Sulodexide protects against sepsis-induced liver injury in neonatal rat by attenuating oxidative stress, apoptosis, and NF-κB/MAPK signaling

Sulodexide protects against sepsis-induced liver injury in neonatal rat by attenuating oxidative stress, apoptosis, and NF-κB/MAPK signaling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Sulodexide protects against sepsis-induced liver injury in neonatal rat by attenuating oxidative stress, apoptosis, and NF-κB/MAPK signaling Wei Lu, Kang Fu, Xinming Zhang, Pedro Antonio Valdes-Sosa, Jun Wang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9345018/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 15 You are reading this latest preprint version Abstract Neonatal sepsis frequently causes liver dysfunction driven by oxidative/nitrosative stress, inflammation, and hepatocyte death. This study evaluated the hepatoprotective effects of Sulodexide (SDX) in an LPS-induced neonatal sepsis rat model and explored underlying pathways. Methods: Neonatal Wistar rats received LPS (5 mg/kg, i.p.) and were assigned to CT, LPS, LPS+SDX (40 LSU/kg), SDX, or LPS+Dexamethasone (DEX, 0.5 mg/kg). Liver injury was assessed by serum ALT/AST and H&E staining. Hepatic edema (wet-to-dry ratio), antioxidant capacity (FRAP, ABTS; MDA; SOD), NO metabolites (NO 2 − , NO 3 − , NO 2 − /NO 3 − ), inflammation (qPCR/Western blot for TNF-α, IL-1β, IFN-γ), apoptosis (Bax/Caspase3, TUNEL), MAPK and NF-κB signaling were evaluated. Transcriptomics with KEGG enrichment was performed. Result: LPS markedly increased ALT/AST, worsened histopathology and edema, reduced FRAP/ABTS and Sod, disrupted NO metabolites, elevated inflammatory cytokines, and increased apoptosis. Under LPS conditions, SDX significantly lowered both AST and ALT, improved histology and W/D ratio, restored antioxidant capacity, suppressed inflammatory mediators, and reduced apoptosis; SDX alone did not raise ALT/AST versus CT. SDX also reduced ERK/JNK and NF-κB phosphorylation. Conclusion：SDX protects against neonatal LPS-induced liver injury by preserving redox homeostasis, limiting inflammation and apoptosis, and suppressing ERK/JNK signaling, supporting SDX as a potential therapy for neonatal sepsis–associated hepatic injury. Sepsis Sulodexide Inflammation MAPK NF-κB Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Neonatal sepsis is the cause of substantial morbidity and mortality and remains one of the most frequent and life-threatening conditions in the neonatal intensive care unit (NICU)[ 1 , 2 ]. Because immune defenses and organ reserve are still developing, neonates are particularly vulnerable to rapid clinical deterioration once systemic infection occurs[ 3 ]. Dysregulated host responses can quickly evolve into circulatory instability, microcirculatory failure, and multi-organ dysfunction[ 4 , 5 ]. Compared with older children and adults, neonates often manifest earlier derailment of endothelial homeostasis, coagulation–inflammation crosstalk, and metabolic imbalance, narrowing the therapeutic window and contributing to poor outcomes[ 6 ]. Among sepsis-associated organ injuries, the liver is both a target and an amplifier of systemic inflammation[ 7 ]. Clinically, neonatal sepsis is frequently accompanied by elevations in transaminases, coagulation abnormalities, and most characteristically cholestatic features marked by increased conjugated bilirubin[ 8 ]. Hepatic dysfunction complicates nutritional tolerance and pharmacokinetics, disrupts bile acid homeostasis, and increases bleeding risk, thereby reinforcing a vicious cycle of inflammation and organ injury[ 9 , 10 ]. Despite advances in antimicrobial therapy and organ support, there is still no specific pharmacologic strategy that directly targets the core pathological processes driving neonatal sepsis–associated liver injury (NSALI)[ 11 ]. Mechanistically, sepsis-associated liver injury is increasingly understood as a multi-axis process driven by oxidative/nitrosative stress, inflammatory cytokine signaling, and hepatocyte death[ 12 , 13 ]. Excessive reactive oxygen species (ROS) and reactive nitrogen species (RNS) generation disrupts redox homeostasis, damages cellular membranes and mitochondria, and sensitizes hepatocytes to apoptosis[ 14 , 15 ]. In parallel, cytokines such as TNF-α and IL-1β orchestrate inflammatory programs that further amplify oxidative stress and impair hepatocellular integrity[ 16 , 17 ]. Nitric oxide metabolism can also become dysregulated during endotoxemia, contributing to nitrosative burden and functional derangement[ 18 , 19 ]. These pathological inputs converge on stress-responsive signaling nodes, among which mitogen-activated protein kinases (MAPKs)—including ERK and JNK—play central roles in integrating inflammatory cues and cellular stress, shaping cytokine production and apoptosis execution[ 20 , 21 ]. Thus, interventions that preserve antioxidant capacity, mitigate inflammatory activation, and restrain stress-kinase signaling may offer a coherent strategy for limiting hepatic damage during neonatal sepsis. Sulodexide (SDX) is a glycosaminoglycan-based compound that has been used clinically in vascular disorders and has been reported to exert endothelial-protective, anti-inflammatory, and antithrombotic effects[ 22 – 24 ]. Distinct from approaches that primarily suppress inflammation broadly, SDX is proposed to stabilize the vascular microenvironment under inflammatory stress and may thereby attenuate downstream organ injury[ 25 , 26 ]. Experimental evidence in sepsis settings suggests that SDX can ameliorate vascular permeability and inflammatory signaling, supporting its potential as an organ-protective agent in systemic inflammation[ 27 , 28 ]. However, whether SDX can protect the neonatal liver during sepsis, and how such protection relates to redox balance, inflammatory mediators, apoptosis, and stress-kinase signaling, remains insufficiently defined. In this study, we investigated the hepatoprotective effect of SDX in an LPS-induced neonatal sepsis model in Wistar rats. We established a structured phenotype-to-mechanism evidence chain aligned with clinically relevant hepatic injury readouts. First, we assessed liver injury using serum transaminases (ALT/AST) and histopathology (HE). Second, we evaluated hepatic edema (wet-to-dry ratio) and redox/nitrosative status, including total antioxidant capacity (FRAP and ABTS), Sod expression, and NO metabolite profiles (NO₂⁻, NO₃⁻, and NO₂⁻/NO₃⁻ ratio). Third, we quantified inflammatory mediators at the transcriptional and protein levels and assessed hepatocyte apoptosis using molecular markers and TUNEL staining. We also performed transcriptomic analysis and pathway enrichment analysis. Finally, we assessed MAPK activity by measuring the phosphorylation levels of ERK and JNK, as well as the inflammation-related NF-κB pathway. Dexamethasone was used as a pharmacological control to evaluate anti-inflammatory efficacy. We hypothesize that SDX alleviates LPS-induced liver injury in newborn rats by maintaining redox homeostasis, suppressing inflammatory responses, reducing apoptosis, and inhibiting the ERK/JNK and NF-κB signaling pathways involved in stress responses. 2. Materials and Methods 2.1. Drugs and chemicals SDX was obtained from(Alfasigma S.p.A., Alanno, Italy)and administered at a dose of 40 LSU/kg. LPS from Escherichia coli O111:B4 (Cat. No. L2630; Sigma-Aldrich, St. Louis, MO, USA) was used to induce neonatal endotoxemia. DEX (Jinfukang Biopharmaceutical Technology Co., Ltd., Shanxi, China) was used as a positive comparator and administered at 0.5 mg/kg. Unless otherwise specified, all other chemicals and reagents were of the highest commercially available analytical grade and were purchased from standard suppliers. 2.2. LPS-induced neonatal sepsis model Neonatal sepsis-like systemic inflammation was induced by LPS as a widely used endotoxemia model in neonatal rodents. Briefly, Wistar neonatal rat pups (postnatal day P3) were weighed immediately before the procedure and randomly allocated to the indicated groups. LPS (Escherichia coli O111:B4; Sigma-Aldrich, Cat. No. L2630) was freshly prepared in sterile 0.9% saline and administered by intraperitoneal (i.p.) injection at 5 mg/kg using a 30–31 G insulin syringe. The injection volume was standardized to 10 µL/g body weight to ensure consistent dosing. Control animals received an equal volume of sterile saline via the same route. After injection, pups were promptly returned to their dams and monitored at predefined intervals (every 2–4 h) for general condition (activity, posture, nursing behavior, and responsiveness). To minimize variability in sepsis severity, LPS was prepared freshly each time from the same batch, injections were performed by the same operator, and procedures were conducted at a consistent time of day. Animals meeting endpoints were euthanized immediately. Unless otherwise stated, animals were euthanized 24 h after LPS administration, and blood and liver tissues were collected for downstream biochemical assays, histopathology, oxidative/nitrosative stress assessment, gene expression analyses, and protein signaling studies. All experimental procedures were approved by the Institutional Animal Care and Use Committee at Hubei University of Technology (Animal Protocol Approval No: HBUT20260015). 2.3. Animals and experimental design Neonatal Wistar rats (postnatal day P3, both sexes) were obtained from the animal facility of Huuazhong University of technology and housed with dams under SPF conditions (12 h light/dark cycle, 25 ± 2°C, 45 ± 5% humidity) with ad libitum access to food and water for dams. Animals were randomly allocated into five groups (n = 10 animals/group for biochemical and molecular analyses; n = 3 animals/group for transcriptomics): Group I (CT): vehicle (0.9% saline, i.p.) Group II (LPS): LPS (1mg/kg, i.p.) Group III (LPS + SDX): SDX (40LSU, i.p.) administered 2 h after LPS challenge Group IV (SDX): SDX alone (40LSU, i.p.) Group V (LPS + DEX): DEX (0.5mg/kg, i.p.) administered 2h after LPS challenge, Animals were euthanized 24 h after LPS injection for serum and liver collection. 2.4. Blood and tissue sampling At 24 h post-LPS, animals were deeply anesthetized and euthanized by i.p. overdose of sodium pentobarbital. Whole blood was collected by cardiac puncture, allowed to clot for 30 min at room temperature, and centrifuged at 4,000 × g for 15 min at 4°C to obtain serum for biochemical assays. Serum samples were aliquoted and stored at -80°C until analysis. Livers were rapidly excised, rinsed in ice-cold PBS, blotted dry, and divided into three portions: (1) snap-frozen in liquid nitrogen and stored at − 80°C for Western blot; (2) stored at − 80°C for biochemical assays; (3) fixed in 10% neutral buffered formalin for histology and TUNEL staining. For biochemical assays, hepatic tissue was homogenized in 10 mM potassium phosphate buffer (pH 7.4) at a 1:5 (w/v) tissue-to-buffer ratio. Homogenates were centrifuged at 12,000 × g for 15 min at 4°C, and supernatants were collected for downstream measurements. 2.5. Biochemical determination 2.5.1. Determination of liver function tests ALT and AST were measured using assay kits from Solare Technology Co., Ltd. (Beijing, China): ALT kit (Cat. No. BC1555), AST kit (Cat. No. BC1565). Assays were performed according to the manufacturer’s instructions. 2.5.2. Quantification of total antioxidant capacity FRAP method, This method relies on the ability of antioxidants to reduce the orange (Fe³⁺-TPTZ) complex to a deep blue (Fe²⁺-TPTZ) complex under acidic conditions. Using a UV spectrophotometer (Agilent, Santa Clara, CA, USA) at 593 nm, the absorbance can indicate the total antioxidant capacity in the sample. ABTS method, which is based on the oxidation of 2,2′-Azinobis-(3-ethylbenzthiazoline-6-sulphonate) (ABTS) diamine salts by potassium persulfate to produce green ABTS free radicals (ABTS•), which are eliminated in the presence of hydrogen-supplying antioxidants. The standard curve was drawn based on the absorbance of the standard solution detected at 734 nm. The sample’s absorbance was measured and inputted into the standard curve to calculate the mixture’s antioxidant capacity. Results were normalized to total protein concentration (BCA assay) and expressed as µmol/g protein. 2.5.3. MDA detection The determination of malondialdehyde (MDA) is performed using the thiobarbituric acid (TBA) method. In brief, under acidic conditions and at high temperatures, MDA in the sample reacts with TBA to form the MDA-(TBA)₂ adduct, which exhibits maximum absorbance at 532 nm. Add 60 µL of tissue extract sample or standard solution to 60 µL of 15% trichloroacetic acid. Mix thoroughly and incubate on ice for 10 minutes. Centrifuge at 10,000 rpm for 5 minutes. Discard the supernatant and add 15 µL of 0.1 M TBA solution. Mix thoroughly and heat at 100°C for 50 minutes. After heating, cool on ice, then proceed with detection. Detection was performed using a C18 column (250 mm × 4.6 mm, 5 µm). The mobile phase consisted of methanol/phosphate buffer (40/60 by volume) at 25 mM and pH 6.5. Perform HPLC separation at 32°C with a constant flow rate of 1 mL/min, and monitor the eluent at a wavelength of 532 nm. 2.5.4. Determination of nitric oxide metabolites Nitrite (NO₂ ⁻ ) and nitrate (NO₃ ⁻ ) in liver tissue were measured using a nitric oxide analyzer (NOA 280i, GE, USA). Samples underwent protein removal treatment with sodium hydroxide and zinc sulfate prior to analysis. 2.6 Quantitative PCR (qPCR) analysis Using 1 mL of TRIzol reagent, homogenize 100 mg of liver tissue with a homogenizer. Determine total RNA concentration at the A260 wavelength and assess RNA purity using the A260/A280 ratio. Convert equal amounts of total RNA from each sample into cDNA using a cDNA synthesis kit (Abclonal, #RK20433, Wuhan, China). Real-time PCR was performed using single-stranded cDNA as a template. The 2X Universal SYBR Green real-time fluorescent quantitative PCR master mix (#RK21203) from Abclonal was employed. PCR reactions were performed on a real-time PCR detection system (#VQ-100B Yuanzan Life Sciences Co., Ltd., Shanghai, China). Gene expression levels were determined using the comparative CT (threshold cycle) method after normalization with the internal control gene GAPDH. The target genes and sequences were as follows (SOD: F-GCGGATGAAGAGAGGCATGTT, R-TTCCACCTTTGCCCAAGTCAT. Caspase3: F-GAGGCCGACTTCTTGTATGC, R-CGGTTAACCCGGGTAAGAAT. BAX: F-CGTGGTTGCCCTCTTCTACTTT, R-TGATCAGCTCGGGCACTTTA. TNF-α: F-GTCCCAACAAGGAGGAGAAGTT, R- TTTGCTACGACGTGGGCTAC. IL-1β: F- CAGCTTTCGACAGTGAGGAGA, R-TGTCGAGATGCTGCTGTGAG) 2.7. Western blotting analysis Equal amounts of protein (30 µg) were separated on 10–12% SDS–PAGE gels and transferred to PVDF membranes (Millipore, 0.45 µm; Cat. No. IPVH00010). Membranes were blocked in 5% non-fat milk (for total proteins) or 5% BSA (for phospho-proteins) in TBS-T and incubated overnight at 4°C with primary antibodies. Primary antibodies including Phospho-ERK1/2 (Immunoway #YM8452, 1:1000), total ERK1/2 (Immunoway #YM8336, 1:1000), phospho-JNK (Proteintech #60666-1-Ig, 1:1000), total JNK (Proteintech #24164-1-AP, 1:1000), NF-κB (Immunoway #YM8209, 1:2500), phospho-NF-κB (Immunoway #YM8422, 1:5000), TNF-α, (HUABIO #ER65189, 1:1000), IL-1β (ABclonal #A27676, 1:1000), IFN-γ (ABclonal #A12450, 1:1000), caspase-3 (Zenbio #341034, 1:1000), α-Tubulin (CST #2144, 1:5000). After washing, membranes were incubated with HRP-conjugated secondary antibodies (CST #7074 anti-rabbit; CST #7076 anti-mouse; 1:5000) for 1 h at room temperature. Bands were visualized using ECL substrate (Thermo Fisher Scientific, Cat. No. 32106) and quantified using ImageJ. Cytokines/caspase-3 were normalized to β-tubulin. 2.8. Histopathology and TUNEL staining 2.8.1. Hematoxylin and eosin (HE) staining Formalin-fixed livers were paraffin-embedded, sectioned at 4 µm, and stained with hematoxylin and eosin using standard procedures. Slides were imaged using an Olympus light microscope equipped with a digital camera. Histological assessment focused on hepatic architecture and inflammatory cell infiltration. 2.8.2. TUNEL assay Apoptosis in liver sections was evaluated using One Step TUNEL Apoptosis Assay Kit (Abbkine #KTA2010, Green Fluorescence) according to the manufacturer’s protocol. Nuclei were counterstained with DAPI, and images were acquired under identical exposure settings across groups. 2.9 RNA Library Construction and Sequencing For RNA sequencing (RNA-seq), total RNA samples with a quantity ≥ 1 µg were selected. mRNA was enriched using oligo(dT) magnetic beads and fragmented into smaller pieces by divalent cations under elevated temperature. The NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs Inc., Ipswich, MA, USA) was used to construct strand-specific libraries, following the manufacturer's protocol. Fragmented mRNA was used as a template for first-strand cDNA synthesis with random hexamer primers, followed by second-strand synthesis. The double-stranded cDNA was purified, end-repaired, and an "A" base was added to the 3 ’ ends for adapter ligation. Multiplexed DNA libraries were then normalized and pooled in equal volumes. After quantification and quality control, the libraries were sequenced on an Illumina platform using the paired-end 150 bp (PE150) mode. 2.10. Statistical analysis Data are presented as Mean ± SD. Statistical comparisons among multiple groups were performed using one-way ANOVA followed by Tukey’s multiple-comparisons test. A two-tailed P < 0.05 was considered statistically significant. Statistical analyses and graphing were performed using GraphPad Prism, Version 10.00 for Windows. 3. Results 3.1 SDX ameliorates sepsis-associated liver dysfunction and histopathological injury To test our hypothesis that SDX protects against neonatal sepsis–associated liver injury, we first evaluated liver function and histopathological damage (Figs. 1 A- 1 B). Compared with the control (CT) group, LPS challenge markedly increased serum AST and ALT levels (p < 0.0001), indicating substantial hepatocellular injury. In the presence of LPS, SDX significantly reduced both AST and ALT levels compared with LPS alone, with a more pronounced effect observed for ALT (p < 0.001). Importantly, SDX administered alone did not increase AST or ALT relative to the control group, indicating no detectable hepatotoxicity under basal conditions. Dexamethasone (DEX), used as a positive comparator, significantly reduced AST in LPS-challenged rat (p < 0.001) and also lowered ALT. Notably, SDX produced a greater reduction in ALT than DEX under LPS conditions (p < 0. 05). Consistent with the biochemical evidence of liver injury, H&E staining revealed preserved hepatic architecture in the CT and SDX-alone groups, with hepatocytes showing largely normal morphology (Figs. 1 C). LPS challenge induced prominent inflammatory cell infiltration and disrupted lobular organization, as highlighted in the magnified views. Notably, SDX treatment in LPS-challenged rat markedly attenuated these histopathological abnormalities, showing reduced inflammatory infiltration and improved tissue architecture compared with the LPS group. 3.2 SDX reduces hepatic edema and preserves redox homeostasis Given the proposed contribution of oxidative stress to sepsis-associated organ injury, we next assessed hepatic antioxidant capacity and tissue edema (Figs. 2A-2E). LPS challenge markedly reduced total antioxidant capacity, as indicated by significantly lower FRAP and ABTS values compared with the CT group (p < 0.0001). Treatment with SDX significantly restored both FRAP and ABTS relative to LPS alone (p < 0.001), whereas SDX administered alone showed no difference compared with the CT group. Consistently, LPS significantly reduced hepatic SOD mRNA expression (p < 0.001), whereas SDX co-treatment partially restored SOD levels compared with LPS alone (p < 0.01), supporting an improvement in antioxidant defenses at the transcriptional level (Fig. 2C). In addition, compared with the LPS group, SDX treatment significantly reduced MDA levels, with no difference observed compared to the CT group (Fig. 2D).In parallel, LPS significantly increased the liver wet-to-dry (W/D) ratio (p < 0.01), indicating hepatic edema (Fig. 2E). This increase was significantly attenuated by SDX under LPS conditions (p < 0.001), with DEX showing a similar edema-reducing effect and bringing W/D back toward baseline (p < 0.001). To further evaluate nitrosative stress, we quantified NO metabolites (Figs. 2E-2G). LPS exposure decreased nitrite (NO₂⁻) (p < 0.001) and markedly increased nitrate (NO₃⁻) (p < 0.0001), resulting in a pronounced reduction in the NO₂⁻/NO₃⁻ ratio (p < 0.0001). SDX co-treatment significantly reduced nitrate accumulation compared with LPS alone (p < 0.01); however, the NO₂⁻/NO₃⁻ ratio was not fully normalized under LPS conditions. Notably, SDX administered alone did not increase nitrate and was associated with a higher NO₂⁻/NO₃⁻ ratio relative to LPS, supporting that SDX does not exacerbate basal nitrosative imbalance. Figure. SDX alleviates hepatic edema and maintains redox balance. (A) FRAP; (B) ABTS; (C) SOD gene expression levels; (D) MDA levwls; (E) wet-to-dry weight ratio of liver; (F) nitrite ; (G) nitrate ; (H) nitrite/nitrate, Data represent mean ± standard deviation, significance levels were denoted as *p < 0.05, **p < 0.01, a Significance levels were denoted as *p < 0.05, **p < 0.01, and ***p < 0.001, suggesting noteworthy distinctions relative toward the group under control. 3.3 SDX suppresses LPS-induced hepatic inflammation at both transcript and protein levels To determine whether SDX mitigates the inflammatory response elicited by LPS, we quantified key pro-inflammatory mediators in liver tissue (Figs. 3 A- 3 B). At the transcriptional level, LPS challenge markedly increased TNF-α (p < 0.0001) and IL-1β (p < 0. 01) mRNA expression compared with the CT group, whereas SDX co-treatment significantly reduced both transcripts relative to LPS alone (p < 0.05, p < 0.01). Importantly, SDX administered alone showed no significant difference from CT, indicating that SDX does not trigger a basal inflammatory response under non-septic conditions. Consistent with the qPCR findings (Figs. 3 C- 3 F), Western blot analysis demonstrated that LPS substantially increased hepatic protein levels of IL-1β, TNF-α, and IFN-γ (p < 0.05). These elevations were attenuated by SDX in LPS-challenged rat, supporting an anti-inflammatory effect of SDX at the protein level. DEX, used as a positive comparator, also reduced inflammatory cytokine expression under LPS conditions. Collectively, these data indicate that SDX effectively blunts LPS-induced hepatic inflammation in neonatal sepsis. 3.4 SDX attenuates hepatocyte apoptosis in septic liver injury Given the tight coupling between inflammatory signaling and hepatocyte death during sepsis, we next examined apoptosis-related endpoints (Figs. 4 A- 4 F). To determine whether SDX alleviates sepsis-associated hepatocyte death, We evaluated apoptosis-related markers at the transcriptional, protein, and tissue levels. Compared with the control group, LPS stimulation significantly increased the mRNA and protein expression of Bax (p < 0.01) and Caspase-3 (p < 0.05) in the liver, indicating that the pro-apoptotic program had been activated. Compared with LPS alone, combination therapy with SDX significantly reduced the transcriptional and protein levels of Bax (p < 0.05) and Caspase-3 (p < 0.05), bringing them closer to baseline levels; in contrast, SDX alone showed no significant difference compared with the control group, indicating that SDX does not have an apoptotic effect under baseline conditions. Finally, TUNEL staining provided in situ confirmation: LPS markedly increased TUNEL-positive signals in liver sections, while SDX co-treatment substantially reduced TUNEL positivity, supporting that SDX mitigates hepatocyte apoptosis during neonatal sepsis (Fig. 4 G). 3.5 SDX reduces the phosphorylation levels of ERK/JNK and NF-κB Given that apoptosis and inflammation are tightly linked to upstream stress-response signaling, we next examined MAPK pathway activity (Fig. 5 ). To identify upstream pathways that may account for the protective effects of SDX, we first performed transcriptomic profiling and pathway enrichment analyses (Figs. 5 A- 5 C). Differential expression analysis revealed substantial transcriptional reprogramming in the liver following LPS challenge (CT vs LPS), whereas SDX treatment under LPS conditions (LPS vs LPS + SDX) was associated with a smaller set of differentially expressed genes, with an overlap of shared genes between comparisons (Figs. 5 A- 5 B). KEGG enrichment analysis further highlighted inflammatory signaling pathways, including NF-κB signaling, and also implicated MAPK-related pathways, suggesting that these programs may contribute to sepsis-associated liver injury and the SDX response (Figs. 5 C). Next, we examined the activity of the MAPK and NF-κB pathways at the protein level (Fig. 5 D– 5 G). Western blotting results showed that LPS stimulation increased the phosphorylation levels of ERK1/2 (p < 0.05), JNK1/2 (p < 0.001), and NF-κB (p < 0.01), indicating that MAPK and NF-κB are activated in sepsis-induced liver injury. Notably, compared with LPS alone, the combination with SDX significantly reduced the phosphorylation levels of ERK1/2 (p < 0.05), JNK1/2 (p < 0.001), and NF-κB (p < 0.01); whereas, compared with the control group (CT), SDX alone did not increase the phosphorylation levels of MAPK and NF-κB. In summary, SDX treatment significantly suppressed the increase in the ratio of phosphorylated NF-κB to total NF-κB. These data support the notion that SDX exerts a hepatoprotective effect by inhibiting MAPK/NF-κB signaling in the livers of newborn rats following LPS stimulation. 4. Discussion Neonatal sepsis remains a major driver of morbidity and mortality, and liver dysfunction is a common and clinically meaningful component of sepsis-associated organ injury[ 29 ]. In this study, we show that SDX mitigates LPS-induced liver injury in neonatal rat, supported by convergent biochemical, histological, and molecular evidence. SDX reduced serum AST/ALT and improved H&E-assessed tissue architecture, attenuated hepatic edema, preserved antioxidant capacity (FRAP/ABTS) ,reduced MDA and with recovery of Sod expression, suppressed inflammatory mediators (TNF-α, IL-1β, IFN-γ) at both transcript and protein levels, and reduced apoptosis (Bax/Caspase3 mRNA and protein expression, and TUNEL positivity). Importantly, SDX alone did not increase AST/ALT, did not impair antioxidant indices, and did not elevate apoptosis-associated readouts, suggesting an overall favorable baseline safety signal under non-septic conditions in this model. Although SDX has not been widely studied in neonatal sepsis–associated liver injury, its protective actions in sepsis and microvascular barrier dysfunction have precedent[ 23 , 30 ]. In septic mouse models (LPS and CLP), SDX has been reported to improve vascular permeability via endothelial glycocalyx remodeling and to reduce syndecan-1 shedding, accompanied by improved organ injury phenotypes and survival signals[ 31 , 32 ]. These prior findings are conceptually consistent with our observation that SDX reduced hepatic edema (W/D ratio) and mitigated parenchymal injury, because glycocalyx integrity is increasingly viewed as a key determinant of microvascular leakage, interstitial edema, and downstream tissue hypoxia/inflammation during sepsis[ 33 – 35 ]. While we did not directly measure glycocalyx biomarkers (e.g., syndecan-1, heparan sulfate), our data extend the emerging SDX narrative by demonstrating protection in the neonatal liver, a tissue that is highly sensitive to inflammatory and oxidative stress perturbations during early life. A notable strength of our dataset is the coherent redox–inflammation–apoptosis axis, which is especially relevant in neonates. Neonatal sepsis is characterized by a combination of inflammatory activation and oxidative stress, and neonates are thought to be more vulnerable because innate immune responses and antioxidant defenses are developmentally immature[ 36 , 37 ]. In line with this framework, LPS caused a pronounced drop in total antioxidant capacity (FRAP/ABTS) together with reduced Sod expression in our neonatal livers, whereas SDX restored antioxidant capacity and partially recovered Sod. These findings align with the broader sepsis literature emphasizing ROS-driven amplification loops that worsen organ dysfunction, while also highlighting that restoring antioxidant defenses may be particularly impactful in early-life sepsis contexts[ 38 – 40 ]. We also observed a marked shift in NO metabolites, decreased NO₂⁻, increased NO₃⁻, and reduced NO₂⁻/NO₃⁻ ratio, after LPS, consistent with an environment favoring NO oxidation and nitrosative stress. In experimental endotoxemia, oxidative stress has been mechanistically linked to caspase activation and hepatocellular injury, supporting the plausibility of redox/nitrosative mechanisms upstream of apoptosis in the liver. SDX reduced nitrate accumulation under LPS conditions but did not fully normalize the NO₂⁻/NO₃⁻ ratio, which may reflect incomplete pathway correction within the sampled time window or multiple upstream sources of RNS that are not fully addressed by SDX alone. Future time-course analyses, coupled with iNOS/NOX-related readouts and peroxynitrite-associated markers, could clarify whether SDX primarily limits excessive NO oxidation or more broadly rebalances NO generation and consumption[ 41 , 42 ]. Our data show that SDX suppresses LPS-induced inflammatory mediators at both transcript and protein levels, and concurrently attenuates hepatocyte apoptosis across mRNA, protein, and in situ assays. Mechanistically, we provide protein-level evidence that SDX reduces ERK/JNK phosphorylation, suggesting that dampening stress-responsive MAPK signaling may represent a proximal node connecting reduced cytokine output with reduced apoptosis execution. In parallel, transcriptomic profiling and KEGG enrichment analyses implicated inflammatory signaling programs, including NF-κB-related pathways, as part of the LPS injury response and/or SDX-responsive network. Our results indicate that SDX significantly inhibits LPS-activated NF-κB. This is consistent with the literature on sepsis-induced liver injury datasets and mechanisms, which emphasize that inflammatory signaling and stress kinase pathways are central to the sepsis-induced liver injury process[ 43 , 44 ]. DEX served as a positive comparator and improved several injury indices under LPS conditions in our model. Notably, SDX produced a more pronounced reduction in ALT than DEX in our dataset, suggesting that SDX may confer hepatoprotection not fully captured by broad glucocorticoid-mediated immunosuppression. This is clinically relevant because systemic corticosteroid exposure in neonates—especially in preterm populations—has long-standing concerns regarding short-term adverse effects like hyperglycemia, hypertension, infection risk signals and potential neurodevelopmental impacts with certain regimens[ 45 ]. In this context, an agent that stabilizes vascular/barrier biology and dampens stress–inflammation signaling without the same endocrine trade-offs could offer a wider therapeutic window for neonatal sepsis–associated organ protection. SDX has antithrombotic properties and neonatal hemostasis differs from adults; therefore, future translational work should explicitly evaluate coagulation-related safety and bleeding risk alongside efficacy. This study has limitations. First, we used an LPS-based model, which captures key features of endotoxemia but does not fully recapitulate polymicrobial neonatal sepsis. Second, we did not define the primary hepatic cellular targets of SDX (hepatocytes vs endothelial/non-parenchymal compartments), nor did we measure glycocalyx integrity, which is mechanistically attractive given prior SDX–glycocalyx literature. Future studies should (i) validate NF-κB activation status (p-p65, nuclear translocation, IκBα dynamics), (ii) test ERK/JNK dependence using pharmacologic or genetic approaches, (iii) extend to polymicrobial neonatal sepsis models, and (iv) incorporate endothelial/glycocalyx markers and microcirculatory readouts to establish whether barrier stabilization is a key upstream driver of hepatic protection. 5. Conclusion SDX protects against neonatal LPS-induced liver injury by improving liver function and histopathology, preserving antioxidant capacity, partially correcting NO metabolite imbalance, suppressing inflammatory cytokine production, and reducing hepatocyte apoptosis. These effects are accompanied by reduced ERK/JNK phosphorylation and transcriptomic implication of NF-κB related inflammatory programs. Placed in the context of prior SDX literature on glycocalyx/barrier protection in sepsis, our findings support SDX as a promising candidate for mitigating neonatal sepsis–associated hepatic injury, warranting further mechanistic validation and neonatal-focused safety evaluation. Declarations Declaration of competing interest The authors declare that there are no conflicts of interest. Funding We would like to thank the Hubei Provincial Department of Science and Technology for its funding, Grant No. 1143/23990102, 4115/00257. CRediT authorship contribution statement Wei Lu : Writing–review & editing, Formal analysis. Kang Fu : Writing–original draft, Methodology, Investigation. Xinming Zhang : Methodology, Data curation. Pedro Antonio Valdes-Sosa : Visualization, Jun Wang : Funding acquisition, Conceptualization. Fuzhong Xing : Supervision, Resources, Project administration. Data Availability Data will be made available on request. References Shane AL, Sánchez PJ, Stoll BJ (2017) Neonatal sepsis. Lancet 390:1770–1780. https://doi.org/10.1016/S0140-6736(17)31002-4 Celik IH, Hanna M, Canpolat FE, Mohan P (2022) Diagnosis of neonatal sepsis: the past, present and future. Pediatr Res 91:337–350. https://doi.org/10.1038/s41390-021-01696-z Kang CR, Byeon JH, Cho H et al (2025) Perinatal Enterovirus Infection in Neonates: A Systematic Review. J Med Virol 97:e70362. https://doi.org/10.1002/jmv.70362 Duignan SM, Lakshminrusimha S, Armstrong K et al (2024) Neonatal sepsis and cardiovascular dysfunction I: mechanisms and pathophysiology. Pediatr Res 95:1207–1216. https://doi.org/10.1038/s41390-023-02926-2 Kharrat A, Jain A (2022) Hemodynamic dysfunction in neonatal sepsis. Pediatr Res 91:413–424. https://doi.org/10.1038/s41390-021-01855-2 Procianoy RS, Silveira RC (2020) The challenges of neonatal sepsis management. Jornal de Pediatria 96:80–86. https://doi.org/10.1016/j.jped.2019.10.004 Lam MMC, Wick RR, Watts SC et al (2021) A genomic surveillance framework and genotyping tool for Klebsiella pneumoniae and its related species complex. Nat Commun 12:4188. https://doi.org/10.1038/s41467-021-24448-3 Hadian F, Rutten C, Siddiqui I et al (2024) Neonatal Liver Imaging: Techniques, Role of Imaging, and Indications. Radiographics 44:e240034. https://doi.org/10.1148/rg.240034 Molloy EJ, Bearer CF (2022) Paediatric and neonatal sepsis and inflammation. Pediatr Res 91:267–269. https://doi.org/10.1038/s41390-021-01918-4 Balayan S, Chauhan N, Chandra R et al (2020) Recent advances in developing biosensing based platforms for neonatal sepsis. Biosens Bioelectron 169:112552. https://doi.org/10.1016/j.bios.2020.112552 Molloy EJ, Bearer CF (2022) Paediatric and neonatal sepsis and inflammation. Pediatr Res 91:267–269. https://doi.org/10.1038/s41390-021-01918-4 Savio LEB, De Andrade Mello P, Figliuolo VR et al (2017) CD39 limits P2X7 receptor inflammatory signaling and attenuates sepsis-induced liver injury. J Hepatol 67:716–726. https://doi.org/10.1016/j.jhep.2017.05.021 Wang J, Tao X, Liu Z et al (2025) Noncoding RNAs in sepsis-associated acute liver injury: Roles, mechanisms, and therapeutic applications. Pharmacol Res 212:107596. https://doi.org/10.1016/j.phrs.2025.107596 Mansoori Moghadam Z, Zhao B, Raynaud C et al (2025) Reactive oxygen species regulate early development of the intestinal macrophage-microbiome interface. Blood 145:2025–2040. https://doi.org/10.1182/blood.2024025240 Carcillo JA (1999) Nitric oxide production in neonatal and pediatric sepsis. Crit Care Med 27:1063–1065. https://doi.org/10.1097/00003246-199906000-00017 Reis Machado J, Soave DF, Da Silva MV et al (2014) Neonatal Sepsis and Inflammatory Mediators. Mediat Inflamm 2014:1–10. https://doi.org/10.1155/2014/269681 Liu H, Fan H, He P et al (2022) Prohibitin 1 regulates mtDNA release and downstream inflammatory responses. EMBO J 41:e111173. https://doi.org/10.15252/embj.2022111173 Joffre J, Hellman J, Ince C, Ait-Oufella H (2020) Endothelial Responses in Sepsis. Am J Respir Crit Care Med 202:361–370. https://doi.org/10.1164/rccm.201910-1911TR Wang R, Chen Y, Han J et al (2024) Selectively targeting the AdipoR2-CaM-CaMKII-NOS3 axis by SCM-198 as a rapid-acting therapy for advanced acute liver failure. Nat Commun 15:10690. https://doi.org/10.1038/s41467-024-55295-7 Zhou R, Yang X, Li X et al (2019) Recombinant CC16 inhibits NLRP3/caspase-1-induced pyroptosis through p38 MAPK and ERK signaling pathways in the brain of a neonatal rat model with sepsis. J Neuroinflammation 16:239. https://doi.org/10.1186/s12974-019-1651-9 Chen X-S, Wang S-H, Liu C-Y et al (2022) Losartan attenuates sepsis-induced cardiomyopathy by regulating macrophage polarization via TLR4-mediated NF-κB and MAPK signaling. Pharmacol Res 185:106473. https://doi.org/10.1016/j.phrs.2022.106473 Ying J, Zhang C, Wang Y et al (2023) Sulodexide improves vascular permeability via glycocalyx remodelling in endothelial cells during sepsis. Front Immunol 14:1172892. https://doi.org/10.3389/fimmu.2023.1172892 Carroll BJ, Piazza G, Goldhaber SZ (2019) Sulodexide in venous disease. J Thromb Haemost 17:31–38. https://doi.org/10.1111/jth.14324 Bignamini AA, Matuška J (2020) Sulodexide for the Symptoms and Signs of Chronic Venous Disease: A Systematic Review and Meta-analysis. Adv Ther 37:1013–1033. https://doi.org/10.1007/s12325-020-01232-1 Zhang Y, Xing J, Mu X et al (2015) Sulodexide therapy for the treatment of diabetic nephropathy, a meta-analysis and literature review. https://doi.org/10.2147/DDDT.S87973 . DDDT 6275 Coccheri S, Mannello F (2013) Development and use of sulodexide in vascular diseases: implications for treatment. https://doi.org/10.2147/DDDT.S6762 . DDDT 49 Song JW, Zullo J, Lipphardt M et al (2018) Endothelial glycocalyx—the battleground for complications of sepsis and kidney injury. Nephrol Dialysis Transplantation 33:203–211. https://doi.org/10.1093/ndt/gfx076 Song JW, Zullo JA, Liveris D et al (2017) Therapeutic Restoration of Endothelial Glycocalyx in Sepsis. J Pharmacol Exp Ther 361:115–121. https://doi.org/10.1124/jpet.116.239509 Dong Y, Basmaci R, Titomanlio L et al (2020) Neonatal sepsis: within and beyond China. Chin Med J 133:2219–2228. https://doi.org/10.1097/CM9.0000000000000935 Becker BF, Jacob M, Leipert S et al (2015) Degradation of the endothelial glycocalyx in clinical settings: searching for the sheddases. Brit J Clin Pharma 80:389–402. https://doi.org/10.1111/bcp.12629 Stackowicz J, Jönsson F, Reber LL (2020) Mouse Models and Tools for the in vivo Study of Neutrophils. Front Immunol 10:3130. https://doi.org/10.3389/fimmu.2019.03130 Rangarajan S, Richter JR, Richter RP et al (2020) Heparanase-enhanced Shedding of Syndecan-1 and Its Role in Driving Disease Pathogenesis and Progression. J Histochem Cytochem 68:823–840. https://doi.org/10.1369/0022155420937087 Muratore CS, Harty MW, Papa EF, Tracy TF (2009) Dexamethasone Alters the Hepatic Inflammatory Cellular Profile Without Changes in Matrix Degradation During Liver Repair Following Biliary Decompression. J Surg Res 156:231–239. https://doi.org/10.1016/j.jss.2009.04.016 Ying J, Zhang C, Wang Y et al (2023) Sulodexide improves vascular permeability via glycocalyx remodelling in endothelial cells during sepsis. Front Immunol 14:1172892. https://doi.org/10.3389/fimmu.2023.1172892 Soleimanpour H, Shahsavari Nia K, Sanaie S et al (2019) Use of Dexmedetomidine in Liver Disease: A Systematic Review and Meta-Analysis. Hepat Mon 19. https://doi.org/10.5812/hepatmon.98530 Parra-Llorca A, Pinilla-Gonzlez A, Torrejón-Rodríguez L et al (2023) Effects of Sepsis on Immune Response, Microbiome and Oxidative Metabolism in Preterm Infants. Children 10:602. https://doi.org/10.3390/children10030602 Hensler E, Petros H, Gray CC et al (2022) The Neonatal Innate Immune Response to Sepsis: Checkpoint Proteins as Novel Mediators of This Response and as Possible Therapeutic/Diagnostic Levers. Front Immunol 13:940930. https://doi.org/10.3389/fimmu.2022.940930 Dery KJ, Chiu R, Kasargod A, Kupiec-Weglinski JW (2025) Feedback Loops Shape Oxidative and Immune Interactions in Hepatic Ischemia–Reperfusion Injury. Antioxidants 14:944. https://doi.org/10.3390/antiox14080944 Schieber M, Chandel NS (2014) ROS Function in Redox Signaling and Oxidative Stress. Curr Biol 24:R453–R462. https://doi.org/10.1016/j.cub.2014.03.034 Li B, Ming H, Qin S et al (2025) Redox regulation: mechanisms, biology and therapeutic targets in diseases. Sig Transduct Target Ther 10:72. https://doi.org/10.1038/s41392-024-02095-6 Bala A (2024) Regulatory role of peroxynitrite in advanced glycation end products mediated diabetic cardiovascular complications. World J Diabetes 15:572–574. https://doi.org/10.4239/wjd.v15.i3.572 Kim ME, Lee JS (2025) Advances in the Regulation of Inflammatory Mediators in Nitric Oxide Synthase: Implications for Disease Modulation and Therapeutic Approaches. Int J Mol Sci 26:1204. https://doi.org/10.3390/ijms26031204 Xu X, Yang T, An J et al (2025) Liver injury in sepsis: manifestations, mechanisms and emerging therapeutic strategies. Front Immunol 16:1575554. https://doi.org/10.3389/fimmu.2025.1575554 Guo Y, Guo W, Chen H et al (2025) Mechanisms of sepsis-induced acute liver injury: a comprehensive review. Front Cell Infect Microbiol 15:1504223. https://doi.org/10.3389/fcimb.2025.1504223 Shastry A, Ahmad D, Richardson A et al (2025) Systemic corticosteroid use and neurodevelopmental outcomes in preterm infants: a cohort study. World J Pediatr 21:575–586. https://doi.org/10.1007/s12519-025-00932-4 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 16 Apr, 2026 Reviews received at journal 15 Apr, 2026 Reviews received at journal 15 Apr, 2026 Reviews received at journal 12 Apr, 2026 Reviewers agreed at journal 12 Apr, 2026 Reviewers agreed at journal 12 Apr, 2026 Reviewers agreed at journal 10 Apr, 2026 Reviewers agreed at journal 10 Apr, 2026 Reviewers agreed at journal 10 Apr, 2026 Reviewers agreed at journal 10 Apr, 2026 Reviewers agreed at journal 10 Apr, 2026 Reviewers invited by journal 10 Apr, 2026 Editor assigned by journal 07 Apr, 2026 Submission checks completed at journal 07 Apr, 2026 First submitted to journal 07 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9345018","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":624142810,"identity":"6a54eec7-1705-40db-98a9-52ab12572368","order_by":0,"name":"Wei Lu","email":"","orcid":"","institution":"Huazhong University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Lu","suffix":""},{"id":624142811,"identity":"f048d08c-acf5-4c68-9e18-f60a078c5156","order_by":1,"name":"Kang Fu","email":"","orcid":"","institution":"Huazhong University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Kang","middleName":"","lastName":"Fu","suffix":""},{"id":624142812,"identity":"266e0603-0610-4b1d-b7b7-57ddc6230f3d","order_by":2,"name":"Xinming Zhang","email":"","orcid":"","institution":"Hubei University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Xinming","middleName":"","lastName":"Zhang","suffix":""},{"id":624142813,"identity":"f42241d7-a652-4ff5-ae2c-bfecaa4971c7","order_by":3,"name":"Pedro Antonio Valdes-Sosa","email":"","orcid":"","institution":"University of Electronic Science and Technology of China","correspondingAuthor":false,"prefix":"","firstName":"Pedro","middleName":"Antonio","lastName":"Valdes-Sosa","suffix":""},{"id":624142814,"identity":"364c205f-14ee-450d-b497-0655ebe52234","order_by":4,"name":"Jun Wang","email":"","orcid":"","institution":"Hubei University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Wang","suffix":""},{"id":624142815,"identity":"8833def9-caa9-469d-afdf-ada115b986e1","order_by":5,"name":"Fuzhong Xing","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABB0lEQVRIie3RPUvDQBjA8SccJMvVrnc49CtcCRQ/Tm5Jl1CEQtGlRALnEnS14IdwcvWOgC5BNwm4pJtjsoVS0Ke2a8+MgveHexnux3EcgMv1FyM4LgAiXLwapyhI+5ByT4jYEar73HQgPutFxMug+DRqORueXr9fdptiRoPUa9rkOOHZSXxmlD/n9+Wi4jfFnFJN+OrxOBkSOglbReVDlcTVOP+QTyzyycBCfCTCKPZDziWSfFTbCd4S1kYJJNNn0B0SBnbCMzoB/RrJ1V1C+FX6JXMqM+tbxFsZNnqxlLdsum67bSzzoDBNayFw+A6MCvDUbuOl1vMYafZrUANsfzvscrlc/7FvoeJZdG2flZ0AAAAASUVORK5CYII=","orcid":"","institution":"Huazhong University of Science and Technology","correspondingAuthor":true,"prefix":"","firstName":"Fuzhong","middleName":"","lastName":"Xing","suffix":""}],"badges":[],"createdAt":"2026-04-07 12:24:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9345018/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9345018/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":107322148,"identity":"c7657544-968b-4389-b4fd-a08e166c2810","added_by":"auto","created_at":"2026-04-20 10:42:13","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3803038,"visible":true,"origin":"","legend":"\u003cp\u003eEffects on serum AST (A) and ALT (B) levels. Data represent mean ± standard deviation. (C) Liver tissue HE staining. Significance levels were denoted as *p \u0026lt; 0.05, **p \u0026lt; 0.01, a Significance levels were denoted as *p \u0026lt; 0.05, **p \u0026lt; 0.01, and ***p \u0026lt; 0.001, suggesting noteworthy distinctions relative toward the group under control.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-9345018/v1/79c1f8826416f524d44a5668.png"},{"id":107322132,"identity":"484407f4-9033-4fdf-ac18-19ea6ea55743","added_by":"auto","created_at":"2026-04-20 10:42:07","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":636694,"visible":true,"origin":"","legend":"\u003cp\u003eSDX alleviates hepatic edema and maintains redox balance. (A) FRAP; (B) ABTS; (C) SOD gene expression levels; (D) MDA levwls; (E) wet-to-dry weight ratio of liver; (F) nitrite ; (G) nitrate ; (H) nitrite/nitrate, Data represent mean ±standard deviation, significance levels were denoted as *p \u0026lt; 0.05, **p \u0026lt; 0.01, a Significance levels were denoted as *p \u0026lt; 0.05, **p \u0026lt; 0.01, and ***p \u0026lt; 0.001, suggesting noteworthy distinctions relative toward the group under control.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-9345018/v1/35aaaad3b99d46f4c87c798f.png"},{"id":107322178,"identity":"7ed67bb0-9b34-4215-a5f1-6db642744a2d","added_by":"auto","created_at":"2026-04-20 10:42:22","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":653824,"visible":true,"origin":"","legend":"\u003cp\u003eSDX suppresses LPS-induced inflammation. (A) TNF-α gene expression; (B) IL-1β gene expression; (C) Western blot analysis of IFN-γ, IL-1β, and TNF-α; (D) IL-1β protein expression; (E) TNF-α protein expression; (F) IFN-γ protein expression. Data represent mean ± standard deviation, significance levels were denoted as *p \u0026lt; 0.05, **p \u0026lt; 0.01, a Significance levels were denoted as *p \u0026lt; 0.05, **p \u0026lt; 0.01, and ***p \u0026lt; 0.001, suggesting noteworthy distinctions relative toward the group under control.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-9345018/v1/5e5afd37cd718fd19d3e8b2a.png"},{"id":107322164,"identity":"8ad4678d-b086-4ab9-9967-aecfb62b3632","added_by":"auto","created_at":"2026-04-20 10:42:18","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3157929,"visible":true,"origin":"","legend":"\u003cp\u003eSDX attenuates LPS-induced hepatic apoptosis in sepsis. (A) Caspase3 protein Western blot, (B) Caspase3 protein expression, (C) Caspase3 gene expression; (D) Bax protein Western blot, (E) Bax protein expression, (F) Bax gene expression (G) TUNEL staining of liver tissue sections. Data represent mean ±standard deviation. significance levels were denoted as *p \u0026lt; 0.05, **p \u0026lt; 0.01, a Significance levels were denoted as *p \u0026lt; 0.05, **p \u0026lt; 0.01, and ***p \u0026lt; 0.001, suggesting noteworthy distinctions relative toward the group under control.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-9345018/v1/aa3190fb35ff7fb7d5f3fe75.png"},{"id":107322157,"identity":"05358bf7-66d0-411c-ad52-7cc42c66ebac","added_by":"auto","created_at":"2026-04-20 10:42:15","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1428989,"visible":true,"origin":"","legend":"\u003cp\u003eEffects on ERK1/2 and JNK1/2 protein expression. (A) Effects of CT versus LPS groups and LPS versus LPS+SDX groups on gene expression. (B) Venn diagram of differentially expressed genes. (C) KEGG enrichment analysis. (D) Representative Western blot bands for ERK1/2, JNK1/2, NF-κB. Liver (phospho/total protein) (E) ERK1/2, (F) JNK1/2, (G) NF-κB. Data represent mean ±standard deviation. significance levels were denoted as *p \u0026lt; 0.05, **p \u0026lt; 0.01, a Significance levels were denoted as *p \u0026lt; 0.05, **p \u0026lt; 0.01, and ***p \u0026lt; 0.001, suggesting noteworthy distinctions relative toward the group under control.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-9345018/v1/60cf556ae6e767bc568ce5ca.png"},{"id":107322253,"identity":"c99c1168-8e41-44c8-8c95-1b43ccb7b847","added_by":"auto","created_at":"2026-04-20 10:42:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9670307,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9345018/v1/d2f20cdb-6dc8-477a-b6ee-4ba9d98d71a0.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Sulodexide protects against sepsis-induced liver injury in neonatal rat by attenuating oxidative stress, apoptosis, and NF-κB/MAPK signaling","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eNeonatal sepsis is the cause of substantial morbidity and mortality and remains one of the most frequent and life-threatening conditions in the neonatal intensive care unit (NICU)[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Because immune defenses and organ reserve are still developing, neonates are particularly vulnerable to rapid clinical deterioration once systemic infection occurs[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Dysregulated host responses can quickly evolve into circulatory instability, microcirculatory failure, and multi-organ dysfunction[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Compared with older children and adults, neonates often manifest earlier derailment of endothelial homeostasis, coagulation\u0026ndash;inflammation crosstalk, and metabolic imbalance, narrowing the therapeutic window and contributing to poor outcomes[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAmong sepsis-associated organ injuries, the liver is both a target and an amplifier of systemic inflammation[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Clinically, neonatal sepsis is frequently accompanied by elevations in transaminases, coagulation abnormalities, and most characteristically cholestatic features marked by increased conjugated bilirubin[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Hepatic dysfunction complicates nutritional tolerance and pharmacokinetics, disrupts bile acid homeostasis, and increases bleeding risk, thereby reinforcing a vicious cycle of inflammation and organ injury[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Despite advances in antimicrobial therapy and organ support, there is still no specific pharmacologic strategy that directly targets the core pathological processes driving neonatal sepsis\u0026ndash;associated liver injury (NSALI)[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMechanistically, sepsis-associated liver injury is increasingly understood as a multi-axis process driven by oxidative/nitrosative stress, inflammatory cytokine signaling, and hepatocyte death[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Excessive reactive oxygen species (ROS) and reactive nitrogen species (RNS) generation disrupts redox homeostasis, damages cellular membranes and mitochondria, and sensitizes hepatocytes to apoptosis[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In parallel, cytokines such as TNF-α and IL-1β orchestrate inflammatory programs that further amplify oxidative stress and impair hepatocellular integrity[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Nitric oxide metabolism can also become dysregulated during endotoxemia, contributing to nitrosative burden and functional derangement[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. These pathological inputs converge on stress-responsive signaling nodes, among which mitogen-activated protein kinases (MAPKs)\u0026mdash;including ERK and JNK\u0026mdash;play central roles in integrating inflammatory cues and cellular stress, shaping cytokine production and apoptosis execution[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Thus, interventions that preserve antioxidant capacity, mitigate inflammatory activation, and restrain stress-kinase signaling may offer a coherent strategy for limiting hepatic damage during neonatal sepsis.\u003c/p\u003e \u003cp\u003eSulodexide (SDX) is a glycosaminoglycan-based compound that has been used clinically in vascular disorders and has been reported to exert endothelial-protective, anti-inflammatory, and antithrombotic effects[\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Distinct from approaches that primarily suppress inflammation broadly, SDX is proposed to stabilize the vascular microenvironment under inflammatory stress and may thereby attenuate downstream organ injury[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Experimental evidence in sepsis settings suggests that SDX can ameliorate vascular permeability and inflammatory signaling, supporting its potential as an organ-protective agent in systemic inflammation[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. However, whether SDX can protect the neonatal liver during sepsis, and how such protection relates to redox balance, inflammatory mediators, apoptosis, and stress-kinase signaling, remains insufficiently defined.\u003c/p\u003e \u003cp\u003eIn this study, we investigated the hepatoprotective effect of SDX in an LPS-induced neonatal sepsis model in Wistar rats. We established a structured phenotype-to-mechanism evidence chain aligned with clinically relevant hepatic injury readouts. First, we assessed liver injury using serum transaminases (ALT/AST) and histopathology (HE). Second, we evaluated hepatic edema (wet-to-dry ratio) and redox/nitrosative status, including total antioxidant capacity (FRAP and ABTS), Sod expression, and NO metabolite profiles (NO₂⁻, NO₃⁻, and NO₂⁻/NO₃⁻ ratio). Third, we quantified inflammatory mediators at the transcriptional and protein levels and assessed hepatocyte apoptosis using molecular markers and TUNEL staining. We also performed transcriptomic analysis and pathway enrichment analysis. Finally, we assessed MAPK activity by measuring the phosphorylation levels of ERK and JNK, as well as the inflammation-related NF-κB pathway. Dexamethasone was used as a pharmacological control to evaluate anti-inflammatory efficacy. We hypothesize that SDX alleviates LPS-induced liver injury in newborn rats by maintaining redox homeostasis, suppressing inflammatory responses, reducing apoptosis, and inhibiting the ERK/JNK and NF-κB signaling pathways involved in stress responses.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Drugs and chemicals\u003c/h2\u003e \u003cp\u003eSDX was obtained from(Alfasigma S.p.A., Alanno, Italy)and administered at a dose of 40 LSU/kg. LPS from Escherichia coli O111:B4 (Cat. No. L2630; Sigma-Aldrich, St. Louis, MO, USA) was used to induce neonatal endotoxemia. DEX (Jinfukang Biopharmaceutical Technology Co., Ltd., Shanxi, China) was used as a positive comparator and administered at 0.5 mg/kg. Unless otherwise specified, all other chemicals and reagents were of the highest commercially available analytical grade and were purchased from standard suppliers.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. LPS-induced neonatal sepsis model\u003c/h2\u003e \u003cp\u003eNeonatal sepsis-like systemic inflammation was induced by LPS as a widely used endotoxemia model in neonatal rodents. Briefly, Wistar neonatal rat pups (postnatal day P3) were weighed immediately before the procedure and randomly allocated to the indicated groups. LPS (Escherichia coli O111:B4; Sigma-Aldrich, Cat. No. L2630) was freshly prepared in sterile 0.9% saline and administered by intraperitoneal (i.p.) injection at 5 mg/kg using a 30\u0026ndash;31 G insulin syringe. The injection volume was standardized to 10 \u0026micro;L/g body weight to ensure consistent dosing. Control animals received an equal volume of sterile saline via the same route.\u003c/p\u003e \u003cp\u003eAfter injection, pups were promptly returned to their dams and monitored at predefined intervals (every 2\u0026ndash;4 h) for general condition (activity, posture, nursing behavior, and responsiveness). To minimize variability in sepsis severity, LPS was prepared freshly each time from the same batch, injections were performed by the same operator, and procedures were conducted at a consistent time of day. Animals meeting endpoints were euthanized immediately.\u003c/p\u003e \u003cp\u003eUnless otherwise stated, animals were euthanized 24 h after LPS administration, and blood and liver tissues were collected for downstream biochemical assays, histopathology, oxidative/nitrosative stress assessment, gene expression analyses, and protein signaling studies. All experimental procedures were approved by the Institutional Animal Care and Use Committee at Hubei University of Technology (Animal Protocol Approval No: HBUT20260015).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Animals and experimental design\u003c/h2\u003e \u003cp\u003eNeonatal Wistar rats (postnatal day P3, both sexes) were obtained from the animal facility of Huuazhong University of technology and housed with dams under SPF conditions (12 h light/dark cycle, 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, 45\u0026thinsp;\u0026plusmn;\u0026thinsp;5% humidity) with ad libitum access to food and water for dams.\u003c/p\u003e \u003cp\u003eAnimals were randomly allocated into five groups (n\u0026thinsp;=\u0026thinsp;10 animals/group for biochemical and molecular analyses; n\u0026thinsp;=\u0026thinsp;3 animals/group for transcriptomics):\u003c/p\u003e \u003cp\u003eGroup I (CT): vehicle (0.9% saline, i.p.)\u003c/p\u003e \u003cp\u003eGroup II (LPS): LPS (1mg/kg, i.p.)\u003c/p\u003e \u003cp\u003eGroup III (LPS\u0026thinsp;+\u0026thinsp;SDX): SDX (40LSU, i.p.) administered 2 h after LPS challenge\u003c/p\u003e \u003cp\u003eGroup IV (SDX): SDX alone (40LSU, i.p.)\u003c/p\u003e \u003cp\u003eGroup V (LPS\u0026thinsp;+\u0026thinsp;DEX): DEX (0.5mg/kg, i.p.) administered 2h after LPS challenge,\u003c/p\u003e \u003cp\u003eAnimals were euthanized 24 h after LPS injection for serum and liver collection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Blood and tissue sampling\u003c/h2\u003e \u003cp\u003eAt 24 h post-LPS, animals were deeply anesthetized and euthanized by i.p. overdose of sodium pentobarbital. Whole blood was collected by cardiac puncture, allowed to clot for 30 min at room temperature, and centrifuged at 4,000 \u0026times; g for 15 min at 4\u0026deg;C to obtain serum for biochemical assays. Serum samples were aliquoted and stored at -80\u0026deg;C until analysis.\u003c/p\u003e \u003cp\u003eLivers were rapidly excised, rinsed in ice-cold PBS, blotted dry, and divided into three portions:\u003c/p\u003e \u003cp\u003e(1) snap-frozen in liquid nitrogen and stored at \u0026minus;\u0026thinsp;80\u0026deg;C for Western blot;\u003c/p\u003e \u003cp\u003e(2) stored at \u0026minus;\u0026thinsp;80\u0026deg;C for biochemical assays;\u003c/p\u003e \u003cp\u003e(3) fixed in 10% neutral buffered formalin for histology and TUNEL staining.\u003c/p\u003e \u003cp\u003eFor biochemical assays, hepatic tissue was homogenized in 10 mM potassium phosphate buffer (pH 7.4) at a 1:5 (w/v) tissue-to-buffer ratio. Homogenates were centrifuged at 12,000 \u0026times; g for 15 min at 4\u0026deg;C, and supernatants were collected for downstream measurements.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Biochemical determination\u003c/h2\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e2.5.1. Determination of liver function tests\u003c/h2\u003e \u003cp\u003eALT and AST were measured using assay kits from Solare Technology Co., Ltd. (Beijing, China): ALT kit (Cat. No. BC1555), AST kit (Cat. No. BC1565). Assays were performed according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.5.2. Quantification of total antioxidant capacity\u003c/h2\u003e \u003cp\u003eFRAP method, This method relies on the ability of antioxidants to reduce the orange (Fe\u0026sup3;⁺-TPTZ) complex to a deep blue (Fe\u0026sup2;⁺-TPTZ) complex under acidic conditions. Using a UV spectrophotometer (Agilent, Santa Clara, CA, USA) at 593 nm, the absorbance can indicate the total antioxidant capacity in the sample. ABTS method, which is based on the oxidation of 2,2\u0026prime;-Azinobis-(3-ethylbenzthiazoline-6-sulphonate) (ABTS) diamine salts by potassium persulfate to produce green ABTS free radicals (ABTS\u0026bull;), which are eliminated in the presence of hydrogen-supplying antioxidants. The standard curve was drawn based on the absorbance of the standard solution detected at 734 nm. The sample\u0026rsquo;s absorbance was measured and inputted into the standard curve to calculate the mixture\u0026rsquo;s antioxidant capacity. Results were normalized to total protein concentration (BCA assay) and expressed as \u0026micro;mol/g protein.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e2.5.3. MDA detection\u003c/h2\u003e \u003cp\u003eThe determination of malondialdehyde (MDA) is performed using the thiobarbituric acid (TBA) method. In brief, under acidic conditions and at high temperatures, MDA in the sample reacts with TBA to form the MDA-(TBA)₂ adduct, which exhibits maximum absorbance at 532 nm. Add 60 \u0026micro;L of tissue extract sample or standard solution to 60 \u0026micro;L of 15% trichloroacetic acid. Mix thoroughly and incubate on ice for 10 minutes. Centrifuge at 10,000 rpm for 5 minutes. Discard the supernatant and add 15 \u0026micro;L of 0.1 M TBA solution. Mix thoroughly and heat at 100\u0026deg;C for 50 minutes. After heating, cool on ice, then proceed with detection. Detection was performed using a C18 column (250 mm \u0026times; 4.6 mm, 5 \u0026micro;m). The mobile phase consisted of methanol/phosphate buffer (40/60 by volume) at 25 mM and pH 6.5. Perform HPLC separation at 32\u0026deg;C with a constant flow rate of 1 mL/min, and monitor the eluent at a wavelength of 532 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e2.5.4. Determination of nitric oxide metabolites\u003c/h2\u003e \u003cp\u003eNitrite (NO₂\u003csup\u003e⁻\u003c/sup\u003e) and nitrate (NO₃\u003csup\u003e⁻\u003c/sup\u003e) in liver tissue were measured using a nitric oxide analyzer (NOA 280i, GE, USA). Samples underwent protein removal treatment with sodium hydroxide and zinc sulfate prior to analysis.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Quantitative PCR (qPCR) analysis\u003c/h2\u003e \u003cp\u003eUsing 1 mL of TRIzol reagent, homogenize 100 mg of liver tissue with a homogenizer. Determine total RNA concentration at the A260 wavelength and assess RNA purity using the A260/A280 ratio. Convert equal amounts of total RNA from each sample into cDNA using a cDNA synthesis kit (Abclonal, #RK20433, Wuhan, China). Real-time PCR was performed using single-stranded cDNA as a template. The 2X Universal SYBR Green real-time fluorescent quantitative PCR master mix (#RK21203) from Abclonal was employed. PCR reactions were performed on a real-time PCR detection system (#VQ-100B Yuanzan Life Sciences Co., Ltd., Shanghai, China). Gene expression levels were determined using the comparative CT (threshold cycle) method after normalization with the internal control gene GAPDH. The target genes and sequences were as follows (SOD: F-GCGGATGAAGAGAGGCATGTT, R-TTCCACCTTTGCCCAAGTCAT. Caspase3: F-GAGGCCGACTTCTTGTATGC, R-CGGTTAACCCGGGTAAGAAT. BAX: F-CGTGGTTGCCCTCTTCTACTTT, R-TGATCAGCTCGGGCACTTTA. TNF-α: F-GTCCCAACAAGGAGGAGAAGTT, R- TTTGCTACGACGTGGGCTAC. IL-1β: F- CAGCTTTCGACAGTGAGGAGA, R-TGTCGAGATGCTGCTGTGAG)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Western blotting analysis\u003c/h2\u003e \u003cp\u003eEqual amounts of protein (30 \u0026micro;g) were separated on 10\u0026ndash;12% SDS\u0026ndash;PAGE gels and transferred to PVDF membranes (Millipore, 0.45 \u0026micro;m; Cat. No. IPVH00010). Membranes were blocked in 5% non-fat milk (for total proteins) or 5% BSA (for phospho-proteins) in TBS-T and incubated overnight at 4\u0026deg;C with primary antibodies. Primary antibodies including Phospho-ERK1/2 (Immunoway #YM8452, 1:1000), total ERK1/2 (Immunoway #YM8336, 1:1000), phospho-JNK (Proteintech #60666-1-Ig, 1:1000), total JNK (Proteintech #24164-1-AP, 1:1000), NF-κB (Immunoway #YM8209, 1:2500), phospho-NF-κB (Immunoway #YM8422, 1:5000), TNF-α, (HUABIO #ER65189, 1:1000), IL-1β (ABclonal #A27676, 1:1000), IFN-γ (ABclonal #A12450, 1:1000), caspase-3 (Zenbio #341034, 1:1000), α-Tubulin (CST #2144, 1:5000).\u003c/p\u003e \u003cp\u003eAfter washing, membranes were incubated with HRP-conjugated secondary antibodies (CST #7074 anti-rabbit; CST #7076 anti-mouse; 1:5000) for 1 h at room temperature. Bands were visualized using ECL substrate (Thermo Fisher Scientific, Cat. No. 32106) and quantified using ImageJ. Cytokines/caspase-3 were normalized to β-tubulin.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Histopathology and TUNEL staining\u003c/h2\u003e \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e \u003ch2\u003e2.8.1. Hematoxylin and eosin (HE) staining\u003c/h2\u003e \u003cp\u003eFormalin-fixed livers were paraffin-embedded, sectioned at 4 \u0026micro;m, and stained with hematoxylin and eosin using standard procedures. Slides were imaged using an Olympus light microscope equipped with a digital camera. Histological assessment focused on hepatic architecture and inflammatory cell infiltration.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section3\"\u003e \u003ch2\u003e2.8.2. TUNEL assay\u003c/h2\u003e \u003cp\u003eApoptosis in liver sections was evaluated using One Step TUNEL Apoptosis Assay Kit (Abbkine #KTA2010, Green Fluorescence) according to the manufacturer\u0026rsquo;s protocol. Nuclei were counterstained with DAPI, and images were acquired under identical exposure settings across groups.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.9 RNA Library Construction and Sequencing\u003c/h2\u003e \u003cp\u003eFor RNA sequencing (RNA-seq), total RNA samples with a quantity\u0026thinsp;\u0026ge;\u0026thinsp;1 \u0026micro;g were selected. mRNA was enriched using oligo(dT) magnetic beads and fragmented into smaller pieces by divalent cations under elevated temperature. The NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs Inc., Ipswich, MA, USA) was used to construct strand-specific libraries, following the manufacturer's protocol. Fragmented mRNA was used as a template for first-strand cDNA synthesis with random hexamer primers, followed by second-strand synthesis. The double-stranded cDNA was purified, end-repaired, and an \"A\" base was added to the 3 \u0026rsquo; ends for adapter ligation. Multiplexed DNA libraries were then normalized and pooled in equal volumes. After quantification and quality control, the libraries were sequenced on an Illumina platform using the paired-end 150 bp (PE150) mode.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Statistical analysis\u003c/h2\u003e \u003cp\u003eData are presented as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Statistical comparisons among multiple groups were performed using one-way ANOVA followed by Tukey\u0026rsquo;s multiple-comparisons test. A two-tailed P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. Statistical analyses and graphing were performed using GraphPad Prism, Version 10.00 for Windows.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.1 SDX ameliorates sepsis-associated liver dysfunction and histopathological injury\u003c/h2\u003e \u003cp\u003eTo test our hypothesis that SDX protects against neonatal sepsis\u0026ndash;associated liver injury, we first evaluated liver function and histopathological damage (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Compared with the control (CT) group, LPS challenge markedly increased serum AST and ALT levels (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), indicating substantial hepatocellular injury. In the presence of LPS, SDX significantly reduced both AST and ALT levels compared with LPS alone, with a more pronounced effect observed for ALT (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Importantly, SDX administered alone did not increase AST or ALT relative to the control group, indicating no detectable hepatotoxicity under basal conditions. Dexamethasone (DEX), used as a positive comparator, significantly reduced AST in LPS-challenged rat (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and also lowered ALT. Notably, SDX produced a greater reduction in ALT than DEX under LPS conditions (p\u0026thinsp;\u0026lt;\u0026thinsp;0. 05).\u003c/p\u003e \u003cp\u003eConsistent with the biochemical evidence of liver injury, H\u0026amp;E staining revealed preserved hepatic architecture in the CT and SDX-alone groups, with hepatocytes showing largely normal morphology (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). LPS challenge induced prominent inflammatory cell infiltration and disrupted lobular organization, as highlighted in the magnified views. Notably, SDX treatment in LPS-challenged rat markedly attenuated these histopathological abnormalities, showing reduced inflammatory infiltration and improved tissue architecture compared with the LPS group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.2 SDX reduces hepatic edema and preserves redox homeostasis\u003c/h2\u003e \u003cp\u003eGiven the proposed contribution of oxidative stress to sepsis-associated organ injury, we next assessed hepatic antioxidant capacity and tissue edema (Figs.\u0026nbsp;2A-2E). LPS challenge markedly reduced total antioxidant capacity, as indicated by significantly lower FRAP and ABTS values compared with the CT group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Treatment with SDX significantly restored both FRAP and ABTS relative to LPS alone (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), whereas SDX administered alone showed no difference compared with the CT group. Consistently, LPS significantly reduced hepatic SOD mRNA expression (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), whereas SDX co-treatment partially restored SOD levels compared with LPS alone (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01), supporting an improvement in antioxidant defenses at the transcriptional level (Fig.\u0026nbsp;2C). In addition, compared with the LPS group, SDX treatment significantly reduced MDA levels, with no difference observed compared to the CT group (Fig.\u0026nbsp;2D).In parallel, LPS significantly increased the liver wet-to-dry (W/D) ratio (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating hepatic edema (Fig.\u0026nbsp;2E). This increase was significantly attenuated by SDX under LPS conditions (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), with DEX showing a similar edema-reducing effect and bringing W/D back toward baseline (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003cp\u003eTo further evaluate nitrosative stress, we quantified NO metabolites (Figs.\u0026nbsp;2E-2G). LPS exposure decreased nitrite (NO₂⁻) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and markedly increased nitrate (NO₃⁻) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), resulting in a pronounced reduction in the NO₂⁻/NO₃⁻ ratio (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). SDX co-treatment significantly reduced nitrate accumulation compared with LPS alone (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01); however, the NO₂⁻/NO₃⁻ ratio was not fully normalized under LPS conditions. Notably, SDX administered alone did not increase nitrate and was associated with a higher NO₂⁻/NO₃⁻ ratio relative to LPS, supporting that SDX does not exacerbate basal nitrosative imbalance.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFigure. SDX alleviates hepatic edema and maintains redox balance. (A) FRAP; (B) ABTS; (C) SOD gene expression levels; (D) MDA levwls; (E) wet-to-dry weight ratio of liver; (F) nitrite ; (G) nitrate ; (H) nitrite/nitrate, Data represent mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation, significance levels were denoted as *p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, a Significance levels were denoted as *p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, and ***p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, suggesting noteworthy distinctions relative toward the group under control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.3 SDX suppresses LPS-induced hepatic inflammation at both transcript and protein levels\u003c/h2\u003e \u003cp\u003eTo determine whether SDX mitigates the inflammatory response elicited by LPS, we quantified key pro-inflammatory mediators in liver tissue (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). At the transcriptional level, LPS challenge markedly increased TNF-α (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and IL-1β (p\u0026thinsp;\u0026lt;\u0026thinsp;0. 01) mRNA expression compared with the CT group, whereas SDX co-treatment significantly reduced both transcripts relative to LPS alone (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Importantly, SDX administered alone showed no significant difference from CT, indicating that SDX does not trigger a basal inflammatory response under non-septic conditions.\u003c/p\u003e \u003cp\u003eConsistent with the qPCR findings (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eF), Western blot analysis demonstrated that LPS substantially increased hepatic protein levels of IL-1β, TNF-α, and IFN-γ (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These elevations were attenuated by SDX in LPS-challenged rat, supporting an anti-inflammatory effect of SDX at the protein level. DEX, used as a positive comparator, also reduced inflammatory cytokine expression under LPS conditions. Collectively, these data indicate that SDX effectively blunts LPS-induced hepatic inflammation in neonatal sepsis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.4 SDX attenuates hepatocyte apoptosis in septic liver injury\u003c/h2\u003e \u003cp\u003eGiven the tight coupling between inflammatory signaling and hepatocyte death during sepsis, we next examined apoptosis-related endpoints (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). To determine whether SDX alleviates sepsis-associated hepatocyte death, We evaluated apoptosis-related markers at the transcriptional, protein, and tissue levels. Compared with the control group, LPS stimulation significantly increased the mRNA and protein expression of Bax (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and Caspase-3 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in the liver, indicating that the pro-apoptotic program had been activated. Compared with LPS alone, combination therapy with SDX significantly reduced the transcriptional and protein levels of Bax (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and Caspase-3 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), bringing them closer to baseline levels; in contrast, SDX alone showed no significant difference compared with the control group, indicating that SDX does not have an apoptotic effect under baseline conditions.\u003c/p\u003e \u003cp\u003eFinally, TUNEL staining provided in situ confirmation: LPS markedly increased TUNEL-positive signals in liver sections, while SDX co-treatment substantially reduced TUNEL positivity, supporting that SDX mitigates hepatocyte apoptosis during neonatal sepsis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003eG).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.5 SDX reduces the phosphorylation levels of ERK/JNK and NF-κB\u003c/h2\u003e \u003cp\u003eGiven that apoptosis and inflammation are tightly linked to upstream stress-response signaling, we next examined MAPK pathway activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003e). To identify upstream pathways that may account for the protective effects of SDX, we first performed transcriptomic profiling and pathway enrichment analyses (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Differential expression analysis revealed substantial transcriptional reprogramming in the liver following LPS challenge (CT vs LPS), whereas SDX treatment under LPS conditions (LPS vs LPS\u0026thinsp;+\u0026thinsp;SDX) was associated with a smaller set of differentially expressed genes, with an overlap of shared genes between comparisons (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). KEGG enrichment analysis further highlighted inflammatory signaling pathways, including NF-κB signaling, and also implicated MAPK-related pathways, suggesting that these programs may contribute to sepsis-associated liver injury and the SDX response (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eNext, we examined the activity of the MAPK and NF-κB pathways at the protein level (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eD\u0026ndash;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eG). Western blotting results showed that LPS stimulation increased the phosphorylation levels of ERK1/2 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), JNK1/2 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), and NF-κB (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating that MAPK and NF-κB are activated in sepsis-induced liver injury. Notably, compared with LPS alone, the combination with SDX significantly reduced the phosphorylation levels of ERK1/2 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), JNK1/2 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), and NF-κB (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01); whereas, compared with the control group (CT), SDX alone did not increase the phosphorylation levels of MAPK and NF-κB. In summary, SDX treatment significantly suppressed the increase in the ratio of phosphorylated NF-κB to total NF-κB. These data support the notion that SDX exerts a hepatoprotective effect by inhibiting MAPK/NF-κB signaling in the livers of newborn rats following LPS stimulation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eNeonatal sepsis remains a major driver of morbidity and mortality, and liver dysfunction is a common and clinically meaningful component of sepsis-associated organ injury[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In this study, we show that SDX mitigates LPS-induced liver injury in neonatal rat, supported by convergent biochemical, histological, and molecular evidence. SDX reduced serum AST/ALT and improved H\u0026amp;E-assessed tissue architecture, attenuated hepatic edema, preserved antioxidant capacity (FRAP/ABTS) ,reduced MDA and with recovery of Sod expression, suppressed inflammatory mediators (TNF-α, IL-1β, IFN-γ) at both transcript and protein levels, and reduced apoptosis (Bax/Caspase3 mRNA and protein expression, and TUNEL positivity). Importantly, SDX alone did not increase AST/ALT, did not impair antioxidant indices, and did not elevate apoptosis-associated readouts, suggesting an overall favorable baseline safety signal under non-septic conditions in this model.\u003c/p\u003e \u003cp\u003eAlthough SDX has not been widely studied in neonatal sepsis\u0026ndash;associated liver injury, its protective actions in sepsis and microvascular barrier dysfunction have precedent[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. In septic mouse models (LPS and CLP), SDX has been reported to improve vascular permeability via endothelial glycocalyx remodeling and to reduce syndecan-1 shedding, accompanied by improved organ injury phenotypes and survival signals[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. These prior findings are conceptually consistent with our observation that SDX reduced hepatic edema (W/D ratio) and mitigated parenchymal injury, because glycocalyx integrity is increasingly viewed as a key determinant of microvascular leakage, interstitial edema, and downstream tissue hypoxia/inflammation during sepsis[\u003cspan additionalcitationids=\"CR34\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. While we did not directly measure glycocalyx biomarkers (e.g., syndecan-1, heparan sulfate), our data extend the emerging SDX narrative by demonstrating protection in the neonatal liver, a tissue that is highly sensitive to inflammatory and oxidative stress perturbations during early life.\u003c/p\u003e \u003cp\u003eA notable strength of our dataset is the coherent redox\u0026ndash;inflammation\u0026ndash;apoptosis axis, which is especially relevant in neonates. Neonatal sepsis is characterized by a combination of inflammatory activation and oxidative stress, and neonates are thought to be more vulnerable because innate immune responses and antioxidant defenses are developmentally immature[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. In line with this framework, LPS caused a pronounced drop in total antioxidant capacity (FRAP/ABTS) together with reduced Sod expression in our neonatal livers, whereas SDX restored antioxidant capacity and partially recovered Sod. These findings align with the broader sepsis literature emphasizing ROS-driven amplification loops that worsen organ dysfunction, while also highlighting that restoring antioxidant defenses may be particularly impactful in early-life sepsis contexts[\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWe also observed a marked shift in NO metabolites, decreased NO₂⁻, increased NO₃⁻, and reduced NO₂⁻/NO₃⁻ ratio, after LPS, consistent with an environment favoring NO oxidation and nitrosative stress. In experimental endotoxemia, oxidative stress has been mechanistically linked to caspase activation and hepatocellular injury, supporting the plausibility of redox/nitrosative mechanisms upstream of apoptosis in the liver. SDX reduced nitrate accumulation under LPS conditions but did not fully normalize the NO₂⁻/NO₃⁻ ratio, which may reflect incomplete pathway correction within the sampled time window or multiple upstream sources of RNS that are not fully addressed by SDX alone. Future time-course analyses, coupled with iNOS/NOX-related readouts and peroxynitrite-associated markers, could clarify whether SDX primarily limits excessive NO oxidation or more broadly rebalances NO generation and consumption[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOur data show that SDX suppresses LPS-induced inflammatory mediators at both transcript and protein levels, and concurrently attenuates hepatocyte apoptosis across mRNA, protein, and in situ assays. Mechanistically, we provide protein-level evidence that SDX reduces ERK/JNK phosphorylation, suggesting that dampening stress-responsive MAPK signaling may represent a proximal node connecting reduced cytokine output with reduced apoptosis execution. In parallel, transcriptomic profiling and KEGG enrichment analyses implicated inflammatory signaling programs, including NF-κB-related pathways, as part of the LPS injury response and/or SDX-responsive network. Our results indicate that SDX significantly inhibits LPS-activated NF-κB. This is consistent with the literature on sepsis-induced liver injury datasets and mechanisms, which emphasize that inflammatory signaling and stress kinase pathways are central to the sepsis-induced liver injury process[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDEX served as a positive comparator and improved several injury indices under LPS conditions in our model. Notably, SDX produced a more pronounced reduction in ALT than DEX in our dataset, suggesting that SDX may confer hepatoprotection not fully captured by broad glucocorticoid-mediated immunosuppression. This is clinically relevant because systemic corticosteroid exposure in neonates\u0026mdash;especially in preterm populations\u0026mdash;has long-standing concerns regarding short-term adverse effects like hyperglycemia, hypertension, infection risk signals and potential neurodevelopmental impacts with certain regimens[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. In this context, an agent that stabilizes vascular/barrier biology and dampens stress\u0026ndash;inflammation signaling without the same endocrine trade-offs could offer a wider therapeutic window for neonatal sepsis\u0026ndash;associated organ protection. SDX has antithrombotic properties and neonatal hemostasis differs from adults; therefore, future translational work should explicitly evaluate coagulation-related safety and bleeding risk alongside efficacy.\u003c/p\u003e \u003cp\u003eThis study has limitations. First, we used an LPS-based model, which captures key features of endotoxemia but does not fully recapitulate polymicrobial neonatal sepsis. Second, we did not define the primary hepatic cellular targets of SDX (hepatocytes vs endothelial/non-parenchymal compartments), nor did we measure glycocalyx integrity, which is mechanistically attractive given prior SDX\u0026ndash;glycocalyx literature. Future studies should (i) validate NF-κB activation status (p-p65, nuclear translocation, IκBα dynamics), (ii) test ERK/JNK dependence using pharmacologic or genetic approaches, (iii) extend to polymicrobial neonatal sepsis models, and (iv) incorporate endothelial/glycocalyx markers and microcirculatory readouts to establish whether barrier stabilization is a key upstream driver of hepatic protection.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eSDX protects against neonatal LPS-induced liver injury by improving liver function and histopathology, preserving antioxidant capacity, partially correcting NO metabolite imbalance, suppressing inflammatory cytokine production, and reducing hepatocyte apoptosis. These effects are accompanied by reduced ERK/JNK phosphorylation and transcriptomic implication of NF-κB related inflammatory programs. Placed in the context of prior SDX literature on glycocalyx/barrier protection in sepsis, our findings support SDX as a promising candidate for mitigating neonatal sepsis\u0026ndash;associated hepatic injury, warranting further mechanistic validation and neonatal-focused safety evaluation.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eDeclaration of competing interest\u003c/h2\u003e \u003cp\u003eThe authors declare that there are no conflicts of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eWe would like to thank the Hubei Provincial Department of Science and Technology for its funding, Grant No. 1143/23990102, 4115/00257.\u003c/p\u003e\u003cp\u003e \u003cb\u003eCRediT authorship contribution statement\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eWei Lu\u003c/b\u003e: Writing\u0026ndash;review \u0026amp; editing, Formal analysis. \u003cb\u003eKang Fu\u003c/b\u003e: Writing\u0026ndash;original draft, Methodology, Investigation. \u003cb\u003eXinming Zhang\u003c/b\u003e: Methodology, Data curation. \u003cb\u003ePedro Antonio Valdes-Sosa\u003c/b\u003e: Visualization, \u003cb\u003eJun Wang\u003c/b\u003e: Funding acquisition, Conceptualization. \u003cb\u003eFuzhong Xing\u003c/b\u003e: Supervision, Resources, Project administration.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eData will be made available on request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eShane AL, S\u0026aacute;nchez PJ, Stoll BJ (2017) Neonatal sepsis. Lancet 390:1770\u0026ndash;1780. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0140-6736(17)31002-4\u003c/span\u003e\u003cspan address=\"10.1016/S0140-6736(17)31002-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCelik IH, Hanna M, Canpolat FE, Mohan P (2022) Diagnosis of neonatal sepsis: the past, present and future. Pediatr Res 91:337\u0026ndash;350. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41390-021-01696-z\u003c/span\u003e\u003cspan address=\"10.1038/s41390-021-01696-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang CR, Byeon JH, Cho H et al (2025) Perinatal Enterovirus Infection in Neonates: A Systematic Review. J Med Virol 97:e70362. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jmv.70362\u003c/span\u003e\u003cspan address=\"10.1002/jmv.70362\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuignan SM, Lakshminrusimha S, Armstrong K et al (2024) Neonatal sepsis and cardiovascular dysfunction I: mechanisms and pathophysiology. Pediatr Res 95:1207\u0026ndash;1216. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41390-023-02926-2\u003c/span\u003e\u003cspan address=\"10.1038/s41390-023-02926-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKharrat A, Jain A (2022) Hemodynamic dysfunction in neonatal sepsis. Pediatr Res 91:413\u0026ndash;424. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41390-021-01855-2\u003c/span\u003e\u003cspan address=\"10.1038/s41390-021-01855-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eProcianoy RS, Silveira RC (2020) The challenges of neonatal sepsis management. Jornal de Pediatria 96:80\u0026ndash;86. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jped.2019.10.004\u003c/span\u003e\u003cspan address=\"10.1016/j.jped.2019.10.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLam MMC, Wick RR, Watts SC et al (2021) A genomic surveillance framework and genotyping tool for Klebsiella pneumoniae and its related species complex. Nat Commun 12:4188. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-021-24448-3\u003c/span\u003e\u003cspan address=\"10.1038/s41467-021-24448-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHadian F, Rutten C, Siddiqui I et al (2024) Neonatal Liver Imaging: Techniques, Role of Imaging, and Indications. Radiographics 44:e240034. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1148/rg.240034\u003c/span\u003e\u003cspan address=\"10.1148/rg.240034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMolloy EJ, Bearer CF (2022) Paediatric and neonatal sepsis and inflammation. Pediatr Res 91:267\u0026ndash;269. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41390-021-01918-4\u003c/span\u003e\u003cspan address=\"10.1038/s41390-021-01918-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBalayan S, Chauhan N, Chandra R et al (2020) Recent advances in developing biosensing based platforms for neonatal sepsis. Biosens Bioelectron 169:112552. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bios.2020.112552\u003c/span\u003e\u003cspan address=\"10.1016/j.bios.2020.112552\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMolloy EJ, Bearer CF (2022) Paediatric and neonatal sepsis and inflammation. Pediatr Res 91:267\u0026ndash;269. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41390-021-01918-4\u003c/span\u003e\u003cspan address=\"10.1038/s41390-021-01918-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSavio LEB, De Andrade Mello P, Figliuolo VR et al (2017) CD39 limits P2X7 receptor inflammatory signaling and attenuates sepsis-induced liver injury. J Hepatol 67:716\u0026ndash;726. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jhep.2017.05.021\u003c/span\u003e\u003cspan address=\"10.1016/j.jhep.2017.05.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Tao X, Liu Z et al (2025) Noncoding RNAs in sepsis-associated acute liver injury: Roles, mechanisms, and therapeutic applications. Pharmacol Res 212:107596. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.phrs.2025.107596\u003c/span\u003e\u003cspan address=\"10.1016/j.phrs.2025.107596\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMansoori Moghadam Z, Zhao B, Raynaud C et al (2025) Reactive oxygen species regulate early development of the intestinal macrophage-microbiome interface. Blood 145:2025\u0026ndash;2040. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1182/blood.2024025240\u003c/span\u003e\u003cspan address=\"10.1182/blood.2024025240\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarcillo JA (1999) Nitric oxide production in neonatal and pediatric sepsis. Crit Care Med 27:1063\u0026ndash;1065. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/00003246-199906000-00017\u003c/span\u003e\u003cspan address=\"10.1097/00003246-199906000-00017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReis Machado J, Soave DF, Da Silva MV et al (2014) Neonatal Sepsis and Inflammatory Mediators. Mediat Inflamm 2014:1\u0026ndash;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2014/269681\u003c/span\u003e\u003cspan address=\"10.1155/2014/269681\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu H, Fan H, He P et al (2022) Prohibitin 1 regulates mtDNA release and downstream inflammatory responses. EMBO J 41:e111173. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.15252/embj.2022111173\u003c/span\u003e\u003cspan address=\"10.15252/embj.2022111173\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJoffre J, Hellman J, Ince C, Ait-Oufella H (2020) Endothelial Responses in Sepsis. Am J Respir Crit Care Med 202:361\u0026ndash;370. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1164/rccm.201910-1911TR\u003c/span\u003e\u003cspan address=\"10.1164/rccm.201910-1911TR\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang R, Chen Y, Han J et al (2024) Selectively targeting the AdipoR2-CaM-CaMKII-NOS3 axis by SCM-198 as a rapid-acting therapy for advanced acute liver failure. Nat Commun 15:10690. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-024-55295-7\u003c/span\u003e\u003cspan address=\"10.1038/s41467-024-55295-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou R, Yang X, Li X et al (2019) Recombinant CC16 inhibits NLRP3/caspase-1-induced pyroptosis through p38 MAPK and ERK signaling pathways in the brain of a neonatal rat model with sepsis. J Neuroinflammation 16:239. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12974-019-1651-9\u003c/span\u003e\u003cspan address=\"10.1186/s12974-019-1651-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X-S, Wang S-H, Liu C-Y et al (2022) Losartan attenuates sepsis-induced cardiomyopathy by regulating macrophage polarization via TLR4-mediated NF-κB and MAPK signaling. Pharmacol Res 185:106473. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.phrs.2022.106473\u003c/span\u003e\u003cspan address=\"10.1016/j.phrs.2022.106473\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYing J, Zhang C, Wang Y et al (2023) Sulodexide improves vascular permeability via glycocalyx remodelling in endothelial cells during sepsis. Front Immunol 14:1172892. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2023.1172892\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2023.1172892\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarroll BJ, Piazza G, Goldhaber SZ (2019) Sulodexide in venous disease. J Thromb Haemost 17:31\u0026ndash;38. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jth.14324\u003c/span\u003e\u003cspan address=\"10.1111/jth.14324\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBignamini AA, Matuška J (2020) Sulodexide for the Symptoms and Signs of Chronic Venous Disease: A Systematic Review and Meta-analysis. Adv Ther 37:1013\u0026ndash;1033. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12325-020-01232-1\u003c/span\u003e\u003cspan address=\"10.1007/s12325-020-01232-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Xing J, Mu X et al (2015) Sulodexide therapy for the treatment of diabetic nephropathy, a meta-analysis and literature review. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2147/DDDT.S87973\u003c/span\u003e\u003cspan address=\"10.2147/DDDT.S87973\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. DDDT 6275\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoccheri S, Mannello F (2013) Development and use of sulodexide in vascular diseases: implications for treatment. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2147/DDDT.S6762\u003c/span\u003e\u003cspan address=\"10.2147/DDDT.S6762\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. DDDT 49\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong JW, Zullo J, Lipphardt M et al (2018) Endothelial glycocalyx\u0026mdash;the battleground for complications of sepsis and kidney injury. Nephrol Dialysis Transplantation 33:203\u0026ndash;211. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/ndt/gfx076\u003c/span\u003e\u003cspan address=\"10.1093/ndt/gfx076\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong JW, Zullo JA, Liveris D et al (2017) Therapeutic Restoration of Endothelial Glycocalyx in Sepsis. J Pharmacol Exp Ther 361:115\u0026ndash;121. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1124/jpet.116.239509\u003c/span\u003e\u003cspan address=\"10.1124/jpet.116.239509\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong Y, Basmaci R, Titomanlio L et al (2020) Neonatal sepsis: within and beyond China. Chin Med J 133:2219\u0026ndash;2228. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/CM9.0000000000000935\u003c/span\u003e\u003cspan address=\"10.1097/CM9.0000000000000935\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBecker BF, Jacob M, Leipert S et al (2015) Degradation of the endothelial glycocalyx in clinical settings: searching for the sheddases. Brit J Clin Pharma 80:389\u0026ndash;402. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/bcp.12629\u003c/span\u003e\u003cspan address=\"10.1111/bcp.12629\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStackowicz J, J\u0026ouml;nsson F, Reber LL (2020) Mouse Models and Tools for the in vivo Study of Neutrophils. Front Immunol 10:3130. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2019.03130\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2019.03130\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRangarajan S, Richter JR, Richter RP et al (2020) Heparanase-enhanced Shedding of Syndecan-1 and Its Role in Driving Disease Pathogenesis and Progression. J Histochem Cytochem 68:823\u0026ndash;840. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1369/0022155420937087\u003c/span\u003e\u003cspan address=\"10.1369/0022155420937087\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuratore CS, Harty MW, Papa EF, Tracy TF (2009) Dexamethasone Alters the Hepatic Inflammatory Cellular Profile Without Changes in Matrix Degradation During Liver Repair Following Biliary Decompression. J Surg Res 156:231\u0026ndash;239. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jss.2009.04.016\u003c/span\u003e\u003cspan address=\"10.1016/j.jss.2009.04.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYing J, Zhang C, Wang Y et al (2023) Sulodexide improves vascular permeability via glycocalyx remodelling in endothelial cells during sepsis. Front Immunol 14:1172892. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2023.1172892\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2023.1172892\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoleimanpour H, Shahsavari Nia K, Sanaie S et al (2019) Use of Dexmedetomidine in Liver Disease: A Systematic Review and Meta-Analysis. Hepat Mon 19. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5812/hepatmon.98530\u003c/span\u003e\u003cspan address=\"10.5812/hepatmon.98530\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParra-Llorca A, Pinilla-Gonzlez A, Torrej\u0026oacute;n-Rodr\u0026iacute;guez L et al (2023) Effects of Sepsis on Immune Response, Microbiome and Oxidative Metabolism in Preterm Infants. Children 10:602. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/children10030602\u003c/span\u003e\u003cspan address=\"10.3390/children10030602\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHensler E, Petros H, Gray CC et al (2022) The Neonatal Innate Immune Response to Sepsis: Checkpoint Proteins as Novel Mediators of This Response and as Possible Therapeutic/Diagnostic Levers. Front Immunol 13:940930. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2022.940930\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2022.940930\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDery KJ, Chiu R, Kasargod A, Kupiec-Weglinski JW (2025) Feedback Loops Shape Oxidative and Immune Interactions in Hepatic Ischemia\u0026ndash;Reperfusion Injury. Antioxidants 14:944. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/antiox14080944\u003c/span\u003e\u003cspan address=\"10.3390/antiox14080944\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchieber M, Chandel NS (2014) ROS Function in Redox Signaling and Oxidative Stress. Curr Biol 24:R453\u0026ndash;R462. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cub.2014.03.034\u003c/span\u003e\u003cspan address=\"10.1016/j.cub.2014.03.034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi B, Ming H, Qin S et al (2025) Redox regulation: mechanisms, biology and therapeutic targets in diseases. Sig Transduct Target Ther 10:72. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41392-024-02095-6\u003c/span\u003e\u003cspan address=\"10.1038/s41392-024-02095-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBala A (2024) Regulatory role of peroxynitrite in advanced glycation end products mediated diabetic cardiovascular complications. World J Diabetes 15:572\u0026ndash;574. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4239/wjd.v15.i3.572\u003c/span\u003e\u003cspan address=\"10.4239/wjd.v15.i3.572\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim ME, Lee JS (2025) Advances in the Regulation of Inflammatory Mediators in Nitric Oxide Synthase: Implications for Disease Modulation and Therapeutic Approaches. Int J Mol Sci 26:1204. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms26031204\u003c/span\u003e\u003cspan address=\"10.3390/ijms26031204\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu X, Yang T, An J et al (2025) Liver injury in sepsis: manifestations, mechanisms and emerging therapeutic strategies. Front Immunol 16:1575554. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2025.1575554\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2025.1575554\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo Y, Guo W, Chen H et al (2025) Mechanisms of sepsis-induced acute liver injury: a comprehensive review. Front Cell Infect Microbiol 15:1504223. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcimb.2025.1504223\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2025.1504223\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShastry A, Ahmad D, Richardson A et al (2025) Systemic corticosteroid use and neurodevelopmental outcomes in preterm infants: a cohort study. World J Pediatr 21:575\u0026ndash;586. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12519-025-00932-4\u003c/span\u003e\u003cspan address=\"10.1007/s12519-025-00932-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Sepsis, Sulodexide, Inflammation, MAPK, NF-κB","lastPublishedDoi":"10.21203/rs.3.rs-9345018/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9345018/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eNeonatal sepsis frequently causes liver dysfunction driven by oxidative/nitrosative stress, inflammation, and hepatocyte death. This study evaluated the hepatoprotective effects of Sulodexide (SDX) in an LPS-induced neonatal sepsis rat model and explored underlying pathways. Methods: Neonatal Wistar rats received LPS (5 mg/kg, i.p.) and were assigned to CT, LPS, LPS+SDX (40 LSU/kg), SDX, or LPS+Dexamethasone (DEX, 0.5 mg/kg). Liver injury was assessed by serum ALT/AST and H\u0026amp;E staining. Hepatic edema (wet-to-dry ratio), antioxidant capacity (FRAP, ABTS; MDA; SOD), NO metabolites (NO\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e−\u003c/sup\u003e, NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e−\u003c/sup\u003e, NO\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e−\u003c/sup\u003e/NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e−\u003c/sup\u003e), inflammation (qPCR/Western blot for TNF-α, IL-1β, IFN-γ), apoptosis (Bax/Caspase3, TUNEL), MAPK and NF-κB signaling were evaluated. Transcriptomics with KEGG enrichment was performed. Result: LPS markedly increased ALT/AST, worsened histopathology and edema, reduced FRAP/ABTS and Sod, disrupted NO metabolites, elevated inflammatory cytokines, and increased apoptosis. Under LPS conditions, SDX significantly lowered both AST and ALT, improved histology and W/D ratio, restored antioxidant capacity, suppressed inflammatory mediators, and reduced apoptosis; SDX alone did not raise ALT/AST versus CT. SDX also reduced ERK/JNK and NF-κB phosphorylation. Conclusion：SDX protects against neonatal LPS-induced liver injury by preserving redox homeostasis, limiting inflammation and apoptosis, and suppressing ERK/JNK signaling, supporting SDX as a potential therapy for neonatal sepsis–associated hepatic injury.\u003c/p\u003e","manuscriptTitle":"Sulodexide protects against sepsis-induced liver injury in neonatal rat by attenuating oxidative stress, apoptosis, and NF-κB/MAPK signaling","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-20 10:38:59","doi":"10.21203/rs.3.rs-9345018/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-16T08:09:58+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-15T17:29:41+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-15T12:24:18+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-12T21:56:33+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"34585151784569893823259500403433784327","date":"2026-04-12T13:57:19+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"64597105226619070177244953790714440939","date":"2026-04-12T09:51:54+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"58807624472917907049074895468403422997","date":"2026-04-10T19:33:03+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"155658524531815418472331053730676694749","date":"2026-04-10T15:35:00+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"63578836842807083114952461974137992179","date":"2026-04-10T14:51:17+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"332330178213013146250011322222883136628","date":"2026-04-10T14:50:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"309554025582939530663106113035701506216","date":"2026-04-10T14:01:37+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-04-10T13:51:36+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-04-08T03:57:21+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-04-08T03:57:13+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2026-04-07T12:12:37+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"0c84c84b-546a-422d-abf5-97f6c90c3550","owner":[],"postedDate":"April 20th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-18T11:24:51+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-20 10:38:59","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9345018","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9345018","identity":"rs-9345018","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}