardiac function. Furthermore, ATP synthesis was reduced in MI-induced CHF along with alterations in the expression of genes associated to mitochondrial biosynthesis and mitochondrial respiratory function; all of these effects were considerably mitigated by SBP therapy. Conclusion Through energy metabolism modulation, SBP restores the cardiac dysfunction and myocardial structural integrity caused by MI. It’s possible that SBP’s regulatory influence on energy metabolism is connected to its positive reinforcement of mitochondrial biosynthesis. Shexiang baoxin pill protects against myocardial infarction induced chronic heart failure by activating energy metabolism via modulating mitochondrial biogenesis Kefa Xiang 1 , Shuai Zhang 1 , Yimin Zheng 1 , Jing Zeng 1* , Feng Yu 1* , Feng Wu 1* 1 Department of Cardiology, The 72nd Group Army Hospital, Huzhou University, Huzhou, Zhejiang 313000, P.R. China *Correspondence: [email protected] These first three authors contributed equally to this work Background The disease known as myocardial infarction (MI)-induced chronic heart failure (CHF) is actually brought on by an imbalance in the energy metabolism of the heart’s supply and demand, which eventually leads to aberrant cardiac cell function and structure. An imbalance in energy metabolism is a major contributor to the pathological process of MI-induced CHF. Strengthening myocardial energy metabolism is a novel approach to treating CHF caused by MI. One well-known traditional Chinese medicine recipe, shexiang baoxin pill (SBP), offers good clinical therapeutic effects on cardiovascular disorders. Uncertainty exists regarding SBP’s impact on CHF’s energy metabolism following MI. In this work, we investigated the regulatory effects of SBP on energy metabolism in mice with CHF caused by MI using a variety of research strategies. Methods By ligating the left anterior descending coronary artery with silk thread, a mouse model of acute myocardial infarction (MI) was created. The success of the MI-induced HF model was verified by collecting the chocardiographic data. Afterwards, four distinct groups of mice were randomly assigned: HF, SBP, sham, and positive control (enalapril) groups. The technique utilized to assess heart function was echocardiography. Cardiac tissue necrosis and myocardial fibrosis were examined using H&E and Masson taining. Myocardial ATP levels were measured using colorimetry. The levels of NT-proBNP, MDA, and SOD were estimated by ELISA. Lastly, the expression levels of PGCα, NRF1, and TFAM in the myocardium were investigated using Western blotting and real-time fluorescence quantitative PCR (RT-qPCR). Results Treatment with SBP decreased oxidative stress and myocardial cell damage brought on by MI-induced CHF, while also improving remodeling of ventricular and cardiac function. Furthermore, ATP synthesis was reduced in MI-induced CHF along with alterations in the expression of genes associated to mitochondrial biosynthesis and mitochondrial respiratory function; all of these effects were considerably mitigated by SBP therapy. Conclusion Through energy metabolism modulation, SBP restores the cardiac dysfunction and myocardial structural integrity caused by MI. It’s possible that SBP’s regulatory influence on energy metabolism is connected to its positive reinforcement of mitochondrial biosynthesis. Keywords Myocardial infarction, Chronic heart failure, Shexiang baoxin pill, Energy metabolism, Cardiac function, Mitochondrial biosynthesis 1. Introduction Heart failure (HF) is a disease that is growing more and more prevalent around the world and has a major clinical and financial burden [1]. It is a complex clinical syndrome characterized by symptoms such as respiratory distress, exercise intolerance, and fatigue, caused by impaired ventricular pumping function [2]. Once heart failure occurs, the condition progresses rapidly and irreversibly. The one-year hospitalization rate for patients with chronic heart failure(CHF) is 31.9%, and the one-year mortality rate is 7.2% [3]. Myocardial infarction(MI) is the predominant cause of HF. According to epidemiological studies, approximately 2.5 million patients experience MI annually, with a post- MI heart failure incidence rate of about 25-40% [4, 5]. HF can manifest at various stages following MI. Upon admission, the incidence ranges from 12% to 20.4%, during hospitalization it varies between 4% and 39%, and after discharge, it is approximately 13% at 30 days, 20-30% at one year, and an annual rate of 1.3-2.2% thereafter[6]. The onset of post-MI HF significantly deteriorates patient outcomes. According to a study utilizing the FAST-MI registry, 37.5% of patients experiencing acute MI subsequently developed HF. This subset of patients exhibited a markedly elevated risk of mortality both during their hospital stay (12.2% vs. 3.0%) and at one year post-discharge (26.6% vs. 5.2%) compared to those without HF [7]. As social aging accelerates, the survival rate for MI patients improves, and post-treatment outcomes for HF patients advance, the incidence of HF is on the rise. Moreever, rehospitalization rates and cardiac events among HF patients remain high [8]. Despite the implementation of the ”new quadruple therapy” consisting of Angiotensin Receptor Neprilysin Inhibitors (ARNI), evidence-based β-blockers, Mineralocorticoid Receptor Antagonists (MRA), and Sodium-Glucose Co-transporter 2 Inhibitors (SGLT2i) to standardize the medication treatment model for HF, the risk of mortality due to HF within five years remains above 50%. At the same time, there has been a lack of new mechanisms for HF drugs in recent years, and the heart failure market is calling for more, safer, and more effective medications [9]. As early as 2004, Circulation [10] and The New England Journal of Medicine in 2007 [11] both emphasized the important role of regulating myocardial cell energy metabolism in improving heart failure. During heart failure, myocardial cells prioritize the use of efficient glucose oxidation to provide ATP energy. Enhancing glycolytic oxidation for energy supply can improve myocardial contractile function, thereby slowing the progression of pump failure [12]. Increasing research confirms that myocardial energy metabolism is a new target for heart failure treatment [10, 13], and improving energy metabolism may be a milestone in the treatment of HF. Traditional Chinese Medicine (TCM) is an integral part of healthcare in East Asia and has been gaining attention as a new source of medicine in the Western medical community [14]. Shexiang Baoxin Pills (SBP) are a classic TCM formula consisting of seven ingredients: artificial musk, ginseng, artificial bezoar, cinnamon bark, toad venom, borneol, and Styrax. In China, SBP is currently one of the most commonly used traditional Chinese medicine formulas for treating or preventing cardiovascular diseases, with proven safety [15, 16]. Research has shown that SBP can directly benefit cardiovascular diseases through various mechanisms. Long-term oral administration of SBP can reduce the area of myocardial ischemia and the incidence of angina pectoris events [17, 18], possibly due to its ability to increase NO and decrease ET-1 and MDA, improving endothelial cell function and promoting angiogenesis [19, 20]; SBP can enhance key molecules involved in fatty acid oxidation pathways, such as AMPK，PGC-1α and PPAR-α， leading to decreased TG and catabolism levels, thus alleviating dyslipidemia [21]. SBP can inhibit the activation of the TGF-β1/Smads pathway, thereby hindering the progression of myocardial fibrosis caused by hypertension [22]. However, the specific mechanism by which SBP improves heart function and protects against heart failure remains unclear. Hence, in our study, we explored the mechanism of action of SBP in improving CHF induced by myocardial infarction in animal models, with a focus on exploring the energy metabolism regulation and related mechanisms involved in SBP. 2. Materials and methods 2.1 Drugs and reagents A batch of SBP (batch number 150410) was purchased from the Shanghai Hutchison Pharmaceuticals Company (Shanghai, China). Enalapril (number E0109000) was purchased from Merck 2.2 Animal and MI induced HFmodel Eight-week-old male C57BL/6 mice, weighing between 18 and 22 grams, were acquired from Sino-British SIPPR/BK Laboratory Animals located in Shanghai, China. These animals were housed at a temperature of 22 ℃, subjected to a 12-hour light/dark cycle, and provided with unrestricted access to water and a standard rodent diet. All procedures involving the animals were conducted in strict adherence to the National Institutes of Health’s “Guide for the Care and Use of Laboratory Animals”, having received approval from the Scientific Investigation Board at the Second Military Medical University (Approval No. SMMU-SIB-202004062). Euthanasia of the animals was performed through dislocation of the cervical vertebrae The mice underwent anesthesia using 2.5% isoflurane gas; once they entered a comatose condition, they were taken off and positioned on a ventilator to sustain the anesthesia. The limbs of the mice were secured, and an incision was made between the third ribs on the left side of the chest. The pectoralis major muscle was cut open and bluntly separated to expose the heart and blood vessels. Under a microscope, the left anterior descending coronary artery was located approximately 1 mm below the edge of the left atrial appendage. An 8-0 suture with a needle was inserted at a depth of about 0.5 mm and spanned about 1 mm. The ligation direction was parallel to the lower edge of the left atrial appendage. After ligation, it was observed that the apex of the heart gradually changed from flesh red to pale white, and the motion of the ventricular wall significantly weakened, indicating successful ligation. Any active bleeding in the heart and thoracic cavity was checked for, and all exudates and hemorrhages were absorbed. Once the mouse’s circulation stabilized, the chest was closed layer by layer, and the wound was sutured. After the mouse resumed autonomous breathing, it was placed on an electric blanket for rewarming for 1 hour before being returned to its cage for free access to food and water. The sham-operated group underwent all steps except for the ligation of the left anterior descending coronary artery. Survival was monitored daily, and after 4 weeks of feeding, echocardiography was performed to screen for mice with successful heart failure models. MI induced CHF mice were randomly divided into HF group, SBP treatment group and enalapril treatment group. According to the clinical dosage guide, SBP was administered at a dose of 20 mg / kg / d and enalapril was administered at a dose of 20 mg / kg / d through gastric tube for 8 weeks. Those doses have exhibited cardioprotective efficacy without toxicity in previous studies [23, 24]. 2.3 Cardiac function measurement After anesthetizing the mice, the chest hair is removed and they are placed in a supine position. A cardiac ultrasound probe is placed on the anterior wall of the heart. The cardiac function of the mice is assessed using two-dimensional and M-mode echocardiography to screen for successful models after modeling or to evaluate the cardiac function of the mice after drug administration. Based on six consecutive cardiac cycles, the main monitoring indicators include heart rate (HR), fractional shortening (FS), left ventricular ejection fraction (EF), and observations of fluctuations in the ventricular walls through echocardiography. 2.4 Assay kit assessment The ATP were extracted and determined with ATP Assay Kit (Beyotime, cat. no. S0026). The analysis of malondialdehyde (MDA) and superoxide dismutase (SOD) in serum was conducted with a reagent kit provided by Jiancheng Biotechnology Co., Ltd., located in Nanjing, China. Additionally, serum levels of N-terminal pro-B-type natriuretic peptide (NT-pro BNP) were measured utilizing an NTpro BNP ELISA kit from Shine Biotechnology Co, Ltd. in Shanghai, China. Every procedure was performed in accordance with the guidelines set forth by the manufacturer. 2.5 Cell lines and cultures The HL-1 mouse cardiomyocyte cell line was purchased from Procell. Cardiomyocytes differentiated from human stem cells induced by iPSC (HiPSC-CMs) were obtained from Help Stem Cell Innovations located in Nanjing, China. All cell culture procedures were strictly carried out according to the manufacturer’s instructions. 2.6 Mitochondrial Respiration analysis of isolated cardiomyocytes The evaluation of mitochondrial respiration in isolated cardiomyocytes was conducted using the Seahorse XF24 analyzer (Seahorse Bioscience), following the methodology outlined in previous studies [25]. The parameters were calculated manually. Further details regarding the identified parameters and the precise computations are outlined in it. 2.7 Western blotting and Real-time PCR Myocardial tissue proteins were extracted utilizing RIPA lysis buffer (Santa Cruz Biotechnology, Texas, USA). Following centrifugation, the proteins present in the supernatant were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred to nitrocellulose membranes. The immunoblotting procedure employed specific antibodies (PGC-1α, AF5395, Affinity; NRF-1, AF5298, Affinity; TFAM, AF0531, Affinity; β-Tubulin, AF1216, Beyotime) to evaluate protein expression levels. Images were captured with the Odyssey Infrared Imaging System (Li-Cor, Lincoln, NE). Band intensity was measured through densitometry analysis using ImageJ software (National Institutes of Health). Total RNA extraction from heart tissue was conducted with Trizol reagent (Takara, catalog number 9109) followed by reverse transcription into cDNA utilizing PrimeScriptTM RT Master Mix (Takara, catalog number RR036A). Real-time quantitative PCR was executed employing the FastStart Universal SYBR Green Master kit (Roche, catalog number 04913914012). Gene expression levels were normalized to the control gene β-Tubulin.The primer pair for the nuclear PGC-1α gene was Forward: ATGAATGCAGCGGTCTTAGC and Reverse: AACAATGGCAGGGTTTGTTC;The primer pair for the nuclear TFAM gene was Forward: CCCACAGAGAACAGAAACAG and Reverse: CCCTGGAAGCTTTCAGATACG; The primer pair for the nuclear NRF-1 gene was Forward: ATCGTCTTGTCTGGGGAAAC and Reverse: TGTTCCAATGTCACCACCTC. 2.8 Statistical analysis Experimental data are all expressed as ”mean ± standard error of the mean (Mean ± SEM)”. Comparisons between two groups were performed using an independent samples T-test, while comparisons between two or more groups were conducted using a one-way analysis of variance (One-way ANOVA). For comparisons involving two factors between groups, a two-way analysis of variance (Two-way ANOVA) was employed. A P-value of less than 0.05 indicates statistical significance, where * represents P< 0.05, ** denotes P< 0.01, and *** signifies P< 0.001. 3. Results 3.1. SBP can effectively improve myocardial injury in MI induced CHF mice To investigate the impact of SBP on cardiac function in mice with MI-induced CHF, we assessed the left ventricular ejection fraction (EF) and fractional shortening (FS). As illustrated in Fig. 2, the echocardiographic parameters of mice in the HF group exhibited significant alterations compared to those in the sham group (Fig. 1A). The MI-induced HF mice demonstrated notable changes in EF and FS, confirming the successful establishment of the CHF model. Additionally, there were no significant variations in body weight or heart rate between the groups after 8 weeks (Fig. 1D and E). Conversely, when compared to the HF group, treatment with enalapril and SBP markedly enhanced the levels of EF and FS (Fig. 1B and C), indicating that enalapril and SBP can mitigate cardiac dysfunction in the mice model of MI-induced CHF. Fig. 1 The impact of SBP on the cardiac function of MI induced CHF mice. (A) Representative M-mode echocardiographic images of left ventricle (LV) in mice. (B,C) The changes of ejection fractions (EF) and fractional * shortening (FS) in mice. (D)Body weight in all mice. (E) Heart rate in all mice. The data is presented in the form of “Mean ± SEM”. * P <0.05, *** P <0.001. 3.2. SBP can effectively improve myocardial injury in MI induced CHF mice To assess myocardial damage in mice with MI-induced CHF, serum NT-pro BNP levels were analyzed. The HF group exhibited significantly elevated serum NT-pro BNP levels compared to the sham group, suggesting an increased risk of CHF (Fig. 2A). In contrast, mice with MI-induced CHF that received SBP and enalapril treatment demonstrated a notable reduction in serum NT-pro BNP levels. Additionally, SOD and MDA are indicators of oxidative stress levels in myocardial cells. In the HF group, serum MDA levels were significantly elevated (Fig. 2B), while serum SOD levels were significantly reduced (Fig. 2C). Compared to the HF group, the SBP and enalapril groups showed a significant decrease in MDA levels (Fig. 2B) and a substantial rise in serum SOD levels (Fig. 2C). Notably, the survival rate of MI-induced CHF mice treated with SBP was significantly higher than that of the control group (Fig. 2D). Fig. 2 The impact of SBP on serum myocardial damage markers and survival rate in MI induced CHF mice. (A) Serum level of NT-proBNP was examined using speciffc kits. (B, C) The serum levels of MDA and SOD were determined using a chemical approach. (D) The survival rate of MI-induced CHF mice. The data is presented in the form of “Mean ± SEM”. * P <0.05, ** P <0.01; *** P <0.001. 3.3. SBP alleviates myocardial tissue necrosis and myocardial fbrosis Hematoxylin and Eosin (H&E) staining revealed that the myocardial fibers in the sham operation group were neatly arranged without noticeable deformation. In contrast, the myocardial tissues of the HF model group displayed fragmented and necrotic myocardial fibers. Treatment with SBP and enalapril notably mitigated the damage observed in MI induced CHF mice (Fig. 3A). Masson’s trichrome staining further demonstrated that, compared to the sham group, the myocardial tissue of MI induced CHF mice was disorganized. A significant presence of blue fibrotic tissue was evident in the myocardial interstitium, accompanied by a notable increase in collagen fiber area and degree of myocardial fibrosis. However, treatment with SBP and enalapril led to a reduction in the collagen fiber area, and the myocardial cells appeared structurally intact and well-organized (Fig. 3B). Fig. 3 Effect of SBP on myocardial injury in HF mice. (A, B) Representative macroscopic photographs of hearts, H&E staining was performed to detect pathological changes, and Masson stained myocardial fibrosis in the myocardial tissues of mice. 3.4. SBP regulates myocardial energy metabolism Compared to the sham group, ATP levels in the HF group were significantly reduced (Fig. 4A), indicating severe energy deficits in the hearts of mice with CHF. In contrast, ATP levels exhibited a significant elevation in the SBP treatment groups relative to the HF group. Conversely, no notable alteration in ATP levels was observed in myocardial tissue within the enalapril group when juxtaposed with the HF group. These findings suggest that SBP can significantly enhance energy supply in the hearts of MI-induced HF mice, whereas the effect of enalapril is less pronounced. In myocardial cell experiments, SBP significantly increased ATP production and exhibited dose and time dependency (Figure 4B and C). Additionally, we observed a notable enhancement in mitochondrial respiration between cardiomyocytes treated with SBP and those left untreated. The influence of SBP on respiration was evident in mitochondrial respiration parameters, with both basal and maximal respiration increasing dose-dependently (Figure 4D-E). Fig. 4 The Impact of SBP on myocardial energy metabolism in cardiomyocytes.(A) The dose concentration of SBP and enalapril are all 20 mg/kg/d. (B,C) Time-effect of ATP level in HL-1 cardiomyocytes, the dose of SBP was 10 μg/mL. The detection time was 0, 6, 12, 24 h. (D-F) After stimulation of iPSC-CMs with different concentrations of ORM, detected for oxygen consumption rate (OCR) to indicate the mitochondrial respiration. The doses of ORM is of 1 and 10 μg/ mL. The data is presented in the form of “Mean ± SEM”. ** P <0.01; *** P 3.5. SBP promotes mitochondrial biogenesis Our findings suggest that SBP may enhance myocardial energy production by optimizing the function of myocardial mitochondria. To further delve into the impact mechanisms of SBP on energy metabolism in HF, we investigated key factors related to mitochondrial biogenesis. As illustrated in Fig.5A-C, the mRNA levels of PGC1α， NRF1, and TFAM in cardiac tissue of HF mice were significantly reduced compared to those in the sham group. Moreover, the expression levels of these genes in the SBP group were markedly increased compared to the HF group (Fig5A-C). Subsequently, we employed Western blotting to assess changes in the protein expression of PGC1α， NRF1, and TFAM in the myocardium. Compared to the control group, the protein levels of PGC1α， NRF1, and TFAM in the myocardium of the SBP group exhibited a significant increase (Fig5D and E). Fig. 5 The Impact of SBP on myocardial mitochondrial biogenesis.(A-C) Quantitative polymerase chain reaction for myocardial PGC1α, NRF1 and TFAM mRNA level.(D, E) Western blotting was performed to measure the expression of PGC1α, NRF1 and TFAM in cardiomyocytess. The data is presented in the form of “Mean ± SEM”. * P <0.05, ** P 4. Discussion CHF, a manifestation or the ultimate battleground for the deterioration of various cardiovascular diseases, has a complex onset and development, with mechanisms that are not yet fully understood [26]. HF is primarily characterized by ventricular remodeling, a process driven predominantly by an imbalance in neuroendocrine hormones [27]. There is an essential link between heart failure and metabolism. Throughout the progression of HF, the heart undergoes extensive remodeling at various levels, including metabolism, structure, and electrophysiology. The reduction in ATP production caused by myocardial energy metabolism disorders is currently considered a significant factor in the development and worsening of heart failure [11]. An important pathological alteration leading to ventricular structural remodeling is metabolic remodeling. This involves changes in energy metabolism pathways during HF and mitochondrial dysfunction, resulting in abnormal changes in cardiac structure and function [28]. Therefore, metabolic remodeling may occur before ventricular remodeling. Cardiac structural remodeling, as well as systolic and diastolic dysfunction, may be terminal outcomes of energy metabolism remodeling. In this study, we initially investigated whether Systolic Blood Pressure (SBP) could enhance ventricular function and structural remodeling in CHF mice induced by MI. We found that mice with CHF induced by MI exhibited significant cardiac remodeling and dysfunction, characterized by a marked increase in cardiac fibrosis and cellular damage. SBP significantly improved the EF and FS in mice with CHF. Simultaneously, SBP notably ameliorated the pathological alterations in the myocardium of CHF mice, primarily by diminishing the extent of myocardial damage and fibrosis. Our experimental findings corroborated that SBP can additionally decrease serum concentrations of NT-proBNP, SOD, and MDA, alleviating oxidative stress levels and cellular damage. While pharmacotherapy can effectively reduce readmission and mortality rates in HF patients, improving their quality of life, the life expectancy of these patients remains low. The trend in incidence and mortality has not been reversed as expected, with over one-third of patients dying within 5.5 years [29]. Excitingly, has determined that SBP can markedly enhance the survival rate of mice with MI-induced CHF. The heart is the organ with the highest energy demand and consumption in the body, consuming ATP equivalent to 7 times its own weight daily [30]. Mitochondrial oxidative phosphorylation contributes about 95% of the myocardial ATP demand, while the remaining 5% is mainly provided by glycolysis [31]. The function of cardiomyocytes depends on the production of a large amount of ATP to maintain their intense calcium-dependent contractile activity [11]. ATP is the only form of energy that myocardial tissue can directly utilize, and cardiac metabolism relies on the coordination of ATP production and utilization pathways [32]. In failing hearts, pathological hypertrophy and adverse remodeling are closely related to the deficiency of ATP levels and energy reserves [33]. Experimental evidence shows that decreased ATP synthesis levels lead to reduced efficiency in converting chemical energy into mechanical energy, directly impairing myocardial contractile function and being a major cause of the development and progression of heart failure [34]. The energy metabolism of a failing heart undergoes drastic changes, leading to a 30%-40% reduction in myocardial ATP generation, affecting the normal cardiac excitation-contraction coupling process and thereby causing myocardial contractile dysfunction [35]. In a healthy adult’s heart, over 90% of the ATP demand is met through oxidative phosphorylation [36]. Mitochondrial oxidative phosphorylation is closely related to the turnover of ATP providing for cardiac contraction and relaxation [37]. The oxidative phosphorylation system is a process wherein the H+ gradient, constructed by mitochondrial respiratory chain complexes I, II, III, and IV, drives the formation of ATP from ADP and Pi through complex V on the inner mitochondrial membrane, representing the most effective pathway for energy production in cells [38].We investigated the effect of SBP on myocardial tissue ATP content in MI-induced CHF mice and examined the changes in ATP content and mitochondrial respiratory function in the myocardium after SBP stimulation. Our experimental results confirm that SBP can significantly improve the myocardial ATP content in MI-induced CHF mice, and can significantly enhance mitochondrial respiratory function and increase ATP content in cardiomyocytes. Peroxisome proliferator-activated receptor coactivator-1α (PGC-1α) serves as a significant regulator of mitochondrial biogenesis, modulating both the quantity and quality of mitochondria. It also plays a role in fatty acid oxidation and thermogenesis processes [39]. Furthermore, PGC-1α regulates the expression of downstream factors associated with mitochondrial function, including NRF1 and TFAM, thereby contributing to the stability of mitochondrial function [40, 41]. In addition, NRF1 can increase the expression of TFAM, as well as the majority of nuclear-encoded subunits of the TCA cycle and ETC complexes [42]. It has been established that the knockout of PGC-1α in rats results in decreased ATP levels and mitochondrial enzyme activity, ultimately leading to HF [43]. To elucidate the role of SBP in regulating mitochondrial dysfunction, we investigated alterations in the gene expression of PGC-1α， NRF1, and TFAM across different groups. Our findings revealed that SBP notably elevated the gene expression levels of PGC-1α， NRF1, and TFAM in the myocardium of mice with MI-induced CHF. Additionally, cell culture experiments confirmed that SBP significantly enhanced the protein expression of these factors within the myocardium. 5. Conclusion Our study has shown that SBP exhibits a cardioprotective effect by improving energy metabolic pathways. The potential cardiac protective effect may be attributed to the activation of mitochondrial biogenesis. These results indicate that SBP is an effective and promising treatment, and that further investigation into mitochondrial biogenesis could provide valuable insights for the treatment of MI-induced CHF. Author contributions KfX, YmZ, and SZ performed the literature review, drafted the manuscript and be responsible for the entire manuscript. FW reviewed the manuscript and made scientific revisions. KfX, YmZ, and SZ contributed equally to this work. Professor FW, FY and JZ are co-rresponding authors of this study. Ethics approval and consent to participate Not applicable. Funding This study was supported by the Zhejiang Provincial Medical Association’s Clinical Medicine Special Project (Project No. 2023ZYC-A25, No.2024ZYC-B81 and No. 2023ZYC-A153), and Chinese Association of Traditional Chinese Medicine Project (Project No. 2023HH-011). Data Availability. Data will be made available on reasonable request. References [1]. Ponikowski, P., Anker, S.D., AlHabib, K.F., Cowie, M.R., Force, T.L., Hu, S., et al., Heart failure: preventing disease and death worldwide. ESC Heart Fail, 2014. 1 (1). 4-25 [2]. Savarese, G. and Lund, L.H., Global Public Health Burden of Heart Failure. Card Fail Rev, 2017. 3 (1). 7-11 [3]. Maggioni, A.P., Dahlström, U., Filippatos, G., Chioncel, O., Crespo Leiro, M., Drozdz, J., et al., EURObservational Research Programme: regional differences and 1-year follow-up results of the Heart Failure Pilot Survey (ESC-HF Pilot). Eur J Heart Fail, 2013. 15 (7). 808-17 [4]. Hellermann, J.P., Jacobsen, S.J., Gersh, B.J., Rodeheffer, R.J., Reeder, G.S., and Roger, V.L., Heart failure after myocardial infarction: a review. Am J Med, 2002. 113 (4). 324-30 [5]. Hellermann, J.P., Jacobsen, S.J., Redfield, M.M., Reeder, G.S., Weston, S.A., and Roger, V.L., Heart failure after myocardial infarction: clinical presentation and survival. Eur J Heart Fail, 2005. 7 (1). 119-25 [6]. Jenča, D., Melenovský, V., Stehlik, J., Staněk, V., Kettner, J., Kautzner, J., et al., Heart failure after myocardial infarction: incidence and predictors. ESC Heart Fail, 2021. 8 (1). 222-237 [7]. Juillière, Y., Cambou, J.P., Bataille, V., Mulak, G., Galinier, M., Gibelin, P., et al., Heart failure in acute myocardial infarction: a comparison between patients with or without heart failure criteria from the FAST-MI registry. Rev Esp Cardiol (Engl Ed), 2012. 65 (4). 326-33 [8]. Savarese, G., Stolfo, D., Sinagra, G., and Lund, L.H., Heart failure with mid-range or mildly reduced ejection fraction. Nat Rev Cardiol, 2022. 19 (2). 100-116 [9]. van Riet, E.E., Hoes, A.W., Wagenaar, K.P., Limburg, A., Landman, M.A., and Rutten, F.H., Epidemiology of heart failure: the prevalence of heart failure and ventricular dysfunction in older adults over time. A systematic review. Eur J Heart Fail, 2016. 18 (3). 242-52 [10]. Taegtmeyer, H., Cardiac metabolism as a target for the treatment of heart failure. Circulation, 2004. 110 (8). 894-6 [11]. Neubauer, S., The failing heart–an engine out of fuel. N Engl J Med, 2007. 356 (11). 1140-51 [12]. Nagoshi, T., Yoshimura, M., Rosano, G.M., Lopaschuk, G.D., and Mochizuki, S., Optimization of cardiac metabolism in heart failure. Curr Pharm Des, 2011. 17 (35). 3846-53 [13]. Brown, D.A., Perry, J.B., Allen, M.E., Sabbah, H.N., Stauffer, B.L., Shaikh, S.R., et al., Expert consensus document: Mitochondrial function as a therapeutic target in heart failure. Nat Rev Cardiol, 2017. 14 (4). 238-250 [14]. Liu, C. and Huang, Y., Chinese Herbal Medicine on Cardiovascular Diseases and the Mechanisms of Action. Front Pharmacol, 2016. 7 . 469 [15]. Zhang, K.J., Zhu, J.Z., Bao, X.Y., Zheng, Q., Zheng, G.Q., and Wang, Y., Shexiang Baoxin Pills for Coronary Heart Disease in Animal Models: Preclinical Evidence and Promoting Angiogenesis Mechanism. Front Pharmacol, 2017. 8 . 404 [16]. Zhou, Z., Shen, W., Yu, L., Xu, C., and Wu, Q., A Chinese patent medicine, Shexiang Baoxin Pill, for Non-ST-elevation acute coronary syndromes: A systematic review. J Ethnopharmacol, 2016. 194 . 1130-1139 [17]. Zhu, H., Luo, X.P., and Wang, L.J., [Evaluation on clinical effect of long-term shexiang baoxin pill administration for treatment of coronary heart disease]. Zhongguo Zhong Xi Yi Jie He Za Zhi, 2010. 30 (5). 474-7 [18]. Wang, L.J., Luo, X.P., and Wang, Y., [Evaluation on tolerability and safety of long-term administration with shexiang baoxin pill in patients with coronary heart disease of stable angina pectoris]. Zhongguo Zhong Xi Yi Jie He Za Zhi, 2008. 28 (5). 399-401 [19]. Wu, J.X., Liang, C., and Ren, Y.S., [Effects of shexiang baoxin pill on function and nitric oxide secretion of endothelial progenitor cells]. Zhongguo Zhong Xi Yi Jie He Za Zhi, 2009. 29 (6). 511-3 [20]. Li, G., Chen, Y., and Wu, J., [Promotion of Function of Endothelial Progenitor Cells with Shexiang Baoxin Pill Treatment under Shear Stress]. Sheng Wu Yi Xue Gong Cheng Xue Za Zhi, 2015. 32 (4). 847-53 [21]. Wei, D., Zheng, N., Zheng, L., Wang, L., Song, L., and Sun, L., Shexiang Baoxin Pill Corrects Metabolic Disorders in a Rat Model of Metabolic Syndrome by Targeting Mitochondria. Front Pharmacol, 2018. 9 . 137 [22]. Jiang, P., Dai, W., Yan, S., Chen, Z., Xu, R., Ding, J., et al., Biomarkers in the early period of acute myocardial infarction in rat serum and protective effects of Shexiang Baoxin Pill using a metabolomic method. J Ethnopharmacol, 2011. 138 (2). 530-6 [23]. Liu, Y.H., Wang, D., Rhaleb, N.E., Yang, X.P., Xu, J., Sankey, S.S., et al., Inhibition of p38 mitogen-activated protein kinase protects the heart against cardiac remodeling in mice with heart failure resulting from myocardial infarction. J Card Fail, 2005. 11 (1). 74-81 [24]. Yu, Y.W., Liu, S., Zhou, Y.Y., Huang, K.Y., Wu, B.S., Lin, Z.H., et al., Shexiang Baoxin Pill attenuates myocardial ischemia/reperfusion injury by activating autophagy via modulating the ceRNA-Map3k8 pathway. Phytomedicine, 2022. 104 . 154336 [25]. Mutikainen, M., Tuomainen, T., Naumenko, N., Huusko, J., Smirin, B., Laidinen, S., et al., Peroxisome proliferator-activated receptor-γ coactivator 1 α1 induces a cardiac excitation-contraction coupling phenotype without metabolic remodelling. J Physiol, 2016. 594 (23). 7049-7071 [26]. Wang, Y., Wang, Q., Li, C., Lu, L., Zhang, Q., Zhu, R., et al., A Review of Chinese Herbal Medicine for the Treatment of Chronic Heart Failure. Curr Pharm Des, 2017. 23 (34). 5115-5124 [27]. Tham, Y.K., Bernardo, B.C., Ooi, J.Y., Weeks, K.L., and McMullen, J.R., Pathophysiology of cardiac hypertrophy and heart failure: signaling pathways and novel therapeutic targets. Arch Toxicol, 2015. 89 (9). 1401-38 [28]. Yang, Z.Q., Han, Y.Y., Gao, F., Tian, J.Y., Bai, R., Guo, Q.H., et al., Shengxian decoction protects against chronic heart failure in a rat model via energy regulation mechanisms. BMC Complement Med Ther, 2023. 23 (1). 200 [29]. Shao-Mei, W., Li-Fang, Y., and Li-Hong, W., Traditional Chinese medicine enhances myocardial metabolism during heart failure. Biomed Pharmacother, 2022. 146 . 112538 [30]. Bedi, K.C., Jr., Snyder, N.W., Brandimarto, J., Aziz, M., Mesaros, C., Worth, A.J., et al., Evidence for Intramyocardial Disruption of Lipid Metabolism and Increased Myocardial Ketone Utilization in Advanced Human Heart Failure. Circulation, 2016. 133 (8). 706-16 [31]. Saddik, M. and Lopaschuk, G.D., Myocardial triglyceride turnover and contribution to energy substrate utilization in isolated working rat hearts. J Biol Chem, 1991. 266 (13). 8162-70 [32]. Noordali, H., Loudon, B.L., Frenneaux, M.P., and Madhani, M., Cardiac metabolism - A promising therapeutic target for heart failure. Pharmacol Ther, 2018. 182 . 95-114 [33]. Keceli, G., Gupta, A., Sourdon, J., Gabr, R., Schär, M., Dey, S., et al., Mitochondrial Creatine Kinase Attenuates Pathologic Remodeling in Heart Failure. Circ Res, 2022. 130 (5). 741-759 [34]. Doenst, T., Nguyen, T.D., and Abel, E.D., Cardiac metabolism in heart failure: implications beyond ATP production. Circ Res, 2013. 113 (6). 709-24 [35]. Ritterhoff, J. and Tian, R., Metabolism in cardiomyopathy: every substrate matters. Cardiovasc Res, 2017. 113 (4). 411-421 [36]. Zuurbier, C.J., Bertrand, L., Beauloye, C.R., Andreadou, I., Ruiz-Meana, M., Jespersen, N.R., et al., Cardiac metabolism as a driver and therapeutic target of myocardial infarction. J Cell Mol Med, 2020. 24 (11). 5937-5954 [37]. Schwemmlein, J., Maack, C., and Bertero, E., Mitochondria as Therapeutic Targets in Heart Failure. Curr Heart Fail Rep, 2022. 19 (2). 27-37 [38]. Papa, S., Martino, P.L., Capitanio, G., Gaballo, A., De Rasmo, D., Signorile, A., et al., The oxidative phosphorylation system in mammalian mitochondria. Adv Exp Med Biol, 2012. 942 . 3-37 [39]. Riehle, C. and Abel, E.D., PGC-1 proteins and heart failure. Trends Cardiovasc Med, 2012. 22 (4). 98-105 [40]. Chen, L., Qin, Y., Liu, B., Gao, M., Li, A., Li, X., et al., PGC-1α-Mediated Mitochondrial Quality Control: Molecular Mechanisms and Implications for Heart Failure. Front Cell Dev Biol, 2022. 10 . 871357 [41]. Li, F., Guo, S., Wang, C., Huang, X., Wang, H., Tan, X., et al., Yiqihuoxue decoction protects against post-myocardial infarction injury via activation of cardiomyocytes PGC-1α expression. BMC Complement Altern Med, 2018. 18 (1). 253 [42]. Rosca, M.G. and Hoppel, C.L., Mitochondrial dysfunction in heart failure. Heart Fail Rev, 2013. 18 (5). 607-22 [43]. Cheng, C.F., Ku, H.C., and Lin, H., PGC-1α as a Pivotal Factor in Lipid and Metabolic Regulation. Int J Mol Sci, 2018. 19 (11): Information & Authors Information Version history V1 Version 1 15 October 2025 Copyright This work is licensed under a Non Exclusive No Reuse License. Authors Affiliations kefa Xiang 0009-0004-8547-8296 Huzhou University View all articles by this author Shuai Zhang Huzhou University View all articles by this author Yimin Zheng Huzhou University View all articles by this author Jing Zeng Huzhou University View all articles by this author Feng Yu Huzhou University View all articles by this author Feng Wu [email protected] Huzhou University View all articles by this author Metrics & Citations Metrics Article Usage 129 views 70 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation kefa Xiang, Shuai Zhang, Yimin Zheng, et al. Shexiang baoxin pill protects against myocardial infarction induced chronic heart failure by activating energy metabolism via modulating mitochondrial biogenesis. Authorea . 15 October 2025. DOI: https://doi.org/10.22541/au.176054600.00720329/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.176054600.00720329/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9ffc86855efcdfa9',t:'MTc3OTQ2MDI5Ng=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();