miR-6760-5p suppresses neoangiogenesis by targeting Yes-associated protein 1 in patients with moyamoya disease undergoing indirect revascularization | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article miR-6760-5p suppresses neoangiogenesis by targeting Yes-associated protein 1 in patients with moyamoya disease undergoing indirect revascularization Yunyu wen, junda chen, Tinghan Long, Fangzhou Chen, Zhibin Wang, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4523087/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective The aim of this research was to investigate the specific regulatory role of miR-6760-5p in angiogenesis in moyamoya disease. Methods HUVECs were transfected with miR-6760-5p inhibitor and mimics fragments, then subjected to assays for cell proliferation, migration, and tube formation. Subsequently, downstream target genes of miR-6760-5p were predicted and the protein expression levels of these genes were evaluated. The presence of miR-6760-5p and YAP1 was verified by a dual luciferase reporter gene test, followed by an assessment of the effects of YAP1 and miR-6760-5p on the HUVECs. Results Comparatively to the control group, increased expression of miR-6760-5p decreased cell growth, movement, and tube formation. YAP1 gene was discovered as a target controlled by miR-6760-5p, with subsequent investigation confirming YAP1 as a gene regulated by miR-6760-5p. Additionally, miR-6760-5p was found to counteract the angiogenesis-promoting effect of YAP1. Conclusion The results of this research suggest a possible link between the miR-6760-5p gene found in the cerebrospinal fluid of individuals with moyamoya disease and the process of vascularization in this particular condition. The findings indicate that miR-6760-5p may be a new molecular indicator and potential target for the diagnosis of moyamoya disease. Moyamoya disease Indirect revascularization Neovascularization MiR-6760-5p YAP1 Figures Figure 1 Figure 2 Figure 3 Introduction Moyamoya disease is a condition characterized by chronic progressive narrowing of the terminal segment of the internal carotid artery and the proximal segment of the middle cerebral artery. Following this narrowing, an abnormal collateral vascular network forms at the base of the skull, resembling smoke under DSA imaging. Suzuki and Takaku, Japanese scientists, coined the name 'moyamoya disease' in 1969. Moyamoya disease is most commonly seen in Asian and Southeast Asian countries such as China, Korea, and Japan, with a prevalence in Asia that is 4. 62 times higher than in Europe and the United States. The primary pathological foundations of moyamoya disease are ischemia resulting from stenosis and hemorrhage caused by the fragile anomalous vascular network4. During childhood, ischemia is the primary manifestation, whereas hemorrhage tends to be more prevalent in adults5. An abnormal vascular network located at the base of the skull is a key feature of moyamoya disease. However, the underlying mechanism responsible for the formation of this abnormal vascular network remains unknown. A variety of arteries, including the occipital artery, middle meningeal artery, superficial temporal artery, and ophthalmic artery, are thought to compensate for moyamoya disease. A study conducted by Liu et al. Showed a significant link between the impaired state of meningeal side vessels and the development of cerebral infarction in patients with moyamoya disease. Furthermore, a supplementary prospective cohort study conducted as part of the JAMs trial has indicated that choroidal vascular collateral anastomosis could potentially serve as a stand-alone predictor for re-bleeding in hemorrhagic MMD7. These perplexing findings serve to underscore the significance of comprehending the mechanisms governing neovascularization, thereby facilitating the formulation of enhanced therapeutic approaches for moyamoya disease. Cerebrospinal fluid acts as the environment for vascular activity in the brain, with miRNAs having the ability to control various biological processes. Angiogenesis regulation includes miRNAs directly interacting with target mRNA's 3' untranslated region, affecting their degradation. Several miRNAs have been identified as being crucial to angiogenesis. Liu et al. demonstrated that miR-15b and miR-106b regulate angiogenesis during heart attacks. Similarly, MiR-493 inhibits the formation of tubes and movement of rat brain micro-vascular endothelial cells by reducing MIF10. Yet, there is a lack of research examining how miRNAs regulate angiogenesis in MMD. Therefore, according to our previous research, Patients with moyamoya disease had elevated levels of miR-6760-5p in their cerebrospinal fluid. Following this, the HUVEC cell model was utilized to investigate the function and underlying mechanism of the potential miRNA, miRNA-6760-5p, in controlling angiogenesis. The results of the research suggest that miRNA-6760-5p shows potential as a future treatment option for MMD. Materials and Methods Ethics statement Study protocol approval was granted by the Ethics Committee of Nanfang Hospital of Southern Medical University. Written informed consent was obtained from all study participants. The MMD group consisted of patients diagnosed with moyamoya disease who required intracranial-extracranial bypass surgery. The control group comprised patients who required lumbar anesthesia for trauma-induced lower limb fracture, varicose veins of the lower limb, and knee joint pathology. Cranial computed tomography (CT) was employed to rule out the presence of intracranial lesions in the patients, who were also queried about their medical history pertaining to intracranial-related ailments such as dizziness, headache, and cerebrovascular accidents. Between October 2017 and December 2018, 20 individuals from the MMD group and 16 individuals from the control group were enrolled and selected from the Southern Hospital of Southern Medical University. During intracranial extracranial bypass surgery for Moyamoya disease (MMD), the dura mater is surgically incised, followed by the extraction of cerebrospinal fluid (CSF), with utmost caution to prevent any blood contamination within the subarachnoid space. In the control group, lumbar puncture was performed to collect interstitial cerebrospinal fluid from the L3/L4 or L4/L5 region. Using reverse transcription-quantitative polymerase chain reaction and microarray analysis to compare miRNA expression Shanghai Boho Biotechnology Co conducted the microarray analysis. We isolated total RNA from 250 liters of CSF using TRIZOL reagent in a sterile environment. The miRNA was isolated from the CSF samples (250 µl) using the Mir-XTM miRNA qRT-PCR TB GreenTM kit (Takara Reagent, Inc., Japan). Following the manufacturer's guidelines, the cDNA was synthesized using the Quant-Studio 5 instrument from Thermo Fisher Scientific at 37°C for 15 minutes, 85°C for 5 seconds, and then held at 4°C. The PCR reaction for fluorescence quantification was carried out under the following conditions: initial denaturation at 95 ℃ for 10 seconds, followed by 40 cycles at 95 ̊℃ for 5 seconds, 60 ̊℃ for 20 seconds, and then 95 ̊℃ for 60 seconds, 55 ̊℃ for 30 seconds, and 95 ̊ °C for 30 seconds. The following primers were used: hsa-miR-574-5p, (F) TGAGTGTGTGTGTGTGTGAGTGTGTGT; hsa-miR-3679-5p, (F) TGAGGATATGGCAGGGAAGGGGA; hsa-miR-6124, (F) GGGAAAAGGAAGGGGGAGGA; hsa-miR-6165, (F) CAGCAGGAGGTGAGGGGAG; hsa-miR-6760-5p, (F) CAGGGAGAAGGTGGAAGTGCAGA; U6, (F) GGAACGATACAGAGAAGATTAGC; U6, (R) TGGAACGCTTCACGAATTTGCG. miRNA expression was quantified using the gene expression level formula F = 2-ΔΔCt method. Cell culture and Cell transfection HUVECs were sourced from the Chinese Academy of Sciences in Shanghai, China, and 293T cells were obtained from ATCC in the USA. The two cell varieties were grown in DMEM with 10% FBS from Gibco, USA, at 37°C in a humid incubator with 5% CO2. Umine biotechnology Co., LTD. (Guangzhou, China) synthesized the hsa-miR-6760-5p mimic, hsa-miR-6760-5p inhibitor, and negative controls (NC). Umine Biotechnology Co., LTD. (Guangzhou, China) produced the YAP1 siRNA, overexpression plasmid, and vector plasmid. The oligonucleotide sequences can be found in Table S1 . Lipofectamine 2000 reagent (Life Technologies, USA) was used to transfect these oligonucleotides into HUVECs, following the manufacturer's instructions. In vitro tube formation assay Matrigel from Corning in the USA was thawed overnight at 4°C, and a 96-well plate and pipette tips were pre-chilled for preparation. Next, 50 microliters of Matrigel was added to every well in the 96-well plate and left to incubate at 37 degrees Celsius for half an hour. Each experiment was conducted in technical triplicate. Transfected HUVECs were harvested 48 hours post-transfection, resuspended in a complete culture medium containing 10% FBS, and cell counting was performed. 15,000 cells were evenly distributed into separate wells containing 100 µl of complete culture medium with 10% FBS, then incubated at 37°C for 6 hours. In our study, tubular structures were visualized using a Japanese light microscope camera manufactured by Olympus. The collected information was analyzed using the Angiogenesis Analyzer plugin in the Image J program. Transwell assay HUVECs that had undergone transfection were gathered 48 hours post-transfection for the transwell test. Afterward, the HUVECs were suspended in Dulbecco's modified Eagle's medium lacking fetal bovine serum and quantified. In the upper chamber, there were 10,000 cells in 200 µl of DMEM. 600 µl of whole culture with 10% FBS was added as a chemoattractant in the bottom chamber. Following a 12-hour incubation period at 37°C, the cells in the top chamber were eliminated with cotton swabs. Using an Olympus light microscope, the cells that moved to the bottom of the membrane were counted 30 minutes after fixation with 4% paraformaldehyde and staining with 0. 1% crystal violet. Assay using Cell Counting Kit-8 For the CCK-8 test, 2 × 103 HUVECs were placed in 96-well dishes and left to incubate for 1, 2, 3, 4, 5, 6, or 7 days. Following this, the cells were exposed to CCK-8 solution in medium without serum for 2 hours, and absorbance readings were then recorded at 450 nm. The resulting data yielded statistically significant CCK-8 value-added curves. Bioinformatics We selected miR-6760-5p's target gene using TargetScan ( www.targetscan.org/ ) and miRBase ( www.mirdb.org/ ). Western blotting analysis BCA Protein Assay Kit (Solarbio Life Sciences, PC0020; Beijing, China) was used for protein concentration determination after cell lysis using RIPA Buffer (Sigma, R0278). The samples were separated by SDS-PAGE at 80 V for two hours, A PVDF membrane (Millipore, IPVH00010; Billerica, MA, USA) was then applied at 320 mA for 100 minutes. The membranes were then obstructed for an hour using 5% BSA (Solarbio Life Sciences, A8020) in 0. 1% Tween-20 (Sigma, P9416). After this, the membranes were incubated overnight with primary antibodies at 4°C. Next, the samples were incubated with Cell Signaling Technology's secondary antibodies labeled with HRP in Danvers, MA, USA, At room temperature for 1 hour. With the Tanon-5500 Chemiluminescent Imaging System from Tanon Science & Technology in Shanghai, China, immunoreactive bands were visualized using Immobilon ECL Ultra Western HRP Substrate (WBULS0500). The antibodies used in this study, including anti-AKT(A16343), anti-HEY2(A15143), anti-Phospho-AKT(AP0637), anti-Phospho-PI3K(AP0854), anti-YAP1(A1001), anti-FOXF1(A13017), and anti-NOTCH1 (A19090), were acquired from Abclonal (Wuhan, China). CST (MA, USA) provided the antibodies anti-Smad2/3(#8685), anti-Phospho-Smad2/3(#8828), and anti-ERK(#9102). The antibody anti-PI3K(67071-1-Ig) was obtained from PTG (Wuhan, China). Lastly, the antibodies anti-MAPK(ab185145), anti-P38(ab170090), and anti-Phospho-P38(ab4822) were acquired from Abcam (MA, USA). Dual Luciferase Assay Umine biotechnology Co., LTD. (Guangzhou, China) created the pmirGLO vector without insert, pmirGLO-YAP1 mut, and pmirGLO-YAP1 wt constructs. Following the transfection with Lipofectamine 2000 transfection agent, matching plasmids were introduced into 293T cells. Using the Luciferase Reporter System from Promega in Madison, WI, USA, we measured the levels of luciferase after 48 hours. Statistical analysis Mean ± standard deviation (mean ± SD) from four separate experiments were reported, with differences among groups determined using one-way ANOVA in SPSS 24. 0. A significance level of p < 0. 05 was considered significant. Results 3. 1MiR-6760-5p inhibits proliferation, tube formation and migration of HUVECs Our previous research revealed an elevation in miR-6760-5p levels in the cerebrospinal fluid of moyamoya disease patients, suggesting its potential as a useful diagnostic tool for this condition. This research utilized HUVEC cells transfected with miR-6760-5p mimics and inhibitor to investigate the role of miR-6760-5p in cellular proliferation, migration, and tubular angiogenesis. During the transwell migration experiment, it was noted that the increased expression of miR-6760-5p (mimics) led to a significant decrease in the quantity of cells crossing the barrier, in contrast to the control group (NC). On the other hand, blocking miR-6760-5p resulted in a notable rise in the quantity of cells passing through the barrier, when compared to the control group (NC) (Fig. 1 B). The tube formation test showed a decrease in the amount of There was an increase in the number of HUVECs cells forming tubes in the miR-6760-5p inhibitor group compared to the miR-6760-5p mimics group (Fig. 1 C). Compared with the normal control (NC), the overexpression (mimics) of miR-6760-5p resulted in a notable decrease in proliferation rate and number of HUVEC cells in the CCK8 proliferation assay. Comparing the HUVEC cells to the standard control (NC), blocking miR-6760-5p resulted in an increase in growth rate and quantity (Fig. 1 D). The findings indicate that miR-6760-5p can inhibit the growth, creation of tubes, and movement of HUVEC cells. 3. 2The miR-6760-5p directly targets YAP1 The prediction results of TargetScan and miRDB website for miR-6760-5p can be imported into Venn diagram construction website to derive the intersection of the two, and it was found that the validation of the two websites for the target genes had 646 genes in the intersection (Fig. We examined 646 genes in the GO and KEGG pathway analysis on the DAVID platform. Following the analysis, we identified 4 angiogenesis-related genes: YAP1, FOXF1, HEY2, and TIPARP. A WB validation of these genes revealed that miR-6760-5p mimics suppressed YAP1 expression, whereas miR-6760-5p inhibitors enhanced it. These findings indicate that YAP1 could be a promising target for miR-6760-5p. We visited the TargetScan website (http // www.targetscan.org/ ) for miRNA binding site prediction analysis (Fig. 2 C), discovering that miR-6760-5p binds to YAP1 at the 1240–1246 gene locus in the 3'UTR region. 1246 genetic location within the 3' untranslated region of YAP1. Based on the YAP1 sequence, we created two plasmids representing the wild-type (YAP1 wt) and mutant (YAP1 mut) versions, as shown in the figure. 2D), and the empty expression vector chosen was pmirGLO (Fig. 2 E), and then we inserted the fragments of YAP1 wt and YAP1 mut into this expression vector, and the structure of the constructed plasmids is shown in Fig. 2 F. The double luciferase reporter gene experiments were performed according to the grouping in Exhibit 1. In dual luciferase reporter gene experiments (Fig. 2 G), YAP1 fluorescence expression was significantly decreased after simultaneous transfection of YAP1 wt and overexpression of miR-6760-5p. Thus, through the dual-luciferase reporter gene assay, we have established that miR-6760-5p can bind to the 3'-UTR region of YAP1 and influence the expression of YAP1. 3. 3In vitro, YAP1 counteracts the regulatory impact of miR-6760-5p on angiogenesis. HUVEC were divided into 5 groups according to Supplementary Table 2, which were control group, YAP1 oe group, YAP1 siRNA group, YAP1 oe + miR-6760-5p group, and YAP1 siRNA + miR-6760-5p group. HUVEC were subjected to treatment to confirm their functions in proliferation, migration, and tube formation. Additionally, cell proteins were collected for WB assay 48 hours post-treatment. The WB analysis revealed that the expression of YAP1 did not show a significant difference compared to the control group (NC) after miR-6760-5p overexpression followed by YAP1 plasmid transfection, but was elevated compared to the group with miR-6760-5p overexpression alone. In the 6760-5p group, the levels of YAP1 expression were comparable to those in the control group (NC). Following the introduction of YAP1 siRNA into the cells, the level of YAP1 expression decreased notably compared to the normal control group (NC), and was even lower than the expression in the miR-6760-5p overexpression group alone (Fig. 5a). This result suggests that miR-6760-5p can interfere with the expression of YAP1. The tube-forming assay results showed that when miR-6760-5p was overexpressed and YAP1 overexpression plasmid was transfected into the cells, there was no notable change in the cells' tube-forming capacity compared to the control group (NC). Compared to cells overexpressed with miR-6760-5p alone, tube-forming ability was significantly improved, indicating a clear recovery. Following the introduction of YAP1 siRNA into the cells, there was a notable decrease in their capacity to form tubes in comparison to the normal control group (NC). Additionally, the tube-forming ability of the cells was absent, showing a significant reduction when compared to the pure overexpression group (miR-6760-5p) (Fig. 5b). This result suggests that YAP1 can restore the effect of miR-6760-5p on the tube-forming ability of cells. Results of the Transwell cell migration assay showed that co-overexpression of miR-6760-5p and YAP1 overexpression plasmids did not significantly affect cell migration ability. As compared to cells overexpressing miR-6760-5p alone, there was a notable increase in cell migration ability. Transfection of YAP1 siRNA into cells resulted in a notable decrease in cell migration ability compared to the normal control group (NC) and the miR-6760-5p overexpression group (Fig. 5c). This result suggests that YAP1 can restore the effect of miR-6760-5p on cell migration. The findings indicate that the miR-6760-5p /YAP1 connection could have a significant impact on controlling angiogenesis in HUVECs. Discussion The precise pathogenesis of moyamoya disease remains elusive, and the etiology of this condition is notably intricate. Presently, both domestic and international researchers and scholars predominantly posit that the pathogenesis is intertwined with genetic factors, vascular factors, and immuno-inflammatory factors12. TThe formation of abnormal vascular networks at the base of the skull is a hallmark of Moyamoya disease, but the exact mechanisms underlying their formation and disappearance remain unclear. In 2021, a comprehensive review examined the impact of diverse growth factors, circulating progenitor cells, neovascularization-associated cytokines, and inflammatory mediators on angiogenesis in moyamoya disease13. The exact connection between these elements, contributes to the development of moyamoya disease, and the compensatory collateral blood vessel inflammation and response to reduced blood flow is still unknown. Therefore, additional research is needed to determine any possible link between genetic mutations, epigenetic factors, and abnormal formation of new blood vessels in this specific situation. MicroRNAs (mirRNAs), small non-coding RNA molecules with 20–22 nucleotides, play a crucial role in regulating diverse biological processes in multicellular organisms, particularly mammals. During physiological conditions, miRNAs play a vital role in safeguarding essential biological processes like cell proliferation, differentiation, and apoptosis14,15. MiRNAs are also involved in the development of cancer, neurological disorders, autoimmune diseases, metabolic diseases, and cardiovascular diseases. Several studies have explored miRNAs' effects on angiogenesis, revealing their ability to promote or inhibit blood vessel formation. Notably, miR-9, a widely studied miRNA, has been identified by Ma et al. as a promoter of vascular endothelial growth factor (VEGF) production, thereby facilitating angiogenesis23. In contrast, Poliseno et al. In 2010, it was found that miR-222 had a notable inhibitory impact on both the scratch test and tube creation test. Moreover, it up-regulated the negative regulation of angiogenesis by down-regulating the expression of ZEB2 GAX, a known negative regulator of angiogenesis. This down-regulation of ZEB2 expression effectively hindered the angiogenesis process24. The RNF213 gene, frequently linked to familial cases, is commonly referred to as a susceptibility gene for MMD. However, certain researchers have conducted a comparative analysis of serum miRNAs in individuals with moyamoya disease and healthy individuals. Their findings indicate that abnormal serum microRNAs (miRNAs) are linked to mutations in the RNF213 gene in cases of MMD25. Suzuki et al. conducted a study. in 2017, it was observed that miR-1911-5p exhibited expression in cerebrospinal fluid, whereas its presence remained undetectable in serum. These findings suggest that brain tissue serves as the primary origin of miRNAs in cerebrospinal fluid. Furthermore, Suzuki et al. demonstrated in their research that miRNAs present in cerebrospinal fluid actively contribute to pathophysiological mechanisms within the central nervous system26. Signaling pathways such as VEGF-VEGFR, Notch, PI3K-AKT, and Smad 2/3 control angiogenesis. The intricate nature of angiogenic regulation suggests that any component of these pathways may influence angiogenesis, and there may exist additional, as yet unidentified pathways that also play a role in this process. According to prior research, individuals with moyamoya disease have higher miR-6760-5p expression in their cerebrospinal fluid, indicating its potential as a diagnostic tool for this condition. Consequently, we conducted in vitro experiments to further authenticate the role of miR-6760-5p. Through a series of in vitro functional experiments, the overexpression of miR-6760-5p inhibited angiogenesis, whereas the inhibition of miR-6760-5p promoted it. Following bioinformatics analysis, we successfully identified the downstream genes associated with miR-6760-5p. Following Western Blot protein immunoblotting tests, it was discovered that YAP1 may be the gene targeted by miR-6760-5p. Using the dual-luciferase reporter gene assay, we definitively verified YAP1 as the specific gene targeted by miR-6760-5p. Subsequently, cellular co-disturbance involving YAP1 and miR-6760-5p was conducted, followed by retrospective experiments. The findings showed that by introducing YAP1, the angiogenic capabilities were partially restored in the presence of miR-6760-5p overexpression, which differed from when only miR-6760-5p was overexpressed. Based on the findings and outcomes of the aforementioned series of experiments, it can be ascertained that miR-6760-5p possesses the capability to modulate angiogenesis by regulating the expression of YAP1, a pivotal signaling molecule within the Hippo signaling pathway. The functionality of miR-6760-5p has received limited investigation, and our study addresses this research gap. Moreover, our findings, which integrate the roles of miRNAs and YAP1 in the angiogenesis process, represent an unprecedented contribution to the field. The potential association between YAP1 and angiogenesis suggests that the future development of pharmacological agents targeting YAP1 activation or inhibition may offer valuable insights and strategies for addressing moyamoya disease and other conditions within the realm of regenerative medicine. By modulating YAP1 and miR-6760-5p, as evidenced by the results of this investigation, it may be possible to impede the advancement of moyamoya disease. Naturally, our study does possess limitations. Owing to time constraints, we were unable to conduct in vivo experiments for validation. However, if animal experimental validation were to yield results consistent with those obtained from in vitro experiments, the credibility of this study would be enhanced. Conclusion This study confirms the role of miR-6760-5p in modulating YAP1 production in moyamoya disease. As a result of these results, miR-6760-5p could be a valuable biomarker and target for the diagnosis and management of moyamoya disease. Declarations Research Funding Grants for this project were provided by the Guangdong Basic and Applied Basic Research Foundation (No. 2020A1515110695) and the President Foundation of Nanfang Hospital, Southern Medical University (No. 2020C035, No. 2023B037). Conflict of Interest This research was conducted without any commercial or financial relationships that could be construed as potential conflicts of interest. Author Contribution Wenfeng Feng and Gang Wang designed the project. Yunyu Wen and Junda Chen performed the experiments and drafted the manuscript. Siyuan Chen, Tinghan Long, Fangzhou Chen and Zhibin Wang assisted with the experimental and data analysis. Wenfeng Feng and Gang Wang revised the manuscript critically. All authors contributed to the article and approved the submitted version. Data Availability Statement The authors confirm that the data supporting the findings of this study are available within the article and its supplementary materials. References Scott RM, Smith ER (2009) Moyamoya disease and moyamoya syndrome[J]. N Engl JMed 360(12):1226–1237 Suzuki J, Takaku A (1969) Cerebrovascular moyamoya disease. Disease showing abnormal net-like vessels in base of brain. Arch Neurol. ;20(3):288 – 99. doi: 10. 1001/archneur. 1969. 00480090076012. PMID: 5775283 Goto Y, Yonekawa Y (1992) Worldwide distribution of moyamoya disease. Neurol Med Chir (Tokyo). ;32(12):883-6. doi: 10. 2176/nmc. 32. 883. PMID: 1282678 Chen T, Wei W, Yu J, Xu S, Zhang J, Li X, Chen J (2023) The Progression of Pathophysiology of Moyamoya Disease. Neurosurgery 93(3):502–509 doi: 10. 1227/neu. 0000000000002455. Epub 2023 Mar 14. PMID: 36912514 SPollak L (2009) Moyamoya disease and moyamoya syndrome. N Engl J Med. ;361(1):98; author reply 98. PMID: 19579282 Liu ZW, Han C, Wang H, Zhang Q, Li SJ, Bao XY, Zhang ZS, Duan L (2020) Clinical characteristics and leptomeningeal collateral status in pediatric and adult patients with ischemic moyamoya disease. CNS Neurosci Ther. ;26(1):14–20. doi: 10. 1111/cns. 13130. Epub 2019 Apr 13. PMID: 31875482; PMCID: PMC6930821 Funaki T, Takahashi JC, Houkin K, Kuroda S, Takeuchi S, Fujimura M, Tomata Y, Miyamoto S (2019) High rebleeding risk associated with choroidal collateral vessels in hemorrhagic moyamoya disease: analysis of a nonsurgical cohort in the Japan Adult Moyamoya Trial. J Neurosurg 130(2):525–530 doi: 10. 3171/2017. 9. JNS17576. Epub 2018 Mar 2. PMID: 29498573 Rupaimoole R, Slack FJ (2017) Nat Rev Drug Discovery 16:203 liu Z, Yang d, Xie P, ren G, Sun G, Zeng X, Sun X (2012) Mir-106b and Mir-15b modulate apoptosis and angiogenesis in myocardial infarction. Cell Physiol Biochem 29:851–862 Li Q, He Q, Baral S, Mao L, Li Y, Jin H, Chen S, An T, Xia Y, Hu B (2016) MicroRNA–493 regulates angiogenesis in a rat model of ischemic stroke by targeting MIF. FEBS J 283:1720–1733 Wang G, Wen Y, Faleti OD, Zhao Q, Liu J, Zhang G, Li M, Qi S, Feng W, Lyu X (2020) A Panel of Exosome-Derived miRNAs of Cerebrospinal Fluid for the Diagnosis of Moyamoya Disease. Front Neurosci. ;14:548278. doi: 10. 3389/fnins. 2020. 548278. PMID: 33100957; PMCID: PMC7546773 Asselman C, Hemelsoet D, Eggermont D, Dermaut B, Impens F (2022) Moyamoya disease emerging as an immune-related angiopathy. Trends Mol Med. ;28(11):939–950. doi: 10. 1016/j. molmed. 2022. 08. 009. Epub 2022 Sep 14. PMID: 36115805 Fang YC, Wei LF, Hu CJ, Tu YK (2021) Pathological Circulating Factors in Moyamoya Disease. Int J Mol Sci. ;22(4):1696. doi: 10. 3390/ijms22041696. PMID: 33567654; PMCID: PMC7915927 Treiber T, Treiber N, Meister G (2019) Regulation of microRNA biogenesis and its crosstalk with other cellular pathways. Nat Rev Mol Cell Biol. ;20(1):5–20. doi: 10. 1038/s41580-018-0059-1. Erratum in: Nat Rev Mol Cell Biol. 2018;19(12):808. Erratum in: Nat Rev Mol Cell Biol. 2019;20(5):321. PMID: 30228348 Gebert LFR, MacRae IJ (2019) Regulation of microRNA function in animals. Nat Rev Mol Cell Biol 20(1):21–37. 10. 1038/s41580-018-0045-7. PMID: 30108335; PMCID: PMC6546304 Esquela-Kerscher A, Slack FJ (2006) Oncomirs - microRNAs with a role in cancer. Nat Rev Cancer. ;6(4):259 – 69. doi: 10. 1038/nrc1840. PMID: 16557279 Azam Z, Quillien V, Wang G, To ST (2019) The potential diagnostic and prognostic role of extracellular vesicles in glioma: current status and future perspectives. Acta Oncol. ;58(3):353–362. doi: 10. 1080/0284186X. 2018. 1551621. Epub 2019 Jan 11. PMID: 30632857 Kir D, Schnettler E, Modi S, Ramakrishnan S (2018) Regulation of angiogenesis by microRNAs in cardiovascular diseases. Angiogenesis. ;21(4):699–710. doi: 10. 1007/s10456-018-9632-7. Epub 2018 Jun 28. PMID: 29956018 Van Meter EN, Onyango JA, Teske KA (2020) A review of currently identified small molecule modulators of microRNA function. Eur J Med Chem. ;188:112008. doi: 10. 1016/j. ejmech. 2019. 112008. Epub 2019 Dec 23. PMID: 31931338 Wang R, Zhang H, Ding W, Fan Z, Ji B, Ding C, Ji F, Tang H (2020) miR-143 promotes angiogenesis and osteoblast differentiation by targeting HDAC7. Cell Death Dis 11(3):179. 10. 1038/s41419-020-2377-4. PMID: 32152265; PMCID: PMC7062786 Zeng Z, Li Y, Pan Y, Lan X, Song F, Sun J, Zhou K, Liu X, Ren X, Wang F, Hu J, Zhu X, Yang W, Liao W, Li G, Ding Y, Liang L (2018) Cancer-derived exosomal miR-25-3p promotes pre-metastatic niche formation by inducing vascular permeability and angiogenesis. Nat Commun 9(1):5395. 10. 1038/s41467-018-07810-w. PMID: 30568162; PMCID: PMC6300604 Fiedler J, Thum T (2016) New Insights Into miR-17-92 Cluster Regulation and Angiogenesis. Circ Res 118(1):9–11 doi: 10. 1161/CIRCRESAHA. 115. 307935. PMID: 26837738 Ma L, Young J, Prabhala H, Pan E, Mestdagh P, Muth D, Teruya-Feldstein J, Reinhardt F, Onder TT, Valastyan S, Westermann F, Speleman F, Vandesompele J, Weinberg RA (2010) miR-9, a MYC/MYCN-activated microRNA, regulates E-cadherin and cancer metastasis. Nat Cell Biol. ;12(3):247 – 56. doi: 10. 1038/ncb2024. Epub 2010 Feb 21. PMID: 20173740; PMCID: PMC2845545 Poliseno L, Tuccoli A, Mariani L, Evangelista M, Citti L, Woods K, Mercatanti A, Hammond S, Rainaldi G (2006) MicroRNAs modulate the angiogenic properties of HUVECs. Blood. ;108(9):3068-71. doi: 10. 1182/blood-2006-01-012369. Epub 2006 Jul 18. PMID: 16849646 Dai D, Lu Q, Huang Q, Yang P, Hong B, Xu Y, Zhao W, Liu J, Li Q (2014) Serum miRNA signature in Moyamoya disease. PLoS ONE 9(8):e102382 : 10. 1371/journal. pone. 0102382. PMID: 25093848; PMCID: PMC4122349 Yagi Y, Ohkubo T, Kawaji H, Machida A, Miyata H, Goda S, Roy S, Hayashizaki Y, Suzuki H, Yokota T (2017) Next-generation sequencing-based small RNA profiling of cerebrospinal fluid exosomes. Neurosci Lett. ;636:48–57. doi: 10. 1016/j. neulet. 2016. 10. 042. Epub 2016 Oct 22. PMID: 27780738 Grothey A, Galanis E (2009) Targeting angiogenesis: progress with anti-VEGF treatment with large molecules. Nat Rev Clin Oncol. ;6(9):507 – 18. doi: 10. 1038/nrclinonc. 2009. 110. Epub 2009 Jul 28. PMID: 19636328 Körbel C, Gerstner MD, Menger MD, Laschke MW (2018) Notch signaling controls sprouting angiogenesis of endometriotic lesions. Angiogenesis. ;21(1):37–46. doi: 10. 1007/s10456-017-9580-7. Epub 2017 Oct 9. PMID: 28993956 Wang L, Feng Y, Xie X, Wu H, Su XN, Qi J, Xin W, Gao L, Zhang Y, Shah VH, Zhu Q (2019) Neuropilin-1 aggravates liver cirrhosis by promoting angiogenesis via VEGFR2-dependent PI3K/Akt pathway in hepatic sinusoidal endothelial cells. EBioMedicine. ;43:525–536. doi: 10. 1016/j. ebiom. 2019. 04. 050. Epub 2019 May 3. PMID: 31060904; PMCID: PMC6558257 Itoh F, Itoh S, Adachi T, Ichikawa K, Matsumura Y, Takagi T, Festing M, Watanabe T, Weinstein M, Karlsson S, Kato M (2012) Smad2/Smad3 in endothelium is indispensable for vascular stability via S1PR1 and N-cadherin expressions. Blood. ;119(22):5320-8. doi: 10. 1182/blood-2011-12-395772. Epub 2012 Apr 12. PMID: 22498737; PMCID: PMC3628112 Additional Declarations No competing interests reported. Supplementary Files Supplementarytable1.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4523087","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":310392203,"identity":"b5b18e7a-32d7-4b22-a9fb-6262f0c8ed27","order_by":0,"name":"Yunyu wen","email":"","orcid":"","institution":"Nanfang Hospital, Southern Medical University,the department of neurosurgery","correspondingAuthor":false,"prefix":"","firstName":"Yunyu","middleName":"","lastName":"wen","suffix":""},{"id":310392204,"identity":"0a59e1aa-9970-43f5-98f4-6ca0430ac8f7","order_by":1,"name":"junda chen","email":"","orcid":"","institution":"Nanfang Hospital, Southern Medical University,the department of neurosurgery","correspondingAuthor":false,"prefix":"","firstName":"junda","middleName":"","lastName":"chen","suffix":""},{"id":310392205,"identity":"16ad23f7-763b-40ba-b77c-b8c166695491","order_by":2,"name":"Tinghan Long","email":"","orcid":"","institution":"Nanfang Hospital, Southern Medical University,the department of neurosurgery","correspondingAuthor":false,"prefix":"","firstName":"Tinghan","middleName":"","lastName":"Long","suffix":""},{"id":310392206,"identity":"dd149dd8-8199-4b69-a40d-feb8d7e61d73","order_by":3,"name":"Fangzhou Chen","email":"","orcid":"","institution":"Nanfang Hospital, Southern Medical University,the department of neurosurgery","correspondingAuthor":false,"prefix":"","firstName":"Fangzhou","middleName":"","lastName":"Chen","suffix":""},{"id":310392207,"identity":"32821310-0639-48c2-9a0e-fd17d93779ef","order_by":4,"name":"Zhibin Wang","email":"","orcid":"","institution":"Nanfang Hospital, Southern Medical University,the department of neurosurgery","correspondingAuthor":false,"prefix":"","firstName":"Zhibin","middleName":"","lastName":"Wang","suffix":""},{"id":310392208,"identity":"10dd6be2-8c52-4aa4-afa3-e7be3ab90ff8","order_by":5,"name":"Siyuan Chen","email":"","orcid":"","institution":"Nanfang Hospital, Southern Medical University,the department of neurosurgery","correspondingAuthor":false,"prefix":"","firstName":"Siyuan","middleName":"","lastName":"Chen","suffix":""},{"id":310392209,"identity":"98158f63-7c26-4080-a744-f7c9609b2b12","order_by":6,"name":"Guozhong Zhang","email":"","orcid":"","institution":"Nanfang Hospital, Southern Medical University,the department of neurosurgery","correspondingAuthor":false,"prefix":"","firstName":"Guozhong","middleName":"","lastName":"Zhang","suffix":""},{"id":310392210,"identity":"0a9584f5-3e9d-45f4-b395-899760dc69f1","order_by":7,"name":"Mingzhou Li","email":"","orcid":"","institution":"Nanfang Hospital, Southern Medical University,the department of neurosurgery","correspondingAuthor":false,"prefix":"","firstName":"Mingzhou","middleName":"","lastName":"Li","suffix":""},{"id":310392211,"identity":"36f80abc-5b9b-495e-ac51-1ba13274f575","order_by":8,"name":"Shichao Zhang","email":"","orcid":"","institution":"Nanfang Hospital, Southern Medical University,the department of neurosurgery","correspondingAuthor":false,"prefix":"","firstName":"Shichao","middleName":"","lastName":"Zhang","suffix":""},{"id":310392212,"identity":"6aaec238-baa4-45c4-b7e9-e4ce66cfcda3","order_by":9,"name":"Huibin Kang","email":"","orcid":"","institution":"Nanfang Hospital, Southern Medical University,the department of neurosurgery","correspondingAuthor":false,"prefix":"","firstName":"Huibin","middleName":"","lastName":"Kang","suffix":""},{"id":310392213,"identity":"41d9336c-cd12-40bb-ad61-7763fb74aaaf","order_by":10,"name":"Wenfeng Feng","email":"","orcid":"","institution":"Nanfang Hospital, Southern Medical University,the department of neurosurgery","correspondingAuthor":false,"prefix":"","firstName":"Wenfeng","middleName":"","lastName":"Feng","suffix":""},{"id":310392214,"identity":"446c1d44-ab9a-4711-9dce-fdac6d4a4e28","order_by":11,"name":"Gang Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA10lEQVRIiWNgGAWjYHACxgcMDDYQJg+RWpgNGBjSSNPCJsHAcJgELfyz2y9I8/w6b687I4Hxwds2BnlzQlok7pwpMObtu5247UYCs+HcNgbDnQ2E9NzISUjO7bmdYHYjgU2at40hweAAAR3yQC2Hc3vO2QO1sP8mSovBjfSDzTk/DjACHcbGTJQWwxs5zMx/G5ITt5152Cw555yE4QZCWuRupD//OeOPnb3Z8eSDH96U2cgTtAUYFwYMjG0gBmMDkJAgqB4I2B8wMPwhRuEoGAWjYBSMWAAAA7ZFC/iyZLwAAAAASUVORK5CYII=","orcid":"","institution":"Nanfang Hospital, Southern Medical University,the department of neurosurgery","correspondingAuthor":true,"prefix":"","firstName":"Gang","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-06-03 16:09:45","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4523087/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4523087/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":58760564,"identity":"ba69c28f-b834-4250-ae74-6dba930e9db9","added_by":"auto","created_at":"2024-06-20 18:50:43","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3649694,"visible":true,"origin":"","legend":"\u003cp\u003eThe results of the cell function experiments indicate successful transfection of inhibitor and mimic fragments into HUVECs(A), with miR-6760-5p demonstrating a suppressive impact on the migration(B), tube formation(C), and proliferation(D) of HUVECs (*p \u0026lt; 0. 05; **p \u0026lt; 0. 01; *** p \u0026lt; 0. 001).\u003c/p\u003e","description":"","filename":"figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4523087/v1/6b8f537e7954c43e73cffa59.png"},{"id":58760559,"identity":"e7082463-f1be-4c6e-91d1-15087b2eb16d","added_by":"auto","created_at":"2024-06-20 18:50:39","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1399539,"visible":true,"origin":"","legend":"\u003cp\u003eYAP1 has been identified as a downstream target gene of miR-6760-5p. This relationship is supported by various analyses, including the predicted Venn diagram of miR-6760-5p target genes(A), the predicted expression of synthesized proteins of the target gene in different treatment groups(B), the predicted results of binding sites of miR-6760-5p and YAP1(C), the sequence of the constructed plasmid(D), the structural mapping of the pmirGLO vector(E), the constructed YAP1 3 'UTR wt and YAP1 3'UTR mut plasmids(F), and the miR-6760-5p and YAP1 dual luciferase reporter gene assay(G). (*p \u0026lt; 0. 05; **p \u0026lt; 0. 01; *** p \u0026lt; 0. 001;ns p\u0026gt; 0. 05)\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4523087/v1/44bc95d97e8602eaf6006858.png"},{"id":58760562,"identity":"7b414b79-90d0-4d59-a0c1-688654d84592","added_by":"auto","created_at":"2024-06-20 18:50:43","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2405651,"visible":true,"origin":"","legend":"\u003cp\u003eYAP1 reinstates the impact of miR-6760-5p on cellular migratory capacity. (A) Impact of various interference techniques on the expression of YAP1 protein; (B) Tube formation assay of HUVECs following diverse treatments; (C) Transwell migration assay of HUVECs following diverse treatments. (*p \u0026lt; 0. 05; **p \u0026lt; 0. 01; *** p \u0026lt; 0. 001;ns p\u0026gt; 0. 05)\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4523087/v1/1e5ccedf7ad97cfabb6f3d1d.png"},{"id":58761103,"identity":"ba338b9f-a28f-469e-935b-37f0d5c8d3c7","added_by":"auto","created_at":"2024-06-20 18:58:23","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9038603,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4523087/v1/0058b2ad-165d-4825-88b3-49c7cd19a63d.pdf"},{"id":58760589,"identity":"400d5506-8757-4872-9646-d3fc17ac6a23","added_by":"auto","created_at":"2024-06-20 18:50:52","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":11362,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarytable1.docx","url":"https://assets-eu.researchsquare.com/files/rs-4523087/v1/edd0d539e944b1c74fffe24c.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"miR-6760-5p suppresses neoangiogenesis by targeting Yes-associated protein 1 in patients with moyamoya disease undergoing indirect revascularization","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMoyamoya disease is a condition characterized by chronic progressive narrowing of the terminal segment of the internal carotid artery and the proximal segment of the middle cerebral artery. Following this narrowing, an abnormal collateral vascular network forms at the base of the skull, resembling smoke under DSA imaging. Suzuki and Takaku, Japanese scientists, coined the name 'moyamoya disease' in 1969. Moyamoya disease is most commonly seen in Asian and Southeast Asian countries such as China, Korea, and Japan, with a prevalence in Asia that is 4. 62 times higher than in Europe and the United States.\u003c/p\u003e \u003cp\u003eThe primary pathological foundations of moyamoya disease are ischemia resulting from stenosis and hemorrhage caused by the fragile anomalous vascular network4. During childhood, ischemia is the primary manifestation, whereas hemorrhage tends to be more prevalent in adults5. An abnormal vascular network located at the base of the skull is a key feature of moyamoya disease. However, the underlying mechanism responsible for the formation of this abnormal vascular network remains unknown. A variety of arteries, including the occipital artery, middle meningeal artery, superficial temporal artery, and ophthalmic artery, are thought to compensate for moyamoya disease. A study conducted by Liu et al. Showed a significant link between the impaired state of meningeal side vessels and the development of cerebral infarction in patients with moyamoya disease. Furthermore, a supplementary prospective cohort study conducted as part of the JAMs trial has indicated that choroidal vascular collateral anastomosis could potentially serve as a stand-alone predictor for re-bleeding in hemorrhagic MMD7. These perplexing findings serve to underscore the significance of comprehending the mechanisms governing neovascularization, thereby facilitating the formulation of enhanced therapeutic approaches for moyamoya disease.\u003c/p\u003e \u003cp\u003eCerebrospinal fluid acts as the environment for vascular activity in the brain, with miRNAs having the ability to control various biological processes. Angiogenesis regulation includes miRNAs directly interacting with target mRNA's 3' untranslated region, affecting their degradation. Several miRNAs have been identified as being crucial to angiogenesis. Liu et al. demonstrated that miR-15b and miR-106b regulate angiogenesis during heart attacks. Similarly, MiR-493 inhibits the formation of tubes and movement of rat brain micro-vascular endothelial cells by reducing MIF10. Yet, there is a lack of research examining how miRNAs regulate angiogenesis in MMD.\u003c/p\u003e \u003cp\u003eTherefore, according to our previous research, Patients with moyamoya disease had elevated levels of miR-6760-5p in their cerebrospinal fluid. Following this, the HUVEC cell model was utilized to investigate the function and underlying mechanism of the potential miRNA, miRNA-6760-5p, in controlling angiogenesis. The results of the research suggest that miRNA-6760-5p shows potential as a future treatment option for MMD.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eEthics statement\u003c/h2\u003e \u003cp\u003e Study protocol approval was granted by the Ethics Committee of Nanfang Hospital of Southern Medical University. Written informed consent was obtained from all study participants. The MMD group consisted of patients diagnosed with moyamoya disease who required intracranial-extracranial bypass surgery. The control group comprised patients who required lumbar anesthesia for trauma-induced lower limb fracture, varicose veins of the lower limb, and knee joint pathology. Cranial computed tomography (CT) was employed to rule out the presence of intracranial lesions in the patients, who were also queried about their medical history pertaining to intracranial-related ailments such as dizziness, headache, and cerebrovascular accidents. Between October 2017 and December 2018, 20 individuals from the MMD group and 16 individuals from the control group were enrolled and selected from the Southern Hospital of Southern Medical University. During intracranial extracranial bypass surgery for Moyamoya disease (MMD), the dura mater is surgically incised, followed by the extraction of cerebrospinal fluid (CSF), with utmost caution to prevent any blood contamination within the subarachnoid space. In the control group, lumbar puncture was performed to collect interstitial cerebrospinal fluid from the L3/L4 or L4/L5 region.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eUsing reverse transcription-quantitative polymerase chain reaction and microarray analysis to compare miRNA expression\u003c/h2\u003e \u003cp\u003eShanghai Boho Biotechnology Co conducted the microarray analysis. We isolated total RNA from 250 liters of CSF using TRIZOL reagent in a sterile environment. The miRNA was isolated from the CSF samples (250 \u0026micro;l) using the Mir-XTM miRNA qRT-PCR TB GreenTM kit (Takara Reagent, Inc., Japan). Following the manufacturer's guidelines, the cDNA was synthesized using the Quant-Studio 5 instrument from Thermo Fisher Scientific at 37\u0026deg;C for 15 minutes, 85\u0026deg;C for 5 seconds, and then held at 4\u0026deg;C. The PCR reaction for fluorescence quantification was carried out under the following conditions: initial denaturation at 95 ℃ for 10 seconds, followed by 40 cycles at 95 ̊℃ for 5 seconds, 60 ̊℃ for 20 seconds, and then 95 ̊℃ for 60 seconds, 55 ̊℃ for 30 seconds, and 95 ̊ \u0026deg;C for 30 seconds. The following primers were used: hsa-miR-574-5p, (F) TGAGTGTGTGTGTGTGTGAGTGTGTGT; hsa-miR-3679-5p, (F) TGAGGATATGGCAGGGAAGGGGA; hsa-miR-6124, (F) GGGAAAAGGAAGGGGGAGGA; hsa-miR-6165, (F) CAGCAGGAGGTGAGGGGAG; hsa-miR-6760-5p, (F) CAGGGAGAAGGTGGAAGTGCAGA; U6, (F) GGAACGATACAGAGAAGATTAGC; U6, (R) TGGAACGCTTCACGAATTTGCG. miRNA expression was quantified using the gene expression level formula F\u0026thinsp;=\u0026thinsp;2-ΔΔCt method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and Cell transfection\u003c/h2\u003e \u003cp\u003e HUVECs were sourced from the Chinese Academy of Sciences in Shanghai, China, and 293T cells were obtained from ATCC in the USA. The two cell varieties were grown in DMEM with 10% FBS from Gibco, USA, at 37\u0026deg;C in a humid incubator with 5% CO2. Umine biotechnology Co., LTD. (Guangzhou, China) synthesized the hsa-miR-6760-5p mimic, hsa-miR-6760-5p inhibitor, and negative controls (NC). Umine Biotechnology Co., LTD. (Guangzhou, China) produced the YAP1 siRNA, overexpression plasmid, and vector plasmid. The oligonucleotide sequences can be found in Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e. Lipofectamine 2000 reagent (Life Technologies, USA) was used to transfect these oligonucleotides into HUVECs, following the manufacturer's instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eIn vitro tube formation assay\u003c/h2\u003e \u003cp\u003eMatrigel from Corning in the USA was thawed overnight at 4\u0026deg;C, and a 96-well plate and pipette tips were pre-chilled for preparation. Next, 50 microliters of Matrigel was added to every well in the 96-well plate and left to incubate at 37 degrees Celsius for half an hour. Each experiment was conducted in technical triplicate. Transfected HUVECs were harvested 48 hours post-transfection, resuspended in a complete culture medium containing 10% FBS, and cell counting was performed. 15,000 cells were evenly distributed into separate wells containing 100 \u0026micro;l of complete culture medium with 10% FBS, then incubated at 37\u0026deg;C for 6 hours. In our study, tubular structures were visualized using a Japanese light microscope camera manufactured by Olympus. The collected information was analyzed using the Angiogenesis Analyzer plugin in the Image J program.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eTranswell assay\u003c/h2\u003e \u003cp\u003eHUVECs that had undergone transfection were gathered 48 hours post-transfection for the transwell test. Afterward, the HUVECs were suspended in Dulbecco's modified Eagle's medium lacking fetal bovine serum and quantified. In the upper chamber, there were 10,000 cells in 200 \u0026micro;l of DMEM. 600 \u0026micro;l of whole culture with 10% FBS was added as a chemoattractant in the bottom chamber. Following a 12-hour incubation period at 37\u0026deg;C, the cells in the top chamber were eliminated with cotton swabs. Using an Olympus light microscope, the cells that moved to the bottom of the membrane were counted 30 minutes after fixation with 4% paraformaldehyde and staining with 0. 1% crystal violet.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eAssay using Cell Counting Kit-8\u003c/h2\u003e \u003cp\u003eFor the CCK-8 test, 2 \u0026times; 103 HUVECs were placed in 96-well dishes and left to incubate for 1, 2, 3, 4, 5, 6, or 7 days. Following this, the cells were exposed to CCK-8 solution in medium without serum for 2 hours, and absorbance readings were then recorded at 450 nm. The resulting data yielded statistically significant CCK-8 value-added curves.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics\u003c/h2\u003e \u003cp\u003eWe selected miR-6760-5p's target gene using TargetScan (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.targetscan.org/\u003c/span\u003e\u003cspan address=\"http://www.targetscan.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and miRBase (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.mirdb.org/\u003c/span\u003e\u003cspan address=\"http://www.mirdb.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting analysis\u003c/h2\u003e \u003cp\u003eBCA Protein Assay Kit (Solarbio Life Sciences, PC0020; Beijing, China) was used for protein concentration determination after cell lysis using RIPA Buffer (Sigma, R0278). The samples were separated by SDS-PAGE at 80 V for two hours, A PVDF membrane (Millipore, IPVH00010; Billerica, MA, USA) was then applied at 320 mA for 100 minutes. The membranes were then obstructed for an hour using 5% BSA (Solarbio Life Sciences, A8020) in 0. 1% Tween-20 (Sigma, P9416). After this, the membranes were incubated overnight with primary antibodies at 4\u0026deg;C. Next, the samples were incubated with Cell Signaling Technology's secondary antibodies labeled with HRP in Danvers, MA, USA, At room temperature for 1 hour. With the Tanon-5500 Chemiluminescent Imaging System from Tanon Science \u0026amp; Technology in Shanghai, China, immunoreactive bands were visualized using Immobilon ECL Ultra Western HRP Substrate (WBULS0500). The antibodies used in this study, including anti-AKT(A16343), anti-HEY2(A15143), anti-Phospho-AKT(AP0637), anti-Phospho-PI3K(AP0854), anti-YAP1(A1001), anti-FOXF1(A13017), and anti-NOTCH1 (A19090), were acquired from Abclonal (Wuhan, China). CST (MA, USA) provided the antibodies anti-Smad2/3(#8685), anti-Phospho-Smad2/3(#8828), and anti-ERK(#9102). The antibody anti-PI3K(67071-1-Ig) was obtained from PTG (Wuhan, China). Lastly, the antibodies anti-MAPK(ab185145), anti-P38(ab170090), and anti-Phospho-P38(ab4822) were acquired from Abcam (MA, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eDual Luciferase Assay\u003c/h2\u003e \u003cp\u003eUmine biotechnology Co., LTD. (Guangzhou, China) created the pmirGLO vector without insert, pmirGLO-YAP1 mut, and pmirGLO-YAP1 wt constructs. Following the transfection with Lipofectamine 2000 transfection agent, matching plasmids were introduced into 293T cells. Using the Luciferase Reporter System from Promega in Madison, WI, USA, we measured the levels of luciferase after 48 hours.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eMean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD) from four separate experiments were reported, with differences among groups determined using one-way ANOVA in SPSS 24. 0. A significance level of p\u0026thinsp;\u0026lt;\u0026thinsp;0. 05 was considered significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3. 1MiR-6760-5p inhibits proliferation, tube formation and migration of HUVECs\u003c/h2\u003e \u003cp\u003eOur previous research revealed an elevation in miR-6760-5p levels in the cerebrospinal fluid of moyamoya disease patients, suggesting its potential as a useful diagnostic tool for this condition. This research utilized HUVEC cells transfected with miR-6760-5p mimics and inhibitor to investigate the role of miR-6760-5p in cellular proliferation, migration, and tubular angiogenesis. During the transwell migration experiment, it was noted that the increased expression of miR-6760-5p (mimics) led to a significant decrease in the quantity of cells crossing the barrier, in contrast to the control group (NC). On the other hand, blocking miR-6760-5p resulted in a notable rise in the quantity of cells passing through the barrier, when compared to the control group (NC) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). The tube formation test showed a decrease in the amount of There was an increase in the number of HUVECs cells forming tubes in the miR-6760-5p inhibitor group compared to the miR-6760-5p mimics group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Compared with the normal control (NC), the overexpression (mimics) of miR-6760-5p resulted in a notable decrease in proliferation rate and number of HUVEC cells in the CCK8 proliferation assay. Comparing the HUVEC cells to the standard control (NC), blocking miR-6760-5p resulted in an increase in growth rate and quantity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). The findings indicate that miR-6760-5p can inhibit the growth, creation of tubes, and movement of HUVEC cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3. 2The miR-6760-5p directly targets YAP1\u003c/h2\u003e \u003cp\u003eThe prediction results of TargetScan and miRDB website for miR-6760-5p can be imported into Venn diagram construction website to derive the intersection of the two, and it was found that the validation of the two websites for the target genes had 646 genes in the intersection (Fig. We examined 646 genes in the GO and KEGG pathway analysis on the DAVID platform. Following the analysis, we identified 4 angiogenesis-related genes: YAP1, FOXF1, HEY2, and TIPARP. A WB validation of these genes revealed that miR-6760-5p mimics suppressed YAP1 expression, whereas miR-6760-5p inhibitors enhanced it. These findings indicate that YAP1 could be a promising target for miR-6760-5p. We visited the TargetScan website (http //\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.targetscan.org/\u003c/span\u003e\u003cspan address=\"http://www.targetscan.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) for miRNA binding site prediction analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), discovering that miR-6760-5p binds to YAP1 at the 1240\u0026ndash;1246 gene locus in the 3'UTR region. 1246 genetic location within the 3' untranslated region of YAP1.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBased on the YAP1 sequence, we created two plasmids representing the wild-type (YAP1 wt) and mutant (YAP1 mut) versions, as shown in the figure. 2D), and the empty expression vector chosen was pmirGLO (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE), and then we inserted the fragments of YAP1 wt and YAP1 mut into this expression vector, and the structure of the constructed plasmids is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF. The double luciferase reporter gene experiments were performed according to the grouping in Exhibit 1. In dual luciferase reporter gene experiments (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG), YAP1 fluorescence expression was significantly decreased after simultaneous transfection of YAP1 wt and overexpression of miR-6760-5p. Thus, through the dual-luciferase reporter gene assay, we have established that miR-6760-5p can bind to the 3'-UTR region of YAP1 and influence the expression of YAP1.\u003c/p\u003e \u003cp\u003e \u003cb\u003e3. 3In vitro, YAP1 counteracts the regulatory impact of miR-6760-5p on angiogenesis.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eHUVEC were divided into 5 groups according to Supplementary Table\u0026nbsp;2, which were control group, YAP1 oe group, YAP1 siRNA group, YAP1 oe\u0026thinsp;+\u0026thinsp;miR-6760-5p group, and YAP1 siRNA\u0026thinsp;+\u0026thinsp;miR-6760-5p group. HUVEC were subjected to treatment to confirm their functions in proliferation, migration, and tube formation. Additionally, cell proteins were collected for WB assay 48 hours post-treatment. The WB analysis revealed that the expression of YAP1 did not show a significant difference compared to the control group (NC) after miR-6760-5p overexpression followed by YAP1 plasmid transfection, but was elevated compared to the group with miR-6760-5p overexpression alone. In the 6760-5p group, the levels of YAP1 expression were comparable to those in the control group (NC). Following the introduction of YAP1 siRNA into the cells, the level of YAP1 expression decreased notably compared to the normal control group (NC), and was even lower than the expression in the miR-6760-5p overexpression group alone (Fig.\u0026nbsp;5a). This result suggests that miR-6760-5p can interfere with the expression of YAP1. The tube-forming assay results showed that when miR-6760-5p was overexpressed and YAP1 overexpression plasmid was transfected into the cells, there was no notable change in the cells' tube-forming capacity compared to the control group (NC). Compared to cells overexpressed with miR-6760-5p alone, tube-forming ability was significantly improved, indicating a clear recovery. Following the introduction of YAP1 siRNA into the cells, there was a notable decrease in their capacity to form tubes in comparison to the normal control group (NC). Additionally, the tube-forming ability of the cells was absent, showing a significant reduction when compared to the pure overexpression group (miR-6760-5p) (Fig.\u0026nbsp;5b). This result suggests that YAP1 can restore the effect of miR-6760-5p on the tube-forming ability of cells. Results of the Transwell cell migration assay showed that co-overexpression of miR-6760-5p and YAP1 overexpression plasmids did not significantly affect cell migration ability. As compared to cells overexpressing miR-6760-5p alone, there was a notable increase in cell migration ability. Transfection of YAP1 siRNA into cells resulted in a notable decrease in cell migration ability compared to the normal control group (NC) and the miR-6760-5p overexpression group (Fig.\u0026nbsp;5c). This result suggests that YAP1 can restore the effect of miR-6760-5p on cell migration. The findings indicate that the miR-6760-5p /YAP1 connection could have a significant impact on controlling angiogenesis in HUVECs.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe precise pathogenesis of moyamoya disease remains elusive, and the etiology of this condition is notably intricate. Presently, both domestic and international researchers and scholars predominantly posit that the pathogenesis is intertwined with genetic factors, vascular factors, and immuno-inflammatory factors12. TThe formation of abnormal vascular networks at the base of the skull is a hallmark of Moyamoya disease, but the exact mechanisms underlying their formation and disappearance remain unclear. In 2021, a comprehensive review examined the impact of diverse growth factors, circulating progenitor cells, neovascularization-associated cytokines, and inflammatory mediators on angiogenesis in moyamoya disease13. The exact connection between these elements, contributes to the development of moyamoya disease, and the compensatory collateral blood vessel inflammation and response to reduced blood flow is still unknown. Therefore, additional research is needed to determine any possible link between genetic mutations, epigenetic factors, and abnormal formation of new blood vessels in this specific situation.\u003c/p\u003e \u003cp\u003eMicroRNAs (mirRNAs), small non-coding RNA molecules with 20\u0026ndash;22 nucleotides, play a crucial role in regulating diverse biological processes in multicellular organisms, particularly mammals. During physiological conditions, miRNAs play a vital role in safeguarding essential biological processes like cell proliferation, differentiation, and apoptosis14,15. MiRNAs are also involved in the development of cancer, neurological disorders, autoimmune diseases, metabolic diseases, and cardiovascular diseases. Several studies have explored miRNAs' effects on angiogenesis, revealing their ability to promote or inhibit blood vessel formation. Notably, miR-9, a widely studied miRNA, has been identified by Ma et al. as a promoter of vascular endothelial growth factor (VEGF) production, thereby facilitating angiogenesis23. In contrast, Poliseno et al. In 2010, it was found that miR-222 had a notable inhibitory impact on both the scratch test and tube creation test. Moreover, it up-regulated the negative regulation of angiogenesis by down-regulating the expression of ZEB2 GAX, a known negative regulator of angiogenesis. This down-regulation of ZEB2 expression effectively hindered the angiogenesis process24.\u003c/p\u003e \u003cp\u003eThe RNF213 gene, frequently linked to familial cases, is commonly referred to as a susceptibility gene for MMD. However, certain researchers have conducted a comparative analysis of serum miRNAs in individuals with moyamoya disease and healthy individuals. Their findings indicate that abnormal serum microRNAs (miRNAs) are linked to mutations in the RNF213 gene in cases of MMD25. Suzuki et al. conducted a study. in 2017, it was observed that miR-1911-5p exhibited expression in cerebrospinal fluid, whereas its presence remained undetectable in serum. These findings suggest that brain tissue serves as the primary origin of miRNAs in cerebrospinal fluid. Furthermore, Suzuki et al. demonstrated in their research that miRNAs present in cerebrospinal fluid actively contribute to pathophysiological mechanisms within the central nervous system26.\u003c/p\u003e \u003cp\u003eSignaling pathways such as VEGF-VEGFR, Notch, PI3K-AKT, and Smad 2/3 control angiogenesis. The intricate nature of angiogenic regulation suggests that any component of these pathways may influence angiogenesis, and there may exist additional, as yet unidentified pathways that also play a role in this process.\u003c/p\u003e \u003cp\u003eAccording to prior research, individuals with moyamoya disease have higher miR-6760-5p expression in their cerebrospinal fluid, indicating its potential as a diagnostic tool for this condition. Consequently, we conducted in vitro experiments to further authenticate the role of miR-6760-5p. Through a series of in vitro functional experiments, the overexpression of miR-6760-5p inhibited angiogenesis, whereas the inhibition of miR-6760-5p promoted it. Following bioinformatics analysis, we successfully identified the downstream genes associated with miR-6760-5p. Following Western Blot protein immunoblotting tests, it was discovered that YAP1 may be the gene targeted by miR-6760-5p. Using the dual-luciferase reporter gene assay, we definitively verified YAP1 as the specific gene targeted by miR-6760-5p. Subsequently, cellular co-disturbance involving YAP1 and miR-6760-5p was conducted, followed by retrospective experiments. The findings showed that by introducing YAP1, the angiogenic capabilities were partially restored in the presence of miR-6760-5p overexpression, which differed from when only miR-6760-5p was overexpressed. Based on the findings and outcomes of the aforementioned series of experiments, it can be ascertained that miR-6760-5p possesses the capability to modulate angiogenesis by regulating the expression of YAP1, a pivotal signaling molecule within the Hippo signaling pathway.\u003c/p\u003e \u003cp\u003eThe functionality of miR-6760-5p has received limited investigation, and our study addresses this research gap. Moreover, our findings, which integrate the roles of miRNAs and YAP1 in the angiogenesis process, represent an unprecedented contribution to the field. The potential association between YAP1 and angiogenesis suggests that the future development of pharmacological agents targeting YAP1 activation or inhibition may offer valuable insights and strategies for addressing moyamoya disease and other conditions within the realm of regenerative medicine. By modulating YAP1 and miR-6760-5p, as evidenced by the results of this investigation, it may be possible to impede the advancement of moyamoya disease.\u003c/p\u003e \u003cp\u003eNaturally, our study does possess limitations. Owing to time constraints, we were unable to conduct in vivo experiments for validation. However, if animal experimental validation were to yield results consistent with those obtained from in vitro experiments, the credibility of this study would be enhanced.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study confirms the role of miR-6760-5p in modulating YAP1 production in moyamoya disease. As a result of these results, miR-6760-5p could be a valuable biomarker and target for the diagnosis and management of moyamoya disease.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eResearch Funding\u003c/h2\u003e \u003cp\u003eGrants for this project were provided by the Guangdong Basic and Applied Basic Research Foundation (No. 2020A1515110695) and the President Foundation of Nanfang Hospital, Southern Medical University (No. 2020C035, No. 2023B037).\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eConflict of Interest\u003c/h2\u003e \u003cp\u003eThis research was conducted without any commercial or financial relationships that could be construed as potential conflicts of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eWenfeng Feng and Gang Wang designed the project. Yunyu Wen and Junda Chen performed the experiments and drafted the manuscript. Siyuan Chen, Tinghan Long, Fangzhou Chen and Zhibin Wang assisted with the experimental and data analysis. Wenfeng Feng and Gang Wang revised the manuscript critically. All authors contributed to the article and approved the submitted version.\u003c/p\u003e\u003ch2\u003eData Availability Statement\u003c/h2\u003e \u003cp\u003eThe authors confirm that the data supporting the findings of this study are available within the article and its supplementary materials.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eScott RM, Smith ER (2009) Moyamoya disease and moyamoya syndrome[J]. N Engl JMed 360(12):1226\u0026ndash;1237\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuzuki J, Takaku A (1969) Cerebrovascular moyamoya disease. Disease showing abnormal net-like vessels in base of brain. Arch Neurol. ;20(3):288\u0026thinsp;\u0026ndash;\u0026thinsp;99. doi: 10. 1001/archneur. 1969. 00480090076012. PMID: 5775283\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoto Y, Yonekawa Y (1992) Worldwide distribution of moyamoya disease. Neurol Med Chir (Tokyo). ;32(12):883-6. doi: 10. 2176/nmc. 32. 883. PMID: 1282678\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen T, Wei W, Yu J, Xu S, Zhang J, Li X, Chen J (2023) The Progression of Pathophysiology of Moyamoya Disease. Neurosurgery 93(3):502\u0026ndash;509 doi: 10. 1227/neu. 0000000000002455. Epub 2023 Mar 14. PMID: 36912514\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSPollak L (2009) Moyamoya disease and moyamoya syndrome. N Engl J Med. ;361(1):98; author reply 98. PMID: 19579282\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu ZW, Han C, Wang H, Zhang Q, Li SJ, Bao XY, Zhang ZS, Duan L (2020) Clinical characteristics and leptomeningeal collateral status in pediatric and adult patients with ischemic moyamoya disease. CNS Neurosci Ther. ;26(1):14\u0026ndash;20. doi: 10. 1111/cns. 13130. Epub 2019 Apr 13. PMID: 31875482; PMCID: PMC6930821\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFunaki T, Takahashi JC, Houkin K, Kuroda S, Takeuchi S, Fujimura M, Tomata Y, Miyamoto S (2019) High rebleeding risk associated with choroidal collateral vessels in hemorrhagic moyamoya disease: analysis of a nonsurgical cohort in the Japan Adult Moyamoya Trial. J Neurosurg 130(2):525\u0026ndash;530 doi: 10. 3171/2017. 9. JNS17576. Epub 2018 Mar 2. PMID: 29498573\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRupaimoole R, Slack FJ (2017) Nat Rev Drug Discovery 16:203\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eliu Z, Yang d, Xie P, ren G, Sun G, Zeng X, Sun X (2012) Mir-106b and Mir-15b modulate apoptosis and angiogenesis in myocardial infarction. Cell Physiol Biochem 29:851\u0026ndash;862\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Q, He Q, Baral S, Mao L, Li Y, Jin H, Chen S, An T, Xia Y, Hu B (2016) MicroRNA\u0026ndash;493 regulates angiogenesis in a rat model of ischemic stroke by targeting MIF. FEBS J 283:1720\u0026ndash;1733\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang G, Wen Y, Faleti OD, Zhao Q, Liu J, Zhang G, Li M, Qi S, Feng W, Lyu X (2020) A Panel of Exosome-Derived miRNAs of Cerebrospinal Fluid for the Diagnosis of Moyamoya Disease. Front Neurosci. ;14:548278. doi: 10. 3389/fnins. 2020. 548278. PMID: 33100957; PMCID: PMC7546773\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAsselman C, Hemelsoet D, Eggermont D, Dermaut B, Impens F (2022) Moyamoya disease emerging as an immune-related angiopathy. Trends Mol Med. ;28(11):939\u0026ndash;950. doi: 10. 1016/j. molmed. 2022. 08. 009. Epub 2022 Sep 14. PMID: 36115805\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFang YC, Wei LF, Hu CJ, Tu YK (2021) Pathological Circulating Factors in Moyamoya Disease. Int J Mol Sci. ;22(4):1696. doi: 10. 3390/ijms22041696. PMID: 33567654; PMCID: PMC7915927\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTreiber T, Treiber N, Meister G (2019) Regulation of microRNA biogenesis and its crosstalk with other cellular pathways. Nat Rev Mol Cell Biol. ;20(1):5\u0026ndash;20. doi: 10. 1038/s41580-018-0059-1. Erratum in: Nat Rev Mol Cell Biol. 2018;19(12):808. Erratum in: Nat Rev Mol Cell Biol. 2019;20(5):321. PMID: 30228348\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGebert LFR, MacRae IJ (2019) Regulation of microRNA function in animals. Nat Rev Mol Cell Biol 20(1):21\u0026ndash;37. 10. 1038/s41580-018-0045-7. PMID: 30108335; PMCID: PMC6546304\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEsquela-Kerscher A, Slack FJ (2006) Oncomirs - microRNAs with a role in cancer. Nat Rev Cancer. ;6(4):259\u0026thinsp;\u0026ndash;\u0026thinsp;69. doi: 10. 1038/nrc1840. PMID: 16557279\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAzam Z, Quillien V, Wang G, To ST (2019) The potential diagnostic and prognostic role of extracellular vesicles in glioma: current status and future perspectives. Acta Oncol. ;58(3):353\u0026ndash;362. doi: 10. 1080/0284186X. 2018. 1551621. Epub 2019 Jan 11. PMID: 30632857\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKir D, Schnettler E, Modi S, Ramakrishnan S (2018) Regulation of angiogenesis by microRNAs in cardiovascular diseases. Angiogenesis. ;21(4):699\u0026ndash;710. doi: 10. 1007/s10456-018-9632-7. Epub 2018 Jun 28. PMID: 29956018\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Meter EN, Onyango JA, Teske KA (2020) A review of currently identified small molecule modulators of microRNA function. Eur J Med Chem. ;188:112008. doi: 10. 1016/j. ejmech. 2019. 112008. Epub 2019 Dec 23. PMID: 31931338\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang R, Zhang H, Ding W, Fan Z, Ji B, Ding C, Ji F, Tang H (2020) miR-143 promotes angiogenesis and osteoblast differentiation by targeting HDAC7. Cell Death Dis 11(3):179. 10. 1038/s41419-020-2377-4. PMID: 32152265; PMCID: PMC7062786\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng Z, Li Y, Pan Y, Lan X, Song F, Sun J, Zhou K, Liu X, Ren X, Wang F, Hu J, Zhu X, Yang W, Liao W, Li G, Ding Y, Liang L (2018) Cancer-derived exosomal miR-25-3p promotes pre-metastatic niche formation by inducing vascular permeability and angiogenesis. Nat Commun 9(1):5395. 10. 1038/s41467-018-07810-w. PMID: 30568162; PMCID: PMC6300604\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFiedler J, Thum T (2016) New Insights Into miR-17-92 Cluster Regulation and Angiogenesis. Circ Res 118(1):9\u0026ndash;11 doi: 10. 1161/CIRCRESAHA. 115. 307935. PMID: 26837738\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa L, Young J, Prabhala H, Pan E, Mestdagh P, Muth D, Teruya-Feldstein J, Reinhardt F, Onder TT, Valastyan S, Westermann F, Speleman F, Vandesompele J, Weinberg RA (2010) miR-9, a MYC/MYCN-activated microRNA, regulates E-cadherin and cancer metastasis. Nat Cell Biol. ;12(3):247\u0026thinsp;\u0026ndash;\u0026thinsp;56. doi: 10. 1038/ncb2024. Epub 2010 Feb 21. PMID: 20173740; PMCID: PMC2845545\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePoliseno L, Tuccoli A, Mariani L, Evangelista M, Citti L, Woods K, Mercatanti A, Hammond S, Rainaldi G (2006) MicroRNAs modulate the angiogenic properties of HUVECs. Blood. ;108(9):3068-71. doi: 10. 1182/blood-2006-01-012369. Epub 2006 Jul 18. PMID: 16849646\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai D, Lu Q, Huang Q, Yang P, Hong B, Xu Y, Zhao W, Liu J, Li Q (2014) Serum miRNA signature in Moyamoya disease. PLoS ONE 9(8):e102382 : 10. 1371/journal. pone. 0102382. PMID: 25093848; PMCID: PMC4122349\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYagi Y, Ohkubo T, Kawaji H, Machida A, Miyata H, Goda S, Roy S, Hayashizaki Y, Suzuki H, Yokota T (2017) Next-generation sequencing-based small RNA profiling of cerebrospinal fluid exosomes. Neurosci Lett. ;636:48\u0026ndash;57. doi: 10. 1016/j. neulet. 2016. 10. 042. Epub 2016 Oct 22. PMID: 27780738\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrothey A, Galanis E (2009) Targeting angiogenesis: progress with anti-VEGF treatment with large molecules. Nat Rev Clin Oncol. ;6(9):507\u0026thinsp;\u0026ndash;\u0026thinsp;18. doi: 10. 1038/nrclinonc. 2009. 110. Epub 2009 Jul 28. PMID: 19636328\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK\u0026ouml;rbel C, Gerstner MD, Menger MD, Laschke MW (2018) Notch signaling controls sprouting angiogenesis of endometriotic lesions. Angiogenesis. ;21(1):37\u0026ndash;46. doi: 10. 1007/s10456-017-9580-7. Epub 2017 Oct 9. PMID: 28993956\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Feng Y, Xie X, Wu H, Su XN, Qi J, Xin W, Gao L, Zhang Y, Shah VH, Zhu Q (2019) Neuropilin-1 aggravates liver cirrhosis by promoting angiogenesis via VEGFR2-dependent PI3K/Akt pathway in hepatic sinusoidal endothelial cells. EBioMedicine. ;43:525\u0026ndash;536. doi: 10. 1016/j. ebiom. 2019. 04. 050. Epub 2019 May 3. PMID: 31060904; PMCID: PMC6558257\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eItoh F, Itoh S, Adachi T, Ichikawa K, Matsumura Y, Takagi T, Festing M, Watanabe T, Weinstein M, Karlsson S, Kato M (2012) Smad2/Smad3 in endothelium is indispensable for vascular stability via S1PR1 and N-cadherin expressions. Blood. ;119(22):5320-8. doi: 10. 1182/blood-2011-12-395772. Epub 2012 Apr 12. PMID: 22498737; PMCID: PMC3628112\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Moyamoya disease, Indirect revascularization, Neovascularization, MiR-6760-5p, YAP1","lastPublishedDoi":"10.21203/rs.3.rs-4523087/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4523087/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eThe aim of this research was to investigate the specific regulatory role of miR-6760-5p in angiogenesis in moyamoya disease.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eHUVECs were transfected with miR-6760-5p inhibitor and mimics fragments, then subjected to assays for cell proliferation, migration, and tube formation. Subsequently, downstream target genes of miR-6760-5p were predicted and the protein expression levels of these genes were evaluated. The presence of miR-6760-5p and YAP1 was verified by a dual luciferase reporter gene test, followed by an assessment of the effects of YAP1 and miR-6760-5p on the HUVECs.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eComparatively to the control group, increased expression of miR-6760-5p decreased cell growth, movement, and tube formation. YAP1 gene was discovered as a target controlled by miR-6760-5p, with subsequent investigation confirming YAP1 as a gene regulated by miR-6760-5p. Additionally, miR-6760-5p was found to counteract the angiogenesis-promoting effect of YAP1.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThe results of this research suggest a possible link between the miR-6760-5p gene found in the cerebrospinal fluid of individuals with moyamoya disease and the process of vascularization in this particular condition. The findings indicate that miR-6760-5p may be a new molecular indicator and potential target for the diagnosis of moyamoya disease.\u003c/p\u003e","manuscriptTitle":"miR-6760-5p suppresses neoangiogenesis by targeting Yes-associated protein 1 in patients with moyamoya disease undergoing indirect revascularization","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-20 18:50:04","doi":"10.21203/rs.3.rs-4523087/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"fe1d3484-2c16-4016-9f23-75a69d2c0772","owner":[],"postedDate":"June 20th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-06-23T22:38:16+00:00","versionOfRecord":[],"versionCreatedAt":"2024-06-20 18:50:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4523087","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4523087","identity":"rs-4523087","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.