Genome identification of the DREB gene family in Lycium barbarum and expression analysis in response to leaf blight infection

Genome identification of the DREB gene family in Lycium barbarum and expression analysis in response to leaf blight infection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genome identification of the DREB gene family in Lycium barbarum and expression analysis in response to leaf blight infection Yahan Chen, Wenxu Wang, Yi Zhou, Haitao Yu, Wei Liu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7405611/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background To analyze the characteristics of members of the dehydration responsive element binding protein (DREB) transcription factor family in Lycium barbarum and their response patterns during L. barbarum leaf blight stress, bioinformatics methods were used to conduct a genome-wide identification of the DREB family members in the L. barbarum genome, and systematically analyze the physical and chemical characteristics of proteins, gene structures, phylogenetic evolution, collinearity, and expression patterns of family members under Alternaria tenuis Nees infection. Results A total of 16 non-redundant LbDREB members were identified in the whole genome of L. barbarum , all of which were hydrophilic proteins. They were unevenly distributed on 10 chromosomes of L. barbarum , encoding 174‒503 amino acids, with a relative molecular mass from 19.29‒57.93 kDa and a theoretical isoelectric point from 4.61‒9.66. Phylogenetic analysis showed that the 16 genes could be divided into 6 subgroups (A1‒A6), all of which contained one AP2 conserved domain. Subcellular prediction showed that the vast majority of LbDREB members were located in the nucleus and cytoplasm, and a small number were located in the mitochondria. Sequence lengths of LbDREB members varied greatly, ranging from 348‒3530 bp, and seven pairs of collinear genes were detected. The ratios of non-synonymous mutations (Ka) to synonymous mutations (Ks) (Ka/Ks ratios) were all < 1, indicating that the LbDREB family tended to purify selection during evolution. The 16 LbDREB members showed significantly different expression characteristics at 0, 24, 48, 72, and 120 h after L. barbarum leaf blight pathogen infection. The overall expression level was highest at 120 h of the infection period, and all 16 members are upregulated in expression. Conclusion The results indicated that the LbDREB gene may play an important role in the response of L. barbarum to leaf blight, and provide a reference for further clarification of the functional mechanism of the DREB transcription factor members in L. barbarum . Lycium barbarum DREB transcription factor bioinformatics analysis leaf blight Alternaria tenuis Nees Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Background Transcription factors are a class of proteins that bind specifically to cis-acting elements in the promoter region of genes, and thus effectively regulate gene transcription activity via this mechanism. Over the duration of plant growth and development, transcription factors play a central role in plant response mechanisms to various biotic and abiotic stressors, such as pathogen infection, insect feeding, drought, and high and low temperatures [ 1 – 5 ] . Analyzing the structural features of DNA-binding domains in plant transcription factors enables these factors to be classified into multiple families, such as myeloblastosis (MYB); NAM, ATAF1/2, and CUC2 (NAC), WRKY transcription factor family (WRKY), ethylene-responsive factor and APETALA2 (AP2/ERF), and basic-leucine zipper (bZIP), all of which play key roles in plant response to biotic stressors [ 2 , 3 ] . The dehydration responsive element binding protein (DREB) is a crucial member of the AP2/ERF superfamily. The constituent members of this family typically contain a conserved AP2 domain consisting of a sequence approximately 60 amino acids in length [ 5 ] . DREB and the ERF gene family (which also belongs to the AP2/ERF superfamily) can be differentiated by comparing the composition of specific amino acid residues in the AP2 domain, even though both contain only one AP2 domain. In the AP2 amino acid domain, the key amino acid positions 14 and 19 are critical for DREB family members, carrying valine (V) and glutamic acid (E), respectively; whereas, ERF family members carry alanine (A) and aspartic acid (D), respectively, at the same AP2 positions [ 5 , 6 ] . It is this type of amino acid variation at key sites that weakens their binding efficiency to cis-acting elements in the promoter regions of downstream genes. DREB transcription factors can specifically bind to the core sequence ACCGAC/GCCGAC of the dehydration response element/C-repeat (DRE/CRT) cis-acting element in the promoter region of downstream genes and activate downstream gene expression through construction of a regulatory network, thereby participating in plant response to low temperatures, drought, high salinity, and other abiotic stressors. However, differences have been found in the cis-acting elements that bind to different members of the ERF family compared to DREB elements, which have led to functional differences [ 3 , 5 , 7 ] . Based on their structural and functional features, the DREB family can be further divided into six subgroups (A1–A6), with each subgroup fulfilling different functions [ 8 ] . Members of subgroup A1 (also known as the DREB1/CBF family) are associated with plant responses to cold stress [ 9 ] . In Arabidopsis thaliana , DREB1A/CBF3, DREB1B/CBF1, and DREB1C/CBF2 genes are able to identify low-temperature stress. By upregulating expression of these genes, the transgenic plant A. thaliana showed significant improvements in its tolerance for low temperatures, drought, and high salinity stress; conversely, silencing of the DREB1A/CBF3 and DREB1B/CBF1 genes attenuated its cold tolerance [ 10 ] . In addition, members of subgroups A2–A6 are closely associated with biotic stress responses and plant growth. These gene families have been detected in a variety of plants, such as A. thaliana , wheat ( Triticum aestivum ), strawberries ( Fragaria vesca ), tomatoes ( Solanum lycopersicum ), walnuts ( Juglans regia ), and grapes ( Vitis vinifera ). Hence, a comprehensive study on the functions of each member in these families is crucial to understanding the mechanism of DREB family members found in L. barbarum (LbDREB) gene expression in L. barbarum and establishing a basis for its application in plant breeding for stress tolerance [ 11 – 14 ] . As a branch of the AP2/ERF family, the DREB gene family is mainly involved in plant response to abiotic stressors, and is also of crucial significance to biotic stresses. In this field of biotic stress regulation, maize DREB1A has been shown to reduce the level of active salicylic acid (SA) by inhibiting the SA synthesis gene ( ZmSARD1 ) and activating the SA inactivation gene ( ZmSAGT ), thereby negatively regulating plant blight resistance [ 15 ] . In moso bamboo, PeDREB28 can bind to the promoter of the abscisic acid (ABA) receptor gene ( DlaPYL3 ) to regulate the ABA signaling pathway and hence indirectly affect disease resistance [ 16 ] . In terms of abiotic stress regulation, 23 DREB members in Hibiscus cannabinus were significantly upregulated under salinity stress, which implied that DREB members are able to activate osmoregulatory genes (e.g., LEA proteins) in order to enhance salt tolerance and maintain leaf health, thereby reducing the chances of pathogen infection [ 17 ] . In moso bamboo, PeDREB28 expression was significantly elevated under drought and low-temperature stress, and enhanced resistance by regulating the ABA signaling pathway and redox-related genes, thereby indirectly inhibiting pathogen colonization [ 16 ] . Lycium barbarum is a multi-stemmed shrub of the family Solanaceae Juss and genus Lycium , mainly found in northwestern China. Its fruits are oval in shape and usually red or orange‒red in color [ 18 ] . Lycium barbarum is rich in nutrients, containing a variety of vitamins (e.g., vitamins C, B1, and B2) and exhibiting significant effects in antioxidation and immune function enhancement. Furthermore, L. barbarum contains an abundance of minerals, including iron, zinc, and selenium, which are essential to the normal physiological functions of the body. In particular, L. barbarum polysaccharides have shown immune regulation, anti-tumor, blood glucose-lowering, blood lipid-lowering, and other biological activities [ 19 ] . In Shennong Bencaojing ( Divine Farmer’s Classic of Materia Medica ), L. barbarum polysaccharides are classified as a high-grade medicine, and are described as being able to “strengthen the muscles and bones, lighten the body and prolong life, and withstand the cold and heat, if administered long-term.” The continuous discovery of the numerous health effects of L. barbarum has been accompanied by growing concerns over its quality, which has attracted widespread attention. Hence, examining the expressions of adversity genes in L. barbarum under biotic and abiotic stresses is profoundly significant for enhancing the quality of L. barbarum . Lycium leaf blight is a major fungal disease in primary L. barbarum production areas, with an incidence rate of 60–80% in the hot and humid season. It can cause severe damage by triggering premature senescence of affected leaves, reducing fruit yield, and degrading fruit quality, directly contributing to economic losses of 30–50% [ 20 ] . This disease is mainly caused by the pathogen Alternaria tenuis Nees [ 20 ] , which is a broad-spectrum parasitic fungus [ 21 ] that can cause wheat leaf blight, eggplant early blight, northern corn leaf blight, Alternaria brassica leaf spot, and other diseases of major economic and food crops. Although Lycium leaf blight poses a substantial threat to the industry, its pathogenic mechanism remains poorly understood. Therefore, the aim of this study was to establish a theoretical basis for identifying leaf blight-resistant DREB transcription factors in L. barbarum through genome-wide analysis, bioinformatics analysis, and examination of DREB expression patterns under leaf blight infection. In addition, this study provides a genetic reserve for improving the disease resistance and quality of L. barbarum . Methods Experimental Materials Test strains and vectors: Escherichia coli DH5α and a cloning vector TSINGKE TSV-007S pClone007 Simple Vector Kit were purchased from Tsingke Biotech Co., Ltd. Test plants: L. barbarum plants were obtained from Jingyuan County, Gansu Province. Main reagents and culture media: The nucleic acid extraction system consisted of TRizol Total RNA Extraction Reagent (Tsingke Biotech) and a FastKing Genomic DNA Dispelling RT SuperMix system (Tiangen Biotech). The gene amplification system consisted of the PrimeSTAR® GXL High-Fidelity DNA Polymerase (Tsingke Biotech) and Ex Taq® Conventional DNA Polymerase (TaKaRa Bio). The nucleic acid analysis system consisted of SYBR® Green Pro Taq HS Real-Time Quantitative Detection Premix (AG Bio) and 2000 bp DNA Molecular Weight Marker (Biomed). The gene cloning system consisted of a KpnI/XbaI double digestion system (TaKaRa Bio) with a plasmid rapid extraction kit (Tiangen Biotech) and a DNA fragment purification kit (Tsingke Biotech). The reverse transcription system consisted of a PrimeScript™ II First Strand cDNA Synthesis Kit (Tsingke Biotech) and Perfect Real-Time RT dedicated reaction system. The microbial culture system consisted of Luria‒Bertani (LB) agar medium containing 50 µg/mL ampicillin. All reagents were prepared according to the manufacturer's standard operating procedures. Identification of DREB family members in L. barbarum Whole-genome sequence data of L. barbarum was obtained from the National Center for Biotechnology Information (NCBI) ( https://www.ncbi.nlm.nih.gov/ ), and DREB family sequence data for A. thaliana , rice ( Oryza sativa ), maize ( Zea mays ), wheat ( T. aestivum ), grape ( V. vinifera ), walnut ( J. regia ), and poplar ( Populus euphratica ) were obtained from the NCBI ( https://www.ncbi.nlm.nih.gov/ ), TAIR ( https://www.arabidopsis.org/ ), and Ensembl Plants ( https://plants.ensembl.org/index.html ) databases [ 22 , 23 ] . Systematic screening of LbDREB was performed using two strategies. First, based on the DREB homologous sequences of six plants, potential DREB family members were identified in the L. barbarum protein sequence files using BLAST analysis. Second, the Hidden Markov Model (HMM) of the AP2 domain (PF00847) was obtained from the pfam ( http://pfam.xfam.org/ ) database and a search was performed on the protein sequences of the L. barbarum genome using TBtools (v2.210) to further screen for DREB family members. To ensure accuracy and reliability of the screening results, the intersection of results obtained using these two methods was taken. The AP2 domain of the candidate genes were then further verified using the Batch CD-Search tool of the NCBI-CDD database ( https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi ) to ensure that all sequences were DREB family members. Cloning of DREB members in L. barbarum Total RNA was extracted from L. barbarum leaves using the TRizol method. The RNA sample was then diluted in 40 µL of nuclease-free water. The concentration of RNA samples was accurately measured using an Unano-2000 Microvolume Nucleic Acid Analyzer, and their integrity was then assessed using agarose gel electrophoresis. Finally, total RNA samples collected from L. barbarum leaves were stored in a refrigerator at -80°C to preserve important materials for subsequent experimental studies. Total RNA extracted from L. barbarum leaves was used as a template to perform cDNA synthesis. The manufacturer’s instructions for the TaKaRa PrimeScriptTM II1st Strand cDNA Synthesis Kit were strictly followed during the reverse transcription process and system construction. Prepared cDNA samples were then transferred to a -20°C refrigerator. Specific primers were designed using Primer 5.0 based on the full-length sequences of the LbDREB1–LbDREB16 genes in the GenBank nucleic acid sequence database as standard sequences, and completed by Xi'an Tsingke Biotech, Co., Ltd. Subsequent procedures were performed within a 25 µL polymerase chain reaction (PCR) system, which comprised 16.3 µL of ddH 2 O, 2.0 µL of cDNA, 2.5 µL of buffer solution, and 2.0 µL of dNTP Mix. In addition, 1.0 µL each of upstream and downstream primers were added, along with 0.2 µL of Taq enzyme. For this reaction, the pre-denaturation step was set at 94°C for 5 min, followed by cycles of denaturation at 94°C for 30 s, annealing for 30 s, and extension at 72°C for 60 s, with a total of 30 cycles. Finally, an extension phase was carried out at 72°C for 10 min, after which the samples were stored at 4°C. The products amplified using the PCR reaction were separated by 2.0% agarose gel electrophoresis. Images of the separated products were then captured using a gel imager, which were recorded in detail and photographed. Gel extraction was performed for specific bands containing the target sequence. The recovered purified product was then mixed with a cloning vector TSINGKE TSV-007S pClone007 Simple Vector Kit at a volume ratio of 1:4, followed by ligation in a metal bath at 25°C for 5 min. DH5α (100 µL) was added to the ligation product. After standing on ice for 25 min, the product was heat-shocked in a water bath at 42°C for 60 s, and immediately immersed in an ice bath for 2 min. Then, 1000 µL of LB culture broth was added, mixed well, and shaken at 37°C for 1 h at 200 rpm. Bacterial solution (100 µL) was spread onto LB solid medium and incubated for 14 h. Single colonies were placed in 5 mL of LB liquid medium, to which 5 µL of Amp was added, followed by incubation for 16 h at 37°C with shaking. Finally, the cultured bacterial solution was used as a template for further PCR experiments involving bacterial solutions. Three bacterial solutions with positive PCR results were screened and transported to Sangon Biotech Co., Ltd. for sequencing. Analysis of physicochemical properties and subcellular localization of DREB family proteins in L. barbarum Physicochemical properties of the 16 DREB family protein sequences screened from the dataset were comprehensively analyzed by accessing the ProtParam tool (Expasy ProtParam tool) on the Expasy server ( www.expasy.org ). This analysis involved several key indicators, such as amino acid chain length, relative molecular mass, isoelectric point, and protein stability coefficient [ 24 ] . In addition, predictions were made for the subcellular localization of DREB proteins using the online analysis tool Cell-PLoc ( http://www.csbio.sjtu.edu.cn/bioinf/Cell-PLoc-2/ ) [ 25 , 26 ] . Multiple sequence alignment of LbDREB proteins was performed using DNAMAN software. Phylogenetic tree construction and chromosomal localization of the DREB family in L. barbarum Phylogenetic tree analysis was performed on the 16 LbDREB protein sequences and the DREB family members of A. thaliana , walnut, grape, and poplar, followed by construction of a dendrogram using the neighbor-joining algorithm in MEGA (v11.0). In addition, 1000 repetitions of the bootstrap test were executed to enhance the reliability of the data. Default values were retained for all parameters during the construction process [ 27 ] . The online tool itol ( https://itol.embl.de/ ) was used to beautify the phylogenetic tree and analyze the phylogenetic relationship of the LbDREB family with A. thaliana homologous genes [ 25 ] . Candidate gene IDs were also screened from the L. barbarum genome annotation file, and TBtools (v2.210) was employed to obtain information on L. barbarum chromosome length and chromosomal location of the LbDREB gene. The screened gene IDs were visualized and localized on the L. barbarum chromosome to facilitate subsequent analysis of biological functions. Analysis of gene structure, conserved motifs, and promoter cis-acting elements of DREB genes in L. barbarum The 16 members of the LbDREB family were analyzed for conserved motifs using the MEME online platform ( http://meme-suite.org/tools/meme ). In this analysis, the number of conserved motifs was set to 10 and other parameters were set to default values, in order to analyze the similarity and functional features of the DREB family [ 4 ] . The structure of the 16 screened LbDREB genes was visualized using the Visualize Gene Structure feature of TBtools (v2.210). Finally, a 2000-bp sequence fragment upstream of the DREB gene in the genome was extracted and uploaded to the Plant Care database ( http://bioinformatics.psb.ugent.be/webtools/plantcare.html/ ) for analysis of cis-acting elements [ 4 , 28 ] . Finally, relevant response element tags were screened from the database, merged, and visualized in TBtools (v2.210) for further mining of their possible biological functions. Analysis of collinearity and ratios of non-synonymous mutations (Ka) to synonymous mutations (Ks) (Ka/Ks) of the DREB family in L. barbarum Collinearity analysis and visualization were performed intra-specifically within L. barbarum and inter-specifically between L. barbarum and A. thaliana using TBtools (v2.210). Defaults settings were used for all parameters. The whole L. barbarum genome was subjected to BLAST analysis, and gene pairs were screened based on E -value < 1e − 5 and Score ≥ 500. In addition, CDS sequences of LbDREB gene pairs were extracted, and the Simple Ka/Ks Calculator tool was employed to accurately calculate Ks and Ka among gene pairs. Expression analysis of DREB family in response to leaf blight in L. barbarum Using healthy L. barbarum plants as materials, mature leaves of the third node in the middle of the plant were selected and inoculated with the Lycium leaf blight pathogen A. tenuis. Leaf samples were collected at 0, 24, 48, 72, and 120 h after inoculation, and stored in an ultra-low temperature refrigerator at -80°C after flash-freezing with liquid nitrogen. Three biological replicates were collected for each time point. Total leaf RNA was extracted using a TRizol kit. cDNA was prepared in strict accordance with the operating instructions of a FastKing gDNA Disppelling RT SuperMix (TIANGEN) Kit, and the template was diluted 5-fold for subsequent quantitative detection. Gene expression analysis was performed using the SYBR Green Type I double-stranded DNA-conjugated fluorescence quantitative detection system (AG Bio). The cDNA synthesized by reverse transcription was used as the template, and the β-actin gene of L. barbarum was used as the endogenous control. A real-time fluorescence quantitative detection system was constructed based on specific amplification primers (Table 1 ) designed for the conserved region of the LbDREB gene. The experimental setup was based on a three-level replication strategy, whereby three groups of biological parallels were set up for each sample, with each group containing four technical replicates. The standard reaction system was configured according to international real-time quantification specifications. The 20 µL standard reaction system comprised 10 µL of 2×SYBR Green Type I premix (with ROX passive reference dye), 150 ng of cDNA template, 0.4 µL of 10 µM Primer F, 0.4 µL of 10 µM Primer R, and 8.2 µL of RNase free water. The specific conditions of the PCR reaction were as follows: pre-denaturation at 95°C for 30 s, denaturation at 95°C for 5 s, annealing at 60°C for 1 min, denaturation at 95°C for 15 s, denaturation at 95°C for 30 s, and annealing at 60°C for 40 times; each cycle consisted of denaturation at 95°C for 15 s and annealing at 60°C for 1 min. Finally, the melting curve was analyzed at 95°C. Relative expression was calculated using the 2 −ΔΔCt method, with all Ct values of the control set to 1. Table 1 Primers for qPCR detection of the DREB gene family in L. barbarum Name of primer Sequence Annealing temperature (°C) Reference gene/Literature LbDREB1 -F CTCGAGCTCATGATGTTGCTG 59 LOC132599422 LbDREB1 -R TGCTTGAATGTCACGAGGGTT 60 LbDREB2 -F GCAACTGGGGCGGTTTATTC 59 LOC132603229 LbDREB2 -R TCCTGGATCTCCCACTACCG 60 LbDREB3 -F AGTTCTGGGGCGAACAGTAG 59 LOC132605424 LbDREB3 -R CGGACACCCATTTTCCGCTA 60 LbDREB4 -F GTCCAATTTGCCTTGGATCTC 57 LOC132606766 LbDREB4 -R TTCTCAGGACCGCCTTTACC 59 LbDREB5 -F GGGCAACTACATCTGCGTCT 60 LOC132609115 LbDREB5 -R TCAATGGTGTGCCAGCTTCA 60 LbDREB6 -F ATCCGTGAACCTCGTAAGCG 60 LOC132611090 LbDREB6 -R GGACGAAGGGTTTGTGTGGA 60 LbDREB7 -F TTGTTAGTCGGTGATGGCGG 60 LOC132618216 LbDREB7 -R CAGTGAGCTTTGGGTAGCGT 60 LbDREB8 -F TCGAGCTTATGATACGGCGG 59 LOC132622643 LbDREB8 -R TGACGGGCTTGAAGTCTCAC 59 LbDREB9-F AAGTAAGCCCGGACCGTATG 59 LOC132626396 LbDREB9-R CGCAGTTTGGCATGTGAGTT 59 LbDREB10 -F TCTTCTCACAATTTTCAAAGGAGAA 57 LOC132630927 LbDREB10 -R CTTTCCCCAAGTTCTTTGCCT 58 LbDREB11 -F TGAGACAAAGGCCATCAGGC 60 LOC132631427 LbDREB11 -R TTCTTCCACGAAGGAGACGTG 60 LbDREB12 -F CGTTTCCCACACCCGAAATG 59 LOC132634093 LbDREB12 -R CTCGTGGCAGGAACAGGTAG 60 LbDREB13 -F TTTGGTTAGGCACTTTCGCC 59 LOC132636814 LbDREB13 -R GAAATGCCCGAAACCAACGA 59 LbDREB14 -F CGCCTCTGAGCGAGATAGTG 60 LOC132639570 LbDREB14 -R GCAAGCTGTCGAAACTGCAT 59 LbDREB15 -F AGCGAAAGACGAGGCTAAGG 59 LOC132640420 LbDREB15 -R TAGGCAGCACTCTGCATTCG 60 LbDREB16 -F AAAGTCACGCATTTGGCTCG 59 LOC132645867 LbDREB16 -R TTCACCCAACTCATCCGACC 59 Actin- F CAATCGGGTATTTCAAGGTCAAC 60 Zhang et al. [ 29 ] Actin- R GAGCAGTGTTTCCCAGCATTG 60 Results Identification of DREB family members in L. barbarum By subjecting the obtained L. barbarum genome sequence data to HMM analysis and local BLASTP alignment, DREB family genes were obtained using HMM analysis. After removing sequences without conserved domains, a total of 16 LbDREB family members ( LbDREB1 – LbDREB16 ) containing one AP2 domain were obtained, and GenBank accession no. were PX233497–PX233512. Analysis of physicochemical properties and prediction of subcellular localization of DREB family proteins in L. barbarum Based on the BLAST alignment and HMM analysis of DREB homologous sequences in 6 plants, 16 DREB protein sequences were obtained using TBtools (v2.210) based on the BLAST alignment of L. barbarum genome protein sequences. Protein physicochemical properties of the 16 screened DREB family member sequences were further analyzed using the ProtParam tool on the Expasy server ( www.expasy.org ). The results indicated that the amino acid length of LbDREB proteins ranged between 174–503, the relative molecular mass ranged between 19.29–57.93 kDa, the theoretical isoelectric point ranged between 4.61–9.66, the aliphatic index ranged between 49.67–80.73, and the grand average of hydrophobicity ranged from − 0.89 to -0.41 (Table 2 ). Among the 16 DREB proteins, all were classified as hydrophilic proteins, and 3 were classified as stable proteins and the remaining as unstable proteins. Next, the characteristic attributes of DREB proteins were predicted using the Cell-PLoc online tool ( http://www.csbio.sjtu.edu.cn/bioinf/Cell-PLoc-2/ ). Based on the prediction results, we found that DREB proteins were mainly located in the cytoplasm and nucleus, with only two ( LbDREB14 and LbDREB16 ) found in mitochondria. Multiple sequence alignment was performed on the 16 LbDREB protein sequences using DNAMAN to clarify the structural properties of LbDREB transcription factors (Fig. 1 ). Our study identified one amino acid sequence that was highly conserved among the different members of the LbDREB gene family, and contained one AP2 domain. This domain was composed of > 60 amino acid residues. Among them, amino acid residues at positions 14 and 19 of this domain were valine (V14) and glutamic acid (E19), respectively, which are essential for cis-acting element recognition of DREB transcription factors. In the DREB family, valine (V14) was generally more conserved than glutamate (E19), and the structural properties of LbDREB genes were consistent with those of the DREB family in other species. Table 2 Information and characteristics of the DREB gene family of Lycium barbarum Sequence ID Protein ID Amino acid length Molecular mass (kDa) pI Instability index Aliphatic index GRAVY Subcellular localization LbDREB 1 XP_060168778 179 20.07 5.93 54.15 80.73 -0.47 N LbDREB2 XP_060172202 302 33.23 6.33 54.85 57.52 -0.75 N LbDREB3 XP_060174560 188 20.05 4.68 53.69 68.19 -0.48 N LbDREB4 XP_060176381 503 57.93 4.69 64.30 65.29 -0.79 N LbDREB5 XP_060178952 348 38.39 4.97 48.33 60.60 -0.76 N LbDREB6 XP_060181480 331 36.50 5.96 55.81 49.67 -0.83 N LbDREB7 XP_060189258 177 19.57 8.90 39.54 66.72 -0.76 N LbDREB8 XP_060193270 174 19.29 7.72 45.26 63.39 -0.76 N LbDREB9 XP_060197238 255 28.30 9.66 36.62 67.33 -0.80 E and N LbDREB10 XP_060202491 391 44.79 5.15 60.12 67.54 -0.84 N LbDREB11 XP_060202985 176 19.91 8.84 57.46 74.26 -0.78 N LbDREB12 XP_060206378 202 21.66 4.80 51.45 70.69 -0.41 N LbDREB13 XP_060209827 391 42.42 4.61 61.86 66.32 -0.48 N LbDREB14 XP_060211992 191 21.66 5.28 57.51 60.26 -0.74 E, M and N LbDREB15 XP_060212995 366 41.15 4.85 42.92 54.45 -0.89 N Note: N represents the cell nucleus; E represents the extracell; M represents the mitochondrion. Phylogenetic analysis and chromosomal localization of the DREB family in L. barbarum To further demonstrate the evolutionary relationships among these gene family members, we constructed a phylogenetic tree based on the screened LbDREB members, as well as those reported in A. thaliana , poplar ( P. euphratica ), grape ( V. vinifera ), and walnut ( J . regia ). As shown in Fig. 2 , based on the phylogenetic results and combined with the grouping of DREB genes in A. thaliana , the LbDREB family members were categorized into six subgroups (A1–A6). Subgroups A1 and A6 were absent in L. barbarum ; whereas, subgroups A2, A3, A4, and A5 contained 6, 2, 6, and 2 DREB family members, respectively, as well as 17, 2, 38, and 18 DREB family members, respectively, from other species. The L. barbarum reference genome on the NCBI database ( https://www.ncbi.nlm.nih.gov/n ) was downloaded as the basis for chromosome-level visualization of the 16 DREB genes using TBTools (v2.210). As shown in Fig. 3 , these 16 genes were distributed across 10 different chromosomes. The largest number of LbDREB genes were distributed on chromosome 3 (3 in total). Chromosomes 1, 5, 7, and 8 each contained two LbDREB genes. Chromosomes 2, 4, 6, 9, and 10 only contained one LbDREB gene each, namely, LbDREB9, LbDREB13, LbDREB1, LbDREB7 , and LbDREB8 , respectively. Furthermore, their distribution was independent of chromosome length and density, showing a relatively even distribution of genes across each chromosome. Conserved motifs and gene structure analysis of the DREB gene family in L. barbarum The conserved motifs of the 16 DREB proteins were analyzed in detail through the online website MEME ( http://meme-suite.org/tools/meme ). A total of 10 conserved motifs (Motifs 1–10) were predicted (Fig. 4 ). Among them, Motifs 1 and 2 were prevalent among DREB family members and their sequences were highly conserved; hence, they can be regarded as the two most central protein motifs in this family. The two conserved motifs of the LbDREB protein contained approximately 60 amino acid residues, which belong to the AP2 domain, playing a key role in DNA recognition and binding (Fig. 5 ). In shown in Fig. 5 , the C-terminus of the RAYD conserved element of Motif 2 contained 39 amino acid residues, which can facilitate binding of regulatory transcription factors to cis-acting elements. These conserved motifs may be involved in regulating the transcriptional activity of DREB proteins, which in turn can affect plant response to adversity. Further structural analysis of genes in the LbDREB family showed that eight LbDREB genes (50%) did not contain introns, seven LbDREB genes (43.75%) contained one intron, and only LbDREB9 contained two introns, suggesting that the LbDREB gene structure was relatively conserved. Analysis of promoter cis-acting elements of the DREB gene family in L. barbarum The 2000 bp cis-acting elements in the upstream promoter region of the 16 LbDREB genes were analyzed using the Plant Care online database. As shown in Fig. 6 , these elements mainly included the following categories in response to abiotic and biotic stressors: auxin-responsive elements, which play a key role in defense and stress responses, and; gibberellin- and SA-responsive elements, each of which correspond to the signaling processes of different plant hormones. Cis-acting elements that play a key role in the ABA signaling pathway were also identified. These include cis-regulatory elements critical to induction of anaerobic conditions, as well as those that modulate light responsiveness. In addition, MYB binding sites associated with drought inducibility were also included, as well as cis-acting elements involved in low-temperature responsiveness and wound repair processes. Collinearity analysis of DREB family members in L. barbarum A total of seven pairs of segmental duplication genes were detected from the LbDREB family (Fig. 7 ), of which one pair ( LbDREB7 and LbDREB8 ) was in subgroup A5, two pairs ( LbDREB4 ‒ LbDREB10 and LbDREB5 ‒ LbDREB15 ) were in subgroup A2, and four pairs ( LbDREB3 ‒ LbDREB12 , LbDREB11 ‒ LbDREB13 , LbDREB11 ‒ LbDREB16 , and LbDREB13 ‒ LbDREB16 ) were in subgroup A4. Genes exhibiting collinear relationships accounted for 81.25% of the LbDREB genes. Annotation files of L. barbarum and A. thaliana were combined using TBtools (v2.210) to perform collinearity analysis between the two species. The results showed that there were 19 orthologous DREB gene pairs between L. barbarum and A. thaliana (Fig. 8 ), indicating that the evolutionary relationship of the DREB family was highly similar between the two. Mutation analysis of DREB family members in L. barbarum Based on calculations of amino acid non-synonymous mutations (Ka) and synonymous mutations (Ks), the Ka/Ks value was > 1 for all seven LbDREB gene pairs, suggesting that the coding of the genes was biased toward purifying selection during evolution (Table 3 ). Table 3 Ka/Ks analysis of LbDREB genes in Lycium barbarum Gene 1 Gene 2 Nonsynonymous mutation (Ka) Synonymous mutation (Ks) Ka/Ks Effective length/bp Average S-sites Average N-sites LbDREB7 LbDREB8 0.15 1.21 0.12 507 118.67 388.33 LbDREB11 LbDREB16 0.19 0.91 0.20 513 120.58 392.42 LbDREB4 LbDREB10 0.37 0.97 0.38 1035 216.17 818.83 LbDREB5 LbDREB15 0.23 0.98 0.23 981 223.25 757.75 LbDREB3 LbDREB12 0.16 1.31 0.13 546 128.00 418 LbDREB11 LbDREB13 0.34 1.89 0.18 534 124.58 409.42 LbDREB13 LbDREB16 0.35 2.12 0.17 510 118.92 391.08 LbDREB7 LbDREB8 0.15 1.22 0.20 507 118.67 388.33 Expression analysis of LbDREBs in response to leaf blight infection in L. barbarum By infecting L. barbarum with the leaf blight pathogen, we analyzed the expression patterns of the 16 LbDREB family members that were previously identified. Gene expression characteristics of the inoculated and control groups were examined by quantitative real-time PCR at five key time points (0, 24, 48, 72, and 120 h). All family members exhibited a significant upregulation trend ( p < 0 .05) during pathogen infection; however, different members had distinct time-sequential expression characteristics. As shown in Fig. 9 , expressions of LbDREB1, LbDREB6, LbDREB10, LbDREB15 , and LbDREB16 increased sharply at 24 h of infection, with peak values reaching 4–6-fold that of the control ( p < 0 .01). This rapid response was highly consistent with the initial stage of lesion formation, suggesting that these members may have played a key role in pathogen recognition or early defense signal transduction. In the middle stage of the disease (48–72 h), LbDREB2, LbDREB4, LbDREB5, LbDREB12, LbDREB13, LbDREB14 , and LbDREB16 maintained 2‒3-fold higher expression levels ( p < 0 .05), and their sustained activation patterns were synchronized with lesion expansion and spread. Of particular note was that LbDREB8, LbDREB9 , and LbDREB16 showed a second expression peak (2–3-fold, p < 0 .05) in the late stage of disease (120 h), suggesting their specific role in systemic defense repair. In contrast, LbDREB3, LbDREB7 , and LbDREB11 were stably upregulated throughout all infection stages and exhibited statistically significant differences. Hence, these members may enhance broad-spectrum host resistance by enhancing the basal defense pathway. Discussion The DREB family is derived from the AP2/EREBP superfamily. The AP2/EREBP family of transcription factors is unique to plants, and its members have a conserved DNA-binding domain—the AP2/EREBP domain [ 17 , 30 ] —which is activated when plants are exposed to adverse stressors such as drought, high salinity, and low temperatures. This domain is able to bind specifically to the PUCCGAC-containing DRE/CRT cis-acting element, thereby activating expression of multiple downstream resistance genes [ 31 , 32 ] . In the present study, we screened for members of the DREB transcription factor family in L. barbarum and analyzed the data on protein physicochemical properties, gene structure, phylogeny, collinearity, and expression patterns of the family members under A. tenuis Nees infection. A total of 16 DREB family transcription factors were downloaded and identified based on published data from the L. barbarum whole-genome database, and were classified into six subgroups according to the A. thaliana classification system [ 8 , 14 ] . However, the 16 LbDREB members only formed 4 subgroups, as no LbDREB members were found in subgroups A1 or A6. One possible reason was that because L. barbarum is a relatively unique medicinal plant, these two subgroups were unable to adapt to environmental requirements. This could have resulted in their extinction or assimilation into other subgroups, ultimately enabling L. barbarum to adapt to its unique growing environment and medicinal value over the long course of evolution. Nonetheless, subgroups A2, A3, A4, and A5 still showed some similarities with DREB subfamilies of other plants [ 6 , 33 ] . This suggested that the DREB gene was relatively well conserved during plant evolution and may fulfill the same function in different species. Systematic research on the evolutionary history and adaptive changes of the DREB family in L. barbarum will facilitate a more comprehensive understanding of its stress resistance mechanism and medicinal value. Gene structural analysis revealed that the exon‒intron structure and promoter region of LbDREB genes contained a variety of cis-acting elements [ 6 , 34 ] . The structural diversity of LbDREB may be related to its function and evolution, while differences in exon‒intron structure may affect regulation as well as protein structure and function [ 35 ] . Genes with more exon‒intron structures may have complex expression regulation mechanisms, whereas genes with fewer exon‒intron structures may be more susceptible to environmental factors [ 12 ] . Cis-acting elements in the promoter region can determine gene expression patterns, causing the latter to function differently in different tissues or stress conditions [ 36 ] . Furthermore, conserved domain analysis revealed the presence of the characteristic AP2/EREBP domain in the LbDREB protein, which has a conserved binding sequence for DNA binding [ 6 , 37 ] . This suggested that the LbDREB gene may bind to DNA with specific binding sequences and regulate expression of downstream genes involved in abiotic stress responses, such as high temperature, low temperature, and high salinity. The upregulation of DREB gene expression in L. barbarum under abiotic stress may have been due to activation of specific transcription factors by stress signals. Hormonal signaling and biotic stressors such as diseases, pests, and weeds may also be involved in DREB gene regulation [ 10 , 38 ] . Therefore, in conjunction with the expression patterns, we hypothesized that LbDREB members may participate in the response to adversity via several mechanisms. First, they may directly activate expression of stress-resistance genes rich in DRE/CRT elements [ 3 , 5 , 7 ] . Second, they may form a regulatory network with other transcription factors to coordinate multiple stress signaling pathways. In particular, some LbDREB genes were differentially expressed after leaf blight fungal infection, and hence may be involved in the response of L. barbarum to biotic stressors. This may indirectly regulate the response to adversity through mechanisms, such as hormone signaling crosstalk, maintenance of reactive oxygen species homeostasis, and induction of disease resistance-related proteins, when subjected to stress [ 15 , 16 ] . Based on the results of comprehensive phylogenetic, gene structure, and expression pattern analyses, we predicted that the LbDREB genes in L. barbarum may have been involved in regulating expression of downstream antiretroviral genes, interacting with transcription factors and participating in biological processes, such as growth and development [ 6 , 39 ] . These functional predictions provide ideas for studying the specific targets of LbDREB genes. As a medicinal and edible plant, L. barbarum has a wide range of applications [ 30 ] . Hence, studying the function and regulatory mechanism of the DREB gene family in L. barbarum will provide new ideas and methods for improving its resistance and quality, while also offering a theoretical basis and genetic resources for subsequent research on resistance signal transduction against Lycium leaf blight and breeding for disease resistance. Declarations Ethics approval and consent to participate Not applicable Consent for publication Not applicable Availability of data and materials The datasets presented in this study are available in the NCBI GenBank repository, GenBank accession no. PX233497–PX233512. Competing interests The authors declare that they have no competing interests. Funding This study was supported by the Talent Start-up Fund Project of Gansu Agricultural University (No. GAU-KYQD-2019-22) and Science and Technology Plan Project of Gansu Province (No. 25CXND001). Author Contributions Yahan Chen and Wenxu Wang designed this study and completed the test operation content, Wenxu Wang and Yi Zhou identified the DREB family members in the L. barbarum genome, Haitao Yu and Wei Liu analyzed expression patterns of family members under A. tenuis Nees infection. Yahan Chen and Wenxu Wang wrote the manuscript. All the authors have read and agreed to the published version of the manuscript. Acknowledgements Not applicable References Kazuko Y, Kazuo S. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters[J]. Trends Plant Sci. 2005;10(2):88–94. LIU X T, CHEN H J, CHENG SS, et al. Genome-wide identification of the WRKY gene family in Hydrangea macrophylla and expression analysis in response to leaf spot disease [J]. Acta Agriculturae Boreali-Sinica(AABS). 2025;40(01):93–103. SONG Y T, HAN L Q, MA K et al. Identification and expression characterization of the DREB transcription factor family in Juglans regia [J]. Molecular Plant Breeding: 1–22. YUE X X XIAOC, ZHANG Q W, et al. Identification and expression pattern analysis of the AP2/ERF gene family in Artemisia argyi [J]. Acta Pharm Sinica. 2024;59(09):2634–47. ZUO Z F, LI Y L, WEI Y J, et al. Identification of the DREB gene family in Zoysia japonica and analysis of its expression patterns under abiotic stress [J]. Acta Prataculturae Sinica. 2025;34(05):74–88. LI AJ, DAI F B, RAO S, P, et al. Cloning of LrDREB1 gene from Lycium ruthenicum and its expression analysis under abiotic stress [J]. Mol Plant Breed. 2020;18(07):2174–81. LI K Y, ZHU HL. Research progress on DREB/CBF transcription factors in plant abiotic stress [J]. Volume 47. SCIENTIA SILVAE SINICAE; 2011. pp. 124–34. 01. SAKUMA Y, LIU Q. DUBOUZET J G, et al. DNA-Binding Specificity of the ERF/AP2 Domain of Arabidopsis DREBs , Transcription Factors Involved in Dehydration- and Cold-Inducible Gene Expression [J]. Volume 290. Biochemical and biophysical research communications; 2002. pp. 1998–1009. 3. DONDE R, GUPTA M K, GOUDA G, et al. Computational characterization of structural and functional roles of DREB1A , DREB1B and DREB1C in enhancing cold tolerance in rice plant [J]. Amino Acids. 2019;51(5):839–53. NICOLE F, DANIELE G, KERSTIN N, et al. DRE-1: An Evolutionarily Conserved F Box Protein that Regulates C. elegans Developmental Age [J]. Dev Cell. 2007;12(3):443–55. DONG C, XI Y, CHEN X L, et al. Genome-wide identification of AP2/EREBP in Fragaria vesca and expression pattern analysis of the FvDREB subfamily under drought stress [J]. BMC Plant Biol. 2021;21(1):295–295. MAQSOOD H, MUNIR F, AMIR R, et al. Genome-wide identification, comprehensive characterization of transcription factors, cis-regulatory elements, protein homology, and protein interaction network of DREB gene family in Solanum lycopersicum [J]. Front Plant Sci. 2022;13:1031679–1031679. RUBIO S, NORIEGA X, PÉREZ F J. Abscisic acid (ABA) and low temperatures synergistically increase the expression of CBF/DREB1 transcription factors and cold-hardiness in grapevine dormant buds [J]. Ann Botany. 2019;123(4):681–9. NIU X, LUO T L, ZHAO H Y, et al. Identification of wheat DREB genes and functional characterization of TaDREB3 in response to abiotic stresses [J]. Gene. 2019;740:144514. ZHANG C X, ZHANG H B, LIN W P, et al. ZmDREB1A controls plant immunity via regulating salicylic acid metabolism in maize [J]. Plant J. 2025;121(2):e17226–17226. HU X, LIANG J X, WANG W J, et al. Comprehensive genome-wide analysis of the DREB gene family in Moso bamboo ( Phyllostachys edulis ): evidence for the role of PeDREB28 in plant abiotic stress response [J]. Plant journal: cell Mol biology. 2023;116(5):1248–70. NI Z Y, XU Z S, LI L C, et al. Research progress on the action mechanism and application of DREB transcription factors in Plant Stress Tolerance [J]. J Triticeae Crops. 2008;28(06):1100–6. GONG H G, REHMAN F, MA Y, et al. Germplasm Resources and Strategy for Genetic Breeding of Lycium Species: A Review [J]. Front Plant Sci. 2022;13:802936–802936. YANG Z J, WU J L, NAN X X, et al. Genome-Wide identification and expression analysis of the LOX gene family in Lycium barbarum [J]. Jiangsu Agricultural Sci. 2025;53(04):83–93. LIU W, ZHANG Q D, WANG D W et al. Symptomatology and pathogen identification of a new Leaf Blight Disease in Lycium barbarum [J]. North HOURTICULTURE, 2018(12): 141–5. Alternaria THOMMAB. from general saprophyte to specific parasite [J]. Mol Plant Pathol. 2003;4(4):225–36. CHEN C, CHEN H, ZHANG Y, et al. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data [J]. Mol Plant. 2020;13(8):1194–202. CHAO Y T, YEN S H YENJH, et al. Orchidstra 2.0-A Transcriptomics Resource for the Orchid Family [J]. Plant Cell Physiol. 2017;58(1):e9. GOLDBERG T, HECHT M, HAMP T, et al. LocTree3 prediction of localization [J]. Nucleic Acids Res. 2014;42:W350–5. XIE JM, CHEN Y, CAI GJ, et al. Tree Visualization By One Table (tvBOT): a web application for visualizing, modifying and annotating phylogenetic trees [J]. Nucleic acids research; 2023. p. 51. HU Z A, LUO P, XIN JJ, et al. Genome-Wide Identification of DREB gene family and its expression analysis under abiotic stresses in Phalaenopsis aphrodite [J]. Volume 32. JOURNAL OF AGRICULTURAL BIOTECHNOLOGY; 2024. pp. 1715–28. 08. FAN L Z, TONG X N, CHEN K, et al. Identification and characterization of the DREB gene family in Citrus trifoliata and their response to abiotic stresses [J]. Jiangsu Agricultural Sci. 2024;52(15):53–64. LIU C, MA L, LI Y, et al. Cloning and expression analysis of HaDREB2A in Haloxylon ammodendron [J]. Genomics Appl Biology. 2015;34(09):1928–33. ZHANG D F YUQ, SHI W J, et al. Screening of reference genes for Real-time Fluorescent Quantitative PCR in Lycium barbarum under different concentrations of Salt Stress [J]. J Shenyang Agricultural Univ. 2022;53(05):581–9. LI ZL, WU Z Y, YE J et al. DREB-Type transcription factors and their research advances in application to plant abiotic stress tolerance genetic engineering improvement [J]. North HOURTICULTURE, 2010(20): 206–10. ELSAYED N, SUN X H MOHAMEDE, et al. Overexpression of Citrus grandis DREB gene in tomato affects fruit size and accumulation of primary metabolites [J]. Sci Hort. 2015;192:460–7. NAKANO T, SUZUKI K, FUJIMURA T, et al. Genome-wide analysis of the ERF gene family in Arabidopsis and rice [J]. Plant Physiol. 2006;140(2):411–32. LI X L, HE H H, WANG H, Han W et al. Identification and expression analysis of the AHL gene family in grape ( Vitix vinifera ) [J]. Plant Gene, 2021: 100285-23. HUANG LL, LI J Z, ZHANG B, et al. Genome-Wide Identification and Expression Analysis of AMT Gene Family in Apple ( Malus domestica Borkh.) [J]. Horticulturae. 2022;8(5):457–457. HAN Y L, CAI M H, ZHANG S, Q, et al. Genome-Wide Identification of AP2/ERF Transcription Factor Family and Functional Analysis of DcAP2/ERF#96 Associated with Abiotic Stress in Dendrobium catenatum [J]. Int J Mol Sci. 2022;23(21):13603–13603. AKHTAR M, JAISWAL A, TAJ G, et al. DREB1/CBF transcription factors: their structure, function and role in abiotic stress tolerance in plants [J]. J Genet. 2012;91(3):385–95. YANG W, LIU X D, CHI X J, et al. Dwarf apple MbDREB1 enhances plant tolerance to low temperature, drought, and salt stress via both ABA-dependent and ABA-independent pathways [J]. Planta. 2011;233(2):219–29. ZHANG JH, JI H T, WANG M, et al. Variation in stress resistance and quality traits of Triticum aestivum lines overexpressing DREB genes [J]. J Shanxi Agricultural Sci. 2013;41(10):1031–3. FENG K, HOU X L, XING G M, et al. Advances in AP2/ERF super-family transcription factors in plant [J]. Crit Rev Biotechnol. 2020;40(6):750–76. Additional Declarations No competing interests reported. Supplementary Files supplementarymaterial.rar Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7405611","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":513351309,"identity":"da80531e-805c-4297-bf7e-dbaab2272a9c","order_by":0,"name":"Yahan Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAs0lEQVRIiWNgGAWjYFACHhBxQI6Nvf0AaVqM+XjOJJCmJXGehIMBcRoMjp89+Lmg5k56mwRDAsOPim1EaDmTlyw949iz3DbpxgOMPWduE6HlQI6BNG/D4dw2mQMJzIxtxGg5/8b4N1BLOptEggGRWm7kmIFsSSBei+SNN2bWPMcOG7YBA/kgUX7hO59jfJun5rC8fHv7wQc/KojQonAAiXMAhyJUIN9AlLJRMApGwSgY0QAAldE/Jsl4Em8AAAAASUVORK5CYII=","orcid":"","institution":"Gansu Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Yahan","middleName":"","lastName":"Chen","suffix":""},{"id":513351312,"identity":"053ba0ce-f994-41a9-bfed-10b39225b565","order_by":1,"name":"Wenxu Wang","email":"","orcid":"","institution":"Gansu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Wenxu","middleName":"","lastName":"Wang","suffix":""},{"id":513351313,"identity":"626a2cc1-f9fb-42a6-ad6b-cce71df95d58","order_by":2,"name":"Yi Zhou","email":"","orcid":"","institution":"Gansu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Zhou","suffix":""},{"id":513351314,"identity":"4d4753e9-465c-43d6-9d34-2e00b041c975","order_by":3,"name":"Haitao Yu","email":"","orcid":"","institution":"Gansu Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Haitao","middleName":"","lastName":"Yu","suffix":""},{"id":513351315,"identity":"bb28ec24-fa05-484e-8519-13ebf7c0a820","order_by":4,"name":"Wei Liu","email":"","orcid":"","institution":"Wuwei Institute of Forestry Science Research","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2025-08-19 07:23:44","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7405611/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7405611/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":91119312,"identity":"03729520-f2b7-4a0b-8853-4449911cca50","added_by":"auto","created_at":"2025-09-11 18:28:30","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":815028,"visible":true,"origin":"","legend":"\u003cp\u003eMultiple sequence alignment of DREB proteins in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7405611/v1/62b398bf65e779ec875a20a4.png"},{"id":91118930,"identity":"9c273a0c-97b0-48e6-b8a6-eea537a5ebea","added_by":"auto","created_at":"2025-09-11 18:20:30","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":702003,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic analysis of the DREB family in \u003cem\u003eLycium barbarum\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7405611/v1/e61cb993d4bc7ed880066556.jpeg"},{"id":91118928,"identity":"e8a4851f-422f-498d-8382-35fcca3a89ac","added_by":"auto","created_at":"2025-09-11 18:20:30","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":90003,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of DREB family members on chromosomes in\u003cem\u003e Lycium barbarum\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7405611/v1/818b0a3cf703546b8230dec8.jpeg"},{"id":91119314,"identity":"4b43b926-fb43-4ac1-93ec-13b5849f9fae","added_by":"auto","created_at":"2025-09-11 18:28:30","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":160222,"visible":true,"origin":"","legend":"\u003cp\u003eConserved motifs and gene structures of the DREB gene family in \u003cem\u003eLycium barbarum\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7405611/v1/3cbb8a300675451c1050d0ec.png"},{"id":91118931,"identity":"1e940eee-3b56-4d9e-b32e-cdbadb670cd5","added_by":"auto","created_at":"2025-09-11 18:20:30","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":233741,"visible":true,"origin":"","legend":"\u003cp\u003eTwo conserved sequences of the DREB gene family in \u003cem\u003eLycium barbarum\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage52.png","url":"https://assets-eu.researchsquare.com/files/rs-7405611/v1/29a813a2fc44f666b95bdffb.png"},{"id":91119318,"identity":"2252c4ae-d50b-4bf6-9433-835e8b41519c","added_by":"auto","created_at":"2025-09-11 18:28:30","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":244535,"visible":true,"origin":"","legend":"\u003cp\u003eDREB gene family promoter cis-acting element in \u003cem\u003eLycium barbarum\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7405611/v1/10b3c4a21817c556c9e2fb24.jpeg"},{"id":91118942,"identity":"e22e54be-ec46-4c37-bf76-406c05013195","added_by":"auto","created_at":"2025-09-11 18:20:30","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":186250,"visible":true,"origin":"","legend":"\u003cp\u003eCollinearity analysis of DREB gene family members in \u003cem\u003eLycium barbarum\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7405611/v1/e522c9575b49d28b39023190.jpeg"},{"id":91118938,"identity":"7a10ebc7-326a-4d7b-8c25-791a5ac34ef6","added_by":"auto","created_at":"2025-09-11 18:20:30","extension":"jpeg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":99592,"visible":true,"origin":"","legend":"\u003cp\u003eCollinearity analysis of DREB genes between \u003cem\u003eLycium barbarum\u003c/em\u003e and \u003cem\u003eArabidopsis thaliana\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7405611/v1/fcfd5d5ce980e5ddf7216ba1.jpeg"},{"id":91119500,"identity":"113bffa8-6c9f-4149-b011-ae5550e08214","added_by":"auto","created_at":"2025-09-11 18:36:30","extension":"jpeg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":772022,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of DREB gene family expression patterns in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7405611/v1/ca462fd106f8a3435499c3c3.jpeg"},{"id":93739921,"identity":"f6945cd4-0908-4684-a80c-de0c042da377","added_by":"auto","created_at":"2025-10-17 04:47:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4173502,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7405611/v1/e1383ddc-365a-40b8-b6a8-5b27903ef5b1.pdf"},{"id":91119319,"identity":"73246d0b-512b-40f0-83bf-05c753855920","added_by":"auto","created_at":"2025-09-11 18:28:30","extension":"rar","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":4332187,"visible":true,"origin":"","legend":"","description":"","filename":"supplementarymaterial.rar","url":"https://assets-eu.researchsquare.com/files/rs-7405611/v1/fd5c8f74b7e9a172ea8c05fe.rar"}],"financialInterests":"No competing interests reported.","formattedTitle":"Genome identification of the DREB gene family in Lycium barbarum and expression analysis in response to leaf blight infection","fulltext":[{"header":"Background","content":"\u003cp\u003eTranscription factors are a class of proteins that bind specifically to cis-acting elements in the promoter region of genes, and thus effectively regulate gene transcription activity via this mechanism. Over the duration of plant growth and development, transcription factors play a central role in plant response mechanisms to various biotic and abiotic stressors, such as pathogen infection, insect feeding, drought, and high and low temperatures \u003csup\u003e[\u003cspan additionalcitationids=\"CR2 CR3 CR4\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e–\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. Analyzing the structural features of DNA-binding domains in plant transcription factors enables these factors to be classified into multiple families, such as myeloblastosis (MYB); NAM, ATAF1/2, and CUC2 (NAC), WRKY transcription factor family (WRKY), ethylene-responsive factor and APETALA2 (AP2/ERF), and basic-leucine zipper (bZIP), all of which play key roles in plant response to biotic stressors \u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eThe dehydration responsive element binding protein (DREB) is a crucial member of the AP2/ERF superfamily. The constituent members of this family typically contain a conserved AP2 domain consisting of a sequence approximately 60 amino acids in length \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. DREB and the ERF gene family (which also belongs to the AP2/ERF superfamily) can be differentiated by comparing the composition of specific amino acid residues in the AP2 domain, even though both contain only one AP2 domain. In the AP2 amino acid domain, the key amino acid positions 14 and 19 are critical for DREB family members, carrying valine (V) and glutamic acid (E), respectively; whereas, ERF family members carry alanine (A) and aspartic acid (D), respectively, at the same AP2 positions \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. It is this type of amino acid variation at key sites that weakens their binding efficiency to cis-acting elements in the promoter regions of downstream genes. DREB transcription factors can specifically bind to the core sequence ACCGAC/GCCGAC of the dehydration response element/C-repeat (DRE/CRT) cis-acting element in the promoter region of downstream genes and activate downstream gene expression through construction of a regulatory network, thereby participating in plant response to low temperatures, drought, high salinity, and other abiotic stressors. However, differences have been found in the cis-acting elements that bind to different members of the ERF family compared to DREB elements, which have led to functional differences \u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eBased on their structural and functional features, the DREB family can be further divided into six subgroups (A1–A6), with each subgroup fulfilling different functions \u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Members of subgroup A1 (also known as the DREB1/CBF family) are associated with plant responses to cold stress \u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. In \u003cem\u003eArabidopsis thaliana\u003c/em\u003e, DREB1A/CBF3, DREB1B/CBF1, and DREB1C/CBF2 genes are able to identify low-temperature stress. By upregulating expression of these genes, the transgenic plant \u003cem\u003eA. thaliana\u003c/em\u003e showed significant improvements in its tolerance for low temperatures, drought, and high salinity stress; conversely, silencing of the \u003cem\u003eDREB1A/CBF3\u003c/em\u003e and \u003cem\u003eDREB1B/CBF1\u003c/em\u003e genes attenuated its cold tolerance \u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. In addition, members of subgroups A2–A6 are closely associated with biotic stress responses and plant growth. These gene families have been detected in a variety of plants, such as \u003cem\u003eA. thaliana\u003c/em\u003e, wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e), strawberries (\u003cem\u003eFragaria vesca\u003c/em\u003e), tomatoes (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e), walnuts (\u003cem\u003eJuglans regia\u003c/em\u003e), and grapes (\u003cem\u003eVitis vinifera\u003c/em\u003e). Hence, a comprehensive study on the functions of each member in these families is crucial to understanding the mechanism of DREB family members found in \u003cem\u003eL. barbarum\u003c/em\u003e (LbDREB) gene expression in \u003cem\u003eL. barbarum\u003c/em\u003e and establishing a basis for its application in plant breeding for stress tolerance \u003csup\u003e[\u003cspan additionalcitationids=\"CR12 CR13\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e–\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eAs a branch of the AP2/ERF family, the DREB gene family is mainly involved in plant response to abiotic stressors, and is also of crucial significance to biotic stresses. In this field of biotic stress regulation, maize \u003cem\u003eDREB1A\u003c/em\u003e has been shown to reduce the level of active salicylic acid (SA) by inhibiting the SA synthesis gene (\u003cem\u003eZmSARD1\u003c/em\u003e) and activating the SA inactivation gene (\u003cem\u003eZmSAGT\u003c/em\u003e), thereby negatively regulating plant blight resistance \u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. In moso bamboo, \u003cem\u003ePeDREB28\u003c/em\u003e can bind to the promoter of the abscisic acid (ABA) receptor gene (\u003cem\u003eDlaPYL3\u003c/em\u003e) to regulate the ABA signaling pathway and hence indirectly affect disease resistance \u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. In terms of abiotic stress regulation, 23 DREB members in \u003cem\u003eHibiscus cannabinus\u003c/em\u003e were significantly upregulated under salinity stress, which implied that DREB members are able to activate osmoregulatory genes (e.g., LEA proteins) in order to enhance salt tolerance and maintain leaf health, thereby reducing the chances of pathogen infection \u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. In moso bamboo, \u003cem\u003ePeDREB28\u003c/em\u003e expression was significantly elevated under drought and low-temperature stress, and enhanced resistance by regulating the ABA signaling pathway and redox-related genes, thereby indirectly inhibiting pathogen colonization \u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003e\u003cem\u003eLycium barbarum\u003c/em\u003e is a multi-stemmed shrub of the family Solanaceae \u003cem\u003eJuss\u003c/em\u003e and genus \u003cem\u003eLycium\u003c/em\u003e, mainly found in northwestern China. Its fruits are oval in shape and usually red or orange‒red in color \u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. \u003cem\u003eLycium barbarum\u003c/em\u003e is rich in nutrients, containing a variety of vitamins (e.g., vitamins C, B1, and B2) and exhibiting significant effects in antioxidation and immune function enhancement. Furthermore, \u003cem\u003eL. barbarum\u003c/em\u003e contains an abundance of minerals, including iron, zinc, and selenium, which are essential to the normal physiological functions of the body. In particular, \u003cem\u003eL. barbarum\u003c/em\u003e polysaccharides have shown immune regulation, anti-tumor, blood glucose-lowering, blood lipid-lowering, and other biological activities \u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. In \u003cem\u003eShennong Bencaojing\u003c/em\u003e (\u003cem\u003eDivine Farmer’s Classic of Materia Medica\u003c/em\u003e), \u003cem\u003eL. barbarum\u003c/em\u003e polysaccharides are classified as a high-grade medicine, and are described as being able to “strengthen the muscles and bones, lighten the body and prolong life, and withstand the cold and heat, if administered long-term.” The continuous discovery of the numerous health effects of \u003cem\u003eL. barbarum\u003c/em\u003e has been accompanied by growing concerns over its quality, which has attracted widespread attention. Hence, examining the expressions of adversity genes in \u003cem\u003eL. barbarum\u003c/em\u003e under biotic and abiotic stresses is profoundly significant for enhancing the quality of \u003cem\u003eL. barbarum\u003c/em\u003e. \u003cem\u003eLycium\u003c/em\u003e leaf blight is a major fungal disease in primary \u003cem\u003eL. barbarum\u003c/em\u003e production areas, with an incidence rate of 60–80% in the hot and humid season. It can cause severe damage by triggering premature senescence of affected leaves, reducing fruit yield, and degrading fruit quality, directly contributing to economic losses of 30–50% \u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. This disease is mainly caused by the pathogen \u003cem\u003eAlternaria tenuis\u003c/em\u003e Nees \u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e, which is a broad-spectrum parasitic fungus \u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e that can cause wheat leaf blight, eggplant early blight, northern corn leaf blight, \u003cem\u003eAlternaria brassica\u003c/em\u003e leaf spot, and other diseases of major economic and food crops. Although \u003cem\u003eLycium\u003c/em\u003e leaf blight poses a substantial threat to the industry, its pathogenic mechanism remains poorly understood. Therefore, the aim of this study was to establish a theoretical basis for identifying leaf blight-resistant DREB transcription factors in \u003cem\u003eL. barbarum\u003c/em\u003e through genome-wide analysis, bioinformatics analysis, and examination of DREB expression patterns under leaf blight infection. In addition, this study provides a genetic reserve for improving the disease resistance and quality of \u003cem\u003eL. barbarum\u003c/em\u003e.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003eExperimental Materials\u003c/p\u003e\u003cp\u003eTest strains and vectors: \u003cem\u003eEscherichia coli\u003c/em\u003e DH5α and a cloning vector TSINGKE TSV-007S pClone007 Simple Vector Kit were purchased from Tsingke Biotech Co., Ltd.\u003c/p\u003e\u003cp\u003eTest plants: \u003cem\u003eL. barbarum\u003c/em\u003e plants were obtained from Jingyuan County, Gansu Province.\u003c/p\u003e\u003cp\u003eMain reagents and culture media: The nucleic acid extraction system consisted of TRizol Total RNA Extraction Reagent (Tsingke Biotech) and a FastKing Genomic DNA Dispelling RT SuperMix system (Tiangen Biotech). The gene amplification system consisted of the PrimeSTAR® GXL High-Fidelity DNA Polymerase (Tsingke Biotech) and Ex Taq® Conventional DNA Polymerase (TaKaRa Bio). The nucleic acid analysis system consisted of SYBR® Green Pro Taq HS Real-Time Quantitative Detection Premix (AG Bio) and 2000 bp DNA Molecular Weight Marker (Biomed). The gene cloning system consisted of a \u003cem\u003eKpnI/XbaI\u003c/em\u003e double digestion system (TaKaRa Bio) with a plasmid rapid extraction kit (Tiangen Biotech) and a DNA fragment purification kit (Tsingke Biotech). The reverse transcription system consisted of a PrimeScript™ II First Strand cDNA Synthesis Kit (Tsingke Biotech) and Perfect Real-Time RT dedicated reaction system. The microbial culture system consisted of Luria‒Bertani (LB) agar medium containing 50 µg/mL ampicillin. All reagents were prepared according to the manufacturer's standard operating procedures.\u003c/p\u003e\u003cp\u003eIdentification of DREB family members in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e\u003cp\u003eWhole-genome sequence data of \u003cem\u003eL. barbarum\u003c/em\u003e was obtained from the National Center for Biotechnology Information (NCBI) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and DREB family sequence data for \u003cem\u003eA. thaliana\u003c/em\u003e, rice (\u003cem\u003eOryza sativa\u003c/em\u003e), maize (\u003cem\u003eZea mays\u003c/em\u003e), wheat (\u003cem\u003eT. aestivum\u003c/em\u003e), grape (\u003cem\u003eV. vinifera\u003c/em\u003e), walnut (\u003cem\u003eJ. regia\u003c/em\u003e), and poplar (\u003cem\u003ePopulus euphratica\u003c/em\u003e) were obtained from the NCBI (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), TAIR (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.arabidopsis.org/\u003c/span\u003e\u003cspan address=\"https://www.arabidopsis.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and Ensembl Plants (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://plants.ensembl.org/index.html\u003c/span\u003e\u003cspan address=\"https://plants.ensembl.org/index.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) databases \u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Systematic screening of LbDREB was performed using two strategies. First, based on the DREB homologous sequences of six plants, potential DREB family members were identified in the \u003cem\u003eL. barbarum\u003c/em\u003e protein sequence files using BLAST analysis. Second, the Hidden Markov Model (HMM) of the AP2 domain (PF00847) was obtained from the pfam (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://pfam.xfam.org/\u003c/span\u003e\u003cspan address=\"http://pfam.xfam.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) database and a search was performed on the protein sequences of the \u003cem\u003eL. barbarum\u003c/em\u003e genome using TBtools (v2.210) to further screen for DREB family members. To ensure accuracy and reliability of the screening results, the intersection of results obtained using these two methods was taken. The AP2 domain of the candidate genes were then further verified using the Batch CD-Search tool of the NCBI-CDD database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to ensure that all sequences were DREB family members.\u003c/p\u003e\u003cp\u003eCloning of DREB members in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e\u003cp\u003eTotal RNA was extracted from \u003cem\u003eL. barbarum\u003c/em\u003e leaves using the TRizol method. The RNA sample was then diluted in 40 µL of nuclease-free water. The concentration of RNA samples was accurately measured using an Unano-2000 Microvolume Nucleic Acid Analyzer, and their integrity was then assessed using agarose gel electrophoresis. Finally, total RNA samples collected from \u003cem\u003eL. barbarum\u003c/em\u003e leaves were stored in a refrigerator at -80°C to preserve important materials for subsequent experimental studies.\u003c/p\u003e\u003cp\u003eTotal RNA extracted from \u003cem\u003eL. barbarum\u003c/em\u003e leaves was used as a template to perform cDNA synthesis. The manufacturer’s instructions for the TaKaRa PrimeScriptTM II1st Strand cDNA Synthesis Kit were strictly followed during the reverse transcription process and system construction. Prepared cDNA samples were then transferred to a -20°C refrigerator.\u003c/p\u003e\u003cp\u003eSpecific primers were designed using Primer 5.0 based on the full-length sequences of the \u003cem\u003eLbDREB1–LbDREB16\u003c/em\u003e genes in the GenBank nucleic acid sequence database as standard sequences, and completed by Xi'an Tsingke Biotech, Co., Ltd. Subsequent procedures were performed within a 25 µL polymerase chain reaction (PCR) system, which comprised 16.3 µL of ddH\u003csub\u003e2\u003c/sub\u003eO, 2.0 µL of cDNA, 2.5 µL of buffer solution, and 2.0 µL of dNTP Mix. In addition, 1.0 µL each of upstream and downstream primers were added, along with 0.2 µL of Taq enzyme. For this reaction, the pre-denaturation step was set at 94°C for 5 min, followed by cycles of denaturation at 94°C for 30 s, annealing for 30 s, and extension at 72°C for 60 s, with a total of 30 cycles. Finally, an extension phase was carried out at 72°C for 10 min, after which the samples were stored at 4°C. The products amplified using the PCR reaction were separated by 2.0% agarose gel electrophoresis. Images of the separated products were then captured using a gel imager, which were recorded in detail and photographed.\u003c/p\u003e\u003cp\u003eGel extraction was performed for specific bands containing the target sequence. The recovered purified product was then mixed with a cloning vector TSINGKE TSV-007S pClone007 Simple Vector Kit at a volume ratio of 1:4, followed by ligation in a metal bath at 25°C for 5 min. DH5α (100 µL) was added to the ligation product. After standing on ice for 25 min, the product was heat-shocked in a water bath at 42°C for 60 s, and immediately immersed in an ice bath for 2 min. Then, 1000 µL of LB culture broth was added, mixed well, and shaken at 37°C for 1 h at 200 rpm. Bacterial solution (100 µL) was spread onto LB solid medium and incubated for 14 h. Single colonies were placed in 5 mL of LB liquid medium, to which 5 µL of Amp was added, followed by incubation for 16 h at 37°C with shaking. Finally, the cultured bacterial solution was used as a template for further PCR experiments involving bacterial solutions. Three bacterial solutions with positive PCR results were screened and transported to Sangon Biotech Co., Ltd. for sequencing.\u003c/p\u003e\u003cp\u003eAnalysis of physicochemical properties and subcellular localization of DREB family proteins in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e\u003cp\u003ePhysicochemical properties of the 16 DREB family protein sequences screened from the dataset were comprehensively analyzed by accessing the ProtParam tool (Expasy ProtParam tool) on the Expasy server (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.expasy.org\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.expasy.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). This analysis involved several key indicators, such as amino acid chain length, relative molecular mass, isoelectric point, and protein stability coefficient \u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. In addition, predictions were made for the subcellular localization of DREB proteins using the online analysis tool Cell-PLoc (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.csbio.sjtu.edu.cn/bioinf/Cell-PLoc-2/\u003c/span\u003e\u003cspan address=\"http://www.csbio.sjtu.edu.cn/bioinf/Cell-PLoc-2/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) \u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. Multiple sequence alignment of LbDREB proteins was performed using DNAMAN software.\u003c/p\u003e\u003cp\u003ePhylogenetic tree construction and chromosomal localization of the DREB family in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e\u003cp\u003ePhylogenetic tree analysis was performed on the 16 LbDREB protein sequences and the DREB family members of \u003cem\u003eA. thaliana\u003c/em\u003e, walnut, grape, and poplar, followed by construction of a dendrogram using the neighbor-joining algorithm in MEGA (v11.0). In addition, 1000 repetitions of the bootstrap test were executed to enhance the reliability of the data. Default values were retained for all parameters during the construction process \u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. The online tool itol (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://itol.embl.de/\u003c/span\u003e\u003cspan address=\"https://itol.embl.de/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to beautify the phylogenetic tree and analyze the phylogenetic relationship of the LbDREB family with \u003cem\u003eA. thaliana\u003c/em\u003e homologous genes \u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. Candidate gene IDs were also screened from the \u003cem\u003eL. barbarum\u003c/em\u003e genome annotation file, and TBtools (v2.210) was employed to obtain information on \u003cem\u003eL. barbarum\u003c/em\u003e chromosome length and chromosomal location of the LbDREB gene. The screened gene IDs were visualized and localized on the \u003cem\u003eL. barbarum\u003c/em\u003e chromosome to facilitate subsequent analysis of biological functions.\u003c/p\u003e\u003cp\u003eAnalysis of gene structure, conserved motifs, and promoter cis-acting elements of DREB genes in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe 16 members of the LbDREB family were analyzed for conserved motifs using the MEME online platform (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://meme-suite.org/tools/meme\u003c/span\u003e\u003cspan address=\"http://meme-suite.org/tools/meme\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). In this analysis, the number of conserved motifs was set to 10 and other parameters were set to default values, in order to analyze the similarity and functional features of the DREB family \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. The structure of the 16 screened LbDREB genes was visualized using the Visualize Gene Structure feature of TBtools (v2.210). Finally, a 2000-bp sequence fragment upstream of the DREB gene in the genome was extracted and uploaded to the Plant Care database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://bioinformatics.psb.ugent.be/webtools/plantcare.html/\u003c/span\u003e\u003cspan address=\"http://bioinformatics.psb.ugent.be/webtools/plantcare.html/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) for analysis of cis-acting elements \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. Finally, relevant response element tags were screened from the database, merged, and visualized in TBtools (v2.210) for further mining of their possible biological functions.\u003c/p\u003e\u003cp\u003eAnalysis of collinearity and ratios of non-synonymous mutations (Ka) to synonymous mutations (Ks) (Ka/Ks) of the DREB family in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e\u003cp\u003eCollinearity analysis and visualization were performed intra-specifically within \u003cem\u003eL. barbarum\u003c/em\u003e and inter-specifically between \u003cem\u003eL. barbarum\u003c/em\u003e and \u003cem\u003eA. thaliana\u003c/em\u003e using TBtools (v2.210). Defaults settings were used for all parameters. The whole \u003cem\u003eL. barbarum\u003c/em\u003e genome was subjected to BLAST analysis, and gene pairs were screened based on \u003cem\u003eE\u003c/em\u003e-value \u0026lt; 1e\u003csup\u003e− 5\u003c/sup\u003e and Score ≥ 500. In addition, CDS sequences of LbDREB gene pairs were extracted, and the Simple Ka/Ks Calculator tool was employed to accurately calculate Ks and Ka among gene pairs.\u003c/p\u003e\u003cp\u003eExpression analysis of DREB family in response to leaf blight in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e\u003cp\u003eUsing healthy \u003cem\u003eL. barbarum\u003c/em\u003e plants as materials, mature leaves of the third node in the middle of the plant were selected and inoculated with the \u003cem\u003eLycium\u003c/em\u003e leaf blight pathogen \u003cem\u003eA. tenuis.\u003c/em\u003e Leaf samples were collected at 0, 24, 48, 72, and 120 h after inoculation, and stored in an ultra-low temperature refrigerator at -80°C after flash-freezing with liquid nitrogen. Three biological replicates were collected for each time point.\u003c/p\u003e\u003cp\u003eTotal leaf RNA was extracted using a TRizol kit. cDNA was prepared in strict accordance with the operating instructions of a FastKing gDNA Disppelling RT SuperMix (TIANGEN) Kit, and the template was diluted 5-fold for subsequent quantitative detection.\u003c/p\u003e\u003cp\u003eGene expression analysis was performed using the SYBR Green Type I double-stranded DNA-conjugated fluorescence quantitative detection system (AG Bio). The cDNA synthesized by reverse transcription was used as the template, and the \u003cem\u003eβ-actin\u003c/em\u003e gene of \u003cem\u003eL. barbarum\u003c/em\u003e was used as the endogenous control. A real-time fluorescence quantitative detection system was constructed based on specific amplification primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) designed for the conserved region of the LbDREB gene. The experimental setup was based on a three-level replication strategy, whereby three groups of biological parallels were set up for each sample, with each group containing four technical replicates. The standard reaction system was configured according to international real-time quantification specifications. The 20 µL standard reaction system comprised 10 µL of 2×SYBR Green Type I premix (with ROX passive reference dye), 150 ng of cDNA template, 0.4 µL of 10 µM Primer F, 0.4 µL of 10 µM Primer R, and 8.2 µL of RNase free water. The specific conditions of the PCR reaction were as follows: pre-denaturation at 95°C for 30 s, denaturation at 95°C for 5 s, annealing at 60°C for 1 min, denaturation at 95°C for 15 s, denaturation at 95°C for 30 s, and annealing at 60°C for 40 times; each cycle consisted of denaturation at 95°C for 15 s and annealing at 60°C for 1 min. Finally, the melting curve was analyzed at 95°C. Relative expression was calculated using the 2\u003csup\u003e−ΔΔCt\u003c/sup\u003e method, with all \u003cem\u003eCt\u003c/em\u003e values of the control set to 1.\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers for qPCR detection of the DREB gene family in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eName of primer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSequence\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAnnealing temperature (°C)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eReference gene/Literature\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB1\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTCGAGCTCATGATGTTGCTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e59\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLOC132599422\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB1\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGCTTGAATGTCACGAGGGTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB2\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCAACTGGGGCGGTTTATTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e59\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLOC132603229\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB2\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCCTGGATCTCCCACTACCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB3\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGTTCTGGGGCGAACAGTAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e59\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLOC132605424\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB3\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGGACACCCATTTTCCGCTA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB4\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTCCAATTTGCCTTGGATCTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e57\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLOC132606766\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB4\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTCTCAGGACCGCCTTTACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e59\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB5\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGGCAACTACATCTGCGTCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLOC132609115\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB5\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCAATGGTGTGCCAGCTTCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB6\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eATCCGTGAACCTCGTAAGCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLOC132611090\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB6\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGACGAAGGGTTTGTGTGGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB7\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTGTTAGTCGGTGATGGCGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLOC132618216\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB7\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGTGAGCTTTGGGTAGCGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB8\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCGAGCTTATGATACGGCGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e59\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLOC132622643\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB8\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGACGGGCTTGAAGTCTCAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e59\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB9-F\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAAGTAAGCCCGGACCGTATG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e59\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLOC132626396\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB9-R\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGCAGTTTGGCATGTGAGTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e59\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB10\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCTTCTCACAATTTTCAAAGGAGAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e57\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLOC132630927\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB10\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTTTCCCCAAGTTCTTTGCCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e58\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB11\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGAGACAAAGGCCATCAGGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLOC132631427\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB11\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTCTTCCACGAAGGAGACGTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB12\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGTTTCCCACACCCGAAATG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e59\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLOC132634093\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB12\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTCGTGGCAGGAACAGGTAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB13\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTTGGTTAGGCACTTTCGCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e59\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLOC132636814\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB13\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAAATGCCCGAAACCAACGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e59\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB14\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGCCTCTGAGCGAGATAGTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLOC132639570\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB14\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCAAGCTGTCGAAACTGCAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e59\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB15\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGCGAAAGACGAGGCTAAGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e59\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLOC132640420\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB15\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTAGGCAGCACTCTGCATTCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB16\u003c/em\u003e-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAAAGTCACGCATTTGGCTCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e59\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLOC132645867\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eLbDREB16\u003c/em\u003e-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTCACCCAACTCATCCGACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e59\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eActin-\u003c/em\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAATCGGGTATTTCAAGGTCAAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eZhang et al. \u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eActin-\u003c/em\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAGCAGTGTTTCCCAGCATTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eIdentification of DREB family members in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eBy subjecting the obtained \u003cem\u003eL. barbarum\u003c/em\u003e genome sequence data to HMM analysis and local BLASTP alignment, DREB family genes were obtained using HMM analysis. After removing sequences without conserved domains, a total of 16 LbDREB family members (\u003cem\u003eLbDREB1\u003c/em\u003e\u0026ndash;\u003cem\u003eLbDREB16\u003c/em\u003e) containing one AP2 domain were obtained, and GenBank accession no. were PX233497\u0026ndash;PX233512.\u003c/p\u003e\n\u003cp\u003eAnalysis of physicochemical properties and prediction of subcellular localization of DREB family proteins in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eBased on the BLAST alignment and HMM analysis of DREB homologous sequences in 6 plants, 16 DREB protein sequences were obtained using TBtools (v2.210) based on the BLAST alignment of \u003cem\u003eL. barbarum\u003c/em\u003e genome protein sequences. Protein physicochemical properties of the 16 screened DREB family member sequences were further analyzed using the ProtParam tool on the Expasy server (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.expasy.org\u003c/span\u003e\u003c/span\u003e). The results indicated that the amino acid length of LbDREB proteins ranged between 174\u0026ndash;503, the relative molecular mass ranged between 19.29\u0026ndash;57.93 kDa, the theoretical isoelectric point ranged between 4.61\u0026ndash;9.66, the aliphatic index ranged between 49.67\u0026ndash;80.73, and the grand average of hydrophobicity ranged from \u0026minus;\u0026thinsp;0.89 to -0.41 (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Among the 16 DREB proteins, all were classified as hydrophilic proteins, and 3 were classified as stable proteins and the remaining as unstable proteins. Next, the characteristic attributes of DREB proteins were predicted using the Cell-PLoc online tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.csbio.sjtu.edu.cn/bioinf/Cell-PLoc-2/\u003c/span\u003e\u003c/span\u003e). Based on the prediction results, we found that DREB proteins were mainly located in the cytoplasm and nucleus, with only two (\u003cem\u003eLbDREB14\u003c/em\u003e and \u003cem\u003eLbDREB16\u003c/em\u003e) found in mitochondria.\u003c/p\u003e\n\u003cp\u003eMultiple sequence alignment was performed on the 16 LbDREB protein sequences using DNAMAN to clarify the structural properties of LbDREB transcription factors (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Our study identified one amino acid sequence that was highly conserved among the different members of the LbDREB gene family, and contained one AP2 domain. This domain was composed of \u0026gt;\u0026thinsp;60 amino acid residues. Among them, amino acid residues at positions 14 and 19 of this domain were valine (V14) and glutamic acid (E19), respectively, which are essential for cis-acting element recognition of DREB transcription factors. In the DREB family, valine (V14) was generally more conserved than glutamate (E19), and the structural properties of LbDREB genes were consistent with those of the DREB family in other species.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n \u003cdiv align=\"left\" class=\"colspec\"\u003e\u003cbr\u003e\u003c/div\u003e\n \u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eInformation and characteristics of the DREB gene family of \u003cem\u003eLycium barbarum\u003c/em\u003e\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence ID\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eProtein ID\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAmino acid length\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eMolecular mass (kDa)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003epI\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eInstability index\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAliphatic index\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGRAVY\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eSubcellular localization\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB\u003c/em\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXP_060168778\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e179\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20.07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e5.93\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e54.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e80.73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-0.47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXP_060172202\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e302\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e33.23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e6.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e54.85\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e57.52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-0.75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXP_060174560\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e188\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e4.68\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e53.69\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e68.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-0.48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXP_060176381\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e503\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e57.93\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e4.69\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e64.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e65.29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-0.79\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB5\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXP_060178952\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e348\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e38.39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e4.97\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e48.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e60.60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-0.76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB6\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXP_060181480\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e331\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e36.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e5.96\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e55.81\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e49.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-0.83\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB7\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXP_060189258\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e177\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e19.57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e8.90\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e39.54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e66.72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-0.76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB8\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXP_060193270\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e174\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e19.29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e7.72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e45.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e63.39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-0.76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB9\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXP_060197238\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e255\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e28.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e9.66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e36.62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e67.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-0.80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eE and N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB10\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXP_060202491\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e391\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e44.79\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e5.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e60.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e67.54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-0.84\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB11\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXP_060202985\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e176\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e19.91\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e8.84\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e57.46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e74.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-0.78\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB12\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXP_060206378\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e202\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e21.66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e4.80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e51.45\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e70.69\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-0.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB13\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXP_060209827\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e391\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e42.42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e4.61\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e61.86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e66.32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-0.48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB14\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXP_060211992\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e191\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e21.66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e5.28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e57.51\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e60.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-0.74\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eE, M and N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB15\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXP_060212995\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e366\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e41.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e4.85\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e42.92\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e54.45\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-0.89\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"1\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"11\"\u003eNote: N represents the cell nucleus; E represents the extracell; M represents the mitochondrion.\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003ePhylogenetic analysis and chromosomal localization of the DREB family in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTo further demonstrate the evolutionary relationships among these gene family members, we constructed a phylogenetic tree based on the screened LbDREB members, as well as those reported in \u003cem\u003eA. thaliana\u003c/em\u003e, poplar (\u003cem\u003eP. euphratica\u003c/em\u003e), grape (\u003cem\u003eV. vinifera\u003c/em\u003e), and walnut ( \u003cem\u003eJ\u003c/em\u003e. \u003cem\u003eregia\u003c/em\u003e). As shown in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, based on the phylogenetic results and combined with the grouping of DREB genes in \u003cem\u003eA. thaliana\u003c/em\u003e, the LbDREB family members were categorized into six subgroups (A1\u0026ndash;A6). Subgroups A1 and A6 were absent in \u003cem\u003eL. barbarum\u003c/em\u003e; whereas, subgroups A2, A3, A4, and A5 contained 6, 2, 6, and 2 DREB family members, respectively, as well as 17, 2, 38, and 18 DREB family members, respectively, from other species.\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003eL. barbarum\u003c/em\u003e reference genome on the NCBI database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/n\u003c/span\u003e\u003c/span\u003e) was downloaded as the basis for chromosome-level visualization of the 16 DREB genes using TBTools (v2.210). As shown in Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, these 16 genes were distributed across 10 different chromosomes. The largest number of LbDREB genes were distributed on chromosome 3 (3 in total). Chromosomes 1, 5, 7, and 8 each contained two \u003cem\u003eLbDREB\u003c/em\u003e genes. Chromosomes 2, 4, 6, 9, and 10 only contained one \u003cem\u003eLbDREB\u003c/em\u003e gene each, namely, \u003cem\u003eLbDREB9, LbDREB13, LbDREB1, LbDREB7\u003c/em\u003e, and \u003cem\u003eLbDREB8\u003c/em\u003e, respectively. Furthermore, their distribution was independent of chromosome length and density, showing a relatively even distribution of genes across each chromosome.\u003c/p\u003e\n\u003cp\u003eConserved motifs and gene structure analysis of the DREB gene family in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe conserved motifs of the 16 DREB proteins were analyzed in detail through the online website MEME (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://meme-suite.org/tools/meme\u003c/span\u003e\u003c/span\u003e). A total of 10 conserved motifs (Motifs 1\u0026ndash;10) were predicted (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). Among them, Motifs 1 and 2 were prevalent among DREB family members and their sequences were highly conserved; hence, they can be regarded as the two most central protein motifs in this family. The two conserved motifs of the LbDREB protein contained approximately 60 amino acid residues, which belong to the AP2 domain, playing a key role in DNA recognition and binding (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). In shown in Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, the C-terminus of the RAYD conserved element of Motif 2 contained 39 amino acid residues, which can facilitate binding of regulatory transcription factors to cis-acting elements. These conserved motifs may be involved in regulating the transcriptional activity of DREB proteins, which in turn can affect plant response to adversity. Further structural analysis of genes in the LbDREB family showed that eight LbDREB genes (50%) did not contain introns, seven LbDREB genes (43.75%) contained one intron, and only \u003cem\u003eLbDREB9\u003c/em\u003e contained two introns, suggesting that the LbDREB gene structure was relatively conserved.\u003c/p\u003e\n\u003cp\u003eAnalysis of promoter cis-acting elements of the DREB gene family in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe 2000 bp cis-acting elements in the upstream promoter region of the 16 LbDREB genes were analyzed using the Plant Care online database. As shown in Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e, these elements mainly included the following categories in response to abiotic and biotic stressors: auxin-responsive elements, which play a key role in defense and stress responses, and; gibberellin- and SA-responsive elements, each of which correspond to the signaling processes of different plant hormones. Cis-acting elements that play a key role in the ABA signaling pathway were also identified. These include cis-regulatory elements critical to induction of anaerobic conditions, as well as those that modulate light responsiveness. In addition, MYB binding sites associated with drought inducibility were also included, as well as cis-acting elements involved in low-temperature responsiveness and wound repair processes.\u003c/p\u003e\n\u003cp\u003eCollinearity analysis of DREB family members in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eA total of seven pairs of segmental duplication genes were detected from the LbDREB family (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e), of which one pair (\u003cem\u003eLbDREB7\u003c/em\u003e and \u003cem\u003eLbDREB8\u003c/em\u003e) was in subgroup A5, two pairs (\u003cem\u003eLbDREB4\u003c/em\u003e‒\u003cem\u003eLbDREB10\u003c/em\u003e and \u003cem\u003eLbDREB5\u003c/em\u003e‒\u003cem\u003eLbDREB15\u003c/em\u003e) were in subgroup A2, and four pairs (\u003cem\u003eLbDREB3\u003c/em\u003e‒\u003cem\u003eLbDREB12\u003c/em\u003e, \u003cem\u003eLbDREB11\u003c/em\u003e‒\u003cem\u003eLbDREB13\u003c/em\u003e, \u003cem\u003eLbDREB11\u003c/em\u003e‒\u003cem\u003eLbDREB16\u003c/em\u003e, and \u003cem\u003eLbDREB13\u003c/em\u003e‒\u003cem\u003eLbDREB16\u003c/em\u003e) were in subgroup A4. Genes exhibiting collinear relationships accounted for 81.25% of the LbDREB genes.\u003c/p\u003e\n\u003cp\u003eAnnotation files of \u003cem\u003eL. barbarum\u003c/em\u003e and \u003cem\u003eA. thaliana\u003c/em\u003e were combined using TBtools (v2.210) to perform collinearity analysis between the two species. The results showed that there were 19 orthologous DREB gene pairs between \u003cem\u003eL. barbarum\u003c/em\u003e and \u003cem\u003eA. thaliana\u003c/em\u003e (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e), indicating that the evolutionary relationship of the DREB family was highly similar between the two.\u003c/p\u003e\n\u003cp\u003eMutation analysis of DREB family members in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eBased on calculations of amino acid non-synonymous mutations (Ka) and synonymous mutations (Ks), the Ka/Ks value was \u0026gt;\u0026thinsp;1 for all seven LbDREB gene pairs, suggesting that the coding of the genes was biased toward purifying selection during evolution (Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n \u003cdiv align=\"left\" class=\"colspec\"\u003e\u003cbr\u003e\u003c/div\u003e\n \u003ctable id=\"Tab3\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eKa/Ks analysis of LbDREB genes in \u003cem\u003eLycium barbarum\u003c/em\u003e\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene 1\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene 2\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eNonsynonymous\u003c/p\u003e\n \u003cp\u003emutation (Ka)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSynonymous\u003c/p\u003e\n \u003cp\u003emutation (Ks)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eKa/Ks\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eEffective\u003c/p\u003e\n \u003cp\u003elength/bp\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAverage\u003c/p\u003e\n \u003cp\u003eS-sites\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAverage\u003c/p\u003e\n \u003cp\u003eN-sites\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB7\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB8\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e507\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e118.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e388.33\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB11\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB16\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.91\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e513\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e120.58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e392.42\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB10\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.97\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1035\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e216.17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e818.83\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB5\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB15\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.98\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e981\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e223.25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e757.75\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB12\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e546\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e128.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e418\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB11\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB13\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.34\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.89\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e534\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e124.58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e409.42\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB13\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB16\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e510\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e118.92\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e391.08\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB7\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLbDREB8\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e507\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e118.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e388.33\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eExpression analysis of LbDREBs in response to leaf blight infection in \u003cem\u003eL. barbarum\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eBy infecting \u003cem\u003eL. barbarum\u003c/em\u003e with the leaf blight pathogen, we analyzed the expression patterns of the 16 LbDREB family members that were previously identified. Gene expression characteristics of the inoculated and control groups were examined by quantitative real-time PCR at five key time points (0, 24, 48, 72, and 120 h). All family members exhibited a significant upregulation trend (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0\u003c/em\u003e.05) during pathogen infection; however, different members had distinct time-sequential expression characteristics.\u003c/p\u003e\n\u003cp\u003eAs shown in Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e, expressions of \u003cem\u003eLbDREB1, LbDREB6, LbDREB10, LbDREB15\u003c/em\u003e, and \u003cem\u003eLbDREB16\u003c/em\u003e increased sharply at 24 h of infection, with peak values reaching 4\u0026ndash;6-fold that of the control (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0\u003c/em\u003e.01). This rapid response was highly consistent with the initial stage of lesion formation, suggesting that these members may have played a key role in pathogen recognition or early defense signal transduction. In the middle stage of the disease (48\u0026ndash;72 h), \u003cem\u003eLbDREB2, LbDREB4, LbDREB5, LbDREB12, LbDREB13, LbDREB14\u003c/em\u003e, and \u003cem\u003eLbDREB16\u003c/em\u003e maintained 2‒3-fold higher expression levels (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0\u003c/em\u003e.05), and their sustained activation patterns were synchronized with lesion expansion and spread. Of particular note was that \u003cem\u003eLbDREB8, LbDREB9\u003c/em\u003e, and \u003cem\u003eLbDREB16\u003c/em\u003e showed a second expression peak (2\u0026ndash;3-fold, \u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0\u003c/em\u003e.05) in the late stage of disease (120 h), suggesting their specific role in systemic defense repair. In contrast, \u003cem\u003eLbDREB3, LbDREB7\u003c/em\u003e, and \u003cem\u003eLbDREB11\u003c/em\u003e were stably upregulated throughout all infection stages and exhibited statistically significant differences. Hence, these members may enhance broad-spectrum host resistance by enhancing the basal defense pathway.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe DREB family is derived from the AP2/EREBP superfamily. The AP2/EREBP family of transcription factors is unique to plants, and its members have a conserved DNA-binding domain\u0026mdash;the AP2/EREBP domain \u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e\u0026mdash;which is activated when plants are exposed to adverse stressors such as drought, high salinity, and low temperatures. This domain is able to bind specifically to the PUCCGAC-containing DRE/CRT cis-acting element, thereby activating expression of multiple downstream resistance genes \u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. In the present study, we screened for members of the DREB transcription factor family in \u003cem\u003eL. barbarum\u003c/em\u003e and analyzed the data on protein physicochemical properties, gene structure, phylogeny, collinearity, and expression patterns of the family members under \u003cem\u003eA. tenuis\u003c/em\u003e Nees infection.\u003c/p\u003e\u003cp\u003eA total of 16 DREB family transcription factors were downloaded and identified based on published data from the \u003cem\u003eL. barbarum\u003c/em\u003e whole-genome database, and were classified into six subgroups according to the \u003cem\u003eA. thaliana\u003c/em\u003e classification system \u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. However, the 16 LbDREB members only formed 4 subgroups, as no LbDREB members were found in subgroups A1 or A6. One possible reason was that because \u003cem\u003eL. barbarum\u003c/em\u003e is a relatively unique medicinal plant, these two subgroups were unable to adapt to environmental requirements. This could have resulted in their extinction or assimilation into other subgroups, ultimately enabling \u003cem\u003eL. barbarum\u003c/em\u003e to adapt to its unique growing environment and medicinal value over the long course of evolution. Nonetheless, subgroups A2, A3, A4, and A5 still showed some similarities with DREB subfamilies of other plants \u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. This suggested that the DREB gene was relatively well conserved during plant evolution and may fulfill the same function in different species. Systematic research on the evolutionary history and adaptive changes of the DREB family in \u003cem\u003eL. barbarum\u003c/em\u003e will facilitate a more comprehensive understanding of its stress resistance mechanism and medicinal value.\u003c/p\u003e\u003cp\u003eGene structural analysis revealed that the exon‒intron structure and promoter region of LbDREB genes contained a variety of cis-acting elements \u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. The structural diversity of LbDREB may be related to its function and evolution, while differences in exon‒intron structure may affect regulation as well as protein structure and function \u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. Genes with more exon‒intron structures may have complex expression regulation mechanisms, whereas genes with fewer exon‒intron structures may be more susceptible to environmental factors \u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. Cis-acting elements in the promoter region can determine gene expression patterns, causing the latter to function differently in different tissues or stress conditions \u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eFurthermore, conserved domain analysis revealed the presence of the characteristic AP2/EREBP domain in the LbDREB protein, which has a conserved binding sequence for DNA binding \u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e. This suggested that the LbDREB gene may bind to DNA with specific binding sequences and regulate expression of downstream genes involved in abiotic stress responses, such as high temperature, low temperature, and high salinity. The upregulation of DREB gene expression in \u003cem\u003eL. barbarum\u003c/em\u003e under abiotic stress may have been due to activation of specific transcription factors by stress signals. Hormonal signaling and biotic stressors such as diseases, pests, and weeds may also be involved in DREB gene regulation \u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eTherefore, in conjunction with the expression patterns, we hypothesized that LbDREB members may participate in the response to adversity via several mechanisms. First, they may directly activate expression of stress-resistance genes rich in DRE/CRT elements \u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Second, they may form a regulatory network with other transcription factors to coordinate multiple stress signaling pathways. In particular, some LbDREB genes were differentially expressed after leaf blight fungal infection, and hence may be involved in the response of \u003cem\u003eL. barbarum\u003c/em\u003e to biotic stressors. This may indirectly regulate the response to adversity through mechanisms, such as hormone signaling crosstalk, maintenance of reactive oxygen species homeostasis, and induction of disease resistance-related proteins, when subjected to stress \u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eBased on the results of comprehensive phylogenetic, gene structure, and expression pattern analyses, we predicted that the LbDREB genes in \u003cem\u003eL. barbarum\u003c/em\u003e may have been involved in regulating expression of downstream antiretroviral genes, interacting with transcription factors and participating in biological processes, such as growth and development \u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e. These functional predictions provide ideas for studying the specific targets of LbDREB genes. As a medicinal and edible plant, \u003cem\u003eL. barbarum\u003c/em\u003e has a wide range of applications \u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. Hence, studying the function and regulatory mechanism of the DREB gene family in \u003cem\u003eL. barbarum\u003c/em\u003e will provide new ideas and methods for improving its resistance and quality, while also offering a theoretical basis and genetic resources for subsequent research on resistance signal transduction against \u003cem\u003eLycium\u003c/em\u003e leaf blight and breeding for disease resistance.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets presented in this study are available in the NCBI GenBank repository, GenBank accession no. PX233497\u0026ndash;PX233512.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Talent Start-up Fund Project of Gansu Agricultural University (No. GAU-KYQD-2019-22) and Science and Technology Plan Project of Gansu Province (No. 25CXND001).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYahan Chen and Wenxu Wang designed this study and completed the test operation content, Wenxu Wang and Yi Zhou identified the DREB family members in the L. barbarum genome, Haitao Yu and Wei Liu analyzed expression patterns of family members under A. tenuis Nees infection. Yahan Chen and Wenxu Wang wrote the manuscript. All the authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKazuko Y, Kazuo S. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters[J]. Trends Plant Sci. 2005;10(2):88\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLIU X T, CHEN H J, CHENG SS, et al. Genome-wide identification of the WRKY gene family in \u003cem\u003eHydrangea macrophylla\u003c/em\u003e and expression analysis in response to leaf spot disease [J]. Acta Agriculturae Boreali-Sinica(AABS). 2025;40(01):93\u0026ndash;103.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSONG Y T, HAN L Q, MA K et al. Identification and expression characterization of the DREB transcription factor family in \u003cem\u003eJuglans regia\u003c/em\u003e [J]. Molecular Plant Breeding: 1\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYUE X X XIAOC, ZHANG Q W, et al. Identification and expression pattern analysis of the AP2/ERF gene family in \u003cem\u003eArtemisia argyi\u003c/em\u003e [J]. Acta Pharm Sinica. 2024;59(09):2634\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZUO Z F, LI Y L, WEI Y J, et al. Identification of the DREB gene family in \u003cem\u003eZoysia japonica\u003c/em\u003e and analysis of its expression patterns under abiotic stress [J]. Acta Prataculturae Sinica. 2025;34(05):74\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLI AJ, DAI F B, RAO S, P, et al. Cloning of \u003cem\u003eLrDREB1\u003c/em\u003e gene from \u003cem\u003eLycium ruthenicum\u003c/em\u003e and its expression analysis under abiotic stress [J]. Mol Plant Breed. 2020;18(07):2174\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLI K Y, ZHU HL. Research progress on DREB/CBF transcription factors in plant abiotic stress [J]. Volume 47. SCIENTIA SILVAE SINICAE; 2011. pp. 124\u0026ndash;34. 01.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSAKUMA Y, LIU Q. DUBOUZET J G, et al. DNA-Binding Specificity of the ERF/AP2 Domain of \u003cem\u003eArabidopsis DREBs\u003c/em\u003e, Transcription Factors Involved in Dehydration- and Cold-Inducible Gene Expression [J]. Volume 290. Biochemical and biophysical research communications; 2002. pp. 1998\u0026ndash;1009. 3.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDONDE R, GUPTA M K, GOUDA G, et al. Computational characterization of structural and functional roles of \u003cem\u003eDREB1A\u003c/em\u003e, \u003cem\u003eDREB1B\u003c/em\u003e and \u003cem\u003eDREB1C\u003c/em\u003e in enhancing cold tolerance in rice plant [J]. Amino Acids. 2019;51(5):839\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNICOLE F, DANIELE G, KERSTIN N, et al. DRE-1: An Evolutionarily Conserved F Box Protein that Regulates C. elegans Developmental Age [J]. Dev Cell. 2007;12(3):443\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDONG C, XI Y, CHEN X L, et al. Genome-wide identification of AP2/EREBP in Fragaria vesca and expression pattern analysis of the FvDREB subfamily under drought stress [J]. BMC Plant Biol. 2021;21(1):295\u0026ndash;295.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMAQSOOD H, MUNIR F, AMIR R, et al. Genome-wide identification, comprehensive characterization of transcription factors, cis-regulatory elements, protein homology, and protein interaction network of DREB gene family in Solanum lycopersicum [J]. Front Plant Sci. 2022;13:1031679\u0026ndash;1031679.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRUBIO S, NORIEGA X, P\u0026Eacute;REZ F J. Abscisic acid (ABA) and low temperatures synergistically increase the expression of CBF/DREB1 transcription factors and cold-hardiness in grapevine dormant buds [J]. Ann Botany. 2019;123(4):681\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNIU X, LUO T L, ZHAO H Y, et al. Identification of wheat DREB genes and functional characterization of \u003cem\u003eTaDREB3\u003c/em\u003e in response to abiotic stresses [J]. Gene. 2019;740:144514.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZHANG C X, ZHANG H B, LIN W P, et al. \u003cem\u003eZmDREB1A\u003c/em\u003e controls plant immunity via regulating salicylic acid metabolism in maize [J]. Plant J. 2025;121(2):e17226\u0026ndash;17226.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHU X, LIANG J X, WANG W J, et al. Comprehensive genome-wide analysis of the DREB gene family in Moso bamboo (\u003cem\u003ePhyllostachys edulis\u003c/em\u003e): evidence for the role of \u003cem\u003ePeDREB28\u003c/em\u003e in plant abiotic stress response [J]. Plant journal: cell Mol biology. 2023;116(5):1248\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNI Z Y, XU Z S, LI L C, et al. Research progress on the action mechanism and application of DREB transcription factors in Plant Stress Tolerance [J]. J Triticeae Crops. 2008;28(06):1100\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGONG H G, REHMAN F, MA Y, et al. Germplasm Resources and Strategy for Genetic Breeding of \u003cem\u003eLycium\u003c/em\u003e Species: A Review [J]. Front Plant Sci. 2022;13:802936\u0026ndash;802936.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYANG Z J, WU J L, NAN X X, et al. Genome-Wide identification and expression analysis of the LOX gene family in \u003cem\u003eLycium barbarum\u003c/em\u003e [J]. Jiangsu Agricultural Sci. 2025;53(04):83\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLIU W, ZHANG Q D, WANG D W et al. Symptomatology and pathogen identification of a new Leaf Blight Disease in \u003cem\u003eLycium barbarum\u003c/em\u003e [J]. North HOURTICULTURE, 2018(12): 141\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlternaria THOMMAB. from general saprophyte to specific parasite [J]. Mol Plant Pathol. 2003;4(4):225\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCHEN C, CHEN H, ZHANG Y, et al. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data [J]. Mol Plant. 2020;13(8):1194\u0026ndash;202.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCHAO Y T, YEN S H YENJH, et al. \u003cem\u003eOrchidstra\u003c/em\u003e 2.0-A Transcriptomics Resource for the \u003cem\u003eOrchid\u003c/em\u003e Family [J]. Plant Cell Physiol. 2017;58(1):e9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGOLDBERG T, HECHT M, HAMP T, et al. LocTree3 prediction of localization [J]. Nucleic Acids Res. 2014;42:W350\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXIE JM, CHEN Y, CAI GJ, et al. Tree Visualization By One Table (tvBOT): a web application for visualizing, modifying and annotating phylogenetic trees [J]. Nucleic acids research; 2023. p. 51.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHU Z A, LUO P, XIN JJ, et al. Genome-Wide Identification of DREB gene family and its expression analysis under abiotic stresses in \u003cem\u003ePhalaenopsis aphrodite\u003c/em\u003e [J]. Volume 32. JOURNAL OF AGRICULTURAL BIOTECHNOLOGY; 2024. pp. 1715\u0026ndash;28. 08.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFAN L Z, TONG X N, CHEN K, et al. Identification and characterization of the DREB gene family in \u003cem\u003eCitrus trifoliata\u003c/em\u003e and their response to abiotic stresses [J]. Jiangsu Agricultural Sci. 2024;52(15):53\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLIU C, MA L, LI Y, et al. Cloning and expression analysis of \u003cem\u003eHaDREB2A\u003c/em\u003e in \u003cem\u003eHaloxylon ammodendron\u003c/em\u003e [J]. Genomics Appl Biology. 2015;34(09):1928\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZHANG D F YUQ, SHI W J, et al. Screening of reference genes for Real-time Fluorescent Quantitative PCR in \u003cem\u003eLycium barbarum\u003c/em\u003e under different concentrations of Salt Stress [J]. J Shenyang Agricultural Univ. 2022;53(05):581\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLI ZL, WU Z Y, YE J et al. DREB-Type transcription factors and their research advances in application to plant abiotic stress tolerance genetic engineering improvement [J]. North HOURTICULTURE, 2010(20): 206\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eELSAYED N, SUN X H MOHAMEDE, et al. Overexpression of Citrus grandis \u003cem\u003eDREB\u003c/em\u003e gene in tomato affects fruit size and accumulation of primary metabolites [J]. Sci Hort. 2015;192:460\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNAKANO T, SUZUKI K, FUJIMURA T, et al. Genome-wide analysis of the ERF gene family in \u003cem\u003eArabidopsis\u003c/em\u003e and rice [J]. Plant Physiol. 2006;140(2):411\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLI X L, HE H H, WANG H, Han W et al. Identification and expression analysis of the AHL gene family in grape (\u003cem\u003eVitix vinifera\u003c/em\u003e) [J]. Plant Gene, 2021: 100285-23.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHUANG LL, LI J Z, ZHANG B, et al. Genome-Wide Identification and Expression Analysis of AMT Gene Family in Apple (\u003cem\u003eMalus domestica\u003c/em\u003e Borkh.) [J]. Horticulturae. 2022;8(5):457\u0026ndash;457.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHAN Y L, CAI M H, ZHANG S, Q, et al. Genome-Wide Identification of AP2/ERF Transcription Factor Family and Functional Analysis of DcAP2/ERF#96 Associated with Abiotic Stress in \u003cem\u003eDendrobium catenatum\u003c/em\u003e [J]. Int J Mol Sci. 2022;23(21):13603\u0026ndash;13603.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAKHTAR M, JAISWAL A, TAJ G, et al. DREB1/CBF transcription factors: their structure, function and role in abiotic stress tolerance in plants [J]. J Genet. 2012;91(3):385\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYANG W, LIU X D, CHI X J, et al. Dwarf apple \u003cem\u003eMbDREB1\u003c/em\u003e enhances plant tolerance to low temperature, drought, and salt stress via both ABA-dependent and ABA-independent pathways [J]. Planta. 2011;233(2):219\u0026ndash;29.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZHANG JH, JI H T, WANG M, et al. Variation in stress resistance and quality traits of \u003cem\u003eTriticum aestivum\u003c/em\u003e lines overexpressing DREB genes [J]. J Shanxi Agricultural Sci. 2013;41(10):1031\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFENG K, HOU X L, XING G M, et al. Advances in AP2/ERF super-family transcription factors in plant [J]. Crit Rev Biotechnol. 2020;40(6):750\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Lycium barbarum, DREB transcription factor, bioinformatics analysis, leaf blight, Alternaria tenuis Nees","lastPublishedDoi":"10.21203/rs.3.rs-7405611/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7405611/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eTo analyze the characteristics of members of the dehydration responsive element binding protein (DREB) transcription factor family in \u003cem\u003eLycium barbarum\u003c/em\u003e and their response patterns during \u003cem\u003eL. barbarum\u003c/em\u003e leaf blight stress, bioinformatics methods were used to conduct a genome-wide identification of the DREB family members in the \u003cem\u003eL. barbarum\u003c/em\u003e genome, and systematically analyze the physical and chemical characteristics of proteins, gene structures, phylogenetic evolution, collinearity, and expression patterns of family members under \u003cem\u003eAlternaria tenuis\u003c/em\u003e Nees infection.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eA total of 16 non-redundant LbDREB members were identified in the whole genome of \u003cem\u003eL. barbarum\u003c/em\u003e, all of which were hydrophilic proteins. They were unevenly distributed on 10 chromosomes of \u003cem\u003eL. barbarum\u003c/em\u003e, encoding 174‒503 amino acids, with a relative molecular mass from 19.29‒57.93 kDa and a theoretical isoelectric point from 4.61‒9.66. Phylogenetic analysis showed that the 16 genes could be divided into 6 subgroups (A1‒A6), all of which contained one AP2 conserved domain. Subcellular prediction showed that the vast majority of LbDREB members were located in the nucleus and cytoplasm, and a small number were located in the mitochondria. Sequence lengths of LbDREB members varied greatly, ranging from 348‒3530 bp, and seven pairs of collinear genes were detected. The ratios of non-synonymous mutations (Ka) to synonymous mutations (Ks) (Ka/Ks ratios) were all \u0026lt;\u0026thinsp;1, indicating that the LbDREB family tended to purify selection during evolution. The 16 LbDREB members showed significantly different expression characteristics at 0, 24, 48, 72, and 120 h after \u003cem\u003eL. barbarum\u003c/em\u003e leaf blight pathogen infection. The overall expression level was highest at 120 h of the infection period, and all 16 members are upregulated in expression.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003eThe results indicated that the LbDREB gene may play an important role in the response of \u003cem\u003eL. barbarum\u003c/em\u003e to leaf blight, and provide a reference for further clarification of the functional mechanism of the DREB transcription factor members in \u003cem\u003eL. barbarum\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"Genome identification of the DREB gene family in Lycium barbarum and expression analysis in response to leaf blight infection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-11 18:20:25","doi":"10.21203/rs.3.rs-7405611/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"434d832c-b7d2-4a97-816b-eed1d834843d","owner":[],"postedDate":"September 11th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-17T04:39:03+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-11 18:20:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7405611","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7405611","identity":"rs-7405611","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}