An ultrasound-guided biopsy technique for obtaining supraclavicular brown fat biopsies and preadipocytes

preprint OA: closed
📄 Open PDF Full text JSON View at publisher
Full text 45,985 characters · extracted from preprint-html · click to expand
An ultrasound-guided biopsy technique for obtaining supraclavicular brown fat biopsies and preadipocytes | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results An ultrasound-guided biopsy technique for obtaining supraclavicular brown fat biopsies and preadipocytes View ORCID Profile Eline S. Andersen , Naja Zenius Jespersen , Tora Ida Henriksen , Bente Klarlund Pedersen , View ORCID Profile Camilla Scheele , View ORCID Profile Michael Bachmann Nielsen , View ORCID Profile Søren Nielsen doi: https://doi.org/10.1101/2024.04.30.570595 Eline S. Andersen 1 Centre for Physical Activity Research, Copenhagen University Hospital - Rigshospitalet , Copenhagen, Denmark Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Eline S. Andersen Naja Zenius Jespersen 1 Centre for Physical Activity Research, Copenhagen University Hospital - Rigshospitalet , Copenhagen, Denmark Find this author on Google Scholar Find this author on PubMed Search for this author on this site Tora Ida Henriksen 1 Centre for Physical Activity Research, Copenhagen University Hospital - Rigshospitalet , Copenhagen, Denmark Find this author on Google Scholar Find this author on PubMed Search for this author on this site Bente Klarlund Pedersen 1 Centre for Physical Activity Research, Copenhagen University Hospital - Rigshospitalet , Copenhagen, Denmark Find this author on Google Scholar Find this author on PubMed Search for this author on this site Camilla Scheele 4 Novo Nordisk Foundation Center for Basic Metabolic Research, University of Copenhagen , Copenhagen, Denmark Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Camilla Scheele Michael Bachmann Nielsen 2 Department of Radiology, Copenhagen University Hospital, Rigshospitalet , Blegdamsvej 9, DK-2100, Copenhagen, Denmark 3 Department of Clinical Medicine, University of Copenhagen , Copenhagen, Denmark Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Michael Bachmann Nielsen Søren Nielsen 1 Centre for Physical Activity Research, Copenhagen University Hospital - Rigshospitalet , Copenhagen, Denmark Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Søren Nielsen For correspondence: soeren.nielsen.01{at}regionh.dk Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Studying activated human brown adipose tissue (BAT) in vivo poses challenges due to its intricate anatomical positioning. Through the implementation of an ultrasound-guided biopsy technique, we successfully collected BAT samples from the supraclavicular region of 27 healthy individuals. As a comparative control, subcutaneous white adipose tissue (WAT) was similarly extracted from the same participants. Furthermore, we isolated progenitor cells from four tissue biopsies in both regions, subsequently subjecting them to a 12-day in vitro differentiation protocol following stimulation with 10 µM norepinephrine. To assess the mRNA expression of thermogenic genes within these small tissue samples, we employed a targeted cDNA amplification procedure, followed by conventional quantitative PCR (qPCR). Our study demonstrated that, with further refinement, this biopsy methodology can be used to obtain thermogenic adipose tissue. However, the expression data exhibited considerable diversity, and no statistically significant overall trends emerged for any of the five BAT marker genes (UCP1, PPARGC1A, PRDM16, CIDEA, CITED1), nor for the WAT marker HOXC8. The differentiation capacity of the progenitor cells revealed irregularities, with only three adipocyte cultures (two WAT and one BAT) displaying satisfactory differentiation potential. Remarkably, the differentiated BAT culture displayed a significantly elevated basal UCP mRNA expression level, further induced by 1.7-fold upon stimulation with norepinephrine. In summary, based on the in vitro data, brown adipose samples can be obtained using our ultrasound-guided biopsy technique approach. However, significant refinements are necessary before robust in vivo data can be generated in future intervention studies. Introduction Since the discovery of brown adipose tissue (BAT) in adult humans[ 1 – 4 ], the tissue has been extensively investigated as a potential therapeutic target for obesity and its related metabolic complications[ 5 – 9 ]. Several studies have reported reduced volumes of BAT in people living with obesity or individuals with impaired cardiometabolic health [ 10 , 11 ]. Upon sympathetic activation, BAT consumes energy and takes up triglycerides and glucose, a feature that is utilized as the primary tool to quantify the volume and activity of human BAT depots[ 12 ]. The quantification of glucose uptake is used as an indirect measurement of volume, using a 18 FDG glucose tracer for positron emission tomography coupled with computed tomography (FDG-PET/CT) scans. However, where the in vivo quantification in this fashion is a relatively uncomplicated procedure, studying the molecular events in the isolated tissue is far from trivial. The anatomical location of BAT in humans makes it difficult to obtain biopsies using conventional methods and involves several technical and practical challenges. Therefore, most of our knowledge about BAT biology is based on studies performed in rodents. However, the importance of performing in depth functional studies on brown fat in a species-specific context, was recently highlighted in a study showing that human BAT is activated by norepinephrine through β2-adrenergic receptors, and not β3-receptors as in rodents [ 13 ]. In addition, we have identified a human specific long noncoding RNA that regulates mitochondrial activity in BAT[ 14 ], a mechanism that is seemingly lacking in rodents. Thus, mapping and better understanding of the human molecular events in this tissue in humans is needed. In adults, the major BAT depots are located around the kidneys, along the spinal cord and in the deep neck and supraclavicular area[ 15 – 17 ], where especially the latter has been examined in various studies[ 18 – 21 ]. A common feature in these studies is that the adipose biopsies have been obtained during goitre or thyroid cancer surgeries where the neck region is already exposed[ 20 ] and while the patients were under general anaesthesia. This approach does not allow for in vivo intervention studies and as BAT is activated through the sympathetic nervous system, our knowledge about human brown adipose tissue is mainly limited to the inactivated state. For the same reason, some studies have utilised the Bergström needle method to take conventional biopsies in the supraclavicular region [ 22 , 23 ]. However, the supraclavicular region is a complex anatomical region which in addition to BAT comprises larger veins, arteries, nerve fibres and muscular tissues; therefore biopsies in that region are associated with significant risks[ 24 ]. A safer, less invasive, more reliable, and applicable biopsy method to study activated human BAT would thus be a major development within the research field. In this study, we therefore aimed to develop an ultrasound-guided small biopsy method to obtain brown adipose tissue depot from the neck region in healthy individuals. To validate the quality of the biopsies, we mapped the expression of thermogenic adipose tissue genes in BAT and used subcutaneous WAT as a reference. We furthermore isolated progenitor cells from both depots, which we expanded and differentiated in vitro. With a new method for obtaining human BAT, we would in the future be able to study activated BAT biology across different metabolic diseases and in response to different interventions such as cooling, exercise interventions and different postprandial states. Methods Study design The study protocol was approved by the Scientific Ethical Committee of the capital region of Denmark, journal number H-1-2014-015, sub-study two. Healthy volunteers were recruited through advertisement. Healthy individuals between the age of 18 – 45 years with a BMI between 18 – 28 were eligible for participation. Furthermore, participants were required to have coagulation factors within the normal range i.e., INR: 0.9 – 1.2, APTT: 25 – 38 seconds, and thrombocytes > 145. Exclusion criterions were as follows: Use of daily medication besides anticonception medication for female participants, pregnancy, acute illness within two weeks prior to participation, chronic diseases including cancer, pulmonary-, cardiac-, kidney or liver-disease as well as endocrine disorders such as diabetes or thyroid disease, alcohol use of more than 14 units pr. week, or smoking in any form. Written informed consent was obtained from all participants following written and oral information about the study elements as well as anticipated risks and potential adverse events, and the study was conducted in accordance with the Helsinki declaration. Following an adverse event (see the results section) a modification to the protocol was included at the request of The Scientific Ethical Committee in which the study responsible doctor would contact the participants by telephone two days following the biopsy to ensure that there were no symptoms compatible with an adverse event. All participants underwent a screening visit which consisted of a medical exam including an ECG, blood samples, the measuring of height, weight, waist- and hip circumference, a dual-energy X-ray (DXA) -scan, a two-hour oral glucose tolerance test, and a watt-max test. Participants eligible for the biopsy visit met in the Hospital in the morning following 6 hours of fasting. Participants were instructed to use passive modes of transportation to get to the hospital and not to have performed vigorous exercise within 24 hours prior to the study day. An abdominal subcutaneous biopsy and one to two supraclavicular biopsies was performed as described in the biopsy section. Subjects Thirty-two healthy volunteers (15 men and 17 women) with a median age of 25, range (18 – 44), BMI 24.5 (18.3 – 18.8), waist/hip ratio 0.8 (0.4 – 1.2) and total body fat percentage 28.6 (8.3 -50.1) were included in the study (table3, table 4 ). Two individuals were excluded following baseline examinations due to coagulation factors outside the normal range, and in three participants no biopsy could be obtained, due to insufficient fat in the region, evaluated by ultrasound ( table 2 ). Two participants had two biopsies obtained on separate days, to be used for both tissue mRNA analyses and cell cultures. Thus, 58 biopsies were obtained from 27 subjects all together. 38 biopsies were snap-frozen in liquid nitrogen to be used for mRNA analyses, whereas 10 were utilized for pre-adipocyte isolation. View this table: View inline View popup Download powerpoint Table 1. The RNA yield from BAT and WAT lysates for each donor (anonymized ID). Nine samples had RNA concentration below the Qubit detection threshold (N.D.). View this table: View inline View popup Download powerpoint Table 2. Inclusion and exclusion criterions for participation in the study View this table: View inline View popup Download powerpoint Table 3. Participant characteristics, tissue samples. Values are median and range. F = Female, M = male, BMI = Body Mass Index, WHR = Waist Hip ratio. View this table: View inline View popup Download powerpoint Table 4. Participant characteristics, Cell culture samples. Values are median and range. F = Female, M = male, BMI = Body Mass Index, WHR = Waist Hip ratio. All included subjects had normal glucose tolerance, as well as TSH, HBA1c, high sensitive CRP, white blood cell count, hemoglobin and cholesterol, including both HDL, LDL and triglyceride levels within the normal range. Biopsy All participants were initially examined by ultrasound B-mode to localize the adipose tissue. A GE Logiq E9 system (GE Healthcare, Chalfont St. Giles, UK) with a linear array, high frequency probe (ML6-15) was used for all examinations. Participants were supine with the neck extended, exposing the supraclavicular area. Both sides of the neck were examined and the side with the easiest and safest access for biopsy was chosen. Local anaesthesia (2 ml of Lidocaine 20mg/ml) was injected subcutaneously. Afterwards the skin was sterilized with ethanol and a small incision was made in the skin. Ultrasound guided biopsy was performed two to three times with a semi-automatic 18G biopsy needle (Medax, Mantova, Italy). The same experienced radiologist (>20 years of interventional ultrasound) performed all supraclavicular biopsies. The biopsy was cleansed using sterile saline and either immediately snap-frozen in liquid nitrogen or placed in cell culture medium (DMEM / F12) + 1% PS. Afterwards an abdominal control biopsy was obtained from the periumbilical subcutaneous adipose depot by one the study investigators using the same method but without ultrasound guidance. RNA isolation The RNeasy Micro Kit (Qiagen) was used to isolate the RNA from the small biopsies. The kit contains poly-A RNA for use as carrier RNA to improve the isolation efficiency from very small tissue samples. The carrier RNA approach was tested according to the manufacturer’s guidelines. The isolation efficiency was compared to a control with no poly-A carrier added. As there was no difference in efficiencies and a potential risk for ineffective amplification with carrier RNA added, we proceeded with the isolation procedure without the carrier. A lysis buffer consisting of 10 ul β-Mercaptoethanol (Sigma, 63689-25ML-F) per 1 ml RLT Buffer (included in the RNeasy Micro Kit) was prepared. The tissue was placed in 2 ml microcentrifuge tubes containing one 5 mm stainless steel bead and added 350 µl lysis buffer per tube. Tubes was placed in the TissueLyser and the tissues were homogenized for 2 min at 20 Hz. Tubes were then transferred to a centrifuge and centrifuged at 16,000 rpm for 3 min and 30 µl of the supernatant was then transferred to new 2 ml tubes containing 350 ul 70% ethanol and mixed with a pipette. Samples were then transferred to RNeasy MinElute spin column placed in a 2 ml collection tube and then centrifuged for 15 s at 10,000 rpm. Columns were then washed with 350 µl RW1 buffer (included in the RNeasy Micro Kit) and then incubated with an 80 µl DNAse buffer (1500 Kunitz unit DNAse solution in 70 µl RDD Buffer) for 30 min and then washed with provided buffers and 80% ethanol, according to the manufacturer’s guideline. Lastly, 14 µl RNasefree water (Thermo Fisher) was added to the samples to elute RNA from the spinning filters. RNA concentrations were determined with an RNA High sensitivity assay (Thermo Fisher) using a Qubit 3.0. ( table 1 ) cDNA procedure and qPCR Adipose Tissue Total RNA (5 ng) was reverse transcribed using cDNA high-capacity kit (Applied Biosystems) according to the manufacturer’s protocol. For those 9 samples ( table 1 ) that were out of detection range, a 5 µl lysate volume was used as input. Then the cDNA was preamplified using the Taqman PreAmp Master Mix (Applied Biosystems) targeting 33 defined mRNAs (Supplementary table 1). Briefly, 5 ul of 33 Taqman assays (Supplementary table 1) was pooled in a tube and 6,25 µl of the taqman pool was then mixed with 6,25 µl cDNA and 12.5 preamp master mix. Tubes were placed in a Thermo cycler and preamplified at 10 cycles (denature 95°C for 15 sec, 60°C for 4 min). Diluted cDNA samples (1:10) were loaded in duplicates and qPCR was performed using ViiA7 Sequence Detection system (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s protocol using TaqMan™ Universal PCR Master Mix (Thermo Fisher). Primary adipocyte cultures Total RNA (200 ng) was reverse transcribed using a cDNA High-Capacity Kit (Applied Biosystems) according to the manufacturer’s protocol. cDNA samples were loaded in triplicate and qPCR was performed with the ViiA7 Sequence Detection system (Applied Biosystems), according to the manufacturer’s protocol, using PowerUp SYBR Green Master Mix for quantification of FABP4, PPARGCA, PPIA and PRDM16 mRNA (Primer sequences below). UCP1 mRNA was quantified using TaqMan Universal PCR Master Mix and the TaqMan primer/probe assay Hs00222453_m1 (ThermoFischer Scientific). SYBR-based primers were designed using the Roche Applied Science Assay Design Centre (Roche) and checked for specificity using Primer-Blast (NCBI). Primers: FABP4 Forward: CCTTTAAAAATACTGAGATTTCCTTCA FABP4 Reverse: GGACACCCCCATCTAAGGTT PPARGC1A Forward: CAAGCCAAACCAACAACTTTATCTCT PPARGC1A Reverse: CACACTTAAGGTGCGTTCAATAGTC PPIA Forward: ACGCCACCGCCGAGGAAAAC PPIA Reverse: TGCAAACAGCTCAAAGGAGACGC PRDM16 Forward: CACGAGTGCAAGGACTGC PRDM16 Reverse: TGTGGATGACCATGTGCTG Cell culture of human primary adipocytes Preadipocytes were isolated from the small supraclavicular and abdominal subcutaneous adipose tissue biopsies. A previously published isolation protocol was modified to preserve as many viable preadipocytes from the very small biopsies as possible material. The adipocyte differentiation procedure was as previously published[ 20 , 25 ]. Briefly, biopsies were digested in DMEM/F12 containing collagenase II (1 mg/ml; Sigma Aldrich) and fatty acid-free bovine serum albumin (15 mg/ml; Sigma Aldrich). The solution was passed through a cell strainer which was subsequently flushed with 10 ml DMEM/F12 to capture as many cells as possible. The solution was centrifuged at 800g for 7 minutes, and cell pellet was subsequently washed with DMEM/F12. The cell pellet was resuspended in growth media consisting of DMEM/F12, 10% Fetal bovine serum, 1% Penicillin-Streptomycin and cells were seeded in one well in a 12-well plate. The cells were grown at 37°C in an atmosphere of 5% CO2 and the medium was changed every second day. Adipocyte differentiation was induced two days after preadipocyte cultures were 100% confluent by treating cells with DMEM/F12 containing 1% Penicillin-Streptomycin, 0.1 μM dexamethasone (Sigma-Aldrich), 100 nM insulin (Actrapid, Novo Nordisk or Humulin, Eli Lilly), 200 nM rosiglitazone (Sigma-Aldrich), 540 μM isobutylmethylxanthine (IBMX) (Sigma-Aldrich), 2 nM T3 (Sigma-Aldrich) and 10 μg/ml transferrin (Sigma-Aldrich). After three days of differentiation, IBMX was removed from the cell culture media. The cell cultures were left to differentiate for an additional nine days, with medium change the third day. Following 12 days of differentiation, cells were harvested for RNA, protein. When stated in the figure legend, cells were stimulated with 10 μM norepinephrine (Sigma-Aldrich) for 4 hr before RNA and protein were isolated. Two hours prior to the norepinephrine stimulation, old medium was replaced by DMEM/F12 (Life technologies) containing 1% penicillin-streptomycin. Statistics and data availability The statistical analysis was performed using GraphPad Prism 9.0 (GraphPad Software Inc., La Jolla, CA, USA). Results are presented as means ± S.E.M. Tissue qPCR data did not pass the Kolmogorov–Smirnov test for normal distribution and therefore data were analysed using the nonparametric Wilcoxon matched-pairs signed rank test. Cell qPCR data were analysed using a 2-way ANOVA. All raw PCR are available online at Mendeley Data. Results An ultrasound guided small needle approach Using an ultrasound guided small biopsy needle approach we aimed for obtaining sufficient volume of adipose tissue to 1) extract RNA that could be further evaluated with qPCR and 2) isolation of adipose progenitors that could be expanded and differentiated to mature adipocytes ( Figure 1A ). Download figure Open in new tab Fig. 1 Ultrasound guided biopsy method for obtaining brown adipose tissue in humans. A, Graphical overview on the experimental design. B , Ultrasound guided localisation of the supraclavicular region. C , Small needle insertion (semi-automatic 18G biopsy needle) in the supraclavicular neck area for obtaining brown adipose tissue. D , Image of the supraclavicular neck area generated by ultrasound. The biopsy needle is outlined with blue. E, Example of the adipose tissue size after the biopsy procedure. All participants were initially examined, in a supine position, exposing the supraclavicular neck area by ultrasound to localize regions with adipose tissue ( figure 1B , 1C). Ultrasound-guided biopsy was performed two to three times with a semi-automatic 18G biopsy needle while carefully monitoring the needle position ( Figure 1D ). Small adipose biopsies were successfully taken out from the supraclavicular region for further examination ( Figure 1E ). Subcutaneous abdominal adipose tissue was used as reference material using the same biopsy method. Applicability and adverse events The biopsy method was fast and easily applicable, and aside from a slight burning sensation related to the injection of local analgesia most subjects felt no discomfort in relation to the procedure. This was with the except of one case, in which the supraclavicular procedure itself caused an immediate sharp pain. In the following days, the subject developed an iatrogenic pneumothorax which gradually increased in size over the next week to require drainage. Thus, the subject had to be hospitalized and required a chest drain for 5 days. On this treatment the pneumothorax was resolved, and the subject recovered without any permanent sequelae. There were no other cases of adverse events or complications. Evaluation of depot specific mRNA signature in small adipose tissue biopsies Based on the PPIA expression, we succeeded in isolating sufficient concentrations of RNA from all the biopsies except from 1 sample ( table 1 ). Furthermore, as expected for a housekeeping gene, the expression levels were comparable between WAT and BAT depots and expressed at levels comparable with higher RNA input approaches (WAT: mean CT=27.4 +/-1.2 SD, BAT: CT=28.1 +/- 1.3 SD) ( Figure 2B ). We next evaluated the expression of the well-described markers of brown and white adipose identity UCP1 , PPARGCA , CITED1 , PRDM16 , CIDEA (all BAT) and HOXC8 (WAT). Apart from CIDEA and HOXC8 , the expression of the identity markers was either lowly expressed or not detectable after 45 qPCR cycles. When comparing the expression levels between the two depots, CIDEA mRNA expression was surprisingly higher in WAT compared to BAT (p<0.01) ( Figure 2C ). None of the other measured markers were expressed different between the two depots ( figure 2C ). Download figure Open in new tab Fig. 2 Evaluation of thermogenic mRNA markers in adipose tissue biopsies obtained. A , Evaluation of cDNA efficiency based on the PPIA mRNA expression (n=19). B , Evaluation of the expression of thermogenic mRNA markers (UCP1, CITED1, PPARGC1A, CIDEA) and the white adipose tissue marker (HOXC8). Statistical significance was determined by Wilcoxon matched pairs signed rank test (n=18) * = p<0.05. Evaluation of adipogenic capacity and thermogenic potential in vitro Out of the ten paired cultures, we succeeded isolating progenitors from 4 WAT and 4 BAT depots (not paired). We conclude that a higher volume of adipose tissue, or possibly further refinement of the isolation protocol is needed to secure expansion and differentiation of the progenitor cells. Importantly, we have later shown that expansion of already isolated progenitorsfrom single cells is possible when provided conditioned media from growing adipose progenitors (REF to Nat Met paper). Thus, using a 48-well plate or even a 96-well plate and providing conditioned media, would potentially result in securing cell isolation from small-sized biopsies in the future. All eight cultures could be expanded until 100% confluence, followed by initiation of the adipocyte differentiation program. However, only three cultures (Two WAT cultures and one BAT cultures) had the potential to differentiate into mature adipocytes, based on the cellular lipid accumulation ( figure 3A-B ). We have recently described that cells divide into two major cell fates during differentiation: adipogenic and SWAT cells[ 26 ] . Whereas the adipogenic cells accumulate lipids, the SWAT cells express extracellular matrix factors. Many of the current cultures thus appears to be dominated by SWAT cells. In terms of thermogenic capacity, there was no statistically significant difference in thermogenic gene expression between depots or in response to a stimulus with norepinephrine ( Figure 3C ). However, expression of UCP1 and PPARGC1A mRNA could be induced in individual cultures. We have previous experience in that there is a large variation in terms of lipid droplet accumulation as well as thermogenic capacity[ 19 ]. Therefore, we cannot conclude on whether that the current results depend on technical limitations of the small biopsies or individual variation in thermogenic potential. Download figure Open in new tab Fig. 3 Evaluation of thermogenic mRNA markers in in vitro differentiated progenitors obtained with ultrasound guided small biopsy needle technique. A, Differentiation capacity based on FABP4 mRNA expression (n=4). B Brightfield Image of fully differentiated adipocytes obtained with small needle biopsy technique.). C Thermogenic mRNA marker expression (PRDM16, PPARGC1A, UCP1, FABPF) in brown and white adipocytes after 12-day differentiation period, stimulated with 10 μM norepinephrine for 4 hours Discussion In this project we developed a cost-effective method for obtaining samples of human supraclavicular adipose tissue and evaluating the thermogenic mRNA signature as well as isolating preadipocytes from the sample. However, several technical and practical challenges need to be solved before the method can be implemented. In this project we assumed that all participants had brown adipose tissue in the supraclavicular region, which we could reach with the biopsy needle and further process for analysis. However, the BAT volume in humans is very variable and are for some individuals completely absent[ 20 ]. For instance, studies have shown a dramatic decrease of BAT prevalence with age[ 10 ]. Furthermore, there are several reports BAT volume being correlated with BMI, glucose tolerance, gender, and ethnicity[ 10 , 27 ]. Therefore, a uniform cohort of younger people with known BAT depots of significant volume should be selected as an inclusion criterion. Although the participants in the present study were relatively young, healthy, and non-obese, a pre-screening procedure including a PET-CT scan combined with a cooling protocol [ 28 ] to ensure the presence of BAT depots of significant volume should be included. A detailed PET-CT BAT localisation map for each individual would most likely improve the BAT biopsy accuracy. As described in the introduction, there are several risks associated with performing biopsies in the supraclavicular region including the risk of bleeding, infection, nerve damage and development of a pneumothorax. In a previous study, where a Bergström needle was utilized 9.6% of participants developed transient numbness and 2.3% hematoma[ 23 ]. In the present study, three subjects were excluded due to insufficient amounts of supraclavicular fat for the biopsy to be performed in a safe manner. In spite of this, one subject nevertheless developed a serious complication in the form of a pneumothorax which required hospitalization and drainage. We assume that the utilization of a smaller needle gauge is the underlying factor contributing to the absence of any additional complications in the current study. Importantly, the observed pneumothorax underlines the difficulty in the application of the described biopsy method. In addition, alternatives in tissue handling and the wet lab procedures needs to be considered. First, a gentler tissue lysis procedure could improve the RNA yield. In this project, we used a silver bullet approach that ruptures the tissue in 2 ml Eppendorf tubes. This method is very efficient when processing larger tissue samples. However, as the tissue in this project was barely visible, it was difficult to evaluate the lysis efficiency. A method with smaller volume of lysis buffer and a manual lysis procedure with a pipette might have resulted in higher RNA yield. Furthermore, the cDNA concentration was in general low and the selected targeted preamplification approach might not be the most efficient method for this purpose. Alternative and more advanced protocols within the single cell technology have been in rapid development within the recent years[ 29 , 30 ] . These technologies are today available as commercialized kits and would most likely have been beneficial for analysing the material isolated in this project. While the biopsy procedure and the processing of the tissue for mRNA-analysis could be improved, the volume of the tissue may be too low for successful isolation of adipogenic progenitors. However, the protocol for cell isolation used in this study[ 20 ] was a modified protocol optimized for larger biopsies and could be revised even further for better performance on smaller biopsies. For instance, a protocol allowing to isolate and culture skin cells from a single 4 mm-punch biopsy, has been developed[ 31 ]. The sample and cell size corresponds to the material this method could most likely be applied in a future protocol. Cell death inducing DFFA like effector a (CIDEA) is a well-established brown adipose tissue mRNA marker[ 32 ]. However, in this study we show an unexpected higher expression of CIDEA in the subcutaneous white adipose tissue. Despite reports about the importance of CIDEA in white adipose tissue[ 33 ], the finding is more likely connected to a technical artefact. In conclusion, we present an ultrasound guided method for obtaining biopsies from the human supraclavicular adipose depot. We show that preadipocytes can be isolated from the samples and that it is possible to extract sufficient RNA for qPCR from the samples. The method, however, needs further development to improve the success rate. With a new and improved method for obtaining human BAT, we would in the future be able to study activated BAT biology across different metabolic diseases and in response to different interventions such as cooling, exercise interventions and different postprandial states. Funding The Centre for Physical Activity Research (CFAS) is supported by TrygFonden (grants ID 101390, ID 20045, and ID 125132). During the study period, the Centre of Inflammation and Metabolism (CIM) was supported by a grant from the Danish National Research Foundation (DNRF55). S.N. acknowledges the Novo Nordisk Foundation (grant no. NNF20OC0061400). NZJ is funded by a research grant from the Danish Diabetes Academy, which is funded by the Novo Nordisk Foundation, grant number NNF17SA0031406. E.S.A was supported by the foundations “Oda og Hans Svenningsens Fond” and “Fonden af 1870 “. Novo Nordisk Foundation Center for Basic Metabolic Research is an independent Research Center, based at the University of Copenhagen, Denmark and partially funded by an unconditional donation from the Novo Nordisk Foundation ( https://cbmr.ku.dk/ ; grant number NNF18CC0034900) Acknowledgement We acknowledge Noemi James, Lone Peijs and Maria Scheel for the technical assistance during the study period. Furthermore, we acknowledge all the included voluntary study participants for their time, trust, and curiosity. References 1. ↵ Nedergaard J , Bengtsson T , Cannon B . Unexpected evidence for active brown adipose tissue in adult humans . American Journal of Physiology-Endocrinology and Metabolism . 2007 ; 444 – 452 . doi: 10.1152/ajpendo.00691.2006 . OpenUrl CrossRef PubMed Web of Science 2. Kirsi A. Virtanen , Martin E. Lidell , Janne Orava , Mikael Heglind , Rickard Westergren , Tarja Niemi , Markku Taittonen , Jukka Laine , Nina-Johanna Savisto , Sven Enerbäck PN . Functional brown adipose tissue in healthy adults . New England Journal of Medicine . 2009 . 3. van Marken Lichtenbelt WD , Vanhommerig JW , Smulders NM , Drossaerts JMAFL , Kemerink GJ , Bouvy ND , et al. Cold-Activated Brown Adipose Tissue in Healthy Men . New England Journal of Medicine . 2009 ; 360 : 1500 – 1508 . doi: 10.1056/nejmoa0808718 OpenUrl CrossRef PubMed Web of Science 4. ↵ Cypess AM , Lehman S , Williams G , Tal I , Rodman D , Goldfine AB , et al. Identification and importance of brown adipose tissue in adult humans . N Engl J Med . 2009 ; 360 : 1509 – 17 . doi: 10.1056/NEJMoa0810780 OpenUrl CrossRef PubMed Web of Science 5. ↵ Hanssen MJW , Lans AAJJ van der , Brans B , Hoeks J , Jardon KMC , Schaart G , et al. Short-term Cold Acclimation Recruits Brown Adipose Tissue in Obese Humans . 2016 ; 65 : 1179 – 1189 . doi: 10.2337/db15-1372 OpenUrl Abstract / FREE Full Text 6. Scheele C , Nielsen S . Metabolic regulation and the anti-obesity perspectives of human brown fat . Redox Biol . 2017 ; 12 : 770 – 775 . doi: 10.1016/j.redox.2017.04.011 OpenUrl CrossRef 7. Enerbäck S , Lidell ME , Saraf MK , Labbe SM , Hurren NM . Brown Adipose Tissue Improves Whole-Body Glucose Homeostasis and Insulin Sensitivity in Humans . Diabetes . 2014 ; 63 : 4089 – 4099 . doi: 10.2337/db14-0746 OpenUrl Abstract / FREE Full Text 8. Lee P , Smith S , Linderman J , Courville AB , Brychta RJ . Temperature-Acclimated Brown Adipose Tissue Modulates Insulin Sensitivity in Humans . Diabetes . 2014 ; 63 : 3686 – 3698 . doi: 10.2337/db14-0513 OpenUrl Abstract / FREE Full Text 9. ↵ Hanssen MJW , Hoeks J , Brans B , Havekes B , Kersten S , Mottaghy FM , et al. Short-term cold acclimation improves insulin sensitivity in patients with type 2 diabetes mellitus . Nat Med . 2015 ; 1 – 5 . doi: 10.1038/nm.3891 OpenUrl CrossRef PubMed 10. ↵ Becher T , Palanisamy S , Kramer DJ , Eljalby M , Marx SJ , Wibmer AG , et al. Brown adipose tissue is associated with cardiometabolic health . Nat Med . 2021 ; 27 : 58 – 65 . doi: 10.1038/s41591-020-1126-7 OpenUrl CrossRef 11. ↵ Leitner BP , Huang S , Brychta RJ , Duckworth CJ , Baskin AS , McGehee S , et al. Mapping of human brown adipose tissue in lean and obese young men . Proc Natl Acad Sci U S A . 2017 ; 114 : 8649 – 8654 . doi: 10.1073/pnas.1705287114 OpenUrl Abstract / FREE Full Text 12. ↵ Chondronikola M , Porter C , Ogunbileje JO , Sidossis LS . Identification and Quantification of Human Brown Adipose Tissue . Methods Mol Biol . 2017 ; 1566 : 159 – 176 . doi: 10.1007/978-1-4939-6820-6_16 OpenUrl CrossRef 13. ↵ Blondin DP , Nielsen S , Kuipers EN , Rensen PCN , Scheele C . Human Brown Adipocyte Thermogenesis Is Driven by b 2-AR Stimulation ll Article Human Brown Adipocyte Thermogenesis Is Driven by b 2-AR Stimulation . Cell Metab . 2020 ; 287 – 300 . doi: 10.1016/j.cmet.2020.07.005 OpenUrl CrossRef 14. ↵ Tran K Van , Brown EL , DeSouza T , Jespersen NZ , Nandrup-Bus C , Yang Q , et al. Human thermogenic adipocyte regulation by the long noncoding RNA LINC00473 . Nat Metab . 2020 ; 2 : 397 – 412 . doi: 10.1038/s42255-020-0205-x OpenUrl CrossRef 15. ↵ Heaton JM . The distribution of brown adipose tissue in the human . J Anat . 1972 ; 112 : 35 – 9 . Available: http://www.ncbi.nlm.nih.gov/pubmed/5086212 %0A http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=PMC1271341 OpenUrl PubMed Web of Science 16. Cypess AM , White AP , Vernochet C , Schulz TJ , Xue R , Sass C a , et al. Anatomical localization, gene expression profiling and functional characterization of adult human neck brown fat . Nat Med . 2013 ; 19 : 635 – 9 . doi: 10.1038/nm.3112 OpenUrl CrossRef PubMed 17. ↵ Min SY , Desai A , Yang Z , Sharma A , DeSouza T , Genga RMJ , et al. Diverse repertoire of human adipocyte subtypes develops from transcriptionally distinct mesenchymal progenitor cells . Proc Natl Acad Sci U S A . 2019 ; 116 : 17970 – 17979 . doi: 10.1073/pnas.1906512116 OpenUrl Abstract / FREE Full Text 18. ↵ So Yun Min , Jamie Kady , Minwoo Nam , Raziel Rojas-Rodriguez , Aaron Berkenwald , Jong Hun Kim , Hye-Lim Noh , Jason K Kim , Marcus P Cooper , Timothy Fitzgibbons , Michael A , Brehm SC . Human “brite/beige” adipocytes develop from capillary networks, and their implantation improves metabolic homeostasis in mice . Nat Med . 2016 ; 176 : 139 – 148 . doi: 10.1038/nm.4031.Human OpenUrl CrossRef 19. ↵ Jespersen NZ , Andersen MW , Jensen VH , Stærkær TW , Severinsen MCK , Mandrup S , et al. Thermogenic genes are blunted whereas brown adipose tissue identity is preserved in human obesity . bioRxiv . 2020 . 20. ↵ Jespersen NZ , Larsen TJ , Peijs L , Daugaard S , Homøe P , Loft A , et al. A Classical Brown Adipose Tissue mRNA Signature Partly Overlaps with Brite in the Supraclavicular Region of Adult Humans . Cell Metab . 2013 ; 17 : 798 – 805 . doi: 10.1016/j.cmet.2013.04.011 OpenUrl CrossRef PubMed Web of Science 21. ↵ Jong JMA de , Sun W , Pires ND , Frontini A , Balaz M , Jespersen NZ , et al. Human brown adipose tissue is phenocopied by classical brown adipose tissue in physiologically humanized mice . Nat Metab . 2019 . doi: 10.1038/s42255-019-0101-4 OpenUrl CrossRef PubMed 22. ↵ Chondronikola M , Volpi E , Børsheim E , Porter C , Annamalai P , Enerbäck S , et al. Brown adipose tissue improves whole-body glucose homeostasis and insulin sensitivity in humans . Diabetes . 2014 ; 63 : 4089 – 4099 . doi: 10.2337/db14-0746 OpenUrl Abstract / FREE Full Text 23. ↵ Chondronikola M , Annamalai P , Chao T , Porter C , Saraf MK , Cesani F , et al. A percutaneous needle biopsy technique for sampling the supraclavicular brown adipose tissue depot of humans . Int J Obes . 2015 ; 39 : 1561 – 1564 . doi: 10.1038/ijo.2015.76 OpenUrl CrossRef PubMed 24. ↵ Kalluri AG , Miao KH , Bordoni B . Anatomy, Shoulder and Upper Limb, Supraclavicular Fossa . Treasure Island (FL) ; 2022 . 25. ↵ Scheele C , Henriksen TI , Nielsen S . Isolation and Characterization of Human Brown Adipocytes . Methods Mol Biol . 2022 ; 2448 : 217 – 234 . doi: 10.1007/978-1-0716-2087-8_14 OpenUrl CrossRef 26. ↵ Palani NP , Horvath C , Timshel PN , Folkertsma P , Grønning AGB , Henriksen TI , et al. Adipogenic and SWAT cells separate from a common progenitor in human brown and white adipose depots . Nat Metab . 2023 ; 5 : 996 – 1013 . doi: 10.1038/s42255-023-00820-z OpenUrl CrossRef 27. ↵ Bakker LEH , Boon MR , van der Linden RAD , Arias-Bouda LP , van Klinken JB , Smit F , et al. Brown adipose tissue volume in healthy lean south Asian adults compared with white Caucasians: a prospective, case-controlled observational study . Lancet Diabetes Endocrinol . 2014 ; 2 : 210 – 217 . doi: 10.1016/S2213-8587(13)70156-6 OpenUrl CrossRef PubMed Web of Science 28. ↵ Søberg S , Löfgren J , Philipsen FE , Jensen M , Hansen AE , Ahrens E , et al. Altered brown fat thermoregulation and enhanced cold-induced thermogenesis in young, healthy, winter-swimming men . Cell Rep Med . 2021 ; 2 . doi: 10.1016/j.xcrm.2021.100408 OpenUrl CrossRef 29. ↵ Sivanantham A , Lee H , Jin Y . Direct Detection of Extracellular Vesicle miRNAs Using a Single-Step RT-qPCR Assay . Methods Mol Biol . 2022 ; 2504 : 137 – 145 . doi: 10.1007/978-1-0716-2341-1_10 OpenUrl CrossRef 30. ↵ Henriksen TI , Heywood SE , Hansen NS , Pedersen BK , Scheele CC , Nielsen S . Single cell analysis identifies the miRNA expression profile of a subpopulation of muscle precursor cells unique to humans with type 2 diabetes . Front Physiol . 2018 ; 9 : 1 – 13 . doi: 10.3389/fphys.2018.00883 OpenUrl CrossRef PubMed 31. ↵ Henrot P , Laurent P , Levionnois E , Leleu D , Pain C , Truchetet ME , et al. A Method for Isolating and Culturing Skin Cells: Application to Endothelial Cells, Fibroblasts, Keratinocytes, and Melanocytes From Punch Biopsies in Systemic Sclerosis Skin . Front Immunol . 2020 ; 11 : 1 – 12 . doi: 10.3389/fimmu.2020.566607 OpenUrl CrossRef PubMed 32. ↵ Li P. Cidea , brown fat and obesity . Mech Ageing Dev . 2004 ; 125 : 337 – 338 . doi: 10.1016/j.mad.2004.01.002 OpenUrl CrossRef PubMed Web of Science 33. ↵ Puri V , Ranjit S , Konda S , Nicoloro SMC , Straubhaar J , Chawla A , et al. Cidea is associated with lipid droplets and insulin sensitivity in humans . Proc Natl Acad Sci U S A . 2008 ; 105 : 7833 – 7838 . doi: 10.1073/pnas.0802063105 OpenUrl Abstract / FREE Full Text View the discussion thread. Back to top Previous Next Posted May 02, 2024. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following An ultrasound-guided biopsy technique for obtaining supraclavicular brown fat biopsies and preadipocytes Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share An ultrasound-guided biopsy technique for obtaining supraclavicular brown fat biopsies and preadipocytes Eline S. Andersen , Naja Zenius Jespersen , Tora Ida Henriksen , Bente Klarlund Pedersen , Camilla Scheele , Michael Bachmann Nielsen , Søren Nielsen bioRxiv 2024.04.30.570595; doi: https://doi.org/10.1101/2024.04.30.570595 Share This Article: Copy Citation Tools An ultrasound-guided biopsy technique for obtaining supraclavicular brown fat biopsies and preadipocytes Eline S. Andersen , Naja Zenius Jespersen , Tora Ida Henriksen , Bente Klarlund Pedersen , Camilla Scheele , Michael Bachmann Nielsen , Søren Nielsen bioRxiv 2024.04.30.570595; doi: https://doi.org/10.1101/2024.04.30.570595 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Physiology Subject Areas All Articles Animal Behavior and Cognition (7649) Biochemistry (17738) Bioengineering (13925) Bioinformatics (42059) Biophysics (21496) Cancer Biology (18643) Cell Biology (25577) Clinical Trials (138) Developmental Biology (13406) Ecology (19946) Epidemiology (2067) Evolutionary Biology (24370) Genetics (15627) Genomics (22551) Immunology (17772) Microbiology (40497) Molecular Biology (17212) Neuroscience (88786) Paleontology (667) Pathology (2845) Pharmacology and Toxicology (4835) Physiology (7663) Plant Biology (15177) Scientific Communication and Education (2047) Synthetic Biology (4304) Systems Biology (9838) Zoology (2272)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00