SPTLC2 Negatively Regulates Neural Stem Cell Activity and Proliferation via Inhibition of the MEK/ERK Signaling: Insights into the Molecular Mechanisms Underlying Neural Stem Cell Behavior | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article SPTLC2 Negatively Regulates Neural Stem Cell Activity and Proliferation via Inhibition of the MEK/ERK Signaling: Insights into the Molecular Mechanisms Underlying Neural Stem Cell Behavior Tianqing Liu, Folin Lan, Junlong Huang, Yuqin Ye, Xinhong Su This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7137060/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The utilization of neural stem cells (NSCs) for facilitating neurogenesis and enhance impaired neural functions has drawn people's attention. Serine palmitoyltransferase long chain base subunit 2 (SPTLC2) can induce the apoptosis of neurons, and the mitogen-activated protein kinase (MEK)/extracellular signal-regulated kinase (ERK) pathway is capable of promoting the differentiation and proliferation of NSCs. Nevertheless, the effect and mechanism of SPTLC2 and the MEK/ERK pathway on the activity and proliferation of NSCs remain unclear. In the current study, the expression of SPTLC2 was modulated through plasmid transfection and verified by PCR and western blot. Once the expression of SPTLC2 was changed, the impact on the activity and proliferation of NSCs was observed via cell counting kit (CCK) and 5-ethynyl-2'-deoxyuridine (EdU) staining. To confirm the relationship between SPTLC2 and the MEK/ERK pathway, western blot was employed to observe the correlation of expression changes. To observe whether SPTLC2 worked through MEK/ERK, the activation state of the MEK/ERK pathway was interfered with by Erucin and U0126 reagents. EdU staining and western blot were utilized to verify whether SPTLC2 affected the activity and proliferation of NSCs through MEK/ERK pathway. It was noted that the expression of SPTLC2 could be altered by plasmid transfection at both mRNA and protein levels. Through modifying the expression of SPTLC2, the activity and proliferation of NSCs could be influenced. Meanwhile, we observed that the expression changes of significant proteins in the MEK/ERK pathway were negatively correlated with SPTLC2. Thus, Our results showed that overexpression of SPTLC2 might inhibit the activity and proliferation of NSCs, and conversely, promote the process. The effect of SPTLC2 on NSCs was achieved through the MEK/ERK pathway. SPTLC2 MEK/ERK pathway neural stem cell activity proliferation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Neural Stem Cells (NSCs) has garnered significant attention in the domains of neuroscience and regenerative medicine due to its potential to differentiate into neurons, astrocytes and oligodendrocytes. It is a type of cells with self-renewal capacity and multi-differentiation potential. Undifferentiated NSCs do not express mature cell antigens, thus it is less likely to be recognized and attacked by the immune system, which renders them to have a favorable safety profile in cell transplantation therapy [ 1 ]. NSCs was initially isolated primarily from the neural tissue of the embryo, such as the hippocampus and the subventricular region of the embryonic brain [ 2 ]. Some specific areas of the adult brain, like the dentate gyrus of the hippocampus and the subependymal zone, also contain a small number of NSCs and can be partially activated under certain conditions, such as injury, bleeding, ischemia and hypoxia, and alterations in the microenvironment [ 3 , 4 ]. Because of their differentiation potential, NSCs has been extensively studied for the treatment of various neurological disorders, such as Parkinson's disease, Alzheimer's disease, brain injury, stroke and multiple sclerosis [ 5 – 7 ]. NSCs can facilitate axon regeneration and myelination, accelerate nerve repair process, and assist in improving nerve function recovery [ 8 ]. Although NSCs demonstrate great potential in the treatment of nervous system diseases, numerous challenges persist, such as survival after cell transplantation, control of differentiation, immune response, and ethical issues. Future research is expected to tackle these problems, optimize the isolation, culture and transplantation of NSCs, and facilitate their transition from basic research to clinical applications. Serine Palmitoyltransferase Long Chain Base Subunit 2 (SPTLC2) is one of the components of the serine palmitoyl transferase complex, which plays a key role in the biosynthesis of sphingolipid [ 9 ]. Sphingolipid is an important component of cell membranes and is indispensable for cell signaling. It maintains the structural integrity of cells and is involved in various cell signaling pathways. It is also an essential component for maintaining the stability and function of cell membranes, as well as cell growth, differentiation, and apoptosis [ 10 ]. Mutations in the SPTLC2 gene have been associated with several genetic disorders, like hereditary sensory autonomic neuropathy Type 1C, which is a disorder that affects the sensory and autonomic nervous systems in which patients might experience symptoms such as sensory loss and autonomic dysfunction [ 11 ]. Some enzymes that affect lipid metabolites such as sphingosine kinase 2 can impact the properties of the cell membrane, including the distribution and activity of receptors on the membrane, which might affect the activation of the mitogen-activated protein kinase (MEK)/ extracellular signal-regulated kinase (ERK) pathway [ 12 ]. Therefore, SPTLC2 might indirectly or directly affect the differentiation and function of NSCs by affecting myelin sheath formation. Although direct evidence is lacking, considering the role of SPTLC2 in lipid metabolism and the extensive impact of MEK/ERK pathway on cell function, it can be hypothesized that SPTLC2 might indirectly affect the activity and function of MEK/ERK pathway by regulating the lipid environment of cell membranes. MEK/ERK pathway is a highly significant pathway in cell signaling, which participates in numerous biological processes, including cell growth, differentiation, proliferation and apoptosis. MEK is a bispecific protein kinase that phosphorylates and activates downstream ERK protein kinase. ERK is a member of the mitogen-activated protein kinase family. Once activated, ERK can enter the nucleus and regulate the activity of transcription factors, thereby influencing gene expression. Under physiological conditions, the MEK/ERK pathway is involved in the regulation of cell growth, differentiation and survival, and is indispensable for maintaining tissue homeostasis and development [ 13 ]. There are abundant literatures supporting that the MEK/ERK pathway is involved in the proliferation, differentiation, migration, apoptosis and other processes of NSCs [ 14 – 16 ]. This study intends to explore whether SPTLC2 can influence the activity and proliferation of NSCs via the MER/ERK pathway. Materials and methods NSCs culture SD rats with 14 days of pregnancy (Huafukang Bio, Beijing, License No. SCXK (Beijing) 2019-0008) were euthanized by inhalation of excess CO2. The fetal mice were removed after alcohol disinfection. The cortical and hippocampus regions were isolated in ice phosphate buffered solution (PBS) and cut them into small pieces as much as possible. Under sterile conditions, tissues were collected. After being washed with D-Hank solution three times, the tissues and 0.125% trypsin /0.02% EDTA solution (Solarbio, Beijing, China) was incubated at 37℃ for 10min. Then, the tissues were ground with 5 ml pipette and filtered with copper mesh to eliminate tissue blocks from the cell suspension. The filtered cell suspension was centrifuged at 1000×g for 3 min, and the trypsin-EDTA solution was removed. The cells were suspended in DMEM/F-12 medium (keygenbio, Jiangsu, China) containing 10% fetal bovine serum. They were washed three times and the supernatant was removed. The cells were re-suspended in serum-free DMEM/F-12 medium containing 20ng/mL basic fibroblast growth factor and 20ng/mL epidermal growth factor (Gibco, Grand Island, NY, USA), and were cultured at 37℃, 5%CO2, and saturated humidity. The medium was changed half-volume every 2 to 3 days and subcultured every 5 to 7 days. The NSCs were subcultured three times and then cultured in 6-well plates at a density of 1×10 5 /ml for the following experiments. The expression of SPTLC2 was changed by transfection After a 2-3-day culture period, the SPTLC2 overexpression vector and interference vector were transfected into cells respectively using the Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer’s instructions. The pcDNA3.1-SPTLC2 (2 µg) (ZHBY Bio, Jiangxi, China) and Lipofectamine 2000 reagent (10 µl) were respectively diluted into 125 µl Neurobasal™ medium (Gibco) for 5 min and then mixed for 20 min at room temperature. The cells were treated with the transfection solutions after being washed three times with PBS. After 6 h of transfection, the transfection solutions were replaced by Neurobasal™ supplemented with 2% B27 (Gibco) and 0.5 mM glutamine (Gibco). Similarly, pcDNA3.1- small interfering pcDNA3.1-siSPTLC2-356 (2 µg), pcDNA3.1-siSPTLC2-739 (2 µg), pcDNA3.1-siSPTLC2-1095 (2 µg) and pcDNA3.1 empty vector as negative control (NC) (2µg) were individually transfected into cells using the same approach. The cells were classified randomly into following groups: control group, SPTLC2 overexpression (OE) NC group, SPTLC2 OE group, si-SPTLC2 NC group, and si-SPTLC2 group. The cells in each group were treated for 48 hours for subsequent detection. Explore the appropriate drug concentrations of Erucin and U0126 10 mg of Erucin (#HY-121323, Medchemexpress LLC, Shanghai, China) was dissolved in 1.55 ml of DMSO to prepare a solution with a concentration of 40mM.10 mg of U0126 (#HY-12031, Medchemexpress) was dissolved in 1.172 ml of DMSO to prepare a solution with a concentration of 20 mM. They were respectively diluted to drug concentrations of 0 µM, 1 µM, 2 µM, 5 µM, 10 µM and 20 µM. The experimental procedures for detecting cell activity by cell counting kit-8 assay (CCK8) were the same as those described in section 2.7 of materials and methods. Quantitative real-time PCR Trizon reagent (Wanleibio, Shenyang, China) was used to extract total RNA from cells, mRNA was obtained using the RNA ultra-pure extraction kit (Wanleibio). The concentration and purity (OD260/OD280) of mRNA were determined by an ultraviolet visible spectrophotometer (Tianmei instrument, Shanghai, China), and cDNA was synthesized with the RNA reverse transcription kit (Sangon biotech, Shanghai, China). Fluorescence quantitative PCR was performed using a fluorescent PCR instrument (Bole life medical products Co., LTD., Shanghai, China). The reaction steps were as follows: predenaturation at 95 ℃ for 10 min, denaturation at 95 ℃ for 10 s, annealing at 58 ℃ for 30 s, extension at 72 ℃ for 30 s, with40 cycles. Using GAPDH as internal reference, the relative gene expression was calculated by the 2-△△Ct method. The primer sequence was presented in the following table. Primer name Primer sequence(5’-3’) GAPDH F GACAACTTTGGCATCGTGGA GAPDH R ATGCAGGGATGATGTTCTGG SPTLC2 F ACTGTCGGGAGCAACCATTC SPTLC2 R CGAACAATAGACCCTTCCATGCT Western blot analysis Cells were washed with PBS and lysis buffer ( Sangon). The cells were scraped to one side and drawn into the labeled eppendorf (EP) tube with a pipette. The cells were completely disrupted by a cell disruptor and then centrifuged at 12,000 r/min for 10 min. The supernatant was taken and transferred to a new EP tube. The bicinchoninic acid (BCA, Sangon) buffer solution was added and boiled in boiling water for 5 min. The protein concentration was determined by the BCA method. Based on the determined protein concentration, the volume of the sample to be filled was converted so that the protein in each well was 6 µg. Protein were extracted and separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE, Wanleibio). Subsequently, the proteins were transferred to a polyvinylidene fluoride (Millipore, Billerica, USA). The membranes were blocked by 5% skim milk powder and then incubated with anti- SPTLC2 (1:1000, #51012-2-AP, Proteintech, Chicago, USA), Anti MEK1/2 (1:1000, #af6385, Affinity bioscience, Cincinnati, USA), Anti-p-MEK1/2 (1:1000, #DF7768, Affinity), Anti-ERK1/2 (1:1000, #AF0155, Affinity), Anti P-ERK1/2 (1:1000, #AF1015, Affinity), Anti-β-Actin(1:2000, #HC201, TransGenbiotech, Beijing, China) over night at 4℃. Horseradish peroxidase (HRP) conjugated goat anti-mouse IgG (H + L) (1:2000, #GB23301, Servicebio, Wuhan, China) or HRP conjugated goat anti-rabbit IgG (H + L) (1:2000, #GB23303, Servicebio) was used as secondary antibody. Finally, protein bands were visualized with enhanced chemiluminescence solution (Wanleibio). Immunofluorescent staining Cells were fixed in 4% paraformaldehyde for 15 min and washed three times with PBS. Subsequently, the samples were permeabilized with 0.5% Triton X-100 for 15 min, washed three times with PBS and then blocked with blocking buffer (Beyotime, Beijing, China) for 30 min. After that, Nestin antibody (1/200, #DF7754, Affinity) was incubated at 4℃ overnight. After washing, fluorescent secondary antibody (1/200, #AS007, Abclonal technology, Wuhan, China) was added, then the disc was sealed with DAPI (#KGE2505-10, keygenbio) and observed under a fluorescence microscope (CKX53, Olympus, Japan). CCK8 detection According to section 2.2 of materials and methods, 96-well plates were taken and labeled for grouping after cell transfection. 100 µl of cell suspension was added to each well and placed in an incubator at 37°C and 5% CO₂ for 24 hours of culture. Then, 10µl of CCK8 reagent (keygenbio) was added to each well and incubated in the incubator for 2 hours. The absorbance value of each well was determined by the enzyme labeling instrument (WD-2012B, Beijing 61 instrument factory) at a wavelength of 450nm. According to section 2.3 of materials and methods, various concentrations of Erucin or U0126 drugs were prepared. After treating NSCs, CCk8 detection was carried out in accordance with the aforementioned method. EdU detection The proliferation capacity of the cells was measured by using the 5-ethynyl-2'-deoxyuridine (EdU) proliferation assay kit (Beyotime). The cells were classified randomly into following groups: control group, control and DMSO group, control and NC group, SPTLC2 OE group, SPTLC2 OE and NCgroup, si-SPTLC2 group, si-SPTLC2 and NC group, SPTLC2 OE and si-SPTLC2 group, SPTLC2 OE and Erucin group, si-SPTLC2 and U0126 group. After the cells were treated separately for 48 hours, they were incubated with EdU working solution (the concentration was 10 µM) diluted with fresh medium for 2 hours. The supernatant was removed, and the cells were fixed with 4% paraformaldehyde for 15 min, and then incubated with 0.5% Triton X-100 at room temperature for 10 min. Subsequently, the click reaction solution was added and incubated for 30 min in the absence of light. After each step, the cells should rinsed with PBS three times, each time for 3 min. The cell nuclei were re-stained with 1ml of 1× Hoechst33342 (Beyotime) and incubated at room temperature in the dark for 10 min. The 1X Hoechst 33342 solution was removed. The cells were washed three times with PBS for 3 min each time, and finally observed under a fluorescence microscope (Olympus). Statistical analysis GraphPad Prism (Version 8, GraphPad Software Inc., San Diego, CA) and ImageJ (V1.8.0, National Institutes of Health, Bethesda, USA) were employed to analyze data and figures. All experiments were repeated at least three times. All data represented the average of three independent experiments and presented as means ± the standard deviation (SD). Group differences were assessed by paired t-test and one-way analysis of variance (ANOVA). Meanwhile, P < 0.05 was regarded as the threshold of statistical significance. Results Results of the immunofluorescence identification of NSCs As depicted in Fig. 1 , bright red fluorescence can be observed under a fluorescence microscope, suggesting the positive expression of nestin, which is a marker of NSCs. The transfection efficiency of SPTLC2 overexpression and interference vectors was verified by qPCR and western blot The qPCR and western blot results indicated that the expression of SPTLC2 in the overexpressed (OE) group was significantly higher than that in the OE negative control (NC) group. Compared with the interference NC group, the expression of SPTLC2 in Si-SPTLC2-1095 group was significantly reduced. In the subsequent experiment, we designated the Si-SPTLC2-1095 group as the Si-SPTLC2 group (Fig. 2 ). The effect of SPTLC2 on the viability of NSCs was determined by CCK8. The CCK8 assay was used to test the activity of NSCs. The cell viability declined in the SPTLC2-OE group as compared with the Control and SPTLC2-OE-NC group. In contrast, the cell viability of the Si-SPTLC2 group was enhanced compared with the Control and Si-SPTLC2-NC group (Fig. 3 ). EdU identified the impact of SPTLC2 on the proliferation of NSCs The nucleus stained with DAPI exhibited blue fluorescence. The proliferative cells stained with EdU displayed red fluorescence. It was shown that the decreased red fluorescence in the SPTLC2-OE group compared with the Control and SPTLC2-OE-NC group indicated reduced cell proliferation. In contrast, compared with the Si-SPTLC2-NC group, the increased red fluorescence in the Si-SPTLC2 group indicated enhanced cell proliferation (Fig. 4 ). Western blot was employed to test the relationship between SPTLC2 and the MEK/ERK pathway Compared with SPTLC2-OE-NC, SPTLC2 protein in SPTLC2-OE group was significantly increased, while the ratios of p-MEK/MEK and p-ERK/ERK were significantly decreased. In contrast, compared with the Si-SPTL2-NC group, the SPTLC2 protein was significantly decreased in the Si-SPTLC2 group, and the ratios of p-MEK/MEK and p-ERK/ERK were significantly increased in the Si-SPTLC2 group (Fig. 5 ). To select the appropriate concentrations of Erucin and U0126 Erucin, an isothiocyanate, is especially abundant in arugula. It has anti-cancer, neuroprotective and anti-inflammatory effects and serves as an efficient activator of MEK/ERK pathway [ 17 – 19 ]. However, as an inhibitor of the MEK/ERK pathway, U0126 inhibits the activities of MEK1 and MEK2 in a non-competitive manner, thereby preventing them from phosphorylating ERK1/2 [ 20 , 21 ]. The Erucin and U0126 reagents were respectively formulated at concentrations of 0 µm, 1 µm, 2 µm, 5 µm, 10 µm, and 20 µm, and their effects on cell activity were examined through the CCK8 experiment to screen for the appropriate concentrations. As shown in Fig. 6 A, it was discovered that when the Erucin concentration was 10 µm, it exerted a relatively significant promoting effect on cell activity, while when the concentration reached 20 µm, it instead inhibited cell activity. From Fig. 6 B, it was found that when the U0126 concentration reached 5 µm, 10 µm, and 20 µm, it all had a significant inhibitory effect on cell activity. Therefore, a concentration of Erucin at 10 µm and a drug concentration of U0126 at 5 µm were selected for the subsequent experiments. Verification of the effect of SPTLC2 on the proliferation of NSCs This experiment was performed to verify the effect of SPTLC2 on NSCs and exclude the influence of DMSO solvent on the experiment. Cells treated with DMSO showed no significant difference in cell proliferation. It could down-regulated the expression of SPTLC2 protein, but there was no significant difference. After the SPTLC2 overexpression vector was transferred into the cells, the expression of SPTLC2 protein was significantly increased, and the proliferation ability of NSCs was significantly decreased. However, when the SPTLC2 interference vector was transfected into the cells transfected with the SPTLC2 overexpression vector, the expression of SPTLC2 protein decreased, and the proliferation ability of NCS significantly increased (Fig. 7 ). Erucin enhanced the expression of MEK/ERK, while U0126 suppressed it After the overexpression of SPTLC2, the expression of SPTLC2 protein was elevated, and the ratios of pMEK/MEK and pERK/ERK were significantly reduced. On this basis, after being treated with Erucin, the expression of SPTLC2 protein was decreased, and the ratios of pMEK/MEK and pERK/ERK were significantly increased compared with SPTLC2-OE group. After interference with SPTLC2, the expression of SPTLC2 protein was lowered, and the ratios of pMEK/MEK and pERK/ERK were significantly increased. On this basis, after being treated with U0126, the expression of the SPTLC2 protein was increased, and the ratios of pMEK/MEK and pERK/ERK were significantly decreased compared with Si-SPTLC2 group (Fig. 8 ). SPTLC2 might regulate the proliferation of NSCs through MEK/ERK pathway After the overexpression vector of SPTLC2 was transferred into cells, the cell proliferation ability was significantly reduced. However, after being treated with Erucin, the proliferation ability of NSCs was improved to a certain extent. After the transfer of Si-SPTLC2 into NSCs, the proliferation ability of NSCs was significantly enhanced. However, after being treated with U0126, the proliferation ability of NSCs was significantly decreased (Fig. 9 ). DISCUSSION The central nervous system (CNS), encompassing the brain and spinal cord, is truly challenging to repair once damaged due to its intricate physiological structure and function, which frequently gives rise to a series of severe complications and long-term health issues [ 22 ]. With the advancement of science and technology, such as the continuous development of stem cell therapy, gene therapy, and other emerging treatmnets, there might be more effective therapeutic approaches in the future. Studies have indicated that transplanted NSCs, under the influence of nerve growth factors and other signaling stimuli in the host microenvironment, initiates the expression and recombination of intracellular structural proteins like microfilaments, microtubules, and intermediate filaments, participates in the emergence of neurites, and plays a crucial role in functions such as the formation of synapses, neurotransmitter transport, and nerve impulse conduction [ 23 , 24 ]. The occurrence of new processes is expected to eventually restore the symptoms and signs of physical motor and sensory disorders as well as cognitive and functional deficits caused by neuron loss. SPTLC2 plays a key role in the synthesis of sphingolipids, which are implicated in cell membrane construction. A study showed that alterations in the activity of sphingolipid metabolizing enzymes such as ceramide synthase can influence the survival and proliferation of NSCs [ 25 ]. The authors found that inhibiting ceramide synthase enhanced the survival rate of NSCs and facilitated their proliferation. Studies had indicated that the direction of differentiation of NSCs into neurons or glial cells can be influenced by regulating sphingolipid metabolism [ 26 ]. Another study revealed that sphingosine-1-phosphate (S1P), a sphingolipid metabolite, exerts an important role in the migration of NSCs [ 27 ]. It showed that S1P promotes the migration of NSCs to the injured area by activating a specific signaling pathway. Previous studies conducted by our group had demonstrated that STPLC2 can promote neuronal apoptosis [ 28 ]. In this study, through CCK assay and EdU staining, we observed that when STPTLC2 was highly expressed, the activity and proliferation of NSCs decreased, conversely, they increased. At the same time, we observed that the expression trend of SPTLC2 was inversely proportional to that of the important molecules in the MEK/ERK pathway. Therefore, we hypothesize that the effect of SPTLC2 on NSCs might be achieved through the MEK/ERK pathway. MEK/ERK pathway plays an important role in regulating the proliferation of NSCs. A variety of growth factors and cytokines, such as epidermal growth factor (EGF) and fibroblast growth factor (FGF), promote proliferation of NSCs by activating the MEK/ERK pathway [ 29 ]. The activation of ERK is capable of regulating the expression of genes associated with the cell cycle, thereby propelling the cell into the division cycle. The MEK/ERK pathway is also of crucial importance for maintaining the survival of NSCs [ 30 ]. Activation of ERK can inhibit apoptotic pathways and promote the expression of anti-apoptotic proteins, thereby protecting NCS from various stress factors. By modifying the expression of STPLC2, a clear negative correlation was observed between the activity and proliferation of NSCs and SPTLC2. In order to verify the relationship between SPTLC2's regulation of NSCs activity and proliferation through MEK/ERK pathway, we altered the expression of SPTLC2 and introduced promoters and inhibitors of MEK/ERK pathway for further validation. In the experiment, it was observed that after the transfer of SPTLC2 overexpression vector into the cells, the vitality and proliferation ability of the cells were significantly reduced ( P < 0.05), and the vitality and proliferation ability of the cells improved after being treated with Erucin. After the transfer of Si-SPTLC2 into the cells, the viability and proliferation ability of the cells were significantly increased, and after being treated with U0126, the viability and proliferation ability of the cells were significantly decreased ( P < 0.05). These results suggest that activation of MEK/ERK pathway can alleviate the inhibitory effect of SPTLC2 high expression on NSCs activity and proliferation, and vice versa. Given the significant role of the MEK/ERK pathway in NSCs, regulatory strategies targeting this pathway are employed in the treatment of neurological diseases. For instance, the activation of the MEK/ERK pathway can facilitate the proliferation and differentiation of NSCs, thus promoting the repair and regeneration of nerve damage. The MEK/ERK pathway plays a crucial role in the biological function of NSCs. By profoundly understanding the mechanism of action of this pathway in NSCs, new strategies and targets can be provided for the treatment of neurological diseases. NSCs therapy may result in tumor formation [ 31 ]. However, MEK/ERK pathway is associated with tumor formation, and whether intervention of MEK/ERK pathway through SPTLC2 can inhibit tumorigenicity during NSCs therapy remains to be investigated. In theory and under certain conditions, NSCs are highly operable, can bypass the blood-brain barrier, and participate in the repair of impaired neural functions [ 32 – 34 ]. Nevertheless, NSCs therapy currently encounters difficulties in maintaining cell viability and function during implantation in vivo, which may lead to low survival rate and poor prognosis of NSCs transplanted cells [ 35 ]. It is expected to improve the activity and proliferation of NSCs by inhibiting SPTLC2. Conclusion Based on the above experimental and literature support, we put forward a reasonable supposition that SPTLC2 was a key enzyme but might also serve as a cytoplasmic messenger to affect the cell cycle. It is also concluded that overexpression of SPTLC2 can inhibit the activity and proliferation of NSCs via the MEK/ERK pathway. Inhibition of SPTLC2 expression can enhance the activity and proliferation of NSCs, which likely occurs through MEK/ERK pathway. Additionally, SPTLC2 is a potential target for drug development, and modulating the activity of SPTLC2 may offer new strategies for treating diseases associated with abnormal sphingolipid metabolism. Further research on SPTLC2 will assist us in better understanding the mechanism of related diseases and developing new treatments. Declarations AUTHOR CONTRIBUTIONS Xinhong Su: Data curation; Experimental implementation; writing-original draft. Folin Lan: Experimental implementation. Junlong Huang: Data analysis; Proofread. Yuqin Ye: formal analysis; Tianqing Liu: project administration; writing – review and editing. ACKNOWLEDGMENTS Not applicable. CONFLICT OF INTEREST STATEMENT The authors have no conflict of interest. DATA AVAILABILITY STATEMENT All raw data and code are available upon request. FUNDING INFORMATION This study was supported by the project of Longyan Science and Technology Bureau (2022LYF17098), Natural Science Foundation of Hunan Province (NO.2023JJ30432), and Excellent Youth Science Research Project of Hunan Education Department (NO.22B0095). ETHICS STATEMENT Ethical approval was granted by the Huafukang Bio, Beijing, License No. SCXK (Beijing) 2019-0008 References Vieira MS, Santos AK, Vasconcellos R, Goulart V, Parreira RC, Kihara AH, Ulrich H, Resende RR (2018) Neural stem cell differentiation into mature neurons: Mechanisms of regulation and biotechnological applications. Biotechnol Adv 36(7):1946-1970. https://doi: 10.1016/j.biotechadv.2018.08.002. 2 Matarredona ER, Zarco N, Castro C, Guerrero-Cazares H (2021) Editorial: Neural Stem Cells of the Subventricular Zone: From Neurogenesis to Glioblastoma Origin. Front Oncol 11:750116. https://doi: 10.3389/fonc.2021.750116. 3 Goncalves JT, Schafer ST, Gage FH (2016) Adult Neurogenesis in the Hippocampus: From Stem Cells to Behavior. Cell 167(4):897-914. https://doi: 10.1016/j.cell.2016.10.021. 4 Llorente V, Velarde P, Desco M, Gomez-Gaviro MV (2022) Current Understanding of the Neural Stem Cell Niches. Cells 11(19): 3002. https://doi: 10.3390/cells11193002 5 Chen C, Chang Z H, Yao B, Liu XY, Zhang XW, Liang J, Wang JJ, Bao SQ, Chen MM, Zhu P, Li XH (2024) 3D printing of interferon gamma-preconditioned NSC-derived exosomes/collagen/chitosan biological scaffolds for neurological recovery after TBI. Bioact Mater 39:375-391. https://doi: 10.1016/j.bioactmat.2024.05.026. 6 Culig L, Chu X, Bohr VA (2022) Neurogenesis in aging and age-related neurodegenerative diseases. Ageing Res Rev 78:101636. https://doi: 10.1016/j.arr.2022.101636. 7 Peruzzotti-Jametti L, Bernstock JD, Willis CM, Manferrari G, Rogall R, Fernandez-Vizarra E, Williamson JC, Braga A, van den Bosch A, Leonardi T, Krzak G, Kittel A, Beninca C, Vicario N, Tan S, Bastos C, Bicci I, Iraci N, Smith JA, Peacock B, Muller KH, Lehner PJ, Buzas EI, Faria N, Zeviani M, Frezza C, Brisson A, Matheson NJ, Viscomi C, Pluchino S (2021) Neural stem cells traffic functional mitochondria via extracellular vesicles. PLoS Biol 19(4):e3001166. https://doi: 10.1371/journal.pbio.3001166. 8 Nekanti U, Sakthivel PS, Zahedi A, Creasman DA, Nishi RA, Dumont CM, Piltti KM, Guardamondo GL, Hernandez N, Chen X, Song H, Lin X, Martinez J, On L, Lakatos A, Pawar K, David BT, Guo Z, Seidlits SK, Xu X, Shea LD, Cummings BJ, Anderson AJ (2024) Multichannel bridges and NSC synergize to enhance axon regeneration, myelination, synaptic reconnection, and recovery after SCI. NPJ Regen Med 9(1):12. https://doi: 10.1038/s41536-024-00356-0. 9 Hornemann T, Penno A, Rutti MF, Ernst D, Kivrak-Pfiffner F, Rohrer L, von Eckardstein A (2009) The SPTLC3 subunit of serine palmitoyltransferase generates short chain sphingoid bases. J Biol Chem 284(39):26322-26330. https://doi: 10.1074/jbc.M109.023192. Kuo A, Hla T (2024) Regulation of cellular and systemic sphingolipid homeostasis. Nat Rev Mol Cell Biol 25(10):802-821. https://doi: 10.1038/s41580-024-00742-y. Murphy SM, Ernst D, Wei Y, Laura M, Liu YT, Polke J, Blake J, Winer J, Houlden H, Hornemann T, Reilly MM (2013) Hereditary sensory and autonomic neuropathy type 1 (HSANI) caused by a novel mutation in SPTLC2. Neurology 80(23):2106-2111. https://doi: 10.1212/WNL.0b013e318295d789. Wang D, Sun L, Niu X, Ren L, Yang X (2025) SphK2 promotes the progression of Helicobacter pylori-positive gastric cancer by regulating the Ras/MEK/ERK pathway. Biochem Biophys Res Commun 751:151396. https://doi: 10.1016/j.bbrc.2025.151396. Ullah R, Yin Q, Snell AH, Wan L (2022) RAF-MEK-ERK pathway in cancer evolution and treatment. Semin Cancer Biol 85:123-154. https://doi: 10.1016/j.semcancer.2021.05.010. Jiang J, Hai J, Liu W, Luo Y, Chen K, Xin Y, Pan J, Hu Y, Gao Q, Xiao F, Luo H (2021) Gallic Acid Induces Neural Stem Cell Differentiation into Neurons and Proliferation through the MAPK/ERK Pathway. J Agric Food Chem 69(42):12456-12464. https://doi: 10.1021/acs.jafc.1c04011. Migita H, Kominami K, Higashida M, Maruyama R, Tuchida N, McDonald F, Shimada F, Sakurada K (2008) Activation of adenosine A1 receptor-induced neural stem cell proliferation via MEK/ERK and Akt signaling pathways. J Neurosci Res 86(13):2820-2828. https://doi: 10.1002/jnr.21742. Wang QC, Lu L, Zhou HJ (2019) Relationship between the MAPK/ERK pathway and neurocyte apoptosis after cerebral infarction in rats. Eur Rev Med Pharmacol Sci 23(12):5374-5381. https://doi: 10.26355/eurrev_201906_18206. Jakubikova J, Sedlak J, Mithen R, Bao Y (2005) Role of PI3K/Akt and MEK/ERK signaling pathways in sulforaphane-and erucin-induced phase II enzymes and MRP2 transcription, G2/M arrest and cell death in Caco-2 cells. Biochem Pharmacol 69(11):1543-1552. https://doi: 10.1016/j.bcp.2005.03.015. Melchini A, Costa C, Traka M, Miceli N, Mithen R, De Pasquale R, Trovato A (2009) Erucin, a new promising cancer chemopreventive agent from rocket salads, shows anti-proliferative activity on human lung carcinoma A549 cells. Food Chem Toxicol 47(7):1430-1436. https://doi: 10.1016/j.fct.2009.03.024. Tarozzi A, Morroni F, Bolondi C, Sita G, Hrelia P, Djemil A, Cantelli-Forti G (2012) Neuroprotective effects of erucin against 6-hydroxydopamine-induced oxidative damage in a dopaminergic-like neuroblastoma cell line. Int J Mol Sci 13(9):10899-10910. https://doi: 10.3390/ijms130910899. Wang T, Wu J, Dong W, Wang M, Zhong X, Zhang W, Dai L, Xie Y, Liu Y, He X, Liu W, Madhusudhan T, Zeng H, Wang H (2021) The MEK inhibitor U0126 ameliorates diabetic cardiomyopathy by restricting XBP1's phosphorylation dependent SUMOylation. Int J Biol Sci 17(12):2984-2999. https://doi: 10.7150/ijbs.60459. Satoh T, Nakatsuka D, Watanabe Y, Nagata I, Kikuchi H, Namura S (2000) Neuroprotection by MAPK/ERK kinase inhibition with U0126 against oxidative stress in a mouse neuronal cell line and rat primary cultured cortical neurons. Neurosci Lett 288(2):163-166. https://doi: 10.1016/s0304-3940(00)01229-5. Candelario-Jalil E, Dijkhuizen RM, Magnus T (2022) Neuroinflammation, Stroke, Blood-Brain Barrier Dysfunction, and Imaging Modalities. Stroke 53(5):1473-1486. https://doi: 10.1161/STROKEAHA.122.036946. Julian D, Hollingsworth E W, Julian K, Imitola J (2019) Convergence of human cellular models and genetics to study neural stem cell signaling to enhance central nervous system regeneration and repair. Semin Cell Dev Biol 95:84-92. https://doi: 10.1016/j.semcdb.2019.07.002. Liu F, Xuan A, Chen Y, Zhang J, Xu L, Yan Q, Long D (2014) Combined effect of nerve growth factor and brain‑derived neurotrophic factor on neuronal differentiation of neural stem cells and the potential molecular mechanisms. Mol Med Rep 10(4):1739-1745. https://doi: 10.3892/mmr.2014.2393. He Q, Wang G, Wakade S, Dasgupta S, Dinkins M, Kong JN, Spassieva SD, Bieberich E (2014) Primary cilia in stem cells and neural progenitors are regulated by neutral sphingomyelinase 2 and ceramide. Mol Biol Cell 25(11):1715-1729. https://doi: 10.1091/mbc.E13-12-0730. Fan W, Tang S, Fan X, Fang Y, Xu X, Li L, Xu J, Li JL, Wang Z, Li X (2021) SIRT1 regulates sphingolipid metabolism and neural differentiation of mouse embryonic stem cells through c-Myc-SMPDL3B. Elife 10:e67452. https://doi: 10.7554/eLife.67452. Tan B, Luo Z, Yue Y, Liu Y, Pan L, Yu L, Yin Y (2016) Effects of FTY720 (Fingolimod) on Proliferation, Differentiation, and Migration of Brain-Derived Neural Stem Cells. Stem Cells Int 2016:9671732. https://doi: 10.1155/2016/9671732. Su X, Ye Y, Yang Y, Zhang K, Bai W, Chen H, Kang E, Kong C, He X (2019) The Effect of SPTLC2 on Promoting Neuronal Apoptosis is Alleviated by MiR-124-3p Through TLR4 Signalling Pathway. Neurochem Res 44(9):2113-2122. https://doi: 10.1007/s11064-019-02849-7. Sutterlin P, Williams EJ, Chambers D, Saraf K, von Schack D, Reisenberg M, Doherty P, Williams G (2013) The molecular basis of the cooperation between EGF, FGF and eCB receptors in the regulation of neural stem cell function. Mol Cell Neurosci 52:20-30. https://doi: 10.1016/j.mcn.2012.10.006. Liao W, Zheng Y, Fang W, Liao S, Xiong Y, Li Y, Xiao S, Zhang X, Liu J (2018) Dual Specificity Phosphatase 6 Protects Neural Stem Cells from beta-Amyloid-Induced Cytotoxicity through ERK1/2 Inactivation. Biomolecules 8(4): 181. https://doi: 10.3390/biom8040181. Rahimi DR, Seyedoshohadaei SA, Ramezani R, Rezaei N (2024) Stem cell therapies for neurological disorders: current progress, challenges, and future perspectives. Eur J Med Res 29(1):386. https://doi: 10.1186/s40001-024-01987-1. Boese AC, Le QE, Pham D, Hamblin MH, Lee JP (2018) Neural stem cell therapy for subacute and chronic ischemic stroke. Stem Cell Res Ther 9(1):154. https://doi: 10.1186/s13287-018-0913-2. Eckert A, Huang L, Gonzalez R, Kim HS, Hamblin MH, Lee JP (2015) Bystander Effect Fuels Human Induced Pluripotent Stem Cell-Derived Neural Stem Cells to Quickly Attenuate Early Stage Neurological Deficits After Stroke. Stem Cells Transl Med 4(7):841-851. https://doi: 10.5966/sctm.2014-0184. Gincberg G, Arien-Zakay H, Lazarovici P, Lelkes PI (2012) Neural stem cells: therapeutic potential for neurodegenerative diseases. Br Med Bull 104:7-19. https://doi: 10.1093/bmb/lds024. De Gioia R, Biella F, Citterio G, Rizzo F, Abati E, Nizzardo M, Bresolin N, Comi GP, Corti S (2020) Neural Stem Cell Transplantation for Neurodegenerative Diseases. Int J Mol Sci 21(9):3103. https://doi: 10.3390/ijms21093103. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7137060","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":490630401,"identity":"f89b8219-2a6f-4fe3-9e21-5c8a7c15dd4f","order_by":0,"name":"Tianqing Liu","email":"","orcid":"","institution":"Longyan First Hospital Affiliated to Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Tianqing","middleName":"","lastName":"Liu","suffix":""},{"id":490630402,"identity":"686bf56b-6cd9-45c6-b448-d09c7aca296a","order_by":1,"name":"Folin Lan","email":"","orcid":"","institution":"Longyan First Hospital Affiliated to Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Folin","middleName":"","lastName":"Lan","suffix":""},{"id":490630403,"identity":"44a2c4fe-0354-43b2-b9b2-4dd4e9674b16","order_by":2,"name":"Junlong Huang","email":"","orcid":"","institution":"Longyan First Hospital Affiliated to Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Junlong","middleName":"","lastName":"Huang","suffix":""},{"id":490630404,"identity":"4e9fa19f-5993-4853-911a-9453c382f5bb","order_by":3,"name":"Yuqin Ye","email":"","orcid":"","institution":"Air Force Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yuqin","middleName":"","lastName":"Ye","suffix":""},{"id":490630405,"identity":"d4f389df-6d92-4797-ac42-18a4db0d180f","order_by":4,"name":"Xinhong Su","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyElEQVRIiWNgGAWjYDACCSBOqLCp72dgbCBBy4MzaYwzG0jRwviw7TDjhgPEusvgdvszicS2NGbj84fbHvxgsJPTJWSZ5JwzZhIJ52zYzG4kthv2MCQbmxGyjl8ih00ioSyNx+wGY5sED8OBxG2EtLBJpD+TSGA7LGHcf7BN8g8xWvglEoAOaztsYMCQ2CZNlC2SM3KMLRLOpCVI3ABqkTEgwi8GN9If3vxRYZPA33/8meSbCjs5glrQTSBN+SgYBaNgFIwCHAAAeAZBx6cAkMkAAAAASUVORK5CYII=","orcid":"","institution":"Longyan First Hospital Affiliated to Fujian Medical University","correspondingAuthor":true,"prefix":"","firstName":"Xinhong","middleName":"","lastName":"Su","suffix":""}],"badges":[],"createdAt":"2025-07-16 07:38:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7137060/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7137060/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":87732264,"identity":"bf4d3ab2-342b-4564-a8fc-1d7c99dc447a","added_by":"auto","created_at":"2025-07-28 11:48:29","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":166068,"visible":true,"origin":"","legend":"\u003cp\u003eIdentification of NSCs through fluorescent staining. NSCs was immunostained using antibodies against nestin. Scale bars= 100 μm.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7137060/v1/c2e054268a2bc8d8db170418.png"},{"id":87733269,"identity":"1939f1a7-84a6-49cd-acfc-2b7bbb5f59cd","added_by":"auto","created_at":"2025-07-28 11:56:29","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":107715,"visible":true,"origin":"","legend":"\u003cp\u003eVerification of transfection efficiency of SPTLC2 overexpression interfering with vector transfection. (A, D) The expression of SPTLC2 was detected by western blot. (B, E) Quantification of Western blots. (C, F) SPTLC2 was quantitatively detected by qPCR. Actin was used as a loading control. Values are presented as the means ± SD, with n=3 independent experiments, *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 vs. Control and NC group. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05 vs. Control and NC group.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7137060/v1/6475d0ee985aeec528656627.png"},{"id":87732262,"identity":"8851ba89-a5dc-4dc5-89a8-938dc957803f","added_by":"auto","created_at":"2025-07-28 11:48:29","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":39328,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of SPTLC2 on the activity of NSCs. The values were presented as the means ± SD, with n=3 independent experiments, *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 vs. Control and SPTLC2-OE-NC group. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05 vs. Control and Si-SPTLC2-NC group.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7137060/v1/1f747edf76887116cd442eb7.png"},{"id":87733270,"identity":"d6bc267d-70be-4155-a802-51e699c20c39","added_by":"auto","created_at":"2025-07-28 11:56:29","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":283915,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of SPTLC2 on proliferation of NSCs. (A) EdU fluorescence staining. (B) Quantification of EdU fluorescence staining. The values are presented as the means ± SD, with n=3 independent experiments, *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 vs. Control and SPTLC2-OE-NC group. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05 vs. Control and Si-SPTLC2-NC group. Scale bars= 100 μm.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7137060/v1/cac6193867f6c26d51dab26f.png"},{"id":87733272,"identity":"e3c12ebe-59d6-4c6d-9e61-b0fcb285aac8","added_by":"auto","created_at":"2025-07-28 11:56:29","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":139314,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of SPTLC2 and proteins related to MEK/ERK pathway was negatively correlated. (A, E) The expression of SPTLC2, pMEK, MEK, pERK, and ERK proteins was detected by western blot. (B, C, D, F, G, H) Quantification of Western blots. Actin was used as a loading control. Values are presented as the means ± SD, with n=3 independent experiments, *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 vs. Control and NC group.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7137060/v1/082d65af1989c11d623f0c33.png"},{"id":87733481,"identity":"fb0af9fe-5e86-4ac8-980e-3f2132376c9a","added_by":"auto","created_at":"2025-07-28 12:04:29","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":32461,"visible":true,"origin":"","legend":"\u003cp\u003eThe appropriate concentrations of Erucin and U0126 were detected by the CCK8 method. A Erucin drug concentration test. B U0126 drug concentration test. Values are presented as the means ± SD, with n=3 independent experiments, *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 vs. 0 μm group.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7137060/v1/cf03717d70902dde5aa4acf0.png"},{"id":87732283,"identity":"bf87a674-3ee3-4d9d-a41c-b96aeaa1a255","added_by":"auto","created_at":"2025-07-28 11:48:30","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":280623,"visible":true,"origin":"","legend":"\u003cp\u003eSPTLC2 inhibited the proliferation of NSCs. (A) NSCss proliferation capacity was analyzed through EdU. (B) Quantification of EdU fluorescence staining. (C) The expression of SPTLC2 was detected by western blot. (D) Quantification of western blots. Actin was used as a loading control. Values are presented as the means ± SD, with n=3 independent experiments, *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, \u003csup\u003ens\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e> 0.05. Scale bars= 100 μm.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-7137060/v1/4bf41b8c8a3c0226d3611cf1.png"},{"id":87732286,"identity":"43310ffb-acb2-432c-ace5-b54281eff721","added_by":"auto","created_at":"2025-07-28 11:48:30","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":148021,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of Erucin and U0126 on SPTLC2 and the MEK/ERK pathway. (A, E) Detection of the protein expression of SPTLC2, pMEK, MEK, pERK, and ERK by western blot. (B, C, D, F, G, H) Quantification of Western blots. Actin was used as a loading control. Values are presented as the means ± SD, with n=3 independent experiments, *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 vs. Control group, \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 vs. Control and SPTLC2-OE group or Control and Si-SPTLC2 group.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-7137060/v1/454fae5a60783c009a076cfe.png"},{"id":87732290,"identity":"d9523605-9c9c-4bc2-9a45-fbef59b1110a","added_by":"auto","created_at":"2025-07-28 11:48:30","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":272527,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of different reagents on NSCs proliferation ability.(A) EdU fluorescence staining. (B) Quantification of EdU fluorescence staining. Values are presented as the means ± SD, with n=3 independent experiments, *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05. Scale bars= 100 μm.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-7137060/v1/89d966f25502857434e226c8.png"},{"id":91721183,"identity":"68b63294-b9e2-4c0c-96f2-93970e1e38e2","added_by":"auto","created_at":"2025-09-19 14:16:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2059429,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7137060/v1/fd263d62-9cc8-4c5c-93ac-6af5cf618ee1.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"SPTLC2 Negatively Regulates Neural Stem Cell Activity and Proliferation via Inhibition of the MEK/ERK Signaling: Insights into the Molecular Mechanisms Underlying Neural Stem Cell Behavior","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNeural Stem Cells (NSCs) has garnered significant attention in the domains of neuroscience and regenerative medicine due to its potential to differentiate into neurons, astrocytes and oligodendrocytes. It is a type of cells with self-renewal capacity and multi-differentiation potential. Undifferentiated NSCs do not express mature cell antigens, thus it is less likely to be recognized and attacked by the immune system, which renders them to have a favorable safety profile in cell transplantation therapy [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. NSCs was initially isolated primarily from the neural tissue of the embryo, such as the hippocampus and the subventricular region of the embryonic brain [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Some specific areas of the adult brain, like the dentate gyrus of the hippocampus and the subependymal zone, also contain a small number of NSCs and can be partially activated under certain conditions, such as injury, bleeding, ischemia and hypoxia, and alterations in the microenvironment [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Because of their differentiation potential, NSCs has been extensively studied for the treatment of various neurological disorders, such as Parkinson's disease, Alzheimer's disease, brain injury, stroke and multiple sclerosis [\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. NSCs can facilitate axon regeneration and myelination, accelerate nerve repair process, and assist in improving nerve function recovery [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Although NSCs demonstrate great potential in the treatment of nervous system diseases, numerous challenges persist, such as survival after cell transplantation, control of differentiation, immune response, and ethical issues. Future research is expected to tackle these problems, optimize the isolation, culture and transplantation of NSCs, and facilitate their transition from basic research to clinical applications.\u003c/p\u003e\u003cp\u003eSerine Palmitoyltransferase Long Chain Base Subunit 2 (SPTLC2) is one of the components of the serine palmitoyl transferase complex, which plays a key role in the biosynthesis of sphingolipid [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Sphingolipid is an important component of cell membranes and is indispensable for cell signaling. It maintains the structural integrity of cells and is involved in various cell signaling pathways. It is also an essential component for maintaining the stability and function of cell membranes, as well as cell growth, differentiation, and apoptosis [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Mutations in the SPTLC2 gene have been associated with several genetic disorders, like hereditary sensory autonomic neuropathy Type 1C, which is a disorder that affects the sensory and autonomic nervous systems in which patients might experience symptoms such as sensory loss and autonomic dysfunction [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Some enzymes that affect lipid metabolites such as sphingosine kinase 2 can impact the properties of the cell membrane, including the distribution and activity of receptors on the membrane, which might affect the activation of the mitogen-activated protein kinase (MEK)/ extracellular signal-regulated kinase (ERK) pathway [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Therefore, SPTLC2 might indirectly or directly affect the differentiation and function of NSCs by affecting myelin sheath formation. Although direct evidence is lacking, considering the role of SPTLC2 in lipid metabolism and the extensive impact of MEK/ERK pathway on cell function, it can be hypothesized that SPTLC2 might indirectly affect the activity and function of MEK/ERK pathway by regulating the lipid environment of cell membranes.\u003c/p\u003e\u003cp\u003eMEK/ERK pathway is a highly significant pathway in cell signaling, which participates in numerous biological processes, including cell growth, differentiation, proliferation and apoptosis. MEK is a bispecific protein kinase that phosphorylates and activates downstream ERK protein kinase. ERK is a member of the mitogen-activated protein kinase family. Once activated, ERK can enter the nucleus and regulate the activity of transcription factors, thereby influencing gene expression. Under physiological conditions, the MEK/ERK pathway is involved in the regulation of cell growth, differentiation and survival, and is indispensable for maintaining tissue homeostasis and development [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. There are abundant literatures supporting that the MEK/ERK pathway is involved in the proliferation, differentiation, migration, apoptosis and other processes of NSCs [\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. This study intends to explore whether SPTLC2 can influence the activity and proliferation of NSCs via the MER/ERK pathway.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cb\u003eNSCs culture\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSD rats with 14 days of pregnancy (Huafukang Bio, Beijing, License No. SCXK (Beijing) 2019-0008) were euthanized by inhalation of excess CO2. The fetal mice were removed after alcohol disinfection. The cortical and hippocampus regions were isolated in ice phosphate buffered solution (PBS) and cut them into small pieces as much as possible. Under sterile conditions, tissues were collected. After being washed with D-Hank solution three times, the tissues and 0.125% trypsin /0.02% EDTA solution (Solarbio, Beijing, China) was incubated at 37℃ for 10min. Then, the tissues were ground with 5 ml pipette and filtered with copper mesh to eliminate tissue blocks from the cell suspension. The filtered cell suspension was centrifuged at 1000\u0026times;g for 3 min, and the trypsin-EDTA solution was removed. The cells were suspended in DMEM/F-12 medium (keygenbio, Jiangsu, China) containing 10% fetal bovine serum. They were washed three times and the supernatant was removed. The cells were re-suspended in serum-free DMEM/F-12 medium containing 20ng/mL basic fibroblast growth factor and 20ng/mL epidermal growth factor (Gibco, Grand Island, NY, USA), and were cultured at 37℃, 5%CO2, and saturated humidity.\u003c/p\u003e\u003cp\u003eThe medium was changed half-volume every 2 to 3 days and subcultured every 5 to 7 days. The NSCs were subcultured three times and then cultured in 6-well plates at a density of 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e/ml for the following experiments.\u003c/p\u003e\u003cp\u003e\u003cb\u003eThe expression of SPTLC2 was changed by transfection\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAfter a 2-3-day culture period, the SPTLC2 overexpression vector and interference vector were transfected into cells respectively using the Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer\u0026rsquo;s instructions. The pcDNA3.1-SPTLC2 (2 \u0026micro;g) (ZHBY Bio, Jiangxi, China) and Lipofectamine 2000 reagent (10 \u0026micro;l) were respectively diluted into 125 \u0026micro;l Neurobasal\u0026trade; medium (Gibco) for 5 min and then mixed for 20 min at room temperature. The cells were treated with the transfection solutions after being washed three times with PBS. After 6 h of transfection, the transfection solutions were replaced by Neurobasal\u0026trade; supplemented with 2% B27 (Gibco) and 0.5 mM glutamine (Gibco). Similarly, pcDNA3.1- small interfering pcDNA3.1-siSPTLC2-356 (2 \u0026micro;g), pcDNA3.1-siSPTLC2-739 (2 \u0026micro;g), pcDNA3.1-siSPTLC2-1095 (2 \u0026micro;g) and pcDNA3.1 empty vector as negative control (NC) (2\u0026micro;g) were individually transfected into cells using the same approach. The cells were classified randomly into following groups: control group, SPTLC2 overexpression (OE) NC group, SPTLC2 OE group, si-SPTLC2 NC group, and si-SPTLC2 group. The cells in each group were treated for 48 hours for subsequent detection.\u003c/p\u003e\u003cp\u003e\u003cb\u003eExplore the appropriate drug concentrations of Erucin and U0126\u003c/b\u003e\u003c/p\u003e\u003cp\u003e10 mg of Erucin (#HY-121323, Medchemexpress LLC, Shanghai, China) was dissolved in 1.55 ml of DMSO to prepare a solution with a concentration of 40mM.10 mg of U0126 (#HY-12031, Medchemexpress) was dissolved in 1.172 ml of DMSO to prepare a solution with a concentration of 20 mM. They were respectively diluted to drug concentrations of 0 \u0026micro;M, 1 \u0026micro;M, 2 \u0026micro;M, 5 \u0026micro;M, 10 \u0026micro;M and 20 \u0026micro;M. The experimental procedures for detecting cell activity by cell counting kit-8 assay (CCK8) were the same as those described in section 2.7 of materials and methods.\u003c/p\u003e\u003cp\u003e\u003cb\u003eQuantitative real-time PCR\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTrizon reagent (Wanleibio, Shenyang, China) was used to extract total RNA from cells, mRNA was obtained using the RNA ultra-pure extraction kit (Wanleibio). The concentration and purity (OD260/OD280) of mRNA were determined by an ultraviolet visible spectrophotometer (Tianmei instrument, Shanghai, China), and cDNA was synthesized with the RNA reverse transcription kit (Sangon biotech, Shanghai, China). Fluorescence quantitative PCR was performed using a fluorescent PCR instrument (Bole life medical products Co., LTD., Shanghai, China). The reaction steps were as follows: predenaturation at 95 ℃ for 10 min, denaturation at 95 ℃ for 10 s, annealing at 58 ℃ for 30 s, extension at 72 ℃ for 30 s, with40 cycles. Using GAPDH as internal reference, the relative gene expression was calculated by the 2-△△Ct method. The primer sequence was presented in the following table.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimer name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer sequence(5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGACAACTTTGGCATCGTGGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eATGCAGGGATGATGTTCTGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSPTLC2 F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACTGTCGGGAGCAACCATTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSPTLC2 R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGAACAATAGACCCTTCCATGCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eWestern blot analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eCells were washed with PBS and lysis buffer ( Sangon). The cells were scraped to one side and drawn into the labeled eppendorf (EP) tube with a pipette. The cells were completely disrupted by a cell disruptor and then centrifuged at 12,000 r/min for 10 min. The supernatant was taken and transferred to a new EP tube. The bicinchoninic acid (BCA, Sangon) buffer solution was added and boiled in boiling water for 5 min. The protein concentration was determined by the BCA method. Based on the determined protein concentration, the volume of the sample to be filled was converted so that the protein in each well was 6 \u0026micro;g. Protein were extracted and separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE, Wanleibio). Subsequently, the proteins were transferred to a polyvinylidene fluoride (Millipore, Billerica, USA). The membranes were blocked by 5% skim milk powder and then incubated with anti- SPTLC2 (1:1000, #51012-2-AP, Proteintech, Chicago, USA), Anti MEK1/2 (1:1000, #af6385, Affinity bioscience, Cincinnati, USA), Anti-p-MEK1/2 (1:1000, #DF7768, Affinity), Anti-ERK1/2 (1:1000, #AF0155, Affinity), Anti P-ERK1/2 (1:1000, #AF1015, Affinity), Anti-β-Actin(1:2000, #HC201, TransGenbiotech, Beijing, China) over night at 4℃. Horseradish peroxidase (HRP) conjugated goat anti-mouse IgG (H\u0026thinsp;+\u0026thinsp;L) (1:2000, #GB23301, Servicebio, Wuhan, China) or HRP conjugated goat anti-rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) (1:2000, #GB23303, Servicebio) was used as secondary antibody. Finally, protein bands were visualized with enhanced chemiluminescence solution (Wanleibio).\u003c/p\u003e\u003cp\u003e\u003cb\u003eImmunofluorescent staining\u003c/b\u003e\u003c/p\u003e\u003cp\u003eCells were fixed in 4% paraformaldehyde for 15 min and washed three times with PBS. Subsequently, the samples were permeabilized with 0.5% Triton X-100 for 15 min, washed three times with PBS and then blocked with blocking buffer (Beyotime, Beijing, China) for 30 min. After that, Nestin antibody (1/200, #DF7754, Affinity) was incubated at 4℃ overnight. After washing, fluorescent secondary antibody (1/200, #AS007, Abclonal technology, Wuhan, China) was added, then the disc was sealed with DAPI (#KGE2505-10, keygenbio) and observed under a fluorescence microscope (CKX53, Olympus, Japan).\u003c/p\u003e\u003cp\u003e\u003cb\u003eCCK8 detection\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAccording to section 2.2 of materials and methods, 96-well plates were taken and labeled for grouping after cell transfection. 100 \u0026micro;l of cell suspension was added to each well and placed in an incubator at 37\u0026deg;C and 5% CO₂ for 24 hours of culture. Then, 10\u0026micro;l of CCK8 reagent (keygenbio) was added to each well and incubated in the incubator for 2 hours. The absorbance value of each well was determined by the enzyme labeling instrument (WD-2012B, Beijing 61 instrument factory) at a wavelength of 450nm. According to section 2.3 of materials and methods, various concentrations of Erucin or U0126 drugs were prepared. After treating NSCs, CCk8 detection was carried out in accordance with the aforementioned method.\u003c/p\u003e\u003cp\u003e\u003cb\u003eEdU detection\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe proliferation capacity of the cells was measured by using the 5-ethynyl-2'-deoxyuridine (EdU) proliferation assay kit (Beyotime). The cells were classified randomly into following groups: control group, control and DMSO group, control and NC group, SPTLC2 OE group, SPTLC2 OE and NCgroup, si-SPTLC2 group, si-SPTLC2 and NC group, SPTLC2 OE and si-SPTLC2 group, SPTLC2 OE and Erucin group, si-SPTLC2 and U0126 group. After the cells were treated separately for 48 hours, they were incubated with EdU working solution (the concentration was 10 \u0026micro;M) diluted with fresh medium for 2 hours. The supernatant was removed, and the cells were fixed with 4% paraformaldehyde for 15 min, and then incubated with 0.5% Triton X-100 at room temperature for 10 min. Subsequently, the click reaction solution was added and incubated for 30 min in the absence of light. After each step, the cells should rinsed with PBS three times, each time for 3 min. The cell nuclei were re-stained with 1ml of 1\u0026times; Hoechst33342 (Beyotime) and incubated at room temperature in the dark for 10 min. The 1X Hoechst 33342 solution was removed. The cells were washed three times with PBS for 3 min each time, and finally observed under a fluorescence microscope (Olympus).\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eGraphPad Prism (Version 8, GraphPad Software Inc., San Diego, CA) and ImageJ (V1.8.0, National Institutes of Health, Bethesda, USA) were employed to analyze data and figures. All experiments were repeated at least three times. All data represented the average of three independent experiments and presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;the standard deviation (SD). Group differences were assessed by paired t-test and one-way analysis of variance (ANOVA). Meanwhile, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was regarded as the threshold of statistical significance.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eResults of the immunofluorescence identification of NSCs\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAs depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, bright red fluorescence can be observed under a fluorescence microscope, suggesting the positive expression of nestin, which is a marker of NSCs.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eThe transfection efficiency of SPTLC2 overexpression and interference vectors was verified by qPCR and western blot\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe qPCR and western blot results indicated that the expression of SPTLC2 in the overexpressed (OE) group was significantly higher than that in the OE negative control (NC) group. Compared with the interference NC group, the expression of SPTLC2 in Si-SPTLC2-1095 group was significantly reduced. In the subsequent experiment, we designated the Si-SPTLC2-1095 group as the Si-SPTLC2 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eThe effect of SPTLC2 on the viability of NSCs was determined by CCK8.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe CCK8 assay was used to test the activity of NSCs. The cell viability declined in the SPTLC2-OE group as compared with the Control and SPTLC2-OE-NC group. In contrast, the cell viability of the Si-SPTLC2 group was enhanced compared with the Control and Si-SPTLC2-NC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEdU identified the impact of SPTLC2 on the proliferation of NSCs\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe nucleus stained with DAPI exhibited blue fluorescence. The proliferative cells stained with EdU displayed red fluorescence. It was shown that the decreased red fluorescence in the SPTLC2-OE group compared with the Control and SPTLC2-OE-NC group indicated reduced cell proliferation. In contrast, compared with the Si-SPTLC2-NC group, the increased red fluorescence in the Si-SPTLC2 group indicated enhanced cell proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eWestern blot was employed to test the relationship between SPTLC2 and the MEK/ERK pathway\u003c/b\u003e\u003c/p\u003e\u003cp\u003eCompared with SPTLC2-OE-NC, SPTLC2 protein in SPTLC2-OE group was significantly increased, while the ratios of p-MEK/MEK and p-ERK/ERK were significantly decreased. In contrast, compared with the Si-SPTL2-NC group, the SPTLC2 protein was significantly decreased in the Si-SPTLC2 group, and the ratios of p-MEK/MEK and p-ERK/ERK were significantly increased in the Si-SPTLC2 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTo select the appropriate concentrations of Erucin and U0126\u003c/b\u003e\u003c/p\u003e\u003cp\u003eErucin, an isothiocyanate, is especially abundant in arugula. It has anti-cancer, neuroprotective and anti-inflammatory effects and serves as an efficient activator of MEK/ERK pathway [\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. However, as an inhibitor of the MEK/ERK pathway, U0126 inhibits the activities of MEK1 and MEK2 in a non-competitive manner, thereby preventing them from phosphorylating ERK1/2 [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The Erucin and U0126 reagents were respectively formulated at concentrations of 0 \u0026micro;m, 1 \u0026micro;m, 2 \u0026micro;m, 5 \u0026micro;m, 10 \u0026micro;m, and 20 \u0026micro;m, and their effects on cell activity were examined through the CCK8 experiment to screen for the appropriate concentrations. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, it was discovered that when the Erucin concentration was 10 \u0026micro;m, it exerted a relatively significant promoting effect on cell activity, while when the concentration reached 20 \u0026micro;m, it instead inhibited cell activity. From Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, it was found that when the U0126 concentration reached 5 \u0026micro;m, 10 \u0026micro;m, and 20 \u0026micro;m, it all had a significant inhibitory effect on cell activity. Therefore, a concentration of Erucin at 10 \u0026micro;m and a drug concentration of U0126 at 5 \u0026micro;m were selected for the subsequent experiments.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eVerification of the effect of SPTLC2 on the proliferation of NSCs\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThis experiment was performed to verify the effect of SPTLC2 on NSCs and exclude the influence of DMSO solvent on the experiment. Cells treated with DMSO showed no significant difference in cell proliferation. It could down-regulated the expression of SPTLC2 protein, but there was no significant difference. After the SPTLC2 overexpression vector was transferred into the cells, the expression of SPTLC2 protein was significantly increased, and the proliferation ability of NSCs was significantly decreased. However, when the SPTLC2 interference vector was transfected into the cells transfected with the SPTLC2 overexpression vector, the expression of SPTLC2 protein decreased, and the proliferation ability of NCS significantly increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eErucin enhanced the expression of MEK/ERK, while U0126 suppressed it\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAfter the overexpression of SPTLC2, the expression of SPTLC2 protein was elevated, and the ratios of pMEK/MEK and pERK/ERK were significantly reduced. On this basis, after being treated with Erucin, the expression of SPTLC2 protein was decreased, and the ratios of pMEK/MEK and pERK/ERK were significantly increased compared with SPTLC2-OE group. After interference with SPTLC2, the expression of SPTLC2 protein was lowered, and the ratios of pMEK/MEK and pERK/ERK were significantly increased. On this basis, after being treated with U0126, the expression of the SPTLC2 protein was increased, and the ratios of pMEK/MEK and pERK/ERK were significantly decreased compared with Si-SPTLC2 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eSPTLC2 might regulate the proliferation of NSCs through MEK/ERK pathway\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAfter the overexpression vector of SPTLC2 was transferred into cells, the cell proliferation ability was significantly reduced. However, after being treated with Erucin, the proliferation ability of NSCs was improved to a certain extent. After the transfer of Si-SPTLC2 into NSCs, the proliferation ability of NSCs was significantly enhanced. However, after being treated with U0126, the proliferation ability of NSCs was significantly decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eThe central nervous system (CNS), encompassing the brain and spinal cord, is truly challenging to repair once damaged due to its intricate physiological structure and function, which frequently gives rise to a series of severe complications and long-term health issues [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. With the advancement of science and technology, such as the continuous development of stem cell therapy, gene therapy, and other emerging treatmnets, there might be more effective therapeutic approaches in the future. Studies have indicated that transplanted NSCs, under the influence of nerve growth factors and other signaling stimuli in the host microenvironment, initiates the expression and recombination of intracellular structural proteins like microfilaments, microtubules, and intermediate filaments, participates in the emergence of neurites, and plays a crucial role in functions such as the formation of synapses, neurotransmitter transport, and nerve impulse conduction [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The occurrence of new processes is expected to eventually restore the symptoms and signs of physical motor and sensory disorders as well as cognitive and functional deficits caused by neuron loss.\u003c/p\u003e\u003cp\u003eSPTLC2 plays a key role in the synthesis of sphingolipids, which are implicated in cell membrane construction. A study showed that alterations in the activity of sphingolipid metabolizing enzymes such as ceramide synthase can influence the survival and proliferation of NSCs [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The authors found that inhibiting ceramide synthase enhanced the survival rate of NSCs and facilitated their proliferation. Studies had indicated that the direction of differentiation of NSCs into neurons or glial cells can be influenced by regulating sphingolipid metabolism [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Another study revealed that sphingosine-1-phosphate (S1P), a sphingolipid metabolite, exerts an important role in the migration of NSCs [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. It showed that S1P promotes the migration of NSCs to the injured area by activating a specific signaling pathway. Previous studies conducted by our group had demonstrated that STPLC2 can promote neuronal apoptosis [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In this study, through CCK assay and EdU staining, we observed that when STPTLC2 was highly expressed, the activity and proliferation of NSCs decreased, conversely, they increased. At the same time, we observed that the expression trend of SPTLC2 was inversely proportional to that of the important molecules in the MEK/ERK pathway. Therefore, we hypothesize that the effect of SPTLC2 on NSCs might be achieved through the MEK/ERK pathway.\u003c/p\u003e\u003cp\u003eMEK/ERK pathway plays an important role in regulating the proliferation of NSCs. A variety of growth factors and cytokines, such as epidermal growth factor (EGF) and fibroblast growth factor (FGF), promote proliferation of NSCs by activating the MEK/ERK pathway [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The activation of ERK is capable of regulating the expression of genes associated with the cell cycle, thereby propelling the cell into the division cycle. The MEK/ERK pathway is also of crucial importance for maintaining the survival of NSCs [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Activation of ERK can inhibit apoptotic pathways and promote the expression of anti-apoptotic proteins, thereby protecting NCS from various stress factors. By modifying the expression of STPLC2, a clear negative correlation was observed between the activity and proliferation of NSCs and SPTLC2. In order to verify the relationship between SPTLC2's regulation of NSCs activity and proliferation through MEK/ERK pathway, we altered the expression of SPTLC2 and introduced promoters and inhibitors of MEK/ERK pathway for further validation. In the experiment, it was observed that after the transfer of SPTLC2 overexpression vector into the cells, the vitality and proliferation ability of the cells were significantly reduced (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the vitality and proliferation ability of the cells improved after being treated with Erucin. After the transfer of Si-SPTLC2 into the cells, the viability and proliferation ability of the cells were significantly increased, and after being treated with U0126, the viability and proliferation ability of the cells were significantly decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These results suggest that activation of MEK/ERK pathway can alleviate the inhibitory effect of SPTLC2 high expression on NSCs activity and proliferation, and vice versa. Given the significant role of the MEK/ERK pathway in NSCs, regulatory strategies targeting this pathway are employed in the treatment of neurological diseases. For instance, the activation of the MEK/ERK pathway can facilitate the proliferation and differentiation of NSCs, thus promoting the repair and regeneration of nerve damage. The MEK/ERK pathway plays a crucial role in the biological function of NSCs. By profoundly understanding the mechanism of action of this pathway in NSCs, new strategies and targets can be provided for the treatment of neurological diseases. NSCs therapy may result in tumor formation [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. However, MEK/ERK pathway is associated with tumor formation, and whether intervention of MEK/ERK pathway through SPTLC2 can inhibit tumorigenicity during NSCs therapy remains to be investigated. In theory and under certain conditions, NSCs are highly operable, can bypass the blood-brain barrier, and participate in the repair of impaired neural functions [\u003cspan additionalcitationids=\"CR33\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Nevertheless, NSCs therapy currently encounters difficulties in maintaining cell viability and function during implantation in vivo, which may lead to low survival rate and poor prognosis of NSCs transplanted cells [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. It is expected to improve the activity and proliferation of NSCs by inhibiting SPTLC2.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eBased on the above experimental and literature support, we put forward a reasonable supposition that SPTLC2 was a key enzyme but might also serve as a cytoplasmic messenger to affect the cell cycle. It is also concluded that overexpression of SPTLC2 can inhibit the activity and proliferation of NSCs via the MEK/ERK pathway. Inhibition of SPTLC2 expression can enhance the activity and proliferation of NSCs, which likely occurs through MEK/ERK pathway. Additionally, SPTLC2 is a potential target for drug development, and modulating the activity of SPTLC2 may offer new strategies for treating diseases associated with abnormal sphingolipid metabolism. Further research on SPTLC2 will assist us in better understanding the mechanism of related diseases and developing new treatments.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXinhong Su: Data curation; Experimental implementation; writing-original draft. Folin Lan: Experimental implementation. Junlong Huang: Data analysis; Proofread. Yuqin Ye: formal analysis; Tianqing Liu: project administration; writing \u0026ndash; review and editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eACKNOWLEDGMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCONFLICT OF INTEREST STATEMENT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDATA AVAILABILITY STATEMENT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll raw data and code are available upon request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFUNDING INFORMATION\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the project of Longyan Science and Technology Bureau (2022LYF17098), Natural Science Foundation of Hunan Province (NO.2023JJ30432), and Excellent Youth Science Research Project of Hunan Education Department (NO.22B0095).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eETHICS STATEMENT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEthical approval was granted by the Huafukang Bio, Beijing, License No. SCXK (Beijing) 2019-0008\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eVieira MS, Santos AK, Vasconcellos R, Goulart V, Parreira RC, Kihara AH, Ulrich H, Resende RR (2018) Neural stem cell differentiation into mature neurons: Mechanisms of regulation and biotechnological applications. Biotechnol Adv 36(7):1946-1970. https://doi: 10.1016/j.biotechadv.2018.08.002.\u003c/li\u003e\n\u003cli\u003e2 Matarredona ER, Zarco N, Castro C, Guerrero-Cazares H (2021) Editorial: Neural Stem Cells of the Subventricular Zone: From Neurogenesis to Glioblastoma Origin. Front Oncol 11:750116. https://doi: 10.3389/fonc.2021.750116.\u003c/li\u003e\n\u003cli\u003e3 Goncalves JT, Schafer ST, Gage FH (2016) Adult Neurogenesis in the Hippocampus: From Stem Cells to Behavior. Cell 167(4):897-914. https://doi: 10.1016/j.cell.2016.10.021.\u003c/li\u003e\n\u003cli\u003e4 Llorente V, Velarde P, Desco M, Gomez-Gaviro MV (2022) Current Understanding of the Neural Stem Cell Niches. Cells 11(19): 3002. https://doi: 10.3390/cells11193002\u003c/li\u003e\n\u003cli\u003e5 Chen C, Chang Z H, Yao B, Liu XY, Zhang XW, Liang J, Wang JJ, Bao SQ, Chen MM, Zhu P, Li XH (2024) 3D printing of interferon gamma-preconditioned NSC-derived exosomes/collagen/chitosan biological scaffolds for neurological recovery after TBI. Bioact Mater 39:375-391. https://doi: 10.1016/j.bioactmat.2024.05.026.\u003c/li\u003e\n\u003cli\u003e6 Culig L, Chu X, Bohr VA (2022) Neurogenesis in aging and age-related neurodegenerative diseases. Ageing Res Rev 78:101636. https://doi: 10.1016/j.arr.2022.101636.\u003c/li\u003e\n\u003cli\u003e7 Peruzzotti-Jametti L, Bernstock JD, Willis CM, Manferrari G, Rogall R, Fernandez-Vizarra E, Williamson JC, Braga A, van den Bosch A, Leonardi T, Krzak G, Kittel A, Beninca C, Vicario N, Tan S, Bastos C, Bicci I, Iraci N, Smith JA, Peacock B, Muller KH, Lehner PJ, Buzas EI, Faria N, Zeviani M, Frezza C, Brisson A, Matheson NJ, Viscomi C, Pluchino S (2021) Neural stem cells traffic functional mitochondria via extracellular vesicles. PLoS Biol 19(4):e3001166. https://doi: 10.1371/journal.pbio.3001166.\u003c/li\u003e\n\u003cli\u003e8 Nekanti U, Sakthivel PS, Zahedi A, Creasman DA, Nishi RA, Dumont CM, Piltti KM, Guardamondo GL, Hernandez N, Chen X, Song H, Lin X, Martinez J, On L, Lakatos A, Pawar K, David BT, Guo Z, Seidlits SK, Xu X, Shea LD, Cummings BJ, Anderson AJ (2024) Multichannel bridges and NSC synergize to enhance axon regeneration, myelination, synaptic reconnection, and recovery after SCI. NPJ Regen Med 9(1):12. https://doi: 10.1038/s41536-024-00356-0.\u003c/li\u003e\n\u003cli\u003e9 Hornemann T, Penno A, Rutti MF, Ernst D, Kivrak-Pfiffner F, Rohrer L, von Eckardstein A (2009) The SPTLC3 subunit of serine palmitoyltransferase generates short chain sphingoid bases. J Biol Chem 284(39):26322-26330. https://doi: 10.1074/jbc.M109.023192.\u003c/li\u003e\n\u003cli\u003eKuo A, Hla T (2024) Regulation of cellular and systemic sphingolipid homeostasis. Nat Rev Mol Cell Biol 25(10):802-821. https://doi: 10.1038/s41580-024-00742-y.\u003c/li\u003e\n\u003cli\u003eMurphy SM, Ernst D, Wei Y, Laura M, Liu YT, Polke J, Blake J, Winer J, Houlden H, Hornemann T, Reilly MM (2013) Hereditary sensory and autonomic neuropathy type 1 (HSANI) caused by a novel mutation in SPTLC2. Neurology 80(23):2106-2111. https://doi: 10.1212/WNL.0b013e318295d789.\u003c/li\u003e\n\u003cli\u003eWang D, Sun L, Niu X, Ren L, Yang X (2025) SphK2 promotes the progression of Helicobacter pylori-positive gastric cancer by regulating the Ras/MEK/ERK pathway. Biochem Biophys Res Commun 751:151396. https://doi: 10.1016/j.bbrc.2025.151396.\u003c/li\u003e\n\u003cli\u003eUllah R, Yin Q, Snell AH, Wan L (2022) RAF-MEK-ERK pathway in cancer evolution and treatment. Semin Cancer Biol 85:123-154. https://doi: 10.1016/j.semcancer.2021.05.010.\u003c/li\u003e\n\u003cli\u003eJiang J, Hai J, Liu W, Luo Y, Chen K, Xin Y, Pan J, Hu Y, Gao Q, Xiao F, Luo H (2021) Gallic Acid Induces Neural Stem Cell Differentiation into Neurons and Proliferation through the MAPK/ERK Pathway. J Agric Food Chem 69(42):12456-12464. https://doi: 10.1021/acs.jafc.1c04011.\u003c/li\u003e\n\u003cli\u003eMigita H, Kominami K, Higashida M, Maruyama R, Tuchida N, McDonald F, Shimada F, Sakurada K (2008) Activation of adenosine A1 receptor-induced neural stem cell proliferation via MEK/ERK and Akt signaling pathways. J Neurosci Res 86(13):2820-2828. https://doi: 10.1002/jnr.21742.\u003c/li\u003e\n\u003cli\u003eWang QC, Lu L, Zhou HJ (2019) Relationship between the MAPK/ERK pathway and neurocyte apoptosis after cerebral infarction in rats. Eur Rev Med Pharmacol Sci 23(12):5374-5381. https://doi: 10.26355/eurrev_201906_18206.\u003c/li\u003e\n\u003cli\u003eJakubikova J, Sedlak J, Mithen R, Bao Y (2005) Role of PI3K/Akt and MEK/ERK signaling pathways in sulforaphane-and erucin-induced phase II enzymes and MRP2 transcription, G2/M arrest and cell death in Caco-2 cells. Biochem Pharmacol 69(11):1543-1552. https://doi: 10.1016/j.bcp.2005.03.015.\u003c/li\u003e\n\u003cli\u003eMelchini A, Costa C, Traka M, Miceli N, Mithen R, De Pasquale R, Trovato A (2009) Erucin, a new promising cancer chemopreventive agent from rocket salads, shows anti-proliferative activity on human lung carcinoma A549 cells. Food Chem Toxicol 47(7):1430-1436. https://doi: 10.1016/j.fct.2009.03.024.\u003c/li\u003e\n\u003cli\u003eTarozzi A, Morroni F, Bolondi C, Sita G, Hrelia P, Djemil A, Cantelli-Forti G (2012) Neuroprotective effects of erucin against 6-hydroxydopamine-induced oxidative damage in a dopaminergic-like neuroblastoma cell line. Int J Mol Sci 13(9):10899-10910. https://doi: 10.3390/ijms130910899.\u003c/li\u003e\n\u003cli\u003eWang T, Wu J, Dong W, Wang M, Zhong X, Zhang W, Dai L, Xie Y, Liu Y, He X, Liu W, Madhusudhan T, Zeng H, Wang H (2021) The MEK inhibitor U0126 ameliorates diabetic cardiomyopathy by restricting XBP1\u0026apos;s phosphorylation dependent SUMOylation. Int J Biol Sci 17(12):2984-2999. https://doi: 10.7150/ijbs.60459.\u003c/li\u003e\n\u003cli\u003eSatoh T, Nakatsuka D, Watanabe Y, Nagata I, Kikuchi H, Namura S (2000) Neuroprotection by MAPK/ERK kinase inhibition with U0126 against oxidative stress in a mouse neuronal cell line and rat primary cultured cortical neurons. Neurosci Lett 288(2):163-166. https://doi: 10.1016/s0304-3940(00)01229-5.\u003c/li\u003e\n\u003cli\u003eCandelario-Jalil E, Dijkhuizen RM, Magnus T (2022) Neuroinflammation, Stroke, Blood-Brain Barrier Dysfunction, and Imaging Modalities. Stroke 53(5):1473-1486. https://doi: 10.1161/STROKEAHA.122.036946.\u003c/li\u003e\n\u003cli\u003eJulian D, Hollingsworth E W, Julian K, Imitola J (2019) Convergence of human cellular models and genetics to study neural stem cell signaling to enhance central nervous system regeneration and repair. Semin Cell Dev Biol 95:84-92. https://doi: 10.1016/j.semcdb.2019.07.002.\u003c/li\u003e\n\u003cli\u003eLiu F, Xuan A, Chen Y, Zhang J, Xu L, Yan Q, Long D (2014) Combined effect of nerve growth factor and brain‑derived neurotrophic factor on neuronal differentiation of neural stem cells and the potential molecular mechanisms. Mol Med Rep 10(4):1739-1745. https://doi: 10.3892/mmr.2014.2393.\u003c/li\u003e\n\u003cli\u003eHe Q, Wang G, Wakade S, Dasgupta S, Dinkins M, Kong JN, Spassieva SD, Bieberich E (2014) Primary cilia in stem cells and neural progenitors are regulated by neutral sphingomyelinase 2 and ceramide. Mol Biol Cell 25(11):1715-1729. https://doi: 10.1091/mbc.E13-12-0730.\u003c/li\u003e\n\u003cli\u003eFan W, Tang S, Fan X, Fang Y, Xu X, Li L, Xu J, Li JL, Wang Z, Li X (2021) SIRT1 regulates sphingolipid metabolism and neural differentiation of mouse embryonic stem cells through c-Myc-SMPDL3B. Elife 10:e67452. https://doi: 10.7554/eLife.67452.\u003c/li\u003e\n\u003cli\u003eTan B, Luo Z, Yue Y, Liu Y, Pan L, Yu L, Yin Y (2016) Effects of FTY720 (Fingolimod) on Proliferation, Differentiation, and Migration of Brain-Derived Neural Stem Cells. Stem Cells Int 2016:9671732. https://doi: 10.1155/2016/9671732.\u003c/li\u003e\n\u003cli\u003eSu X, Ye Y, Yang Y, Zhang K, Bai W, Chen H, Kang E, Kong C, He X (2019) The Effect of SPTLC2 on Promoting Neuronal Apoptosis is Alleviated by MiR-124-3p Through TLR4 Signalling Pathway. Neurochem Res 44(9):2113-2122. https://doi: 10.1007/s11064-019-02849-7.\u003c/li\u003e\n\u003cli\u003eSutterlin P, Williams EJ, Chambers D, Saraf K, von Schack D, Reisenberg M, Doherty P, Williams G (2013) The molecular basis of the cooperation between EGF, FGF and eCB receptors in the regulation of neural stem cell function. Mol Cell Neurosci 52:20-30. https://doi: 10.1016/j.mcn.2012.10.006.\u003c/li\u003e\n\u003cli\u003eLiao W, Zheng Y, Fang W, Liao S, Xiong Y, Li Y, Xiao S, Zhang X, Liu J (2018) Dual Specificity Phosphatase 6 Protects Neural Stem Cells from beta-Amyloid-Induced Cytotoxicity through ERK1/2 Inactivation. Biomolecules 8(4): 181. https://doi: 10.3390/biom8040181.\u003c/li\u003e\n\u003cli\u003eRahimi DR, Seyedoshohadaei SA, Ramezani R, Rezaei N (2024) Stem cell therapies for neurological disorders: current progress, challenges, and future perspectives. Eur J Med Res 29(1):386. https://doi: 10.1186/s40001-024-01987-1.\u003c/li\u003e\n\u003cli\u003eBoese AC, Le QE, Pham D, Hamblin MH, Lee JP (2018) Neural stem cell therapy for subacute and chronic ischemic stroke. Stem Cell Res Ther 9(1):154. https://doi: 10.1186/s13287-018-0913-2.\u003c/li\u003e\n\u003cli\u003eEckert A, Huang L, Gonzalez R, Kim HS, Hamblin MH, Lee JP (2015) Bystander Effect Fuels Human Induced Pluripotent Stem Cell-Derived Neural Stem Cells to Quickly Attenuate Early Stage Neurological Deficits After Stroke. Stem Cells Transl Med 4(7):841-851. https://doi: 10.5966/sctm.2014-0184.\u003c/li\u003e\n\u003cli\u003eGincberg G, Arien-Zakay H, Lazarovici P, Lelkes PI (2012) Neural stem cells: therapeutic potential for neurodegenerative diseases. Br Med Bull 104:7-19. https://doi: 10.1093/bmb/lds024.\u003c/li\u003e\n\u003cli\u003eDe Gioia R, Biella F, Citterio G, Rizzo F, Abati E, Nizzardo M, Bresolin N, Comi GP, Corti S (2020) Neural Stem Cell Transplantation for Neurodegenerative Diseases. Int J Mol Sci 21(9):3103. https://doi: 10.3390/ijms21093103.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"SPTLC2, MEK/ERK pathway, neural stem cell, activity, proliferation ","lastPublishedDoi":"10.21203/rs.3.rs-7137060/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7137060/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe utilization of neural stem cells (NSCs) for facilitating neurogenesis and enhance impaired neural functions has drawn people's attention. Serine palmitoyltransferase long chain base subunit 2 (SPTLC2) can induce the apoptosis of neurons, and the mitogen-activated protein kinase (MEK)/extracellular signal-regulated kinase (ERK) pathway is capable of promoting the differentiation and proliferation of NSCs. Nevertheless, the effect and mechanism of SPTLC2 and the MEK/ERK pathway on the activity and proliferation of NSCs remain unclear.\u003cstrong\u003e \u003c/strong\u003eIn the current study, the expression of SPTLC2 was modulated through plasmid transfection and verified by PCR and western blot. Once the expression of SPTLC2 was changed, the impact on the activity and proliferation of NSCs was observed via cell counting kit (CCK) and 5-ethynyl-2'-deoxyuridine (EdU) staining. To confirm the relationship between SPTLC2 and the MEK/ERK pathway, western blot was employed to observe the correlation of expression changes. To observe whether SPTLC2 worked through MEK/ERK, the activation state of the MEK/ERK pathway was interfered with by Erucin and U0126 reagents. EdU staining and western blot were utilized to verify whether SPTLC2 affected the activity and proliferation of NSCs through MEK/ERK pathway.\u003cstrong\u003e \u003c/strong\u003eIt was noted that the expression of SPTLC2 could be altered by plasmid transfection at both mRNA and protein levels. Through modifying the expression of SPTLC2, the activity and proliferation of NSCs could be influenced. Meanwhile, we observed that the expression changes of significant proteins in the MEK/ERK pathway were negatively correlated with SPTLC2. Thus, Our results showed that overexpression of SPTLC2 might inhibit the activity and proliferation of NSCs, and conversely, promote the process. The effect of SPTLC2 on NSCs was achieved through the MEK/ERK pathway.\u003c/p\u003e","manuscriptTitle":"SPTLC2 Negatively Regulates Neural Stem Cell Activity and Proliferation via Inhibition of the MEK/ERK Signaling: Insights into the Molecular Mechanisms Underlying Neural Stem Cell Behavior","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-28 11:48:25","doi":"10.21203/rs.3.rs-7137060/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"878fed09-9ba5-4bb1-bc0c-573371ab97f0","owner":[],"postedDate":"July 28th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-09-19T14:08:37+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-28 11:48:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7137060","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7137060","identity":"rs-7137060","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.