Reactivation of an errantivirus inDrosophilaovarian somatic tissue: from germline invasion to taming

preprint OA: closed
📄 Open PDF Full text JSON View at publisher
⚙ AI-generated deep summary by qwen3.7-flash, 2026-09-17 · read from full text ⓘ

This study investigated the reactivation of the ZAM errantivirus in Drosophila ovarian somatic tissue when piRNA-mediated control was abolished. The researchers observed that the virus invaded oocytes from somatic cells, causing severe fertility defects before the germline mounted an adaptive immune response to restrict invasion and restore reproductive function. These findings highlight the dynamic evolutionary arms race between host genomes and transposable elements, revealing a specific time window during oogenesis favorable for viral endogenization. Relevance to endometriosis: The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Summary Most Drosophila transposable elements (TEs) are LTR retrotransposons, some of which belong to the genus Errantivirus and share structural and functional characteristics with vertebrate endogenous retroviruses (ERVs). These virus-derived elements occupy a large part of the genome, but it is unclear whether and how they can be reactivated and if they retain their replication capacity. We created conditions where control of the Drosophila ZAM errantivirus through the piRNA pathway was abolished leading to its reactivation in real time in somatic gonadal cells. We show that ZAM may remain active in these cells indicating that errantiviruses may hide from the efficient germline piRNA pathway by being expressed exclusively in somatic cells. After reactivation, ZAM invaded the oocytes and severe fertility defects were observed. The germline then set up its own adaptive genomic immune response against the constantly invading errantivirus, restricting invasion and restoring fertility. Our results not only highlight how errantiviruses and their host adapt to each other but also reveal a time window during oogenesis that may be favourable for viral germline invasion and endogenization.
Full text 96,623 characters · extracted from preprint-html · click to expand
Reactivation of an errantivirus in Drosophila ovarian somatic tissue: from germline invasion to taming | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Reactivation of an errantivirus in Drosophila ovarian somatic tissue: from germline invasion to taming Marianne Yoth , Stéphanie Maupetit-Méhouas , Abdou Akkouche , Nathalie Gueguen , Benjamin Bertin , View ORCID Profile Silke Jensen , View ORCID Profile Emilie Brasset doi: https://doi.org/10.1101/2022.08.29.505639 Marianne Yoth 1 iGReD, Université Clermont Auvergne, CNRS, INSERM, Faculté de Médecine , 63000 Clermont-Ferrand, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Stéphanie Maupetit-Méhouas 1 iGReD, Université Clermont Auvergne, CNRS, INSERM, Faculté de Médecine , 63000 Clermont-Ferrand, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Abdou Akkouche 1 iGReD, Université Clermont Auvergne, CNRS, INSERM, Faculté de Médecine , 63000 Clermont-Ferrand, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Nathalie Gueguen 1 iGReD, Université Clermont Auvergne, CNRS, INSERM, Faculté de Médecine , 63000 Clermont-Ferrand, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Benjamin Bertin 2 LIMAGRAIN EUROPE, Centre de recherche , 63720 Chappes, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Silke Jensen 1 iGReD, Université Clermont Auvergne, CNRS, INSERM, Faculté de Médecine , 63000 Clermont-Ferrand, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Silke Jensen For correspondence: emilie.brasset{at}uca.fr silke.jensen{at}uca.fr Emilie Brasset 1 iGReD, Université Clermont Auvergne, CNRS, INSERM, Faculté de Médecine , 63000 Clermont-Ferrand, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Emilie Brasset For correspondence: emilie.brasset{at}uca.fr silke.jensen{at}uca.fr Abstract Full Text Info/History Metrics Preview PDF Summary Most Drosophila transposable elements (TEs) are LTR retrotransposons, some of which belong to the genus Errantivirus and share structural and functional characteristics with vertebrate endogenous retroviruses (ERVs). These virus-derived elements occupy a large part of the genome, but it is unclear whether and how they can be reactivated and if they retain their replication capacity. We created conditions where control of the Drosophila ZAM errantivirus through the piRNA pathway was abolished leading to its reactivation in real time in somatic gonadal cells. We show that ZAM may remain active in these cells indicating that errantiviruses may hide from the efficient germline piRNA pathway by being expressed exclusively in somatic cells. After reactivation, ZAM invaded the oocytes and severe fertility defects were observed. The germline then set up its own adaptive genomic immune response against the constantly invading errantivirus, restricting invasion and restoring fertility. Our results not only highlight how errantiviruses and their host adapt to each other but also reveal a time window during oogenesis that may be favourable for viral germline invasion and endogenization. Introduction In vertebrates, many LTR retrotransposons belong to the family of endogenous retroviruses (ERVs). ERVs are a class of transposable elements (TEs) that are closely related to infectious retroviruses. Retroviruses are a family of RNA viruses defined by their ability to reverse transcribe their RNA genome into DNA which is then integrated into the host cell genome. While most retroviruses infect somatic cells, occasionally they may infect germ cells and if integrated in the germline genome, they may emerge as ERVs: they become permanent elements in the host genome and are vertically transmitted. ERVs are then capable of replicating themselves and integrating at new genomic loci, which contributes to their success in invading vertebrate genomes. In Human, ERV-related sequences occupy 9% of the genome, in mice 12%, in rat 10.2%, in microbats 5.3%, in marmosets 7.5% ( http://repeatmasker.org/genomicDatasets/RMGenomicDatasets.html ). Each new ERV copy then evolves independently and can be at the origin of the emergence of a new TE family. In mice, IAPE and IAP ERVs illustrate the evolutionary history of ERVs 1 . Indeed, IAPEs are still retroviruses capable of infecting other cells, after an extracellular passage, whereas the highly repeated IAPs, derived from IAPEs by losing the envelope gene (env), are strictly intracellular, evolving within a single cell. It is crucial to note that TEs, can only be maintained in a species if they are able to transpose into the germline genome. If they do not, at least from time to time, they will accumulate mutations until there are no functional copies left and the TE family dies out. Some TEs gained cell and developmental stage specific expression 2 – 6 . TEs that have acquired the capacity to be expressed exclusively in somatic cells must therefore maintain their ability to invade germ cells to survive. ERVs are TEs, and although the presence of TEs in the genome has been shown to provide some evolutionary benefits (reviewed in 7 ), unregulated TE expression and transposition represent a threat to genome integrity and host fitness. Thus, under physiological conditions, most TEs are repressed by epigenetic mechanisms and maintained in a dormant state. In metazoan gonads, TE expression and mobilization is restrained by PIWI-interacting RNAs (piRNAs) (reviewed in 8 , 9 ). The piRNA pathway has been extensively studied in the Drosophila melanogaster ovary that comprises about 16 ovarioles, each of which contains a succession of follicles composed of germ cells surrounded by somatic follicle cells 10 . piRNAs originate from specific source loci, the piRNA clusters 11 . In Drosophila, the piRNA clusters expressed in the germline are particularly numerous and diverse while there is only one major piRNA cluster expressed in gonadal somatic cells, that is flamenco ( flam ) 12 – 16 . Within the Drosophila genome, there is a specific group of TEs that share structural and functional characteristics with vertebrate ERVs. These insect LTR transposons are classified as errantiviruses and belong to the Metaviridae family. In Drosophila melanogaster some errantiviruses have been shown to have the capacity to move from cell to cell. These include TEs such as ZAM, Idefix or Gypsy whose expression is restricted to the somatic follicle cells of the ovary 17 – 24 . The intercellular invasion capacity may pose a particular threat, especially if they are able to cross the so-called Weismann barrier separating somatic and germ cells (reviewed in 25 ). In the germ cells, TE expression and transposition are known to be controlled by the piRNA pathway, but research has primarily concentrated on how piRNAs silence TEs that are expressed in the cells where the corresponding piRNAs are produced. The role of piRNAs in the silencing of a TE that is activated in a cell type different from the one where the silencing mechanism must take place remains unclear. Consequently, whether these TEs can escape the robust epigenetic control mediated by piRNAs when arriving in the germline and how they are tamed by the host over time remained to be puzzled out. The ZAM errantivirus was discovered through its uncontrolled activity in an unstable line, RevI- H2, about 25 years ago 26 , 27 . ZAM has 3 intact ORFs encoding proteins whose function is analogous to that of the Gag, Pol and Env proteins of ERVs or retroviruses 26 . In the RevI-H2 Drosophila line bearing a large deletion in the flamenco piRNA cluster, ZAM had become active and is specifically expressed in gonadal somatic cells 14 , 17 . Moreover, ZAM inserted into multiple new loci in the RevI-H2 line, including a germline-specific piRNA cluster, resulting in unexpected production of germline piRNAs that map to ZAM 26 – 28 . The biological role of these germline ZAM -mapping piRNAs remained unexplored. Since these studies, ZAM has emerged as a key model for studying host-TE interactions and the relationship between somatic cells and the germline during TE invasion. By analyzing different conditions of ZAM reactivation, we aimed here to study what happens in real time when an errantivirus is reactivated de novo and how the host responds. Specifically, we sought to elucidate whether piRNAs produced in the germline counteract TE invasion from the somatic cells or whether TE transcripts are protected from degradation by virus-like particles when arriving in the germline. We show that in the RevI-H2 line, ZAM is still expressed in the follicle cells but it doesn’t invade the germline while ZAM copies with invasive capacities have been maintained in the genome. To recreate the initial unstable condition, we de novo reactivated ZAM in the ovarian follicle cells, either by soma-specific knock-down of the piRNA pathway, or by deleting a ZAM copy in the somatic flamenco piRNA cluster, while keeping the piRNA pathway fully functional. De novo ZAM reactivation in the follicle cells led to a massive ZAM invasion deep into the adjacent oocyte and its ooplasm. We demonstrate that this invasion could be impeded by the expression of de novo ZAM -targeting piRNAs produced in the germ cells themselves demonstrating that these piRNAs are functional against the native ZAM . These results show that by being expressed exclusively in somatic cells, errantiviruses may evade the control by the very efficient germinal piRNA pathway and remain active for long periods of time. The challenged germ cells then mount an adaptive genomic immune response to tackle the permanent invasion. Results In an ancient flamenco mutant line, ZAM is still expressed, but the line is nevertheless stable To investigate the history of ZAM transposition dynamics, we monitored ZAM copies in the RevI-H2i2 line, an isogenic line that was recently derived from the parental flam mutant RevI- H2 line that has more than 25 years of laboratory history. It had previously been reported that the RevI-H2 line was unstable and that ZAM actively transposed in this line 27 . The ZAM instability in RevI-H2 had been linked to a deletion of a large part of the flam piRNA cluster. This deletion spanned over more than 120 kb and comprised many different TE relics, including more or less recent copies, and all ZAM -related copies of the flam locus 14 , 15 . In the RevI-H2i2 genome, Oxford Nanopore Technology (ONT) genome sequencing revealed 18 ZAM copies ( Fig. 1a and Table 1 for coordinates). Only one of these ZAM copies was also present in the reference genome ( http://flybase.org ). The other 17 new insertions were very similar to the ZAM reference element identified in the initial RevI-H2 line 26 and we could clearly localize 14 of the 17 new ZAM insertions. Interestingly, ONT long-read sequencing, allowed identifying different ZAM variants. Specifically, six were full-length ZAM elements (ZAM-fl), one, named ZAM-v1, harbored a deleted 5’-UTR (5’ untranslated region), two, named ZAM-v3 , had a 303 bp deletion within the 5’-UTR, four had large internal deletions in the coding regions, and four were full-length insertions with a deletion at the C-terminal end of the pol gene of positions 5494 to 6120 in the ZAM internal sequence 26 (Repbase ZAM _I, https://www.girinst.org/repbase/29 ). This deleted part of the pol gene does not correspond to any known protein domain and the fact that there are five identical copies of this ZAM at different locations in the RevI-H2i2 genome indicates that this ZAM variant, which we named ZAM-v2 , is competent for transposition. The full-length ZAM , ZAM-v1 and ZAM-v3 copies all potentially encode Gag, Pol and Env proteins ( Fig. 1a ). Download figure Open in new tab Figure 1: ZAM is expressed in follicle cells in the RevI-H2i2 isogenic line but the line is stable. a . ZAM elements in the RevI-H2i2 genome. Each triangle represents a ZAM insertion. The different ZAM-variants are presented in the illustration on the right. The positions refer to ZAM internal sequences ( ZAM _I in RepBase). Blue: full-length ZAM elements (ZAM-fl); violet: ZAM variants ZAM-v1 with deleted 5’-UTR; orange: ZAM -variants ZAM-v2 , in which positions 5494-6120 are deleted; yellow: ZAM-variants ZAM-v3 with a 303 bp deletion in the 5’-UTR; green: ZAM with internal deletions other than ZAM variants above; gray: full-length ZAM copy also present in the reference Release 6 genome ( http://flybase.org ). The dotted box indicates four ZAM copies on the X chromosome inserted in referenced germline piRNA clusters (Cluster 9 and 13). No ZAM insertion was found in chromosome 4 (1.35 Mb, not shown). For coordinates and details see Supplementary Table 1. b . Projection of confocal images of ovarioles, germarium, and stage 10 follicles showing ZAM expression by smRNA FISH (in red) in RevI- H2i2 ovaries. DNA was stained with DAPI (white). c . Fold-change in the steady-state ZAM , Gypsy and Burdock RNA levels for RevI-H2i2 ovaries compared with w 1118 ovaries (control), quantified by RT-qPCR (primer sequences in Supplementary Table 5). At least three biological replicates and three technical replicates were used. ** p-value 0.05) (Mann-Whitney test). Error bars indicate the standard deviation (SD). d . Confocal sections of stage 10 egg chambers of RevI-H2i2 and w 1118 control line showing ZAM -encoded Gag (green) and Env (red) proteins. DNA was stained with DAPI (white). e . Morphology of control and RevI-H2i2 ovaries. f. Box plot displaying the number of eggs laid per fly per day by control and RevI-H2i2 females. Each dot represents an individual female. The midline indicates the median value, and the box shows the first and third quartile. Error bars indicate the SD. ns, not-significant ( p-value >0.05) (Mann-Whitney test). In the initial RevI-H2 line, a ZAM insertion was found in the germline piRNA cluster 9 , which is close to the X chromosome centromere 28 . Here, in the RevI-H2i2 line, thanks to long-read sequencing, we could identify ZAM insertions in repeated sequences, such as piRNA clusters, more accurately. We now identified three ZAM insertions in piRNA cluster 9 (one ZAM-fl and two ZAM-v2 ), and also a ZAM-fl insertion, which is localized in either piRNA cluster 13 or cluster 56 (uncertainty is due to flanking repeats, piRNA clusters as in 30 ) ( Fig. 1a ). We reanalyzed the Illumina sequencing data of the initial RevI-H2 line and found evidence that all these ZAM insertions in piRNA cluster 9 and 13 or 56 were already present ten years ago, and that at least 14 of the ZAM insertions in the RevI-H2i2 line were already present in the parental RevI-H2 line. This result indicates that the genomic ZAM profile is the same as ten years ago and suggests that no new ZAM insertions occurred since then in the germline. Strikingly, no new ZAM insertion was detected in the flam piRNA cluster. Thus, in the RevI- H2i2 line, no ZAM piRNA can be produced from flam , the major somatic piRNA source locus. Interestingly, single-molecule RNA fluorescence in situ hybridization (smRNA FISH) revealed the presence of ZAM RNA in RevI-H2i2 follicle cells, demonstrating that ZAM is not silenced in these somatic cells and that transcriptionally active copies of ZAM are still present in the genome. ZAM transcripts were produced in follicle cells, starting very early during oogenesis in the germarium. Then, after stage 8, ZAM transcripts accumulated in a patch of follicle cells located at the posterior side of the follicles. We did not detect any ZAM staining in germ cells (nurse cells or oocytes) ( Fig. 1b ). RNase A treatment led to complete loss of ZAM staining in the follicle cells ( Supplementary Fig. 1a ). We did not detect any ZAM RNA in the Iso1A, w 1118 and w IR 6 control ovaries ( Supplementary Fig. 1b ). Using RT-qPCR, we confirmed that ZAM was expressed in the RevI-H2i2 ovaries. Conversely, other TEs such as the soma-specific Gypsy and the germline-specific Burdock , were not upregulated ( Fig. 1c ). Interestingly, we observed that, besides the full-length ZAM, at least ZAM variants ZAM-v2 and ZAM-v3 are expressed in RevI-H2i2 ovaries ( Supplementary Fig. 1c ,d). ZAM is an errantivirus that encodes Gag, Pol and Env proteins. Using immunostaining, we were able to detect ZAM Gag and Env proteins that accumulated in the posterior follicle cells in late-stage follicles (> stage 9) ( Fig. 1d ). All these results showed that ZAM transcripts and proteins are still expressed in the RevI-H2i2 line. Although ZAM was expressed in follicle cells, the RevI-H2i2 line was fertile. Indeed, the ovary morphology and the number of eggs laid were comparable in RevI-H2i2 and control females ( Fig. 1e , f). Altogether, these results indicate that no silencing mechanism had been set up to repress the ZAM errantivirus in follicle cells suggesting that ZAM expression has no major deleterious effect in the RevI-H2i2 line and that there is no selective pressure to specifically repress ZAM in the follicles cells. These findings suggest that RevI-H2i2 is a stable line although ZAM is actively expressed in follicle cells. Germline ZAM- targeting piRNAs constrain ZAM invasion from adjacent somatic cells Transposition of ZAM in the initial RevI-H2 line had occurred in the germline, as attested by the transmission of ZAM insertions to the offspring, despite the fact that ZAM is specifically and exclusively expressed in the somatic follicle cells. This confirms that the ZAM errantivirus, when expressed in follicle cells, transits to the germline to integrate into the germ cell genome. However, we showed that ZAM insertions are stabilized in the RevI-H2i2 line. The RevI-H2i2 flies produce high amounts of sense and antisense ZAM -derived piRNAs with a ping-pong signature, revealed by an over-representation of 10-nucleotide 5’-overlaps between sense and antisense ZAM -derived piRNAs ( Fig. 2a ), while there was no ping-pong signature for ZAM in diverse control lines 23 , 28 . Ping-pong amplification of piRNAs can only occur in the germline in Drosophila (reviewed in 31 ). Thus, these ZAM piRNAs observed in RevI-H2i2 are derived from the germline. Importantly, our previous research has demonstrated that the X chromosome of the RevI-H2 line, which contains the ZAM copies inserted in germline piRNA clusters, is both necessary and sufficient to produce ZAM -regulating piRNAs 28 . Additionally, in both RevI-H2 28 and RevI-H2i2 background, a ZAM sensor transgene is silenced in the germ cells ( Supplementary Fig. 2a ). We therefore hypothesized that piRNAs produced in germ cells can thwart ZAM invasion from somatic cells to the germline and thus protect the germline from new ZAM transposition. However, piRNAs are known to silence TEs in the cells where they are produced and TEs, such as ZAM , are not expressed directly in germ cells but arrive from surrounding somatic cells. Moreover, ZAM RNA may transit in an encapsulated form and the capacity of piRNAs to target encapsulated RNAs remains unknown. Download figure Open in new tab Figure 2: Germline ZAM piRNAs produced in RevI-H2i2 germ cells counteract ZAM invasion. a. Density plot of ZAM -mapping regulatory piRNAs along the ZAM sequence in RevI-H2i2 ovaries (up to 3 mismatches). In the lower right corner is the histogram showing the percentage of 5’-overlaps between sense and antisense ZAM -derived piRNAs (23–29 nt) in RevI-H2i2 ovaries. The proportion of 10nt 5’-overlaps is in red and the corresponding Z-score is indicated. b. Antisense piRNAs mapping to TE internal sequences (0-3 mismatches) in the RevI-H2i2 line upon white- (control), ago3-, or piwi -GLKD. Normalized per million of genome-mapping piRNAs. c. Histogram showing the percentage of 5’-overlaps between sense and antisense ZAM -mapping piRNAs (up to 3 mismatches) in white-, ago3-, or piwi- GLKD RevI-H2i2 ovaries. The percentage of 10nt overlaps is in red and the corresponding Z-score is indicated. d. Color-inverted confocal images of stage 10 egg chambers showing ZAM smRNA FISH signal in ovaries of the indicated genotypes. e. Bar plot showing the percentage of stage 10 follicles with ZAM RNA detected in the ooplasm by smRNA FISH of RevI-H2i2 ovaries with the indicated GLKD. This experiment was done three times and approximately 50 follicles per conditions were observed for each experiment. Error bars indicate the SD. f. Scatter plot showing the normalized counts of antisense Piwi-bound piRNAs mapping to individual internal TEs sequences in control ovaries ( white -sKD) and vret -sKD ovaries. Antisense piRNA counts, mapped allowing up to 3 mismatches, were normalized per million of genome-mapping piRNAs (RPM, here in logarithmic scale). TEs in red have a vret -sKD/ white -sKD ratio <0.3. ZAM is boxed black. g. Confocal images of ovarioles showing ZAM smRNA FISH signal (in red) in white - (control) and v ret -sKD ovaries. DNA was stained with DAPI (white). h . Color- inverted confocal projection of stage 10 egg chamber showing ZAM sm RNA FISH signal in vret -sKD ovaries. i. Bar plot showing the percentage of stage 10 follicles with ZAM RNA invasion of the ooplasm, assessed by ZAM smRNA FISH, of white - (control) and vret -sKD ovaries. This experiment was done twice and ∼50 follicles per condition were observed for each experiment. Error bars indicate the SD. To test whether germline ZAM-derived piRNAs were efficient to counteract an invasion coming from surrounding somatic cells, we abolished the piRNA pathway in the germ cells by germline-specific knock-down (GLKD) of piRNA pathway components, in a RevI-H2i2 genetic background producing ZAM piRNAs in the germline. It is important to note that, during the genetic crosses performed, only the X chromosome of the RevI-H2i2 was tracked to ensure that the ZAM insertions in the germline piRNA clusters were maintained (crossing schemes presented in Figure S6). We observed that the germline knock-down of proteins of the piRNA pathway, Zucchini (Zuc), Argonaute 3 (Ago3) and Piwi, led to a decrease in the production of ZAM- targeting piRNAs, i.e. piRNAs that are complementary and thus antisense to ZAM ( Fig. 2b , Supplementary Fig.2b). The decrease in antisense piRNAs was comparable to that observed for germline TEs (i.e., Burdock and Accord ) or intermediate TEs (i.e., Idefix ), while somatic- TEs such as Tirant did not show a similar decrease. Furthermore, in ago3 -GLKD ovaries, the ping-pong signature for ZAM was abolished, as for many other germline-specific TEs, while it was maintained in piwi- GLKD ovaries for instance ( Fig. 2c , Supplementary Fig. 2c ). We then analyzed the subcellular localization of ZAM RNAs by smRNA FISH in the RevI- H2i2 white -GLKD control line in which ZAM -derived piRNAs are produced in the germline. ZAM RNA staining was restricted to follicle cells, only a minor ZAM RNA signal was detected in the posterior pole of approximately 10% of stage 10 oocytes ( Fig. 2d,e ). However, when the piRNA pathway was abolished in RevI-H2i2 germ cells through vreteno (vret) , zuc, ago3 or armitage (armi) GLKD, ZAM RNA was no longer restricted to follicle cells, a high signal was also detected in oocytes. ZAM RNA spread throughout the ooplasm, but was clearly enriched at the posterior pole of the oocyte, adjacent to the ZAM -expressing follicle cells, supporting the fact that ZAM RNA originated from follicle cells ( Fig. 2d ). Actually, 30-70% of stage 10 follicles showed a strong ZAM RNA signal in oocytes ( Fig. 2e ). The strongest invasion phenotype was observed for the RevI-H2i2 ago3 -GLKD condition where we found a decrease in the production of ZAM -derived piRNAs and the loss of the ping-pong signature ( Fig. 2b ). In this condition, ZAM RNA accumulation in the ooplasm was correlated with a strong increase of ZAM RNA in total ovaries (RT-qPCR data) ( Supplementary Fig. 2d ). These results showed that when the piRNA pathway is affected in the germline , ZAM RNAs transit from the somatic follicle cells, where they are produced, to the oocyte. Altogether, our data strongly suggest that ZAM piRNAs produced by the germline piRNA pathway trigger post-transcriptional silencing of ZAM RNAs arriving from follicle cells. We confirmed this finding using a line where no ZAM -derived piRNA is produced in the germline ( w 1118 genetic background) and in which we knocked down the piRNA pathway in the follicle cells by somatic knock-down (sKD) of armi , vret , piwi or yb . The amount of antisense piRNAs that target soma-specific TEs, including ZAM, was strongly decreased ( Fig. 2f , Supplementary Fig. 2e , f). RT-qPCR analysis showed that ZAM and another soma-specific TE, Gypsy , were derepressed, but not the germline-specific Burdock ( Supplementary Fig. 2g ). Importantly, smRNA FISH results revealed that ZAM RNAs were not restricted to the posterior follicle cells. Like in ovaries harboring GLKD of the piRNA pathway in RevI-H2i2 background, ZAM RNAs were present in oocytes ( Fig. 2g,h , Supplementary Fig. 2h ). We detected ZAM RNAs in the ooplasm in 90% of stage 10 follicles ( Fig. 2i ). This result confirmed that, when no ZAM piRNA is produced in the germline, ZAM RNAs expressed in the somatic follicle cells transit to the oocyte. ZAM RNAs transcribed in follicle cells transit to the oocyte and are conveyed to the embryos in absence of germline ZAM piRNAs Although ZAM is expected to be transcribed only in follicle cells due to its dependence on the Pointed somatic transcription factor 17 , 32 , it was possible that some ZAM copies acquired the capacity to be expressed in the germline over time. Therefore, we wanted to rule out the possibility that ZAM RNAs detected in the RevI-H2i2 oocyte originated from germinal nurse cells. If some ZAM genomic insertions could be expressed in the germline of the RevI-H2i2 line, then germline depletion of Piwi , which is required for the transcriptional gene silencing of TEs, should lead to the transcriptional de-silencing of ZAM . We observed that Piwi-GLKD in the RevI-H2i2 ovaries led to the de-silencing of TEs that are capable of transcribing in the germline such as Burdock . However, we did not observe any changes in either the ZAM RNA level or localization ( Fig. 3a,b ). Moreover, depletion of Ago3 induced a substantial accumulation of ZAM RNA solely in the ooplasm. In contrast to TEs expressed in the germline (e.g, Burdock ), we never detected ZAM RNA staining in the cytoplasm of the nurse cells at any stage ( Fig. 3c ). These results strongly support that ZAM cannot be expressed in the RevI-H2i2 germ cells and that ZAM RNAs detected in oocytes originate from the somatic follicle cells, not nurse cells. Download figure Open in new tab Figure 3: ZAM RNAs transcribed in the follicle cells transit to the oocyte and are deposited in early embryos. a. Confocal images of stage 10 follicles in the RevI-H2i2 piwi -GLKD line. Burdock (green) and ZAM (red) mRNAs were detected by smRNA FISH. DNA was stained with DAPI (blue). b. Fold-change in the steady-state ZAM , Burdock and Piwi RNA levels for RevI-H2i2 piwi- GLKD ovaries compared with RevI-H2i2 white- GLKD ovaries (control), quantified by RT- qPCR (primer sequences in Supplementary Table 5). At least three biological replicates and three technical replicates were used. *: p- value < 0.05, **: p -value 0.05) (Mann-Whitney test). Error bars indicate the standard deviation (SD) c. Confocal images of ovarioles and of an isolate stage 8 egg chamber in the RevI-H2i2 ago3 -GLKD line. Burdock (green) and ZAM (red) mRNAs were detected by smRNA FISH. DNA was stained with DAPI (blue). d. Color-inverted confocal images showing ZAM smRNA FISH signal in early embryos collected 0-2 hours after egg laying (AEL). Mothers were from the indicated genotype. e. Zoom on the posterior part of a vret -sKD early embryo collected at 0-1 hours AEL showing ZAM RNA accumulation at the posterior pole. f. Color-inverted confocal images showing ZAM smRNA FISH signal in embryos laid by vret -sKD females at the indicated developmental stages. Throughout the animal kingdom, the first embryonic development stages are controlled by transcripts and proteins deposited by the mother during oogenesis 33 . In Drosophila, most of the maternal mRNAs are dumped from nurse cells into the oocyte during oogenesis. Although ZAM transcripts originate from the somatic follicle cells, when we investigated ZAM RNA transmission to the oocyte, we found such transcripts also in early embryos. Indeed, in conditions where ZAM RNA had been detected in oocytes, smRNA FISH experiments revealed a strong accumulation of ZAM RNAs in early embryos, before the zygotic transition, 0-2 hours after egg laying: from a RevI-H2i2 mother with GLKD of the piRNA pathway, and also from a mother without germinal ZAM piRNAs with sKD of the piRNA pathway in follicle cells ( Fig. 3d , Supplementary Fig. 3a ). Furthermore, ZAM RNAs accumulated at the posterior pole of early embryos where future germ cells cellularize ( Fig. 3e , Supplementary Fig.3b). We detected ZAM RNA in high quantity until stage 5 of embryogenesis and few ZAM RNA signal persisting until the cellularization of the blastoderm (∼stage 8-9) ( Fig. 3f ). In the progeny of the RevI-H2i2 line, we did not detect any ZAM RNA, although ZAM RNAs were produced in follicle cells of RevI-H2i2 ovaries ( Fig. 3d ). This confirmed that ZAM invasion of the germline does not occur in this line. These data revealed an efficient post-transcriptional silencing of ZAM RNAs arriving from follicle cells into the oocyte by piRNAs produced in the germline. This mechanism should limit the transposition of the somatic ZAM retrotransposon into the germline genome. De novo ZAM reactivation leads to massive oocyte invasion and may result in severe fertility defects Our results demonstrate that an adaptive response can emerge to counteract the invasion of germ cells by an errantivirus. To go deeper, we sought to assess the direct impact of reactivating an errantivirus in real time, before the establishment of any adaptive response by the germline. To conduct this study, we aimed to specifically reactivate ZAM de novo . The loss of the piRNA pathway in the somatic follicle cells leads to ZAM reactivation, however many other TEs are also desilenced ( Supplementary Fig. 2e , g). Moreover, alteration in the expression of piRNA pathway genes also results in severe developmental defects during oogenesis 34 – 37 . Therefore, this model cannot be used to specifically analyze the impact of ZAM reactivation in ovaries. On the other hand, in the RevI-H2 line where ZAM was also reactivated, a large deletion of flamenco occurred during non-targeted mutagenesis and an adaptive response had already been set up in the germline. Thus, we chose to create a condition where a single TE is reactivated de novo and the piRNA pathway is fully functional. Using CRISPR-Cas9, we de novo deleted the longest ZAM copy in the flam piRNA cluster in a line carrying the X chromosome of the Iso1A reference line. As in this line, the flam ZAM copy is at the genomic position X:21,778,810..21,783,994, we used two guides designed to create a deletion spanning over X:21,777,135..21,784,062 (6926 pb). We named the resulting line flamΔZAM . Mapping of genome-unique piRNAs to the flam locus highlighted the complete loss of piRNA production in the targeted region compared with the control Iso1A line ( Fig. 4a ). Conversely, the global production of genome-unique piRNAs mapping upstream and downstream of ZAM was not affected. We confirmed that the deletion induced a strong decrease of all piRNAs mapping to the internal regions of the reference ZAM . However, piRNAs targeting the ZAM LTR were still produced ( Fig. 4b ). In line with these results, PCR amplification and DNA sequencing of the CRISPR-Cas9 target locus showed that only the internal regions of ZAM had been deleted from the flam piRNA cluster, resulting in the retention of a solo-LTR at the initial ZAM insertion site (Supplementary Fig. 4). Download figure Open in new tab Figure 4: ZAM deletion from the flamenco piRNA cluster leads to ZAM reactivation and oocyte invasion. a. Density plots showing genome-unique piRNAs mapping over 20 kb of the flamenco piRNA cluster (without mismatch) where the ZAM insertion is located (Release 6: X:21,769,891..21,789,891) in the control (Iso1A) and flam Δ ZAM lines. The position of the flamenco ZAM copy (ZAM-flam) is indicated. The positions of the sgRNAs used for ZAM-flam deletion by CRISPR-Cas9 are shown in red. b. Density plot of ZAM -mapping regulatory piRNAs along the ZAM sequence in control and flamΔZAM ovaries (up to 3 mismatches). c. Scatter plot showing the normalized counts of antisense regulatory piRNAs mapping to individual internal TE sequences in control ovaries (Iso1A) versus flamΔZAM ovaries. Antisense piRNA counts, mapped allowing up to 3 mismatches, were normalized per million of genome-mapping piRNAs (RPM, here in logarithmic scale). TEs in red have a flamΔZAM / Iso1A ratio <0.3. d. Color-inverted confocal images of ovarioles (upper panels) and stage 10 egg chambers (lower panels) from the indicated genotypes showing ZAM smRNA FISH signal. e. Ovaries of the flamΔZAM line and of the flamΔZAM line with three recent ZAM copies introduced by genetic crossing and X chromosome recombination with the RevI-H2 line. f. Box plot displaying the number of eggs laid per fly per day by RevI-H2i2, flamΔZAM and flamΔZAM females with three recent ZAM copies. Each dot represents an individual female. The midline indicates the median value, and the box shows the first and third quartile. Error bars indicate the SD. *** p-value 0.05) (Mann-Whitney test). In the flamΔZAM line , only the production of ZAM -derived antisense piRNAs was strongly altered, whereas the production of antisense piRNAs mapping to other TEs was not affected ( Fig. 4c ). This shows that the ZAM deletion from flam impairs ZAM -derived piRNA production, but does not affect the global piRNA production in ovaries. In sum, in the flamΔZAM line, the piRNA pathway was functional and almost no piRNAs that could target the internal ZAM sequences were produced. We then analyzed ZAM RNA expression by smRNA FISH in flamΔZAM ovaries. Surprisingly, we did not detect any ZAM expression ( Fig. 4d - panel 1). Based on this observation, we hypothesized that either there was no functional ZAM copy in the flamΔZAM line, or that the ZAM solo-LTR retained in flam was sufficient to silence ZAM expression. To check this, we exchanged chromosome II or III of the flamΔZAM line with chromosome II or III of the RevI- H2i2 line that each contains three or two recently transposed potentially functional ZAM copies, respectively. We made sure not to introduce the ZAM copies located in germline piRNA clusters of the X chromosome of the RevI-H2i2 line that are involved in the production of ZAM-regulating piRNAs in the germline. smRNA FISH revealed that ZAM RNAs were strongly expressed when these ZAM copies were added to the genome of the flamΔZAM line ( Fig. 4d – panels 2 and 3). We also observed a strong invasion of oocytes with chromosome II, where approximately 70% of stage 10 follicles presented ZAM RNAs in the ooplasm, and moderate invasion with chromosome III. Similarly, we observed strong invasion of the oocyte when we added three euchromatic ZAM copies located on the telomere side of the X chromosome of the RevI-H2 line to the flamΔZAM genome ( Fig. 4d – panel 4). Overall, our findings show that in the absence of ZAM -derived piRNAs in the somatic follicle cells and in the germline, transcripts from functional ZAM copies massively invade the oocytes. Additionally, our results demonstrate that the presence of a solo-LTR of ZAM (454 bp) in the flam piRNA cluster of the flamΔZAM line was not sufficient to silence ZAM expression in follicle cells ( Supplementary Fig. 4a ). The three ZAM copies added to the X chromosome of the flamΔZAM line consist of one full length ZAM insertion ( ZAM-fl ), one ZAM-v2 and one ZAM-v3 . Utilizing the sequence specificity of each insertion, we conducted RT-PCR analysis to determine which copies were expressed. The results revealed that ZAM-fl , ZAM-v2 and ZAM- v3 copies are expressed in RevI-H2i2 ovaries as well as when joined to the flamΔZAM genome (Supplementary Fig, 4b). An important observation was that the flamΔZAM flies that contain the three functional ZAM copies on the X chromosome displayed atrophied ovaries and reduced fertility compared with the control flamΔZAM flies that lack functional ZAM copies ( Fig. 4e,f ). Specifically, 90% of flamΔZAM females with active ZAM copies did not lay eggs. These data indicate that the reactivation of one single errantivirus in a patch of follicle cells can induce severe fertility defects. These results suggest that when ZAM piRNAs are produced in the germline, they contribute to ensure not only genome integrity but also fertility by protecting the oocytes against ZAM invasion. No initial small RNA response takes place after ZAM reactivation The reactivation of an errantivirus, such as ZAM, in a genetic context where the piRNA pathway is functional provides a unique opportunity to examine the genomic immune response to TE reactivation and germline invasion. piRNAs and siRNAs are the two main classes of small RNAs produced to control the expression of transposable elements and counteract viral infection, respectively. Moreover, invading viral RNAs can be processed to small RNAs to initiate a primary response 38 , 39 . To characterize the small RNA response upon ZAM reactivation, we sequenced small RNAs that are complexed with Argonaute proteins (named here “regulatory” piRNAs) from flamΔZAM ovaries containing two or four potentially functional ZAM copies. In the flamΔZAM line, there were no de novo ZAM piRNAs (23 to 29 nt) produced upon ZAM reactivation, despite germline invasion. Indeed, only few sense and antisense ZAM piRNAs were detected in the ovaries of the flamΔZAM line that contained functional ZAM copies ( Fig. 5a , Supplementary Fig. 5a ). Moreover, this lack of piRNA production concerned only ZAM . The level of regulatory piRNAs targeting other TEs was not reduced ( Fig. 5b , Supplementary Fig. 5b ). Download figure Open in new tab Figure 5: No initial piRNA and siRNA response after ZAM retrotransposon reactivation a. Density plot of regulatory piRNAs along the ZAM internal sequence in ovaries from a control line ( white -sKD) and from the flamΔZAM -RevI-H2i2 chr III line (up to 3 mismatches). b. Scatter plots showing the normalized counts of regulatory piRNAs mapping to individual internal TE sequences in control ovaries ( white-sKD ) versus flamΔZAM -RevI-H2i2 chr III ovaries. piRNA counts, mapped allowing up to 3 mismatches, were normalized per million of genome-mapping piRNAs (RPM, here in logarithmic scale). c . Density plot of ZAM -mapping regulatory siRNAs (21nt small-RNAs complexed with Argonaute proteins) along the ZAM internal sequence produced in control ( white -sKD) and in flamΔZAM RevI-H2i2 chr III ovaries (0-1 mismatch). d . Scatter plot showing the normalized counts of antisense regulatory siRNAs mapping to individual internal TE sequences in control ovaries ( white-sKD ) versus flam Δ ZAM RevI-H2i2 chr III ovaries. Antisense siRNA counts, mapped allowing up to 1 mismatch, were normalized per million of genome-mapping siRNAs (RPM, here in logarithmic scale). We sequenced total small RNAs in vret- or yb -sKD ovaries where ZAM was also reactivated. Surprisingly we observed sense ZAM -mapping small RNAs of various sizes, including 23-29 nt small RNAs that are not produced in a white -sKD control condition ( Supplementary Fig. 5c ). However, the sense 23-29 nt ZAM -derived small RNAs detected in yb - and vret -sKD ovaries did not display uridine bias at the 5’ end, a feature of mature primary piRNAs ( Supplementary Fig. 5d ). Furthermore, these sense ZAM -mapping small RNAs were not immunoprecipitated with Piwi proteins. We detected almost no Piwi-bound sense or antisense ZAM -mapping piRNAs in vret- or yb- sKD ovaries ( Supplementary Fig. 5e ). In addition, no sense regulatory ZAM piRNAs complexed with Argonaute proteins were detected in vret- sKD ovaries ( Supplementary Fig. 2f ). These results suggest that the sense ZAM -mapping small RNAs are most likely degradation products of excess ZAM sense transcripts and not piRNAs. Thus, in these different conditions, we did not detect any primary piRNA response either in the somatic cells where ZAM is expressed or in the oocyte that it invades. Given that the ZAM errantivirus shares some structural and functional characteristics with retroviruses, we also asked whether ZAM reactivation could trigger a siRNA response. For this, we analyzed the production of 21 nt small RNAs complexed with Argonaute proteins (“regulatory” siRNAs). Similar levels of ZAM 21 nt small RNAs were produced in a control line and in the flamΔZAM line with functional ZAM copies ( Fig. 5c ). Globally, the production of 21 nt small RNAs in this line was comparable to the control for all TEs, including ZAM ( Fig. 5d ). ZAM -mapping 21 nt small RNAs were slightly increased only in the vret -sKD condition, compared to the white -sKD control line without ZAM expression ( Supplementary Fig. 5f ). Overall, our results suggest that no or very few siRNAs that could protect ovaries from ZAM activity are produced upon activation of this errantivirus in follicle cells. Therefore, we propose that no innate small RNA response is triggered in the lines where ZAM is reactivated, suggesting that ZAM will not be brought under control until the establishment of specific adaptive immunity and immune memory. Discussion The discovery that piRNAs produced in germ cells not only restrict TE expression in the germline itself but also counteract the invasion of errantiviruses from adjacent cells reveals a novel role of piRNAs produced locally as an effective defense mechanism at the tissue scale. When piRNAs against ZAM are produced in the germline, ZAM transcripts are limited to a patch of follicle cells and flies are fertile. Conversely, in the absence of ZAM -derived piRNAs in the germline, transcripts from functional ZAM copies massively invade the oocytes and are even transmitted to the embryos. At the molecular level, our study revealed that piRNAs produced in nurse cells and dumped into the oocyte can target RNAs produced by follicle cells and delivered to the oocyte. It is tempting to speculate that the ZAM RNAs arriving from somatic cells are targeted by complementary antisense piRNAs and degraded through the ping-pong cycle (reviewed in 31 ). This would result in the production of ZAM sense piRNAs, thus participating in the amplification of the pool of piRNAs against ZAM and strengthening the defense mechanism against the invasion. Transposition in the germ cell genome is crucial for TE propagation in a population because it allows the vertical transmission of new insertions. At the time of invasion (e.g. in the flamΔZAM line), no ZAM -derived piRNA was produced in somatic or germ cells. Therefore, this condition could be compared to what happens when a TE first enters a new species by horizontal transfer. In this case, according to several studies, an initial transposition burst occurs that leads to TE accumulation in the genome before the induction of an adaptive response by the host to control transposition 40 – 45 . We found at least 17 new ZAM insertions in the RevI-H2i2 genome, testifying that ZAM actively transposed. Surprisingly, we identified three ZAM insertions in the same germline piRNA cluster on the X chromosome. It has been proposed that two different mechanisms can explain the de novo piRNA production required to specifically silence a novel invading TE. Indeed, piRNAs can be produced from a new TE insertion into a pre-existing piRNA cluster, and also by stand-alone TE insertions converted into piRNA-producing loci 46 – 49 . Interestingly, when active ZAM copies are added into a flamΔZAM genetic background, these copies do not produce regulatory ZAM -derived piRNAs and are not converted into piRNA producing regions. Actually, ZAM should be transcriptionally inactive in the germline because ZAM expression is regulated by the somatic transcription factor Pointed 32 . Therefore, although the contribution of individual copies needs to be investigated, our data strongly suggest that germline ZAM piRNAs originate at least in part from piRNA clusters. In line with our findings, computer simulations of the TE invasion dynamics suggested that several insertions in piRNA clusters are likely to be required to stop the invasion in the germline 50 . Conversely, we found that a single insertion in a somatic piRNA cluster, such as flamenco, is sufficient for TE silencing in the somatic follicle cells, as previously suggested 14 . Indeed, we show here that in follicle cells, the flamenco piRNA cluster acts alone as the principal regulator of transposon activity. A precise deletion of the internal part of the ZAM TE inserted in flamenco leads to complete derepression of functional ZAM copies. Surprisingly, it seems that reactivation of this errantivirus in only a patch of somatic cells can lead to severe fertility defects. However, in the germline, the deletion of the three most highly expressed germline piRNA clusters (42AB, 38C, and 20A) affected neither fertility nor TE silencing 48 . This could be explained by the fact that in the germline, but not in somatic cells, redundancy in piRNA production among different piRNA clusters is observed, with probably multiple piRNA clusters involved in the silencing of the same TE. Moreover, many TE copies have acquired mutations and are non-functional for transcription or for transposition. In the flamΔZAM line, although no ZAM piRNA was produced, we did not detect any ZAM expression. However, when we introduced functional copies of ZAM , ZAM was expressed demonstrating that depending on the genetic background, the transposon landscape varies and functional copies can be absent or present. In general, the TE content varies considerably among populations 47 , 51 . Interestingly, we identified ZAM copies with a deletion that affects the pol gene. The copy numbers of this ZAM variant ZAM-v2 and of ZAM full-length elements (ZAM-fl) that have transposed in the RevI-H2 line are similar (4 and 6 copies respectively), suggesting that even this ZAM -variant can transpose very efficiently. Studies in different organisms have shown that TEs rapidly diversify. For instance, the mariner DNA transposon is present in 68 different versions in grass genomes 52 . Such rapid diversification certainly promotes speciation of new families of active TEs. One interesting question is how ZAM RNAs transit into the oocyte and at which stage during Drosophila oogenesis ZAM transposes in germ cells. We noticed that ZAM RNAs, although transcribed in follicle cells, were deposited and accumulated at the posterior pole of early embryos, where future germ cells cellularize. ZAM might have evolved to preferentially mobilize in the dividing primordial germ cells of the offspring instead of the developing oocyte, which is not in a phase favorable to transposition because of its prolonged arrest in prophase I associated with highly compacted chromatin 53 . Previous experiments demonstrated that ZAM RNAs accumulate in follicle cells when vitellogenesis is defective, suggesting that ZAM transmission to the oocytes requires functional vitellogenin trafficking 20 (Supplementary Video 1). Moreover, errantiviruses, such as ZAM and Gypsy , can form pseudo-viral particles in follicle cells when they are expressed 17 , 19 , 20 , 24 . ZAM Gag and Env proteins are expressed in RevI-H2i2 follicle cells. Retroviral envelope glycoproteins undergo proteolytic processing by cellular serine endoproteases (furin and proprotein convertases), in order to produce the two functional subunits, a glycosylated hydrophilic polypeptide (SU) and a transmembrane domain (TM). This step is necessary to achieve protein competence to promote membrane fusion and virus infectivity 54 , 55 . The errantiviral env gene, acquired from insect baculovirus 56 , encodes a protein whose function is analogous to that of retroviral Env protein, which is responsible for infectious properties. Indeed, ZAM Env protein is composed of an SU, a TM and an Arg–X–Lys–Arg conserved domain, which is considered to be a furin consensus proteolytic cleavage site 26 , 55 , 57 . A recent study demonstrated that intracellular retrotransposition of the Gypsy errantivirus can occur in the absence of the Env protein, while intercellular transmission requires a functional Env 19 . Currently, whether ZAM can transpose intracellularly, in follicle cells, and the exact mechanisms (Env protein dependent or independent) used for ZAM transmission to the oocyte are unknown. Once a virus enters the target cells, several scenarios for retrovirus uncoating have been proposed. Recent advances on the HIV-1 strongly suggest an uncoating at the nuclear pore and within the nuclear compartment 58 . Errantiviruses also encode Gag proteins which are capable of mediating the assembly of virus-like particles. However, there are significant differences between these proteins and retroviral Gag proteins, which might lead to a different uncoating process for errantiviruses 59 . In our study, we observed the loss of ZAM RNA in the oocyte when germline ZAM -derived piRNAs are produced. We can hypothesize that the ZAM capsid is dissociated soon after entry into the oocyte and that piRNAs can therefore easily target ZAM RNAs. It is also possible that ZAM RNAs are still encapsidated in the oocyte, but the capsid does not protect the ZAM RNA from piRNAs and their associated endonuclease. Previous studies on virus-like particles of the yeast Ty retrotransposon suggest that these particles form open structures that leave the RNA at the interior of the capsid accessible to RNase 60 , 61 . It has been proposed that in different species, an “innate” response at the piRNA or siRNA level can be initiated in the gonads upon retrovirus invasion ( 39 , 62–67) . We found that no clear innate small RNA response is triggered upon ZAM reactivation in Drosophila ovaries. Total small- RNA sequencing after ZAM reactivation revealed the presence of sense ZAM -mapping small RNAs, but they lack characteristics of siRNAs or piRNAs. We hypothesize that these sense small RNAs are degradation products generated when there is an excessive amount of ZAM RNAs. Altogether, these results show that no initial small RNA response is mounted upon ZAM reactivation, leaving follicle cells, where ZAM is expressed, and also oocytes unprotected against ZAM transposition. Our findings suggest that the piRNA response is a robust response that, in the case of ZAM , must be established either in the follicle cells or in the germ cells to efficiently control the invading TE. However, the time required for developing a robust piRNA response to sustainably control TE transposition remains unknown. Lastly, it is thought that the piRNA pathway has no antiviral role in Drosophila 68 . However, it would be interesting to determine whether this is also true if parts of the viral genome are integrated into a germline piRNA cluster during infection. Germline and somatic piRNA pathways and their respective piRNA clusters are distinct. There is no ping-pong amplification of piRNAs in the somatic follicle cells and piRNA production in these cells is almost exclusively dependent on a single piRNA cluster, flamenco , making it more vulnerable to mutation. A key outcome of our results is that they suggest that not only does the host adapt to the TE but the TE also seems to have adapted to the host: the exclusive expression of ZAM in somatic cells allows the TE to “hide” in the follicle cells and invade an unprotected germline after a simple deletion of a short flam sequence. The errantivirus ZAM thus seems to have adapted to the host by gaining tissue specificity and by adopting an expression niche. Methods Fly stocks, transgenic lines, and crosses Flies were maintained at 25°C under a light/dark cycle and 60% humidity. Between 3 and 6 days after hatching, flies were used for experiments. The RNAi lines against components of the piRNA pathway used in this study are listed in Supplementary Table S2 . Isogenic lines from the RevI-H2 stock were generated by crossing a single female with a single male for five generations. Germline and somatic knock-down have been performed using the nanos-gal4 and the traffic-jam-gal4 driver lines respectively ( Supplementary Table S2 ) . The Drosophila line carrying the ZAM sensor is described in 28 . The sensor expresses the GFP reporter gene under the control of an inducible Upstream Activation Sequence promoter (UASp) and harbors a ZAM fragment in its 3′-UTR (pGFP- ZAM ). Single-molecule RNA fluorescence in situ hybridization (smRNA FISH) in ovaries and embryos ZAM smRNA FISH was performed using 48 probes that target ZAM transcripts in a region that is absent in the ZAM inserted in the flamenco piRNA cluster to detect only transcripts of active ZAM copies (sequences in Supplementary Table S3 ). Ovaries from 3 to 6-day-old flies were dissected in Schneider’s Drosophila Medium and fixed in Fixing Buffer (4% formaldehyde, 0.3% Triton X-100, 1x PBS) for 20 min at room temperature, rinsed three times in 0.3% Triton X-100, once in PBS, and permeabilized in 70% ethanol at 4°C overnight. Permeabilized ovaries were rehydrated in smRNA FISH wash buffer (10% formamide in 2x SSC) for 10 min. Ovaries were resuspended in 50µL hybridization buffer (10% dextran sulfate, 10% formamide in 2x SSC) supplemented with 1µL of smRNA FISH probes. Hybridization was performed with rotation at 37°C overnight. Ovaries were then washed twice with smRNA FISH wash buffer at 37°C for 30 min and twice with 2xSSC solution. Then, DNA was stained with DAPI (1/500 dilution in 2x SSC) at room temperature for 20 min. Ovaries were mounted in 30 µL Vectashield mounting medium and imaged on a Zeiss LSM-980 or Zeiss LSM-800 confocal microscope. The resulting images were processed using FIJI/ImageJ. The RNA signal specificity was confirmed by adding 1 mg/mL of RNase A in 2x SSC for 2h before the hybridization step. For embryo staining, flies were caged and fed yeast paste. Embryos (0-2h) were collected, dechorionated in 50% bleach for 4 min and rinsed in water. Eggs were fixed in 4% paraformaldehyde/heptane for 20 min, devitellinized by vigorous shaking in 100% methanol and stored in methanol at -20°C. Embryos were rehydrated with 1:1 methanol in 1xPBS, 0.1% Tween-20 for 5 min and twice in 1xPBS, 0.1% Tween-20. Embryos were resuspended in smRNA FISH wash buffer (10% formamide in 2x SSC) for 10 min and then processed for smRNA FISH as described for ovaries. Immunostaining combined with smRNA FISH was performed by adding primary antibodies to the smRNA FISH probes in the hybridization buffer and incubating at 37°C overnight. Embryos were washed twice with smRNA FISH wash buffer and incubated with the secondary antibody for 90 min. After two washes in 2x SSC, embryos were mounted in 30 µL Vectashield mounting medium. Immunofluorescence analysis of ovaries and embryos Ovaries from 3-6-day-old flies were dissected in supplemented Schneider’s medium, ovarioles were separated, and the muscle sheath was removed before fixation to obtain undistorted follicles. Then, ovaries were fixed in 4% formaldehyde/1x PBS/2% Tween-20 for 15 min, rinsed three times with 1x PBS/2% Tween-20, and incubated 2 hours in PBT (1x PBS, 0.1% Triton X-100, 1% BSA). Ovaries were incubated with primary antibodies in PBT at 4°C overnight (antibodies are described in Supplementary Table S4 ) . After three washes in PBT, ovaries were incubated with the corresponding secondary antibodies coupled to Alexa-488 or Cy3 for 90 min. After two washes in 1x PBS, DNA was stained with DAPI (1/500 dilution in 1x PBS) for 20 min. Ovaries were mounted in 30 µL Vectashield mounting medium and imaged on a Zeiss LSM-980 or Zeiss LSM-800 confocal microscope. The resulting images were processed using FIJI/ImageJ. RT-qPCR analysis of transposon expression 10-20 pairs of dissected ovaries were homogenized in TRIzol reagent (Ambion). Following DNase I treatment, cDNA was prepared from 1 µg RNA by random priming of total RNA using Superscript IV Reverse Transcriptase (ThermoFisher Scientific). Quantitative PCR was performed with Roche FastStart SYBR Green Master on a the Lightcycler® 480 Instrument. RT-qPCR was used for quantification of transposon mRNA levels (primer sequences in Supplementary Table S5 ). All experiments were done with three biological replicates and with technical triplicates. Steady-state RNA levels were calculated from the threshold cycle for amplification with the 2 −ΔΔCT method; rp49 was used for normalization. Immunoprecipitation of Piwi-ribonucleoprotein complexes For each genotype, 50 pairs of ovaries from 3-6-day-old flies were dissected, lysed in 1 ml lysis buffer (20 mM HEPES-NaOH at pH 7.0, 150 mM NaCl, 2.5 mM MgCl2, 250 mM sucrose, 0.05% NP40, 0.5% Triton X-100, 1x Roche-Complete). Samples were cleared by centrifugation at 10000 × g at 4°C for 10 min. Extracts were incubated with rotation with rabbit polyclonal anti-Piwi antibodies (4 µg per sample) at 4°C for 4h followed by overnight incubation with Dynabeads TM Protein A (50 µl, Invitrogen, 10002D) at 4°C with rotation. Before incubation, beads were equilibrated in NT2 buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM MgCl2, 0.05% NP40). Beads were washed twice with ice-cold NT2 and twice with NT2 in which NaCl concentration was adjusted to 300 mM. Nucleic acids that co-immunoprecipitated with Piwi were isolated by treating beads with 0.7 mg/ml proteinase K in 0.3ml proteinase K buffer (0.5% SDS, 10mM Tris-HCl pH 7.4, 50mM NaCl, 5mM EDTA), followed by phenol/chloroform extraction (phenol at neutral pH) and ethanol precipitation. DNA Isolation, Oxford Nanopore Technology sequencing and genome analysis DNA was extracted from 200 RevI-H2i2 females using the Qiagen Blood & Cell Culture DNA Midi kit. The genomic DNA quality and quantity were evaluated using a Femto Pulse (Agilent) and a Qbit 3.0 (Invitrogen) respectively. Oxford Nanopore Technology (ONT) sequencing was performed by I2BC (Gif-sur-Yvette, France) using five micrograms of genomic DNA. Adapter- trimmed ONT reads were analyzed using NCBI Blastn ( https://blast.ncbi.nlm.nih.gov/Blast.cgi ) or command-line Blastn (Blastn 2.8.1). The RevI- H2i2 ONT reads containing ZAM insertions were detected by Blastn with the reference ZAM 22 , Repbase ZAM _I and ZAM _LTR sequences ( https://www.girinst.org/repbase/ , 29 ). The ZAM containing reads were then recovered with bedtools getfasta ( https://bedtools.readthedocs.io/en/latest/content/tools/getfasta.html , 69 ). The ZAM insertion sites where determined using Blastn of the ZAM containing reads to the D. melanogaster Release 6 genome ( http://flybase.org ). The absence of empty sites, without a given ZAM insertion, was verified by Blastn of the respective empty insertion sites, recovered from the D. melanogaster Release 6 genome, to all ONT reads. Sequencing data are available in NCBI GEO database (GSE213456). RNA-sequencing and analysis 3 independent total RNA extractions from 30 ovaries from 3-6-day-old RevI-H2i2 flies using Trizol (Invitrogen) were performed. Strand-specific libraries for RNA sequencing (RNA-Seq) were constructed at BGI. 1 µg of total RNA was used to prepare mRNA library using MGIEasy RNA Library Prep kit and sequenced as PE150 reads on the DNBSEQ G400 sequencer, and adapter-clipped reads were provided by BGI. The data were analyzed on the local Galaxy platform using HISAT2 alignment (Galaxy Version 2.1.0). The reads were first mapped to ZAM-fl and to ZAM-v2 using the “Disable spliced alignment” option. The mapped reads were then aligned to ZAM_I sequence (Repbase) with the default options, i.e. allowing split alignment. Reads were visualized using “Integrative Genomics Viewer” version 2.16.1. The coverage of RNA-seq reads corresponding to ZAM-v2 was determined as the number of split reads specific to the ZAM-v2 deletion at positions ZAM_I:5494-6120, normalized to the average coverage of the pointed transcript. Coverage of RNA-seq reads corresponding to ZAM- fl and ZAM-v2 was determined as the number of non-split reads at position 5495, the left edge of the deletion, normalized to the average coverage of the pointed transcript. Only the left edge was used for this purpose, as the right edge of the deletion is also mapped by reads corresponding to ZAM-variants with other internal deletions (green in Figure 1a ). Small RNA sequencing Regulatory small RNA extraction was performed as described in 70 . Briefly, 50 pairs of ovaries from 3-6-day-old flies were lysed and Argonaute-small RNA complexes were isolated using TraPR ion exchange spin columns (Lexogen, Catalog Nr.128.08). Total RNA also was extracted for some samples (80-100 ovaries for each sample) using the classical TRIzol extraction, followed by 2S rRNA depletion and size selection before sequencing. Sequencing was performed by Fasteris SA (Geneva, Switzerland) on an Illumina NextSeq550 instrument (13-15 million reads per sample). Illumina small RNA sequencing reads were loaded on the small RNA analysis pipeline sRNAPipe 71 for mapping to the various genomic sequence categories of the D. melanogaster genome (Release 6). For the analysis, 23-29nt genome mappers were selected as piRNAs, and 21nt genome mappers were selected as siRNAs. “Genome-unique” piRNAs were defined as 23-29 reads that mapped uniquely across the reference genome. piRNAs were mapped to TEs allowing up to 3 mismatches, siRNAs allowing up to 1 mismatch, and genome-unique piRNAs to piRNA clusters as defined in 11 allowing no mismatch. The window size was of 91nt for the entire ZAM , 86 nt for ZAM_I and 140nt for the flamenco region at X:21,769,891..21,789,891 to establish the piRNA density profiles. For comparison between samples, all read counts were normalized by the number of piRNA/siRNA reads used as input (genome-mapped piRNAs or siRNAs, genome-unique piRNAs) and represented in RPM [RPM = read-count * 1,000,000 / (total of genome mapping piRNAs)], or RPKM [RPM = read-count * 1,000,000 / (TE Length/1000) / (total of genome mapping piRNAs)] in the case of density profiles. To assess the ping-pong signature, the counts of 1 to 23nt 5’-overlaps were determined, and the percentage of 10nt 5’-overlaps over the total 1-23nt 5’-overlaps was calculated. The Z-score for 10nt 5’overlaps was determined using the percentages of all 1 to 23nt-long 5’overlaps as a background and was considered significant when it was >1.96. Scatter plots were done with RStudio with antisense piRNAs or siRNAs mapping to the respective internal sequence of Tes (allowing 0-3 mismatches for piRNAs and 0-1 mismatch for siRNAs). All small RNA sequencing done for this study is listed in Supplementary Table S6 . Small-RNA sequencing data are available in NCBI GEO database (GSE213368). Sterility tests For the sterility tests, RevI-H2i2 homozygous females were compared to w 1118 females, and homozygous flamΔZAM females that carry three functional ZAM copies from the RevI-H2 X chromosome were compared to flamΔZAM females without these functional ZAM copies in their genome. Sterility tests were performed at 25° C. Thirty 3-6-day-old virgin females of each genotype were individually mated with three w 1118 males, and eggs were collected for 24 hours. The number of eggs laid by each female was determined. Then, eggs were kept at 25°C for another 24 hours before determining the egg hatching rate. The experiment was done twice for a total of approximatively 60 replicates for each condition. Generation of the flamΔZAM line using the CRISPR-Cas9 technology The ZAM copy in the flamenco piRNA cluster was deleted using a pCFD6 plasmid that expresses two single guide RNAs (sgRNAs) under the Gal4/UAS system. The sgRNAs were designed to target genome-unique sequences located upstream and downstream of the flamenco ZAM copy: TTGTAGCGCTCTTCTTCTCT (sgRNA flamΔZAM_1 ) and AGCGCAACCACGTACAGCGA (sgRNA flamΔZAM_2 ). The pCFD6 plasmid harboring these sgRNAs was injected by the Bestgene company into embryos from the BL#9736 stock (Bloomington stock center) for integration of the plasmid into the genomic site 53B2. The obtained flies were crossed with nanos-gal4; UAS-Cas9 flies (BL#54593, Bloomington stock center). Prior to crossing, the X chromosome of each of these lines was replaced by the X chromosome of the Iso1A Drosophila line. After the crosses, 500 lines were derived and screened by PCR using primers specific for the flamenco ZAM copy. The detailed crossing schemes are available upon request. Lines without amplification of internal flamenco ZAM sequences were selected for PCR amplification of the target locus with primers that framed the flamenco ZAM copy and the target sequences of the sgRNAs. The obtained amplicons were sequenced. AUTHOR CONTRIBUTIONS Conceptualization, MY, SJ and EB; Validation and Investigation, MY, SMM, AA, NG, BB, Data curation and bioinformatic analyses, MY, SJ, writing—original draft, MY and EB; writing—review and editing, MY, SJ and EB; Supervision, SJ and EB, funding acquisition, MY and EB. FUNDING This work was supported by grants from the Agence Nationale pour la Recherche (CHApiTRE ANR-20-CE12-0005, BiopiC ANR-21-CE12-0022, and EpiTET ANR-17-CE12-0030-03), the La Fondation ARC pour la recherche sur le cancer (PJA20171206129). M.Y. was supported by the Ministère de l’Enseignement Supérieur et de la Recherche and the Fondation pour la Recherche Médicale (FDT202106012950). This research was financed by the French government IDEX-ISITE initiative 16-IDEX-0001 (CAP 20-25). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. COMPETING INTERESTS The authors declare that no competing interest exists. Download figure Open in new tab Supplementary Figure 1 (related to Figure 1) a. Color-inverted confocal images of ovarioles from RevI-H2i2 ovaries showing ZAM RNA signal without (left panel) and after (right panel) RNase A treatment. b. Color-inverted confocal images of ovarioles showing that ZAM RNA is completely absent in Iso1A, w 1118 , and w IR 6 ovaries. c. Mapping of mRNA-Seq reads of the full-length ZAM ( ZAM-fl ) and of ZAM-v2 to the reference ZAM internal sequences ZAM _I (Repbase) allowing splitting of the reads. Above is shown ZAM-v2 structure. The inset below shows a zoom on the ZAM-v2 deletion with the corresponding split reads. Reads corresponding to ZAM mRNA are in blue, antisense reads are in red. Positions of the shown regions within ZAM _I are indicated. d. Coverage of mRNA-seq reads corresponding to the indicated ZAM -variants normalized to the average coverage of the gene pointed . Download figure Open in new tab Supplementary Figure 2 (related to Figure 2) a . Confocal images of ovarioles with GFP (green) and DNA (white) staining. Ovarioles of the progeny of a cross between either w 1118 control females or RevI-H2i2 females and males carrying the pGFP- ZAM sensor transgene driven by actin-Gal4. b. Antisense regulatory piRNAs (23-29 small-RNAs complexed with Argonaute proteins) mapping to TE internal sequences (0-3 mismatches) in the RevI-H2i2 line upon white- (control), or zuc -GLKD. Normalized per million of genome-mapping piRNAs. c. Box plot displaying the Z-score distribution of 10nt 5’-overlaps for TE-mapping piRNAs in the white -GLKD and ago3 -GLKD RevI-H2i2 lines. Each dot represents a TE with a Z-score >1.96 (dotted line) in the control condition ( white -GLKD). ZAM is highlighted in red. The midline indicates the median value, and the box shows the first and third quartile. Error bars indicate the SD. *** p-value <0.001 (Mann-Whitney test). d . Bar plot showing the steady-state ZAM RNA levels in total RNA from ovaries with the indicated genotypes (RT-qPCR, normalized to rp49 , primer sequences in Supplementary Table S5 ). At least three biological replicates and two technical replicates were used. ** p-value <0.01 (Mann-Whitney tst); error bars indicate the SD. e . Scatter plot showing the normalized counts of antisense Piwi-bound piRNAs mapping to individual internal TE sequence in control ovaries ( white -sKD) versus yb -sKD ovaries. Antisense piRNA counts, mapped allowing up to 3 mismatches, were normalized per million of genome-mapping piRNAs (RPM, here in logarithmic scale). TEs in blue have a yb -sKD/ white -sKD ratio >3; TEs in red have a ratio <0.3. ZAM is boxed in black. f. Density plot along the ZAM sequence of ZAM -mapping regulatory piRNAs produced in white- and vret -sKD ovaries (up to 3 mismatches). g . Fold-change in the steady-state ZAM, Gypsy and Burdock RNA level for the indicated sKD ovaries, compared with white -sKD ovaries, measured by RT-qPCR (primer sequences in Supplementary Table S5 ). At least three biological replicates and two technical replicates were used. ** p-value <0.01 (Mann-Whitney test); error bars indicate the SD. h . Color-inverted confocal images of ovarioles (upper panels) and stage 10 egg chambers (lower panels) from the indicated sKD lines showing ZAM RNA expression in follicle cells and in the ooplasm in indicated conditions. Download figure Open in new tab Supplementary Figure 3 (related to Figure 3): a. Color-inverted confocal images of early embryos collected 0-2 hours after egg laying (AEL). Mothers harbor the indicated sKD of the piRNA pathway. ZAM RNA signal was detected by smRNA FISH. b. Projection of confocal images of stage 1 embryos (0-1 h AEL) laid by vret - sKD females showing ZAM RNA detected by smRNA FISH and Aub protein immunostaining. Both accumulated at the posterior pole of the embryo where future germ cells cellularize (Z- projection of 25 stacks). Download figure Open in new tab Supplementary Figure 4 (related to Figure 4 ): a. Sequence alignment of the RevI-H2 consensus ZAM LTR and the ZAM solo-LTR that remains in the flamΔZAM line after CRISPR-Cas9 deletion of the internal ZAM sequence in flamenco . The image shows the RevI-H2 consensus ZAM LTR (upper sequence) and the ZAM solo-LTR (lower sequence) with their TATA-box and polyadenylation signal (pA-signal) at position 312 of the ZAM consensus, the transcription start site (TSS, at position 327), the start of the poly-A tail at position 341 (CAAGCAGC-(A)n), according to Leblanc et al, 1997. b. RT- PCR results showing the expression of the different ZAM -variants in the ovaries of the following fly lines: flam !i ZAM , RevI-H2i2 and flam !iZAM with three copies of ZAM from the RevI-H2 X chromosome (one ZAM-fl , one ZAM-v2 and one ZAM-v3 ). Three biological replicates were used for each condition (s1, s2, s3). Rp49 has been used as the housekeeping gene control. The primers used for specific amplification of each variant are indicated on the schematic representation of ZAM variants and represented by arrows, and color-coded as follows: Blue: Primers for specific amplification of ZAM-fl . Orange: Primers for specific amplification of ZAM -v2 (primer ZAM -v2_R overlaps left and right edges of the ZAM -v2 deletion). Yellow: Primers for amplification of Z AM-fl and ZAM -v3, where the size of the amplification product differs due to a specific deletion in the 5’-UTR of ZAM -v3. (primer sequences in Supplementary Table S5 ). Download figure Open in new tab Supplementary Figure 5 (Related to Figure 5 ) a . Density plot of ZAM -mapping regulatory piRNAs (23-29 nt small-RNAs complexed with Argonaute proteins) along the ZAM internal sequence in flamΔZAM -RevI-H2i2 chr II ovaries (up to 3 mismatches). b. Scatter plots showing the normalized counts of regulatory piRNAs mapping to individual internal TE sequences in control ovaries ( white- sKD) versus flamΔZAM - RevI-H2i2 chr II ovaries. Antisense piRNA counts, mapped allowing up to 3 mismatches, were normalized per million of genome-mapping piRNAs (RPM, here in logarithmic scale). (c) Density plot of total small RNAs of 23 to 29 nt along the ZAM sequence in white- sKD, vret - sKD and yb- sKD ovaries (up to 3 mismatches). c. Density plot of total ZAM -mapping small RNAs of 23 to 29 nt along the ZAM internal sequence in white- sKD, vret -sKD and yb- sKD ovaries (up to 3 mismatches). d . Sequence logo for the first ten positions in ZAM-mapping sense small RNAs of 23 to 29nt (from total ovarian small RNA) in vret -sKD ovaries. The nucleotide height represents its relative frequency at that position. e. Density plot of ZAM - mapping Piwi-bound piRNAs along the ZAM internal sequence in white- sKD, vret -sKD and yb- sKD ovaries (up to 3 mismatches). f. Density plot of ZAM -mapping regulatory siRNAs (21nt small-RNAs complexed with Argonaute proteins) along the ZAM internal sequence produced in white -sKD and vret -sKD ovaries (0-1 mismatch). Download figure Open in new tab Supplementary Figure 6 Description of the genetic crosses performed to obtain the different RevI-H2i2-GLKD lines. Supplementary Video 1 Video of confocal Z-stacks overlay of stage 10 egg chambers from vret-sKD ovaries expressing Yolk-protein-1-GFP (green) showing ZAM smRNA FISH signal (red). View this table: View inline View popup Download powerpoint Supplementary Table S1 ZAM insertions in the RevI-H2i2 genome View this table: View inline View popup Download powerpoint Supplementary Table 2 Drosophila lines used View this table: View inline View popup Download powerpoint Supplementary Table 3 smRNA FISH probes View this table: View inline View popup Download powerpoint Supplementary Table 4 Antibodies used View this table: View inline View popup Download powerpoint Supplementary Table S5 Primers used View this table: View inline View popup Download powerpoint Supplementary Table S6 small-RNA seq ACKNOWLEDGEMENTS We thank the Bloomington Stock Center for providing stocks. We thank J. Brennecke for providing antibodies. We thank www.flybase.org , “ http://www.girinst.org ” and NCBI for providing databases and tools. We thank S. Chambeyron and K. Senti for helpful discussions, A. Molaro and the members of the Brasset laboratory for comments on the manuscript. We thank C. Vaury for having established the original RevI-H2 line over 30 years ago, and for preserving it all these years. We thank Y. Renaud and P. Pouchin for helpful advices and development of the iGReD bioinfomatics platform. We also thank the CLIC facility (Clermont Imagerie Confocale). We thank Gentyane Facility for the Quality Control of gDNA. Footnotes The list and order of authors have been modified. We have taken great care, throughout the manuscript, to differentiate between retroviruses and errantiviruses, a group of insect LTR retrotransposons. We paid attention to the nuances and intricacies of each type. We have relocated the focus in the abstract and introduction to ensure that it provides accurate and informative overview of the subject matter. To test whether the different copies are still expressed in the RevI-H2i2 genome we performed sequencing of the RevI-H2i2 ovary mRNAs. Interestingly, we observed that, besides the full-length ZAM, at least the ZAM variants ZAM-v2 and ZAM-v3 are expressed in RevI-H2i2 ovaries. These results are confirmed by RT-PCR experiments performed using specific primers of each variant to determine which copies are expressed. These new results are presented in the revised manuscript. Additionally, we have added Figure S6, which displays all the genetic crosses that partially include RevI-H2i2 chromosomes such as those used to generate the RevI-H2i2 Nanos-Gal4 and the RevI-H2i2 RNAi lines. This will help to better understand the diversity in ZAM copies that may exist in the tested flies. REFERENCES 1. ↵ Dewannieux , M. et al. The mouse IAPE endogenous retrovirus can infect cells through any of the five GPI-anchored Ephrin A proteins . PLoS Pathog . 7 , e1002309 ( 2011 ). 2. ↵ Frank , J. A. et al. Evolution and antiviral activity of a human protein of retroviral origin . Science 378 , 422 – 428 ( 2022 ). OpenUrl CrossRef 3. Grow , E. J. et al. Intrinsic retroviral reactivation in human preimplantation embryos and pluripotent cells . Nature 522 , 221 – 225 ( 2015 ). OpenUrl CrossRef PubMed 4. Svoboda , P. et al. RNAi and expression of retrotransposons MuERV-L and IAP in preimplantation mouse embryos . Dev. Biol . 269 , 276 – 285 ( 2004 ). OpenUrl CrossRef PubMed Web of Science 5. Tokuyama , M. et al. ERVmap analysis reveals genome-wide transcription of human endogenous retroviruses . Proc. Natl. Acad. Sci. U. S. A . 115 , 12565 – 12572 ( 2018 ). OpenUrl Abstract / FREE Full Text 6. ↵ Gerdes , P. , Richardson , S. R. , Mager , D. L. & Faulkner , G. J . Transposable elements in the mammalian embryo: pioneers surviving through stealth and service . Genome Biol . 17 , 100 ( 2016 ). 7. ↵ Nicolau , M. , Picault , N. & Moissiard , G . The Evolutionary Volte-Face of Transposable Elements: From Harmful Jumping Genes to Major Drivers of Genetic Innovation . Cells 10 , ( 2021 ). 8. ↵ Ozata , D. M. , Gainetdinov , I. , Zoch , A. , O’Carroll , D. & Zamore , P. D . PIWI-interacting RNAs: small RNAs with big functions . Nat. Rev. Genet . 20 , 89 – 108 ( 2019 ). OpenUrl PubMed 9. ↵ Czech , B. et al. piRNA-Guided Genome Defense: From Biogenesis to Silencing . Annu. Rev. Genet . 52 , 131 – 157 ( 2018 ). OpenUrl CrossRef PubMed 10. ↵ King , R. C. , Aggarwal , S. K. & Aggarwal , U . The development of the female Drosophila reproductive system . J. Morphol . 124 , 143 – 166 ( 1968 ). OpenUrl CrossRef PubMed 11. ↵ Brennecke , J. et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila . Cell 128 , 1089 – 1103 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 12. ↵ Pélisson , A. et al. Gypsy transposition correlates with the production of a retroviral envelope-like protein under the tissue-specific control of the Drosophila flamenco gene . EMBO J . 13 , 4401 – 4411 ( 1994 ). OpenUrl CrossRef PubMed Web of Science 13. Desset , S. , Meignin , C. , Dastugue , B. & Vaury , C . COM, a heterochromatic locus governing the control of independent endogenous retroviruses from Drosophila melanogaster . Genetics 164 , 501 – 509 ( 2003 ). OpenUrl Abstract / FREE Full Text 14. ↵ Zanni , V. et al. Distribution, evolution, and diversity of retrotransposons at the flamenco locus reflect the regulatory properties of piRNA clusters . Proc. Natl. Acad. Sci. U. S. A . 110 , 19842 – 19847 ( 2013 ). OpenUrl Abstract / FREE Full Text 15. ↵ Desset , S. , Buchon , N. , Meignin , C. , Coiffet , M. & Vaury , C . In Drosophila melanogaster the COM locus directs the somatic silencing of two retrotransposons through both Piwi- dependent and -independent pathways . PLoS One 3 , ( 2008 ). 16. ↵ Lau , N. C. et al. Abundant primary piRNAs, endo-siRNAs, and microRNAs in a Drosophila ovary cell line . Genome Res . 19 , 1776 – 1785 ( 2009 ). OpenUrl Abstract / FREE Full Text 17. ↵ Leblanc , P. et al. Life Cycle of an Endogenous Retrovirus, ZAM, in Drosophila melanogaster . J. Virol . 74 , 10658 – 10669 ( 2000 ). OpenUrl Abstract / FREE Full Text 18. Song , S. U. , Kurkulos , M. , Boeke , J. D. & Corces , V. G . Infection of the germ line by retroviral particles produced in the follicle cells: A possible mechanism for the mobilization of the gypsy retroelement of Drosophila . Development 124 , 2789 – 2798 ( 1997 ). OpenUrl Abstract 19. ↵ Keegan , R. M. , Talbot , L. R. , Chang , Y. H. , Metzger , M. J. & Dubnau , J . Intercellular viral spread and intracellular transposition of Drosophila gypsy . PLoS Genet . 17 , 1 – 22 ( 2021 ). OpenUrl CrossRef 20. ↵ Brasset , E. et al. Viral particles of the endogenous retrovirus ZAM from Drosophila melanogaster use a pre-existing endosome/exosome pathway for transfer to the oocyte . Retrovirology 3 , 1 – 9 ( 2006 ). OpenUrl CrossRef PubMed 21. Tcheressiz , S. et al. Expression of the Idefix retrotransposon in early follicle cells in the germarium of Drosophila melanogaster is determined by its LTR sequences and a specific genomic context . Mol. Genet. Genomics 267 , 133 – 141 ( 2002 ). OpenUrl CrossRef PubMed 22. ↵ Sokolova , O. A. et al. Special vulnerability of somatic niche cells to transposable element activation in Drosophila larval ovaries . Sci. Rep . 10 , ( 2020 ). 23. ↵ Malone , C. D. et al. Specialized piRNA Pathways Act in Germline and Somatic Tissues of the Drosophila Ovary . Cell 137 , 522 – 535 ( 2009 ). OpenUrl CrossRef PubMed Web of Science 24. ↵ Chalvet , F. et al. Proviral amplification of the Gypsy endogenous retrovirus of Drosophila melanogaster involves env-independent invasion of the female germline . EMBO J . 18 , 2659 – 2669 ( 1999 ). OpenUrl Abstract / FREE Full Text 25. ↵ Bline , A. P. , Le Goff , A. & Allard , P . What Is Lost in the Weismann Barrier? Journal of developmental biology 8 , ( 2020 ). 26. ↵ Leblanc , P. , Desset , S. , Dastugue , B. & Vaury , C . Invertebrate retroviruses: ZAM a new candidate in D. melanogaster . EMBO J . 16 , 7521 – 7531 ( 1997 ). OpenUrl Abstract / FREE Full Text 27. ↵ Desset , S. et al. Mobilization of two retroelements, ZAM and Idefix, in a novel unstable line of Drosophila melanogaster . Mol. Biol. Evol . 16 , 54 – 66 ( 1999 ). OpenUrl CrossRef PubMed Web of Science 28. ↵ Duc , C. et al. Trapping a somatic endogenous retrovirus into a germline piRNA cluster immunizes the germline against further invasion . Genome Biol . 20 , 1 – 14 ( 2019 ). OpenUrl CrossRef 29. ↵ Jurka , J. et al. Repbase Update, a database of eukaryotic repetitive elements . Cytogenet. Genome Res . 110 , 462 – 467 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 30. ↵ George , P. et al. Increased production of piRNAs from euchromatic clusters and genes in Anopheles gambiae compared with Drosophila melanogaster . Epigenetics and Chromatin 8 , ( 2015 ). 31. ↵ Czech , B. & Hannon , G. J . One Loop to Rule Them All: The Ping-Pong Cycle and piRNA- Guided Silencing . Trends Biochem. Sci . 41 , 324 – 337 ( 2016 ). OpenUrl CrossRef PubMed 32. ↵ Meignin , C. , Dastugue , B. & Vaury , C . Intercellular communication between germ line and somatic line is utilized to control the transcription of ZAM, an endogenous retrovirus from Drosophila melanogaster . Nucleic Acids Res . 32 , 3799 – 3806 ( 2004 ). OpenUrl CrossRef PubMed 33. ↵ Atallah , J. & Lott , S. E . Evolution of maternal and zygotic mRNA complements in the early Drosophila embryo . PLoS Genet . 14 , e1007838 ( 2018 ). 34. ↵ Aravin , A. A. & Hannon , G. J . Small RNA silencing pathways in germ and stem cells . Cold Spring Harb. Symp. Quant. Biol . 73 , 283 – 290 ( 2008 ). OpenUrl Abstract / FREE Full Text 35. Khurana , J. S. & Theurkauf , W . piRNAs, transposon silencing, and Drosophila germline development . J. Cell Biol . 191 , 905 – 913 ( 2010 ). OpenUrl Abstract / FREE Full Text 36. Saito , K. & Siomi , M. C . Small RNA-mediated quiescence of transposable elements in animals . Dev. Cell 19 , 687 – 697 ( 2010 ). OpenUrl CrossRef PubMed Web of Science 37. ↵ Klattenhoff , C. et al. Drosophila rasiRNA pathway mutations disrupt embryonic axis specification through activation of an ATR/Chk2 DNA damage response . Dev. Cell 12 , 45 – 55 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 38. ↵ Parameswaran , P. et al. Six RNA viruses and forty-one hosts: viral small RNAs and modulation of small RNA repertoires in vertebrate and invertebrate systems . PLoS Pathog . 6 , e1000764 ( 2010 ). 39. ↵ Yu , T. et al. The piRNA Response to Retroviral Invasion of the Koala Genome . Cell 179 , 632 – 643 .e12 ( 2019 ). OpenUrl CrossRef 40. ↵ Le Rouzic , A. & Capy , P . The first steps of transposable elements invasion: Parasitic strategy vs. genetic drift . Genetics 169 , 1033 – 1043 ( 2005 ). OpenUrl Abstract / FREE Full Text 41. Kofler , R. , Senti , K. A. , Nolte , V. , Tobler , R. & Schlötterer , C . Molecular dissection of a natural transposable element invasion . Genome Res . 28 , 824 – 835 ( 2018 ). OpenUrl Abstract / FREE Full Text 42. Robillard , É. , Le Rouzic , A. , Zhang , Z. , Capy , P. & Hua-Van , A . Experimental evolution reveals hyperparasitic interactions among transposable elements . Proc. Natl. Acad. Sci. U. S. A . 113 , 14763 – 14768 ( 2016 ). OpenUrl Abstract / FREE Full Text 43. Schaack , S. , Gilbert , C. & Feschotte , C . Promiscuous DNA: Horizontal transfer of transposable elements and why it matters for eukaryotic evolution . Trends Ecol. Evol . 25 , 537 – 546 ( 2010 ). OpenUrl CrossRef PubMed Web of Science 44. Wierzbicki , F. , Kofler , R. & Signor , S . Evolutionary dynamics of piRNA clusters in Drosophila . Mol. Ecol . 1 – 17 ( 2021 ). 45. ↵ Yoth , M. , Jensen , S. & Brasset , E . The Intricate Evolutionary Balance between Transposable Elements and Their Host: Who Will Kick at Goal and Convert the Next Try? Biology 11 , ( 2022 ). 46. ↵ Mohn , F. , Sienski , G. , Handler , D. & Brennecke , J . The Rhino-Deadlock-Cutoff complex licenses noncanonical transcription of dual-strand piRNA clusters in Drosophila . Cell 157 , 1364 – 1379 ( 2014 ). OpenUrl CrossRef PubMed Web of Science 47. ↵ Luo , S. et al. The evolutionary arms race between transposable elements and piRNAs in Drosophila melanogaster . BMC Evol. Biol . 20 , 1 – 18 ( 2020 ). OpenUrl CrossRef 48. ↵ Gebert , D. et al. Large Drosophila germline piRNA clusters are evolutionarily labile and dispensable for transposon regulation . Mol. Cell 1 – 14 ( 2021 ). 49. ↵ Shpiz , S. , Ryazansky , S. , Olovnikov , I. , Abramov , Y. & Kalmykova , A . Euchromatic Transposon Insertions Trigger Production of Novel Pi- and Endo-siRNAs at the Target Sites in the Drosophila Germline . PLoS Genet . 10 , ( 2014 ). 50. ↵ Kofler , R . Dynamics of transposable element invasions with piRNA clusters . Mol. Biol. Evol . 36 , 1457 – 1472 ( 2019 ). OpenUrl CrossRef 51. ↵ Lerat , E. et al. Population-specific dynamics and selection patterns of transposable element insertions in European natural populations . Mol. Ecol . 28 , 1506 – 1522 ( 2019 ). OpenUrl CrossRef 52. ↵ Feschotte , C. & Wessler , S. R . Mariner-like transposases are widespread and diverse in flowering plants . Proc. Natl. Acad. Sci. U. S. A . 99 , 280 – 285 ( 2002 ). OpenUrl Abstract / FREE Full Text 53. ↵ Navarro-Costa , P. et al. Early programming of the oocyte epigenome temporally controls late prophase i transcription and chromatin remodelling . Nat. Commun . 7 , ( 2016 ). 54. ↵ Bergeron , F. , Leduc , R. & Day , R . Subtilase-like pro-protein convertases: from molecular specificity to therapeutic applications . J. Mol. Endocrinol . 24 , 1 – 22 ( 2000 ). OpenUrl Abstract 55. ↵ Klenk , H. D. & Garten , W . Host cell proteases controlling virus pathogenicity . Trends Microbiol . 2 , 39 – 43 ( 1994 ). OpenUrl CrossRef PubMed 56. ↵ Malik , H. S. , Henikoff , S. & Eickbush , T. H . Poised for contagion: evolutionary origins of the infectious abilities of invertebrate retroviruses . Genome Res . 10 , 1307 – 1318 ( 2000 ). OpenUrl Abstract / FREE Full Text 57. ↵ Hosaka , M. et al. Arg-X-Lys/Arg-Arg motif as a signal for precursor cleavage catalyzed by furin within the constitutive secretory pathway . J. Biol. Chem . 266 , 12127 – 12130 ( 1991 ). OpenUrl Abstract / FREE Full Text 58. ↵ Guedán , A. , Caroe , E. R. , Barr , G. C. R. & Bishop , K. N . The Role of Capsid in HIV-1 Nuclear Entry . Viruses 13 , ( 2021 ). 59. ↵ Syomin , B. V. , Kandror , K. V. , Semakin , A. B. , Tsuprun , V. L. & Stepanov , A. S . Presence of the gypsy (MDG4) retrotransposon in extracellular virus-like particles . FEBS Lett . 323 , 285 – 288 ( 1993 ). OpenUrl CrossRef PubMed 60. ↵ Palmer , K. J. et al. Cryo-electron microscopy structure of yeast Ty retrotransposon virus- like particles . J. Virol . 71 , 6863 – 6868 ( 1997 ). OpenUrl Abstract / FREE Full Text 61. ↵ Burns , N. R. et al. Symmetry, flexibility and permeability in the structure of yeast retrotransposon virus-like particles . EMBO J . 11 , 1155 – 1164 ( 1992 ). OpenUrl 62. Kolliopoulou , A. et al. PIWI pathway against viruses in insects . Wiley Interdiscip. Rev. RNA 10 , e1555 ( 2019 ). 63. Rozhkov , N. V. et al. Small RNA-based silencing strategies for transposons in the process of invading Drosophila species . RNA 16 , 1634 – 1645 ( 2010 ). OpenUrl Abstract / FREE Full Text 64. Rozhkov , N. V. et al. Evolution and dynamics of small RNA response to a retroelement invasion in drosophila . Mol. Biol. Evol . 30 , 397 – 408 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 65. Kawamura , Y. et al. Drosophila endogenous small RNAs bind to Argonaute 2 in somatic cells . Nature 453 , 793 – 797 ( 2008 ). OpenUrl CrossRef PubMed Web of Science 66. Rehwinkel , J. et al. Genome-Wide Analysis of mRNAs Regulated by Drosha and Argonaute Proteins in Drosophila melanogaster . Mol. Cell. Biol . 26 , 2965 – 2975 ( 2006 ). OpenUrl Abstract / FREE Full Text 67. Katsuma , S. et al. Transcriptome profiling reveals infection strategy of an insect maculavirus . DNA Res . 25 , 277 – 286 ( 2018 ). OpenUrl 68. ↵ Petit , M. et al. piRNA pathway is not required for antiviral defense in Drosophila melanogaster . Proceedings of the National Academy of Sciences 113 , E4218 – E4227 ( 2016 ). OpenUrl Abstract / FREE Full Text 69. ↵ Quinlan , A. R. & Hall , I. M . BEDTools: a flexible suite of utilities for comparing genomic features . Bioinformatics 26 , 841 – 842 ( 2010 ). OpenUrl CrossRef PubMed Web of Science 70. ↵ Grentzinger , T. et al. A universal method for the rapid isolation of all known classes of functional silencing small RNAs . Nucleic Acids Res . 48 , ( 2020 ). 71. ↵ Pogorelcnik , R. , Vaury , C. , Pouchin , P. , Jensen , S. & Brasset , E . sRNAPipe: A Galaxy-based pipeline for bioinformatic in-depth exploration of small RNAseq data . Mob. DNA 9 , 4 – 9 ( 2018 ). OpenUrl Back to top Previous Next Posted June 26, 2023. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Reactivation of an errantivirus in Drosophila ovarian somatic tissue: from germline invasion to taming Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Reactivation of an errantivirus in Drosophila ovarian somatic tissue: from germline invasion to taming Marianne Yoth , Stéphanie Maupetit-Méhouas , Abdou Akkouche , Nathalie Gueguen , Benjamin Bertin , Silke Jensen , Emilie Brasset bioRxiv 2022.08.29.505639; doi: https://doi.org/10.1101/2022.08.29.505639 Share This Article: Copy Citation Tools Reactivation of an errantivirus in Drosophila ovarian somatic tissue: from germline invasion to taming Marianne Yoth , Stéphanie Maupetit-Méhouas , Abdou Akkouche , Nathalie Gueguen , Benjamin Bertin , Silke Jensen , Emilie Brasset bioRxiv 2022.08.29.505639; doi: https://doi.org/10.1101/2022.08.29.505639 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Genetics Subject Areas All Articles Animal Behavior and Cognition (8003) Biochemistry (18709) Bioengineering (14841) Bioinformatics (44360) Biophysics (22560) Cancer Biology (19680) Cell Biology (26844) Clinical Trials (138) Developmental Biology (13942) Ecology (20969) Epidemiology (2067) Evolutionary Biology (25412) Genetics (16151) Genomics (23477) Immunology (18678) Microbiology (42413) Molecular Biology (18021) Neuroscience (93343) Paleontology (699) Pathology (2977) Pharmacology and Toxicology (5086) Physiology (8105) Plant Biology (15969) Scientific Communication and Education (2094) Synthetic Biology (4549) Systems Biology (10219) Zoology (2384) window.__CF$cv$params={r:'a3c63cdc89a7c89d',t:'MTc4OTYyODQ2Ng==',u:'01a0ae2b536d751682052d34c2699754',ut:'p.KXOOyiID8EC_LUuYEu_2VFvMDpckTEr8l3J7Y0BZ4-1789628470-1.2.1.1-wwB9dSNP2D.9HYfoa.MDIHHvZk1G9QN7P1_JwSWm1kWYBXKu4okRBUsg9MJ.ZhTmhdgK8KakgW6lJJ7Fz9SfG86wEvvubL7N0s1066qK9ug',i:60};(function(){if(!document.body)return;var s=document.createElement('script');s.src='/cdn-cgi/challenge-platform/scripts/precursor/main.js';document.head.appendChild(s);})();

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

⚙ Ask this paper AI returns verbatim quotes from the full text · source: preprint-html ⓘ

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00