Chloroquine Phosphate Targets the MAPK-ERK Pathway to Inhibit ASFV SY- 1 Replication In Vitro

preprint OA: closed
Full text JSON View at publisher
Full text 115,737 characters · extracted from preprint-html · click to expand
Chloroquine Phosphate Targets the MAPK-ERK Pathway to Inhibit ASFV SY- 1 Replication In Vitro | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Chloroquine Phosphate Targets the MAPK-ERK Pathway to Inhibit ASFV SY- 1 Replication In Vitro Haiying Mao, Yong Wang, Ke Zhang, Wenhui Zhou, Chuxing Cheng, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8029940/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Feb, 2026 Read the published version in Virology Journal → Version 1 posted 10 You are reading this latest preprint version Abstract African swine fever virus (ASFV) causes a highly lethal disease in domestic pigs and wild boars, resulting in substantial economic losses on the global swine industry. However, effective vaccines against this virus remain elusive because of its large genome and high mutation frequency. Thus, drugs against ASFV infection need to be developed urgently. Chloroquine phosphate (CQP) has been demonstrated in previous studies to exert inhibitory effects against a variety of viruses, but its inhibitory effect against the SY-1 strain of ASFV remains unclear. Therefore, we selected CQP as the research subject to investigate its anti-ASFV function. In this study, we confirmed that chloroquine phosphate (CQP) exerts a significant inhibitory effect on the ASFV SY-1 strain by RT-qPCR, western blot, and HAD 50 . Transcriptome sequencing and KEGG pathway enrichment analysis showed that CQP treatment significantly affected multiple signaling pathways, including the cytokine–cytokine receptor interaction, Toll-like receptor signaling pathway, tumour necrosis factor (TNF) signaling pathway and IL-17 signaling pathway. Western blot results further indicated that CQP can inhibit ERK phosphorylation. Treatment with the MAPK agonist C16-PAF reversed the inhibitory effect of CQP, verifying the key role of this pathway in the anti-viral mechanism of CQP. In sum, the results of this study indicate that CQP effectively inhibits ASFV replication by suppressing the MAPK-ERK signalling pathway. This study provides a theoretical basis and technical support for the development of anti-viral strategies targeting ASFV. ASFV SY-1 strain chloroquine phosphate (CQP) anti-viral drugs MAPK-ERK pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction African swine fever (ASF) is a highly contagious and fatal infectious disease caused by the African swine fever virus (ASFV) and it can be transmitted through vectors such as soft ticks, or via contact with infected wild boars or domestic pigs[ 1 – 3 ]. First identified in Kenya in 1921(Eustace Montgomery 1921) and in 2017, ASF outbreaks were repeatedly reported in the Far East region of Russia[ 4 , 5 ]. In 2018, ASF was first confirmed in Heilongjiang Province, China, followed by subsequent cases reported in provinces such as Henan, Jiangsu, and Zhejiang[ 6 ]. To date, the epidemic situation remains complex and difficult to control, causing severe panic and substantial economic losses to the swine industry[ 7 , 8 ]. ASFV belongs to the Asfarviridae family and is a double-stranded DNA virus[ 9 , 10 ]. Its genome is approximately 170–190 kb in length, containing 150–167 open reading frames (ORFs), and the viral particles have a diameter ranging from 175 to 215 nm[ 11 , 12 ]. Currently, the main approaches to combat ASF include vaccines and drugs. Developed ASFV vaccines include inactivated vaccines[ 13 ], live-attenuated vaccines[ 14 ], nucleic acid vaccines[ 15 ], and subunit vaccines[ 16 ] and so on[ 17 ]. However, vaccine development remains challenging because of the large genome, large ORF number, and high variability of this virus [ 18 ]. In addition to vaccines, antiviral drugs are also important strategies for preventing and controlling ASFV replication. Chemical synthetic drugs such as GS-441524[ 19 ], and Cidofovir (cHPMPC)[ 20 ] have been used to inhibit ASFV replication. Natural products, widely present in plants and animals, have attracted extensive attention in recent years due to the antiviral effects of their compounds and metabolites. Studies have demonstrated that: Apigenin[ 21 ], Kaempferol[ 22 ] and Deoxycholic acid[ 23 ] can inhibit replication of ASFV by hindering viral DNA replication and protein synthesis, inducing autophagy and suppressing the MAPK signaling pathway. Chloroquine phosphate (CQP) is the most commonly used antimalarial drug in clinical practice[ 24 ]. Owing to its immunomodulatory properties, it has also been widely used in the treatment of autoimmune diseases such as systemic lupus erythematosus(SLE)[ 25 ] and rheumatoid arthritis (RA)[ 26 , 27 ]. With in-depth research, an increasing number of reports have indicated that CQP also possesses broad-spectrum antiviral activity. During the COVID-19 pandemic, CQP showed significant inhibitory effects on SARS-CoV-2 in vitro and exhibited a high selectivity index[ 28 ]. In addition, this drug (including Chloroquine analog ) can inhibit viruses such as influenza virus[ 29 ], dengue virus[ 30 ], Ebola virus (EBOV)[ 31 ], and human immunodeficiency virus (HIV)[ 32 ]. However, the inhibitory effect of CQP on ASFV and the underlying mechanisms remain unclear. Thus, this study aimed to investigate the inhibitory effect of CQP on ASFV and elucidate the underlying mechanisms. Our work provides novel insights into the prevention and control of ASFV. Materials and methods Cells and virus Primary porcine alveolar macrophages (PAMs) were obtained from the alveoli of 30-day-old healthy piglets. The piglets were euthanised via Zoletil®50 (Virbac, France) overdose for lung collection. After the aseptic collection of cells, erythrocytes were removed using erythrocyte lysate (Biosharp, China) and then centrifuged at a low speed. The supernatant was discarded, and the cell precipitates were resuspended in RPMI1640 (Sigma, USA) complete medium containing 10% fetal bovine serum (FBS , LONSERA, China) and cultured in an incubator at 37℃ with 5% CO2. All animal experiments were approved by the Scientific Ethics Committee of Huazhong Agricultural University and conducted strictly in accordance with the Guidelines for the Welfare and Use of Laboratory Animals formulated by this committee (Approval Number: HZAUSW-202503300001). The ASFV SY-1 (GenBank accession number: OM161110) strain was propagated in PAMs for amplification and stored at −80°C until use. All operations involving infection of SY-1 were carried out exclusively in the Animal Biosafety Level 3 Laboratory of Huazhong Agricultural University. Cell viability assay Cell counting kit-8 (CCK-8) (Abbkine, China) was used to detect the cytotoxicity of CQP (MCE, USA) against PAMs. The CQP stock solution was prepared by ultrapure water to a final storage concentration of 50 mM. Different concentrations (1.625, 3.125, 6.25, 12.5, 25, 50, 100, and 200μM) of CQP were added to PAMs and incubated at 37°C and 5% CO2 for 48 h. Subsequently, 10 μL of the CCK-8 reagent was added to each well and incubated for another 1 h. The absorbance was measured at 450 nm using a microplate reader (Thermo Fisher Scientific, USA). GraphPad Prism 8.0 (GraphPad Software, CA) was used to calculate 50 % cytotoxic concentration (CC 50 ). Detection of virus loading Quantitative polymerase chain reaction (qPCR) was performed to calculate the copy number of ASFV genomic DNA from supernatants or cells. In brief, ASFV genomic DNA was extracted using the FastPure Viral DNA/RNA Mini Kit (Vazyme, China). The reaction system for qPCR contained 2 µL of FAM-BHQ1 labelled probe (CCACGGGAGGAATACCAACCCAGTG), 2 µL of PerfectStart II Probe qPCR Supermix UDG (TransGen Biotech, China), 5 µL of template DNA, and 11 µL of nuclease-free water. qPCR was performed on a QuantStudio™ 6 Flex (Applied Biosystems, USA). The amplified conditions were as follows: 57°C for 5 min; 94°C for 5 min; then 94°C for 5 s and 57°C for 30 s, 40 cycles. Reverse transcription PCR (RT-PCR) Total cellular RNA was extracted using the TransZol Up Plus RNA Kit (TransGen Biotech, China). Subsequently, the extracted RNA was reverse-transcribed into complementary DNA (cDNA) using the HiScript III All-in-one RT SuperMix Perfect for qPCR (Vazyme, China). The reverse transcription reaction system was composed as follows: 4 μL of 5× All-in-one qRT SuperMix, 1 μL of Enzyme Mix, 1–2 μg of RNA template, and nuclease-free water to make up the final volume. The thermal cycling program was set as: 50°C for 15 min; 85°C for 5 s; and a final hold at 4°C. The RT-qPCR was performed on a QuantStudio™ 6 Flex (Applied Biosystems, USA) and calculations were performed using 2 - △△ Ct by GAPDH was used as an endogenous negative control. The primer sequences were used in this study are listed in Table 1. Table 1: The primer sequences Sus GAPDH-F ACATGGCCTCCAAGGAGTAAGA Sus GAPDH-R GATCGAGTTGGGGCTGTGACT ASFV P30-F ATTCTTCTTGAGCCTGATG ASFV P30-R GGTAGCCTGTATAATTGGTT Sus IL-1β-F AGTCTGCCCTGTACCCCAACT Sus IL-1β-R ATCTTGGCGGCCTTTGGAGTT Sus TNF-α-F CCAATGGCAGAGTGGGTATG Sus TNF-α-R TGAAGAGGACCTGGGAGTAG HAD 50 assay HAD 50 experiments were performed to verify the effect of CQP on viral particles. PAMs were spread into 96-well plates, and then the virus solution was diluted into 10 -1 –10 -10 dilutions, each containing eight replicates, through 10-fold dilution. The virus dilution was added to the cell culture wells containing PAMs and then incubated for 2 days. Subsequently, 1% porcine erythrocytes were added to the 96-cell culture plates and incubated for 2–3 days. Erythrocyte adsorption was observed under a fluorescence microscope. Finally, HAD 50 was calculated using the Reed–Muench method. Transcriptome sequencing PAMs were first divided into two primary groups: no ASFV infection and ASFV-infected (MOI = 0.1). Each primary group was further split into CQP-treated (experimental) and water-treated (control) subgroups. Cell samples were collected at 0 (no ASFV infection), 24, and 48 h post-infection (hpi). Total RNA was extracted for high-throughput RNA sequencing. Raw reads were first filtered via BGI’s SOAPnuke (removing adaptor-contaminated reads, those with >5% unknown nucleotides, and low-quality reads) and then aligned to the Sus scrofa reference genome (Sscrofa11.1). Subsequently, differential expression analysis was performed to screen for differentially expressed genes (DEGs) in each treatment group, with the criteria of |Fold-change| > 1 and Q-value ≤ 0.05. BGI’s Dr. Tom multi-omics data mining system (https://www.bgi.com/global/service/dr-tom), clustering heatmaps, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis were carried out for the DEGs, and the analysis results were visualised. Western blot The samples were carried out the SDS-PAGE gel, and transfer the bands to polyvinylidene fluoride ( PVDF) membranes. The membranes were blocked with 1% bovine serum albumin (BSA) and incubated overnight with p38 MAPK (CST, #8690), p-p38 MAPK (CST, #4511), ERK1/2 (Abmart, T40071S), p-ETK1/2 (Abmart, T40072S), P30 (this antibody was stored in our laboratory), β-action (Proteintech, Catalog No. 66009-1-Ig) and GAPDH (Proteintech, Catalog No. 60004-1-Ig) antibodies at 4°C and washed with 0.5% PBST. Finally, the membranes were incubated with the corresponding rabbit and mouse secondary antibodies. Indirect immunofluorescence assay (IFA) The amount and strength of fluorescence were measured using IFA to observe the effect of CQP on virus replication. PAMs were spread in 12 well plates, infected with ASFV at 0.1 MOI for 2 h, and then treated with different concentrations of CQP for 48 h. The cells were fixed with 4% (w/v), permeabilised with 0.1% (v/v) Triton X-100, and blocked with 2% (w/v) BSA. The primary antibody against ASFV P30 protein were incubated for 2 h. Next, the CoraLite594-conjugated goat anti-rabbit IgG (H+L) secondary antibody (Proteintech, Catalog No. SA00013-4) were incubated at RT for 1 h in the dark. Nuclei were counterstained with 4’,6-diamidino-2-phenylindole solution (1:1000 dilution in PBS) at RT for 10 min in the dark. Finally, the fluorescence was observed under a fluorescence microscope, photographed, and recorded. Time-course inhibition test For the pre-treatment experiment, PAMs were incubated with CQP at 37°C for 2 h, infected with ASFV at 0.1 MOI for 2 h, washed twice with PBS, and then added with the medium for 48 h. For the co-treatment assay, PAMs were infected with ASFV at 0.1 MOI and then treated with CQP at a final concentration of 12.5 µM for 2 h. The cells were washed with sterile PBS and then added with normal fresh medium containing 5% FBS. For the post-treatment assay, the cells were first infected with ASFV for 2 h and then treated with CQP at a final concentration of 12.5 µM for 48 h. Supernatants from all three treatments were collected to detect viral copy number, and the cells were used to detect P30 protein levels. PAMs were inoculated with ASFV at 0.1 MOI for 2 h, and 12.5 µM CQP was added to different wells at distinct time points (0, 3, 6, 9, 12, 15, or 18 h post medium addition) for 3 h. For the negative control group, the cells were treated identically but without CQP supplementation. All groups of cells were further cultured at 37°C for 48 h, after which qPCR analysis and western blot were performed to assess viral replication. Statistical analysis All data were from at least two independent experiments (each measured in triplicate) and presented as mean ± standard deviation (SD). Student’s t-test or one-way ANOVA was used for statistical significance analysis via GraphPad Prism 8.0 (P < 0.05). Specific details are in corresponding figure legends. Results Effect of CQP treatment on PAM activity CQP (Figure 1A) exerts anti-viral activity against many viruses, but its inhibitory effect on type II ASFV remains unclear. Therefore, we tested the effect of CQP on ASFV. CCK-8 results revealed that different concentrations of CQP exerted toxic effects on PAMs. Treatment with 25 μM CQP decreased cell viability to below 80% (Figure 1B). The 50% cytotoxic concentration (CC50) of CQP was 52.97 μM (Figure 1C). CQP inhibits the replication of ASFV Based on the maximum safe concentration of CQP, PAMs were infected with ASFV at MOI=0.1 for 2h and incubated with different concentrations (25, 12.5, 6.25, 3.125, and 1.625μM) of CQP for 48h. The supernatants were used to test the viral copies via qPCR and cells were used to visualize the amount of virus fluorescence by fluorescence microscope. The result of qPCR showed that with concentration increase, the viral copies became lower and lower (Figure 2A). Notably, the inhibition rate of viral replication was dose-dependent at low concentrations but flat at 25, 12.5 and 6.25μM, with an EC 50 of 2.300μM, as calculated using the GraphPad Prism software (Figure 2B, 2C). Meanwhile, IFA results showed that viral fluorescence decreased with increasing drug concentration (Figure 2D). CQP sustainably inhibited ASFV replication in vitro To validate the effect of CQP on the replication cycle of ASFV, we infected PAMs with ASFV for 2 h and then treated them with 12.5μMCQP for 24, 48, and 72 h. The supernatants and cells were used to detect the viral copies, HAD 50 , P30 at the mRNA and protein levels. The results of qPCR and HAD 50 showed that CQP treatment inhibited ASFV replication in different times (Figure 3A, 3B), and we could more intuitively observe that CQP can inhibit rosette formation production compared with control when the HAD 50 assay was preformed (Figure 3C). CQP treatment inhibited ASFV replication by decreasing the mRNA and protein levels of P30 (Figure 3E, 3F). These results indicate that CQP has an anti-ASFV activity in vitro. CQP inhibited ASFV replication in the late stage of infection Time-of-addition assays with different treatment modes were designed and performed to explore the time of action of CQP on ASFV (Figure 4A). The results of qPCR and western blot showed that CQP did not exert obvious inhibitory effect during co-incubation but had significant effects on post-treatment (Figure 4B, 4C). To further investigate which stage of the post-treatment was important, we added CQP to the PAM cells after infected with ASFV for 3h as the different treatment modes (Figure 4D). The results of qPCR and western blot showed that CQP acted mainly at 6 h during ASFV infection (Figure 4E, 4F). To assess the effect of CQP on viral adsorption and entry, we performed qPCR analysis, which revealed no significant impact on either process (Supplementary Figure 1A, 1B). The above results suggested that CQP exerts its anti-viral function mainly at the late stage of ASFV infection. Transcriptomic analysis of PAMs infected with ASFV of CQP treatment To further investigate the role of CQP in combating ASFV, we performed transcriptome sequencing to analyze the underlying mechanisms. PAMs were infected with ASFV at 0.1 MOI, and samples were collected at 0 h (no infection), 24 hpi, and 48 hpi for sequencing. DEGs were defined as those with p 1, as detailed in Supplementary Table 1, Supplementary Table 2, Supplementary Table 3. Compared with the control group, the CQP group had 96 downregulated and 25 upregulated genes at 0 h, 93 downregulated and 25 upregulated genes at 24 hpi, and 86 downregulated and 11 upregulated genes at 48 hpi (Figure 3 A, C, E). Subsequently, KEGG pathway enrichment analysis was conducted on these DEGs at the three time points. At 0 hpi, the DEGs were significantly enriched in pathways including cytokine–cytokine receptor interaction, Toll-like receptor signaling pathway, chemokine signaling pathway, JAK-STAT signaling pathway, tumour necrosis factor (TNF) signaling pathway, and IL-17 signaling pathway (Figure 3B). At 24 hpi, the DEGs were significantly enriched in the TNF signaling pathway, cytokine–cytokine receptor interaction, IL-17 signaling pathway, PPRA signaling pathway, Toll-like receptor signaling pathway, and NF-kappa B signaling pathway (Figure 3D). At 48 hpi, the DEGs were mainly enriched in the cytokine–cytokine receptor interaction, Toll-like receptor signaling pathway, chemokine signaling pathway, PPRA signaling pathway, IL-17 signaling pathway, NF-kappa B signaling pathway, and TNF signaling pathway (Figure 3F). These results indicated that CQP primarily focused on the chemokine signaling pathway, TNF signaling pathway, Toll-like receptor signaling pathway, and IL-17 signaling pathway at 0 h, 24 hpi, and 48 hpi. We found that these signaling pathways are associated with the MAPK pathway by cross-referencing the KEGG Pathway Enrichment Analysis website (KEGG PATHWAY Database) (Figure 3H), suggesting that the MAPK signaling pathway is a key target of CQP. CQP inhibited ASFV by regulating the MAPK-ERK signaling pathway To further confirm that CQP exerts its effects through the MAPK pathway[23], we examined key proteins in the MAPK signaling pathway through western blot. The MAPK signaling pathway mainly included P38, ERK, and JNK[33]. However, we did not find suitable anti-JNK or anti-p-JNK antibodies for PAMs. The results demonstrated that CQP significantly suppressed ERK phosphorylation, with no notable effects on other MAPK proteins, including P38 expression and P38 phosphorylation (Figure 6A-C). To further verify this finding, we treated cells with 10µM C16-PAF (MAPK agonist)[33]. Treatment with the agonist alone significantly elevated ERK phosphorylation, whereas co-treatment with CQP and the agonist decreased ERK phosphorylation and ERK phosphorylation was significantly elevated (Figure 6D-F). These results confirm that CQP indeed exerts its functions via the MAPK-ERK signaling pathway. Considering that the MAPK signaling pathway is a critical mediator of inflammation[34–36], we subsequently quantified the mRNA levels of IL1β and TNF-α using RT-qPCR. The results indicated that CQP treatment significantly downregulated the levels of IL-1β (Figure 6G) and TNF-α (Figure 6H). When the cells were treated with the agonist alone, the levels of IL-1β and TNF-α were significantly increased. In contrast, when the cells were co-treated with CQP and C16-PAF, the mRNA levels of IL-1β (Figure 6I) and TNF-α (Figure 6J) were reduced. Collectively, these findings demonstrate that CQP exerts its antiviral activity by suppressing the MAPK-ERK signaling pathway. Discussion ASF has inflicted substantial economic losses on the global swine industry since its outbreak, and there are currently no commercial vaccines available for effective prevention and control of the disease[37, 38]. Given the difficult progress in vaccine development, drug-based prevention and treatment have become a key focus of current research. Various compounds have been identified to inhibit ASFV replication. For example, luteolin restricts viral proliferation by regulating the NF-κB/STAT3/ATF6 signaling pathway[39], dihydromyricetin inhibits ASFV by downregulating TLR4-mediated pyroptosis[40], and rhein suppresses viral replication via activating the caspase-dependent mitochondrial apoptotic pathway[41] and so on. In the present study, we confirmed that CQP can significantly inhibit ASFV replication. Previously, Geraldes and Valdeira et al. reported that CQ exerts an inhibitory effect on the genotype I strain BAV17[42]. We further extended this finding by demonstrating that CQP is also effective against the genotype II strain SY-1, suggesting that it possesses anti-viral potential against multiple ASFV subtypes. Through transcriptomic analysis, we found that CQP possibly exerts its antiviral function by inhibiting the MAPK-ERK signaling pathway and we hypothesize that CQP is also capable of inhibiting inflammatory responses via the MAPK-ERK signaling pathway (Figure 6G-J). However, we have not yet verified the direct causal link between changes in IL-1β/TNF-α levels and ASFV replication—for instance, through experiments involving the exogenous supplementation of IL-1β/TNF-α. Thus, whether CQP truly suppresses virus-induced inflammation by targeting this pathway still requires further investigation. This mechanism differs from the report of Geraldes and Valdeira (1985) that CQ prevents ASFV from uncoating in acidic vesicles, causing its retention in lysosomal-like vacuoles. This difference suggests that CQP has multi-target anti-viral properties. And the selection index (SI = CC₅₀/EC₅₀) of CQP was approximately 23, which is far higher than the safety threshold for clinical use (SI > 10). This suggests that CQP could be administered via oral or injectable routes for emergency prevention and control of ASFV, with reference to its clinical dosage for antimalarial treatment. Future studies should verify in vivo efficacy through pig challenge experiments, thereby providing a dosage basis for its application in veterinary clinical practice. Beyond regulating host response, some drugs can also directly target viral proteins. For instance, arctiin specifically binds to the ATP-binding domain of the viral topoisomerase P1192R to exerts its antiviral effect[43], stilbene derivatives (SD1 and SD4) inhibit replication by interfering with the binding of the viral protein pA104R to DNA[44]. Drawing on this, we adopted the method established by Lv et al.[43] and initially screened eight viral proteins that may interact with CQP compared with control, as showed in Supplementary Table 4 and Supplementary Table 5, using native electrophoresis combined with chromatography-mass spectrometry/mass spectrometry (LC-MS/MS) (Supplementary Figure 2A). We used the molecular docking simulations to analyze the docking score (Supplementary Figure 2B) and potential binding site (Supplementary Figure 2C) between these proteins and CQP, and speculated that CQP also may regulate ASFV replication by interacting with viral protein. However, these interactions still require further verification through experiments such as bio-layer interferometry. In summary, this study provides a new perspective and experimental basis for the development of ASFV-targeting drugs, with particular emphasis on the potential of CQP as a multi-mechanism antiviral agent. Future research should further clarify its targets and molecular mechanisms, laying a theoretical foundation for promoting the effective prevention and control of ASF. Declarations Author Contributions HM conceived and designed the experiments and was a major contributor in writing the manuscript. HM and YW performed the data. WZ, KZ, ZS, LW, and XS provided the reagents. CC and SF carried out the transcriptome analysis. XH, QZ, ZZ and YZ analyzed the results. MJ provided the experimental platform and ideas. All authors contributed to the manuscript and approved the submitted version. Disclosure statement The authors have no conflicts of interest. Data availability statement Data are openly available publicly: the sequencing data generated in this study have been deposited in the NCBI Sequence Read Archive (SRA) under the accession number PRJNA1322095. Correspondence and requests for materials cloud be addressed to Meilin Jin. Acknowledgments We appreciate all members of the (ABSL-3) laboratory of Huazhong Agricultural University for their involvement in the study. Funding This work was supported by the 2025 Hubei Provincial Natural Science Foundation Project: 2025AFB157 References Gallardo MC, Reoyo A de la T, Fernández-Pinero J, et al (2015) African swine fever: a global view of the current challenge. Porcine Health Management 1:21. https://doi.org/10.1186/s40813-015-0013-y Sánchez-Cordón PJ, Montoya M, Reis AL, Dixon LK (2018) African swine fever: A re-emerging viral disease threatening the global pig industry. Vet J 233:41–48. https://doi.org/10.1016/j.tvjl.2017.12.025 Qu H, Ge S, Zhang Y, et al (2022) A systematic review of genotypes and serogroups of African swine fever virus. Virus Genes 58:77–87. https://doi.org/10.1007/s11262-021-01879-0 Cwynar P, Stojkov J, Wlazlak K (2019) African Swine Fever Status in Europe. Viruses 11:310. https://doi.org/10.3390/v11040310 Mulumba-Mfumu LK, Saegerman C, Dixon LK, et al (2019) African swine fever: Update on Eastern, Central and Southern Africa. Transbound Emerg Dis 66:1462–1480. https://doi.org/10.1111/tbed.13187 Zhou X, Li N, Luo Y, et al (2018) Emergence of African Swine Fever in China, 2018. Transbound Emerg Dis 65:1482–1484. https://doi.org/10.1111/tbed.12989 Wu K, Liu J, Wang L, et al (2020) Current State of Global African Swine Fever Vaccine Development under the Prevalence and Transmission of ASF in China. Vaccines (Basel) 8:531. https://doi.org/10.3390/vaccines8030531 Ruedas-Torres I, Thi To Nga B, Salguero FJ (2024) Pathogenicity and virulence of African swine fever virus. Virulence 15:2375550. https://doi.org/10.1080/21505594.2024.2375550 Iyer LM, Balaji S, Koonin EV, Aravind L (2006) Evolutionary genomics of nucleo-cytoplasmic large DNA viruses. Virus Res 117:156–184. https://doi.org/10.1016/j.virusres.2006.01.009 Gaudreault NN, Madden DW, Wilson WC, et al (2020) African Swine Fever Virus: An Emerging DNA Arbovirus. Front Vet Sci 7:. https://doi.org/10.3389/fvets.2020.00215 Chapman DAG, Tcherepanov V, Upton C, Dixon LK (2008) Comparison of the genome sequences of non-pathogenic and pathogenic African swine fever virus isolates. J Gen Virol 89:397–408. https://doi.org/10.1099/vir.0.83343-0 Rajko-Nenow P, Batten C (2022) Genotyping of African Swine Fever Virus. Methods Mol Biol 2503:119–132. https://doi.org/10.1007/978-1-0716-2333-6_8 Blome S, Gabriel C, Beer M (2014) Modern adjuvants do not enhance the efficacy of an inactivated African swine fever virus vaccine preparation. Vaccine 32:3879–3882. https://doi.org/10.1016/j.vaccine.2014.05.051 Chen W, Zhao D, He X, et al (2020) A seven-gene-deleted African swine fever virus is safe and effective as a live attenuated vaccine in pigs. Sci China Life Sci 63:623–634. https://doi.org/10.1007/s11427-020-1657-9 Yuan F, Cui J, Wang T, et al (2025) Selection, Design, and Immunogenicity Studies of ASFV Antigens for Subunit mRNA Cocktail Vaccines with Specific Immune Response Profiles. ACS Infect Dis 11:1907–1921. https://doi.org/10.1021/acsinfecdis.5c00029 Lopera-Madrid J, Medina-Magües LG, Gladue DP, et al (2021) Optimization in the expression of ASFV proteins for the development of subunit vaccines using poxviruses as delivery vectors. Sci Rep 11:23476. https://doi.org/10.1038/s41598-021-02949-x Zhang Y, Mei X, Zhang C, et al (2024) ASFV subunit vaccines: Strategies and prospects for future development. Microbial Pathogenesis 197:107063. https://doi.org/10.1016/j.micpath.2024.107063 Chandana MS, Nair SS, Chaturvedi VK, et al (2024) Recent progress and major gaps in the vaccine development for African swine fever. Braz J Microbiol 55:997–1010. https://doi.org/10.1007/s42770-024-01264-7 Huang Z, Gong L, Zheng Z, et al (2021) GS-441524 inhibits African swine fever virus infection in vitro. Antiviral Res 191:105081. https://doi.org/10.1016/j.antiviral.2021.105081 Goulding LV, Kiss E, Goatley L, et al (2022) In vitro and in vivo antiviral activity of nucleoside analogue cHPMPC against African swine fever virus replication. Antiviral Res 208:105433. https://doi.org/10.1016/j.antiviral.2022.105433 Hakobyan A, Arabyan E, Avetisyan A, et al (2016) Apigenin inhibits African swine fever virus infection in vitro. Arch Virol 161:3445–3453. https://doi.org/10.1007/s00705-016-3061-y Arabyan E, Hakobyan A, Hakobyan T, et al (2021) Flavonoid Library Screening Reveals Kaempferol as a Potential Antiviral Agent Against African Swine Fever Virus. Front Microbiol 12:736780. https://doi.org/10.3389/fmicb.2021.736780 Gao Q, Xu Y, Feng Y, et al (2024) Deoxycholic acid inhibits ASFV replication by inhibiting MAPK signaling pathway. International Journal of Biological Macromolecules 266:130939. https://doi.org/10.1016/j.ijbiomac.2024.130939 Scherbel AL, Schuchter SL, Harrison JW (1957) Comparison of effects of two antimalarial agents, hydroxychloroquine sulfate and chloroquine phosphate, in patients with rheumatoid arthitis. Cleve Clin Q 24:98–104. https://doi.org/10.3949/ccjm.24.2.98 Wozniacka A, Lesiak A, Narbutt J, et al (2006) Chloroquine treatment influences proinflammatory cytokine levels in systemic lupus erythematosus patients. Lupus 15:268–275. https://doi.org/10.1191/0961203306lu2299oa Young JP (1959) Chloroquine phosphate (Aralen) in the long-term treatment of rheumatoid arthritis. Ann Intern Med 51:1159–1178. https://doi.org/10.7326/0003-4819-51-6-1159 Panayi GS, Neill WA, Duthie JJ, McCormick JN (1973) Action of chloroquine phosphate in rheumatoid arthritis. 1. Immunosuppressive effect. Ann Rheum Dis 32:316–318. https://doi.org/10.1136/ard.32.4.316 Mo L, Zheng P (2020) [Chloroquine phosphate: therapeutic drug for COVID-19]. Nan Fang Yi Ke Da Xue Xue Bao 40:586–594. https://doi.org/10.12122/j.issn.1673-4254.2020.04.22 Paton NI, Lee L, Xu Y, et al (2011) Chloroquine for influenza prevention: a randomised, double-blind, placebo controlled trial. Lancet Infect Dis 11:677–683. https://doi.org/10.1016/S1473-3099(11)70065-2 Jayasekara KG, Suresh S, Goonasekara C, et al (2024) Anti-dengue viral activity of Glycyrrhiza glabra roots in Vero cells. Sci Rep 14:25922. https://doi.org/10.1038/s41598-024-76184-5 Dowall SD, Bosworth A, Watson R, et al (2015) Chloroquine inhibited Ebola virus replication in vitro but failed to protect against infection and disease in the in vivo guinea pig model. J Gen Virol 96:3484–3492. https://doi.org/10.1099/jgv.0.000309 Romanelli F, Smith KM, Hoven AD (2004) Chloroquine and hydroxychloroquine as inhibitors of human immunodeficiency virus (HIV-1) activity. Curr Pharm Des 10:2643–2648. https://doi.org/10.2174/1381612043383791 Yang Q, Guo H, Li H, et al (2025) The CXCL8/MAPK/hnRNP-K axis enables susceptibility to infection by EV-D68, rhinovirus, and influenza virus in vitro. Nat Commun 16:1715. https://doi.org/10.1038/s41467-025-57094-0 Ma J-Q, Ding J, Zhang L, Liu C-M (2014) Ursolic acid protects mouse liver against CCl4-induced oxidative stress and inflammation by the MAPK/NF-κB pathway. Environ Toxicol Pharmacol 37:975–983. https://doi.org/10.1016/j.etap.2014.03.011 Liu J, Xu Y, Wu Q, et al (2018) Sirtuin‑1 protects hair follicle stem cells from TNFα-mediated inflammatory stress via activating the MAPK-ERK-Mfn2 pathway. Life Sci 212:213–224. https://doi.org/10.1016/j.lfs.2018.10.003 Wang Y, Han D, Huang Y, et al (2024) Oral administration of punicalagin attenuates imiquimod-induced psoriasis by reducing ROS generation and inflammation via MAPK/ERK and NF-κB signaling pathways. Phytotherapy Research 38:713–726. https://doi.org/10.1002/ptr.8071 Gogin A, Gerasimov V, Malogolovkin A, Kolbasov D (2013) African swine fever in the North Caucasus region and the Russian Federation in years 2007-2012. Virus Res 173:198–203. https://doi.org/10.1016/j.virusres.2012.12.007 Rahimi P, Sohrabi A, Ashrafihelan J, et al Emergence of African Swine Fever Virus, Northwestern Iran - Volume 16, Number 12—December 2010 - Emerging Infectious Diseases journal - CDC. https://doi.org/10.3201/eid1612.100378 Chen Y, Guo Y, Song Z, et al (2022) Luteolin restricts ASFV replication by regulating the NF-κB/STAT3/ATF6 signaling pathway. Vet Microbiol 273:109527. https://doi.org/10.1016/j.vetmic.2022.109527 Chen Y, Song Z, Chang H, et al (2023) Dihydromyricetin inhibits African swine fever virus replication by downregulating toll-like receptor 4-dependent pyroptosis in vitro. Vet Res 54:58. https://doi.org/10.1186/s13567-023-01184-8 Song Z, Chen Y, Chang H, et al (2023) Rhein suppresses African swine fever virus replication in vitro via activating the caspase-dependent mitochondrial apoptosis pathway. Virus Res 338:199238. https://doi.org/10.1016/j.virusres.2023.199238 Geraldes A, Valdeira ML (1985) Effect of chloroquine on African swine fever virus infection. J Gen Virol 66 (Pt 5):1145–1148. https://doi.org/10.1099/0022-1317-66-5-1145 Lv C, Yang J, Zhao L, et al (2023) Bacillus subtilis partially inhibits African swine fever virus infection in vivo and in vitro based on its metabolites arctiin and genistein interfering with the function of viral topoisomerase II. J Virol 97: e0071923. https://doi.org/10.1128/jvi.00719-23 Liu R, Sun Y, Chai Y, et al (2020) The structural basis of African swine fever virus pA104R binding to DNA and its inhibition by stilbene derivatives. Proc Natl Acad Sci U S A 117:11000–11009. https://doi.org/10.1073/pnas.1922523117 Additional Declarations No competing interests reported. Supplementary Files SupplementaryTable1.xlsx SupplementaryTable2.xlsx SupplementaryTable2.xlsx SupplementaryTable3.xlsx SupplementaryTable4.xlsx SupplementaryTable5.xlsx SupplementaryMaterial.docx Rawdata.zip Cite Share Download PDF Status: Published Journal Publication published 26 Feb, 2026 Read the published version in Virology Journal → Version 1 posted Editorial decision: Revision requested 25 Nov, 2025 Reviews received at journal 24 Nov, 2025 Reviews received at journal 23 Nov, 2025 Reviewers agreed at journal 12 Nov, 2025 Reviewers agreed at journal 12 Nov, 2025 Reviewers agreed at journal 12 Nov, 2025 Reviewers invited by journal 12 Nov, 2025 Editor assigned by journal 06 Nov, 2025 Submission checks completed at journal 06 Nov, 2025 First submitted to journal 04 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8029940","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":549471897,"identity":"0a390e16-af0f-478a-9e9b-848116ca8d74","order_by":0,"name":"Haiying Mao","email":"","orcid":"","institution":"National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Haiying","middleName":"","lastName":"Mao","suffix":""},{"id":549471901,"identity":"764e39da-e3db-4b2a-8a7d-bb9fb499b758","order_by":1,"name":"Yong Wang","email":"","orcid":"","institution":"National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Wang","suffix":""},{"id":549471904,"identity":"49eac7f2-22b1-4d81-8656-d1222403acf1","order_by":2,"name":"Ke Zhang","email":"","orcid":"","institution":"National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Ke","middleName":"","lastName":"Zhang","suffix":""},{"id":549471906,"identity":"ff416595-9edc-4c25-99a3-ca1bccd89856","order_by":3,"name":"Wenhui Zhou","email":"","orcid":"","institution":"National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Wenhui","middleName":"","lastName":"Zhou","suffix":""},{"id":549471907,"identity":"0eb57978-7a66-409a-8e0d-a262b66267ee","order_by":4,"name":"Chuxing Cheng","email":"","orcid":"","institution":"National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Chuxing","middleName":"","lastName":"Cheng","suffix":""},{"id":549471908,"identity":"361d30cd-4241-40d9-84a2-e74cebbced62","order_by":5,"name":"Shuo Fang","email":"","orcid":"","institution":"National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Shuo","middleName":"","lastName":"Fang","suffix":""},{"id":549471914,"identity":"130fbe1a-01e6-47be-a4e4-a60aebc09305","order_by":6,"name":"Lihao Wang","email":"","orcid":"","institution":"National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Lihao","middleName":"","lastName":"Wang","suffix":""},{"id":549471918,"identity":"d1086fd6-9286-4faa-a4db-478cddd928f2","order_by":7,"name":"Zhenrui Song","email":"","orcid":"","institution":"National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zhenrui","middleName":"","lastName":"Song","suffix":""},{"id":549471919,"identity":"7821cd03-d36b-46f4-96dc-c47085252c32","order_by":8,"name":"Xiaomei Sun","email":"","orcid":"","institution":"National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xiaomei","middleName":"","lastName":"Sun","suffix":""},{"id":549471920,"identity":"66043e6a-f090-48cb-943f-bf7af3b93e2b","order_by":9,"name":"Xiaotong Hu","email":"","orcid":"","institution":"National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xiaotong","middleName":"","lastName":"Hu","suffix":""},{"id":549471921,"identity":"24e4a161-906b-43d9-beca-0382bcba7220","order_by":10,"name":"Yuemei Zhang","email":"","orcid":"","institution":"National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yuemei","middleName":"","lastName":"Zhang","suffix":""},{"id":549471922,"identity":"9fdb820c-099f-4fe3-aef1-6373ca8447ad","order_by":11,"name":"Zong Zou","email":"","orcid":"","institution":"National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zong","middleName":"","lastName":"Zou","suffix":""},{"id":549471923,"identity":"0063dd7d-a3d0-4781-88ff-6b30b6e3a691","order_by":12,"name":"Qiang Zhang","email":"","orcid":"","institution":"National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Qiang","middleName":"","lastName":"Zhang","suffix":""},{"id":549471924,"identity":"8d0a7268-a7c0-4221-a5e9-457013fcc757","order_by":13,"name":"Ya Zhao","email":"","orcid":"","institution":"National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Ya","middleName":"","lastName":"Zhao","suffix":""},{"id":549471925,"identity":"64e9d368-59df-4def-b380-c5c549906d75","order_by":14,"name":"Meilin Jin","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABCUlEQVRIiWNgGAWjYBACxmYQaWDBw8DewMCQUMCQABFnI6hFgoeB5wBQiwERWqBAAohAionRwtzOe3TDhwIJGXPJ14kfHhgw5Mm3nzFg+FB2mIF/dgMOh/Gl3ZwBdJjl7NzNEkCHFTP25Bgwzjh3mEHizgEcWnjMbvMAtRjczt0A0pLYzJBjwMzbdhjowQTcWv6AtNw8u/kHSEsb/xsD5r+EtIBCzOAG7zawLT0SQFsYCWi52QPSciZ3m0WCgUTiDIlnBQd7zqXzSNzArsWw/4zZjR9/bOwNjp/dfPNHhU3i/P7kjQ9+lFnL8c/AoaUBlS8BJg8AMQ9W9UAgj0tiFIyCUTAKRgEcAAAOyFgKmCc0cQAAAABJRU5ErkJggg==","orcid":"","institution":"National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Meilin","middleName":"","lastName":"Jin","suffix":""}],"badges":[],"createdAt":"2025-11-04 14:23:43","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8029940/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8029940/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12985-026-03114-4","type":"published","date":"2026-02-26T15:57:49+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":96637275,"identity":"47f94fea-2558-4f4c-ad02-24c7b1da69ef","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1451654,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/b25b582c424525d67db470e9.tif"},{"id":96637276,"identity":"31047bd3-6554-4407-8520-4c16e9c6ca05","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":85887,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/dfc9b4ff0deb0040edf80887.docx"},{"id":96710487,"identity":"cc97194d-7ff7-4b7e-8b47-239fb224ddc9","added_by":"auto","created_at":"2025-11-25 10:10:43","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16774466,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/85886a04f42591548be4bdff.tif"},{"id":96637290,"identity":"d62f0767-b83d-47d9-8371-6bab87032246","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12193016,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.tif","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/b75a6792e66f312da98f336c.tif"},{"id":96637283,"identity":"439de9e4-30cd-4335-9737-0c7447a82d9a","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":28554,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/0d73405ee8537aac3fff957c.xlsx"},{"id":96709983,"identity":"ba69ee06-eb97-4d73-8069-428a8efd5c52","added_by":"auto","created_at":"2025-11-25 10:09:51","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":28129,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/217fe3d71e0fbac197251465.xlsx"},{"id":96637287,"identity":"2fe85864-1086-4ad6-9a38-c25e1f188ab0","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"xlsx","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":24565,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/cdaace81bba9a833672efb73.xlsx"},{"id":96709900,"identity":"0bc07fff-66ac-4a62-ab42-7319142afa49","added_by":"auto","created_at":"2025-11-25 10:09:46","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3037862,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.tif","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/4a00132afc667dcf89a4a174.tif"},{"id":96637293,"identity":"56fce6ef-5957-4c55-b844-7f4b7fe54c64","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"xlsx","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13422,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable4.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/7ddf5f4e6ebd7802e3dfaff7.xlsx"},{"id":96709108,"identity":"ad79fb8e-988d-49a9-80d6-59ad00982fdf","added_by":"auto","created_at":"2025-11-25 10:07:41","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4628222,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/c1aa6539d1f71f5dbf214229.tif"},{"id":96637294,"identity":"f40f29c4-30ed-42ae-b58b-b4281a7b870e","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"xlsx","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16632,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable5.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/3d265d42cd92a2aeb0e938f4.xlsx"},{"id":96709413,"identity":"2f85803e-abd9-4c50-be25-21b51165b986","added_by":"auto","created_at":"2025-11-25 10:09:00","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4653582,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.tif","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/c4be5c667bbabc5661b05929.tif"},{"id":96637292,"identity":"fcdc7b29-9ee8-4bea-86ab-2187167fdb34","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"json","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14223,"visible":true,"origin":"","legend":"","description":"","filename":"d4e56b5ac20946cc9074f7ae75c0aeb9.json","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/c7a7f73c6df1147bffc9ee49.json"},{"id":96637316,"identity":"1234797e-b96b-4940-b6d2-a816db74c394","added_by":"auto","created_at":"2025-11-24 13:46:11","extension":"zip","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":50134078,"visible":true,"origin":"","legend":"","description":"","filename":"Rawdatad1.zip","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/23e707919e30347b3fc66f1d.zip"},{"id":96709809,"identity":"80b788f2-4842-45de-a7df-37ecf449f050","added_by":"auto","created_at":"2025-11-25 10:09:42","extension":"docx","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":630995,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/9aa5120778af111127f504d1.docx"},{"id":96637291,"identity":"d1ff600f-1809-4923-8b7f-5e1f74f9c965","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"xml","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":110685,"visible":true,"origin":"","legend":"","description":"","filename":"d4e56b5ac20946cc9074f7ae75c0aeb91enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/de91b4fbab699a178238c6fe.xml"},{"id":96637298,"identity":"3657012d-788d-4d41-8ea0-db301bf65497","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"tif","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1451654,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/a919e556d7d732ccbc6244f1.tif"},{"id":96637310,"identity":"9cee3b3e-54eb-4220-a94d-8793cbe1199b","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"tif","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16774466,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/efd46100a82c9263eebfb565.tif"},{"id":96709645,"identity":"6fedb798-096c-480e-8c87-d5b7bb8526c6","added_by":"auto","created_at":"2025-11-25 10:09:28","extension":"tif","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12193016,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.tif","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/39d3a77bd50561b4784f8673.tif"},{"id":96709128,"identity":"d7716c99-b76a-4652-920d-2fc20c75ba2a","added_by":"auto","created_at":"2025-11-25 10:07:47","extension":"tif","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3037862,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.tif","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/11014c7c912bcf60b8ba1f37.tif"},{"id":96637304,"identity":"0cf8d0d1-229c-40a3-a924-d4f2219a7694","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"tif","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4628222,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/c1e81e5f4aa9167793f0c542.tif"},{"id":96709076,"identity":"3e76107a-876f-4829-a0f6-e9ccee3f1eb5","added_by":"auto","created_at":"2025-11-25 10:07:31","extension":"tif","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4653582,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.tif","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/d66920b3dc907f23d9552fe6.tif"},{"id":96709454,"identity":"7bff4707-24c4-4773-9e34-2ede39a4e8d2","added_by":"auto","created_at":"2025-11-25 10:09:02","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":113665,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/0bf23a2b0888d0f339c978d0.png"},{"id":96637314,"identity":"827cc796-5e91-4eb1-b8c0-47e7d0e334a6","added_by":"auto","created_at":"2025-11-24 13:46:11","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1471295,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/5938085637a52dbb04315201.png"},{"id":96709062,"identity":"705cc926-7e1e-4f4a-8cbf-b05e0e201d62","added_by":"auto","created_at":"2025-11-25 10:07:26","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1701287,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/08125cf0eb6c87cdda6bc5b4.png"},{"id":96637300,"identity":"313f935a-ef69-4eda-819c-1f9251c8ec4f","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":264737,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/3ae6b9b19e74e3734fc7f9b2.png"},{"id":96637301,"identity":"6ef12339-097c-46bf-879a-78dd2f1efb90","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":561381,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/51848f5ad79ed5cf3429179b.png"},{"id":96637303,"identity":"529a958d-306a-4e31-90ed-743a62871154","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"png","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":456301,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/bc47418b3e4470bc621d1daf.png"},{"id":96710509,"identity":"783f3c1c-040f-4a8e-9f46-09001f7bf03e","added_by":"auto","created_at":"2025-11-25 10:10:46","extension":"xml","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":109343,"visible":true,"origin":"","legend":"","description":"","filename":"d4e56b5ac20946cc9074f7ae75c0aeb91structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/0b66a02b96171cf1ff4b0ab6.xml"},{"id":96637313,"identity":"5074002a-4eab-4b7b-b11f-80ce5eda79b8","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"html","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":120477,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/14c7c5348f19dd30ba10bf39.html"},{"id":96710467,"identity":"a979c0df-89c1-4cf1-822a-2330165144ff","added_by":"auto","created_at":"2025-11-25 10:10:42","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3044352,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe effect of CQP on the activity of PAMs. (A)\u003c/strong\u003e The chemical structure of CQP. \u003cstrong\u003e(B)\u003c/strong\u003e CCK-8 assay was used to measure the cytotoxicity of CQP after CQP treatment for 48 h in PAMs. \u003cstrong\u003e(C)\u003c/strong\u003e CC\u003csub\u003e50\u003c/sub\u003e and its corresponding CC\u003csub\u003e50 \u003c/sub\u003ecurve were determined according to cell viability data using GraphPad Prism 8.0.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/81e11608d16fe8c2eaf6b015.png"},{"id":96710239,"identity":"705483c3-f2dc-47e2-a33e-89acacca18ff","added_by":"auto","created_at":"2025-11-25 10:10:20","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":61088301,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCQP inhibits the replication of ASFV. (A-D)\u003c/strong\u003e PAMs were infected with ASFV at MOI=0.1 for 2h and incubated with different concentrations (25, 12.5, 6.25, 3.125 and 1.625μM) of CQP for 48h, qPCR was used to measure the viral copies of supernatants\u003cstrong\u003e(A)\u003c/strong\u003e, the inhibition rate of CQP\u003cstrong\u003e(B)\u003c/strong\u003e and the EC\u003csub\u003e50\u003c/sub\u003e\u003cstrong\u003e(C)\u003c/strong\u003e was be calculated using the GraphPad Prism software, IFA was used to achieve visualization of the viral replication\u003cstrong\u003e(D)\u003c/strong\u003e. ***P \u0026lt; 0.001 and ****P \u0026lt; 0.0001\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/f3c65356f478edd7c43583c9.png"},{"id":96637299,"identity":"bd9ce9cf-d885-4313-9479-56da40172702","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":49799893,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCQP sustainably inhibited ASFV replication in vitro. (A-E)\u003c/strong\u003e PAMs were infected with ASFV at MOI=0.1 for 2 h. Thereafter, we discarded the supernatants and treated the cells with 12.5μM CQP for 24h, 48h and 72h. Supernatants were collected and performed qPCR \u003cstrong\u003e(A)\u003c/strong\u003e, HAD\u003csub\u003e50\u003c/sub\u003e \u003cstrong\u003e(B)\u003c/strong\u003e to detect the viral copies and virion, respectively. \u003cstrong\u003e(C)\u003c/strong\u003e Imaging rosettes formed by fluorescence microscope (the black arrows point to the rosettes formed by erythrocyte agglutination). The cells were used to assay the mRNA level and protein level of P30 by qRT-PCR\u003cstrong\u003e(D)\u003c/strong\u003e, and western blot\u003cstrong\u003e (E)\u003c/strong\u003e, respectively. Data were obtained from three independent experiments. ***P \u0026lt; 0.001 and ****P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/21c8b7b2419572b0e5b23c7f.png"},{"id":96637285,"identity":"25f89907-eff6-4faf-90a7-4d8b09ea8de3","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":7108898,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCQP inhibited ASFV replication in the late stage of infection.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eThe schematic diagram of before, during and after of CQP addition assays. \u003cstrong\u003e(B, C)\u003c/strong\u003ePAMs were treated with CQP pre-treatment, co-treatment, post-treatment infection with ASFV (MOI=0.1). The samples were further incubated for 48 h after ASFV infection, collected, and evaluated via qPCR\u003cstrong\u003e(B)\u003c/strong\u003e and western blotting \u003cstrong\u003e(C)\u003c/strong\u003e. \u003cstrong\u003e(D)\u003c/strong\u003e The schematic diagram of time-of-CQP addition assays. The PAMs were infected with ASFV at MOI=0.1 for 2h, and PAMs were treated with 12.5μM CQP at 0, 3, 6, 9, 12, 15 h and 18h and incubated for 3 h. All samples were collected after infection with ASFV for 48 h and analyzed using q-PCR assay\u003cstrong\u003e(E)\u003c/strong\u003e and western blotting\u003cstrong\u003e(F)\u003c/strong\u003e. ***P \u0026lt; 0.001 and ****P \u0026lt; 0.0001\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/fa5934aece7aeddd6dca1a88.png"},{"id":96637317,"identity":"11010371-088e-491a-9cfc-3767c0bdbca5","added_by":"auto","created_at":"2025-11-24 13:46:11","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":15683021,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscriptomic analysis of PAMs infected with ASFV of CQP treatment.\u003c/strong\u003e \u003cstrong\u003e(A, C, and\u003c/strong\u003e \u003cstrong\u003eE)\u003c/strong\u003e PAMs were infected with ASFV at MOI = 0.1. Volcanic map analysis of DEGs by transcriptomic sequencing compared with that in the control group at 0h, 24h and 48 h after infection. \u003cstrong\u003e(B, D, and F)\u003c/strong\u003e KEGG pathway enrichment analysis of DEGs compared with the control group at 0, 24, and 48 h after infection. \u003cstrong\u003e(G)\u003c/strong\u003e Analysis diagram of the chemokine signaling pathway, Toll-like receptor signaling pathway, TNF signaling pathway and IL-17 signaling pathway, respectively.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/3e27d8e22ecf1c6bc004689a.png"},{"id":96637296,"identity":"8be41590-5645-440c-a652-27c302a0b88a","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":22673770,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCQP inhibited ASFV by regulating the MAPK-ERK signaling pathway. (A-C and G, H) \u003c/strong\u003ePMAs were infected ASFV with MOI=0.1 for 2h, and the cells were treated with 12.5μM CQP or control for 0h, 24h and 48h.Western blotting was used to measure the expression of P38, P-P38, ERK1/2, P-ERK1/2, P30 proteins. β-actin expression was used as an internal control\u003cstrong\u003e(A)\u003c/strong\u003e, the intensities of relative phosphorylation of ERK1/2\u003cstrong\u003e(B)\u003c/strong\u003eand P38\u003cstrong\u003e(C) \u003c/strong\u003ewere determined using Image J, the mRNA level of IL-1β\u003cstrong\u003e(G)\u003c/strong\u003e,TNF-α\u003cstrong\u003e(H)\u003c/strong\u003e. \u003cstrong\u003e(D-F and I, J) \u003c/strong\u003eWestern blotting of the expression of P38, P-P38, ERK1/2, P-ERK1/2, P30 proteins after infection with ASFV for 2h, and were treated with 12.5μM CQP for 24h, with or without treatment with the MAPK-ERK pathway agonist C16-PAF. The intensities of relative phosphorylation of ERK1/2\u003cstrong\u003e(E)\u003c/strong\u003e and P38\u003cstrong\u003e(F)\u003c/strong\u003e were determined using Image J and the mRNA level of IL-1β\u003cstrong\u003e(I)\u003c/strong\u003e ,TNF-α\u003cstrong\u003e(J)\u003c/strong\u003e. **P \u0026lt; 0.01,\u003cstrong\u003e \u003c/strong\u003e***P \u0026lt; 0.001 and ****P \u0026lt; 0.0001\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/a5fa784194a423b674ef312d.png"},{"id":96637274,"identity":"b11579ee-0ba6-4950-8704-d2a7a2ff3184","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"xlsx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":28554,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/d6f506c64474f76756bec1db.xlsx"},{"id":96637279,"identity":"b3a1f434-286d-4d88-9e9f-b9919b2025b7","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":28129,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/9e7cbf94d20eee7ef4700840.xlsx"},{"id":96637278,"identity":"e32f6ce1-3838-4785-9bc5-a3fdbc4e71f7","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":28129,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/2c0722951f1858d519452e85.xlsx"},{"id":96709077,"identity":"0f26edef-2581-457b-8cd0-c745a10fe965","added_by":"auto","created_at":"2025-11-25 10:07:31","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":24565,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/7784167c09ffe85c27cf686d.xlsx"},{"id":96710460,"identity":"f4ee5136-6db0-497a-91e1-3625c6ad3b2b","added_by":"auto","created_at":"2025-11-25 10:10:41","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":13422,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable4.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/27487ad057672369d5b17d4d.xlsx"},{"id":96709410,"identity":"de895565-2f86-4f14-a35b-583060bdfa55","added_by":"auto","created_at":"2025-11-25 10:08:59","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":16632,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable5.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/92dc670441381907612ebcd1.xlsx"},{"id":96637288,"identity":"ced31bfb-f591-47e0-b86d-89bfab19b033","added_by":"auto","created_at":"2025-11-24 13:46:10","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":630995,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/97a4f18a493f809bc15e2c57.docx"},{"id":96637318,"identity":"cee54434-f3f9-4d36-b149-77933ed881ea","added_by":"auto","created_at":"2025-11-24 13:46:12","extension":"zip","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":50134078,"visible":true,"origin":"","legend":"","description":"","filename":"Rawdata.zip","url":"https://assets-eu.researchsquare.com/files/rs-8029940/v1/b69c86bf2a24e79a0406c14e.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"Chloroquine Phosphate Targets the MAPK-ERK Pathway to Inhibit ASFV SY- 1 Replication In Vitro","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAfrican swine fever (ASF) is a highly contagious and fatal infectious disease caused by the African swine fever virus (ASFV) and it can be transmitted through vectors such as soft ticks, or via contact with infected wild boars or domestic pigs[\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. First identified in Kenya in 1921(Eustace Montgomery 1921) and in 2017, ASF outbreaks were repeatedly reported in the Far East region of Russia[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. In 2018, ASF was first confirmed in Heilongjiang Province, China, followed by subsequent cases reported in provinces such as Henan, Jiangsu, and Zhejiang[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. To date, the epidemic situation remains complex and difficult to control, causing severe panic and substantial economic losses to the swine industry[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. ASFV belongs to the Asfarviridae family and is a double-stranded DNA virus[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Its genome is approximately 170\u0026ndash;190 kb in length, containing 150\u0026ndash;167 open reading frames (ORFs), and the viral particles have a diameter ranging from 175 to 215 nm[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eCurrently, the main approaches to combat ASF include vaccines and drugs. Developed ASFV vaccines include inactivated vaccines[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], live-attenuated vaccines[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], nucleic acid vaccines[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], and subunit vaccines[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] and so on[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. However, vaccine development remains challenging because of the large genome, large ORF number, and high variability of this virus [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In addition to vaccines, antiviral drugs are also important strategies for preventing and controlling ASFV replication. Chemical synthetic drugs such as GS-441524[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], and Cidofovir (cHPMPC)[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] have been used to inhibit ASFV replication. Natural products, widely present in plants and animals, have attracted extensive attention in recent years due to the antiviral effects of their compounds and metabolites. Studies have demonstrated that: Apigenin[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], Kaempferol[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] and Deoxycholic acid[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] can inhibit replication of ASFV by hindering viral DNA replication and protein synthesis, inducing autophagy and suppressing the MAPK signaling pathway.\u003c/p\u003e\u003cp\u003eChloroquine phosphate (CQP) is the most commonly used antimalarial drug in clinical practice[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Owing to its immunomodulatory properties, it has also been widely used in the treatment of autoimmune diseases such as systemic lupus erythematosus(SLE)[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] and rheumatoid arthritis (RA)[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. With in-depth research, an increasing number of reports have indicated that CQP also possesses broad-spectrum antiviral activity. During the COVID-19 pandemic, CQP showed significant inhibitory effects on SARS-CoV-2 in vitro and exhibited a high selectivity index[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In addition, this drug (including Chloroquine analog ) can inhibit viruses such as influenza virus[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], dengue virus[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], Ebola virus (EBOV)[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], and human immunodeficiency virus (HIV)[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eHowever, the inhibitory effect of CQP on ASFV and the underlying mechanisms remain unclear. Thus, this study aimed to investigate the inhibitory effect of CQP on ASFV and elucidate the underlying mechanisms. Our work provides novel insights into the prevention and control of ASFV.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cstrong\u003eCells and virus\u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrimary porcine alveolar macrophages (PAMs) were obtained from the alveoli of 30-day-old healthy piglets. The piglets were euthanised via Zoletil\u0026reg;50 (Virbac, France) overdose for lung collection. After the aseptic collection of cells, erythrocytes were removed using erythrocyte lysate (Biosharp, China) and then centrifuged at a low speed. The supernatant was discarded, and the cell precipitates were resuspended in RPMI1640 (Sigma, USA) complete medium containing 10% fetal bovine serum (FBS , LONSERA, China) and cultured in an incubator at 37℃\u0026nbsp;with 5% CO2. All animal experiments were approved by the Scientific Ethics Committee of Huazhong Agricultural University and conducted strictly in accordance with the Guidelines for the Welfare and Use of Laboratory Animals formulated by this committee (Approval Number: HZAUSW-202503300001).\u003c/p\u003e\n\u003cp\u003eThe ASFV SY-1 (GenBank accession number: OM161110) strain was propagated in PAMs for amplification and stored at \u0026minus;80\u0026deg;C until use. All operations involving infection of SY-1 were carried out exclusively in the Animal Biosafety Level 3 Laboratory of Huazhong Agricultural University.\u003cstrong\u003e\u0026nbsp;Cell viability assay\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell counting kit-8 (CCK-8) (Abbkine, China) was used to detect the cytotoxicity of CQP (MCE, USA)\u0026nbsp;against PAMs.\u0026nbsp;The CQP stock solution was prepared by ultrapure water to a final storage concentration of 50 mM. Different concentrations (1.625, 3.125, 6.25, 12.5, 25, 50, 100, and 200\u0026mu;M) of CQP were added to PAMs and incubated at 37\u0026deg;C and 5% CO2 for 48 h.\u0026nbsp;Subsequently, 10 \u0026mu;L of the CCK-8 reagent was added to each well and incubated for another 1 h. The absorbance was measured at 450 nm using a microplate reader (Thermo Fisher Scientific, USA). GraphPad Prism 8.0 (GraphPad Software, CA) was used to calculate 50 % cytotoxic concentration (CC\u003csub\u003e50\u003c/sub\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetection of virus loading\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQuantitative polymerase chain reaction (qPCR) was performed to calculate the copy number of ASFV genomic DNA from supernatants or cells. In brief, ASFV genomic DNA was extracted using the FastPure Viral DNA/RNA Mini Kit (Vazyme, China). The reaction system for qPCR contained 2 \u0026micro;L of FAM-BHQ1 labelled probe (CCACGGGAGGAATACCAACCCAGTG), 2 \u0026micro;L of PerfectStart II Probe qPCR Supermix UDG (TransGen Biotech, China), 5 \u0026micro;L of template DNA, and 11 \u0026micro;L of nuclease-free water. qPCR was performed on a QuantStudio\u0026trade;\u0026nbsp;6 Flex (Applied Biosystems, USA). The amplified conditions were as follows: 57\u0026deg;C for 5 min; 94\u0026deg;C for 5 min; then 94\u0026deg;C for 5 s and 57\u0026deg;C for 30 s, 40 cycles.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReverse transcription PCR (RT-PCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal cellular RNA was extracted using the TransZol Up Plus RNA Kit\u0026nbsp;(TransGen Biotech, China). Subsequently, the extracted RNA was reverse-transcribed into complementary DNA (cDNA) using the HiScript III All-in-one RT SuperMix Perfect for qPCR (Vazyme, China). The reverse transcription reaction system was composed as follows: 4 \u0026mu;L of 5\u0026times; All-in-one qRT SuperMix, 1 \u0026mu;L of Enzyme Mix, 1\u0026ndash;2 \u0026mu;g of RNA template, and nuclease-free water to make up the final volume. The thermal cycling program was set as: 50\u0026deg;C for 15 min; 85\u0026deg;C for 5 s; and a final hold at 4\u0026deg;C. The RT-qPCR was performed on a QuantStudio\u0026trade; 6 Flex (Applied Biosystems, USA) and calculations were performed using 2\u003csup\u003e-\u003c/sup\u003e\u003csup\u003e△△\u003c/sup\u003e\u003csup\u003eCt\u003c/sup\u003e by GAPDH was used as an endogenous negative control.\u0026nbsp;The primer sequences were used in this study are listed in\u0026nbsp;\u003cstrong\u003eTable 1.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"418\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 100%;\"\u003e\n \u003cp\u003eTable 1: The primer sequences\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 31.5789%;\"\u003e\n \u003cp\u003eSus GAPDH-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68.4211%;\"\u003e\n \u003cp\u003eACATGGCCTCCAAGGAGTAAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 31.5789%;\"\u003e\n \u003cp\u003eSus GAPDH-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68.4211%;\"\u003e\n \u003cp\u003eGATCGAGTTGGGGCTGTGACT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 31.5789%;\"\u003e\n \u003cp\u003eASFV P30-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68.4211%;\"\u003e\n \u003cp\u003eATTCTTCTTGAGCCTGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 31.5789%;\"\u003e\n \u003cp\u003eASFV P30-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68.4211%;\"\u003e\n \u003cp\u003eGGTAGCCTGTATAATTGGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 31.5789%;\"\u003e\n \u003cp\u003eSus IL-1\u0026beta;-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68.4211%;\"\u003e\n \u003cp\u003eAGTCTGCCCTGTACCCCAACT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 31.5789%;\"\u003e\n \u003cp\u003eSus IL-1\u0026beta;-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68.4211%;\"\u003e\n \u003cp\u003eATCTTGGCGGCCTTTGGAGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 31.5789%;\"\u003e\n \u003cp\u003eSus TNF-\u0026alpha;-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68.4211%;\"\u003e\n \u003cp\u003eCCAATGGCAGAGTGGGTATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 31.5789%;\"\u003e\n \u003cp\u003eSus TNF-\u0026alpha;-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68.4211%;\"\u003e\n \u003cp\u003eTGAAGAGGACCTGGGAGTAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eHAD\u003csub\u003e50\u003c/sub\u003e assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHAD\u003csub\u003e50\u003c/sub\u003e experiments were performed to verify the effect of CQP on viral particles. PAMs were spread into 96-well plates, and then the virus solution was diluted into 10\u003csup\u003e-1\u003c/sup\u003e\u0026ndash;10\u003csup\u003e-10\u003c/sup\u003e dilutions, each containing eight replicates, through 10-fold dilution. The virus dilution was added to the cell culture wells containing PAMs and then incubated for 2 days. Subsequently, 1% porcine erythrocytes were added to the 96-cell culture plates and incubated for 2\u0026ndash;3 days. Erythrocyte adsorption was observed under a fluorescence microscope. Finally, HAD\u003csub\u003e50\u003c/sub\u003e was calculated using the Reed\u0026ndash;Muench method.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranscriptome sequencing\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePAMs were first divided into two primary groups: no ASFV infection and ASFV-infected (MOI = 0.1). Each primary group was further split into CQP-treated (experimental) and water-treated (control) subgroups. Cell samples were collected at 0 (no ASFV infection), 24, and 48 h post-infection (hpi). Total RNA was extracted for high-throughput RNA sequencing. Raw reads were first filtered via BGI\u0026rsquo;s SOAPnuke (removing adaptor-contaminated reads, those with \u0026gt;5% unknown nucleotides, and low-quality reads) and then aligned to the Sus scrofa reference genome (Sscrofa11.1). Subsequently, differential expression analysis was performed to screen for differentially expressed genes (DEGs) in each treatment group, with the criteria of |Fold-change| \u0026gt; 1 and Q-value\u0026nbsp;\u0026le;\u0026nbsp;0.05. BGI\u0026rsquo;s Dr. Tom multi-omics data mining system (https://www.bgi.com/global/service/dr-tom), clustering heatmaps, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis were carried out for the DEGs, and the analysis results were visualised.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe samples were carried out the SDS-PAGE gel, and transfer the bands to polyvinylidene fluoride\u003cstrong\u003e\u0026nbsp;(\u003c/strong\u003ePVDF) membranes. The membranes were blocked with 1% bovine serum albumin (BSA) and incubated overnight with p38 MAPK (CST, #8690), p-p38 MAPK (CST, #4511), ERK1/2 (Abmart, T40071S), p-ETK1/2 (Abmart, T40072S), P30 (this antibody was stored in our laboratory),\u0026nbsp;\u0026beta;-action (Proteintech, Catalog No. 66009-1-Ig) and GAPDH (Proteintech, Catalog No. 60004-1-Ig) antibodies at 4\u0026deg;C and washed with 0.5% PBST. Finally, the membranes were incubated with the corresponding rabbit and mouse secondary antibodies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIndirect immunofluorescence assay (IFA)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp;The amount and strength of fluorescence were measured using IFA to observe the effect of CQP on virus replication. PAMs were spread in 12 well plates, infected with ASFV at 0.1 MOI for 2 h, and then treated with different concentrations of CQP for 48 h. The cells were fixed with 4% (w/v), permeabilised with 0.1% (v/v) Triton X-100, and blocked with 2% (w/v) BSA. The primary antibody against ASFV P30 protein were incubated for 2 h. Next, the CoraLite594-conjugated goat anti-rabbit IgG (H+L) secondary antibody (Proteintech, Catalog No. SA00013-4) were incubated at RT for 1 h in the dark. Nuclei were counterstained with 4\u0026rsquo;,6-diamidino-2-phenylindole solution (1:1000 dilution in PBS) at RT for 10 min in the dark. Finally, the fluorescence was observed under a fluorescence microscope, photographed, and recorded.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTime-course inhibition test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor the pre-treatment experiment, PAMs were incubated with CQP at 37\u0026deg;C for 2 h, infected with ASFV at 0.1 MOI for 2 h, washed twice with PBS, and then added with the medium \u0026nbsp;for 48 h. For the co-treatment assay, PAMs were infected with ASFV at 0.1 MOI and then treated with CQP at a final concentration of 12.5 \u0026micro;M for 2 h. The cells were washed with sterile PBS and then added with normal fresh medium containing 5% FBS. For the post-treatment assay, the cells were first infected with ASFV for 2 h and then treated with CQP at a final concentration of 12.5 \u0026micro;M for 48 h. Supernatants from all three treatments were collected to detect viral copy number, and the cells were used to detect P30 protein levels. PAMs were inoculated with ASFV at 0.1 MOI for 2 h, and 12.5 \u0026micro;M CQP was added to different wells at distinct time points (0, 3, 6, 9, 12, 15, or 18 h post medium addition) for 3 h. For the negative control group, the cells were treated identically but without CQP supplementation. All groups of cells were further cultured at 37\u0026deg;C for 48 h, after which qPCR analysis and western blot were performed \u0026nbsp;to assess viral replication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data were from at least two independent experiments (each measured in triplicate) and presented as mean \u0026plusmn; standard deviation (SD). Student\u0026rsquo;s t-test or one-way ANOVA was used for statistical significance analysis via GraphPad Prism 8.0 (P \u0026lt; 0.05). Specific details are in corresponding figure legends.\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eEffect of CQP treatment on PAM activity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCQP (Figure 1A) exerts anti-viral activity against many viruses, but its inhibitory effect on type II ASFV remains unclear. Therefore, we tested the effect of CQP on ASFV. CCK-8 results revealed that different concentrations of CQP exerted toxic effects on PAMs. Treatment with 25\u0026nbsp;\u0026mu;M CQP decreased cell viability to below 80% (Figure 1B). The 50% cytotoxic concentration (CC50) of CQP was 52.97\u0026nbsp;\u0026mu;M (Figure 1C).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCQP inhibits the replication of ASFV\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBased on the maximum safe concentration of CQP, PAMs were infected with ASFV at MOI=0.1 for 2h and incubated with different concentrations (25, 12.5, 6.25, 3.125, and 1.625\u0026mu;M) of CQP for 48h. The supernatants were used to test the viral copies via qPCR and cells were used to visualize the amount of virus fluorescence by fluorescence microscope. The result of qPCR showed that with concentration increase, the viral copies became lower and lower (Figure 2A). Notably, the inhibition rate of viral replication was dose-dependent at low concentrations but flat at 25, 12.5 and 6.25\u0026mu;M, with an EC\u003csub\u003e50\u003c/sub\u003e of 2.300\u0026mu;M, as calculated using the GraphPad Prism software (Figure 2B, 2C). Meanwhile, IFA results showed that viral fluorescence decreased with increasing drug concentration (Figure 2D).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCQP sustainably inhibited ASFV replication in vitro\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo validate the effect of CQP on the replication cycle of ASFV, we infected PAMs with ASFV for 2 h and then treated them with 12.5\u0026mu;MCQP for 24, 48, and 72 h. The supernatants and cells were used to detect the viral copies, HAD\u003csub\u003e50\u003c/sub\u003e, P30 at the mRNA and protein levels. The results of qPCR and HAD\u003csub\u003e50\u003c/sub\u003e showed that CQP treatment inhibited ASFV replication in different times (Figure 3A, 3B), and we could more intuitively observe that CQP can inhibit rosette formation production compared with control when the HAD\u003csub\u003e50\u003c/sub\u003e assay was preformed (Figure 3C). CQP treatment inhibited ASFV replication by decreasing the mRNA and protein levels of P30 (Figure 3E, 3F). These results indicate that CQP has an anti-ASFV activity in vitro.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCQP inhibited ASFV replication in\u0026nbsp;the\u0026nbsp;late stage of infection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTime-of-addition assays with different treatment modes were designed and performed to explore the time of action of CQP on ASFV (Figure 4A). The results of qPCR and western blot showed that CQP did not exert obvious inhibitory effect during co-incubation but had significant effects on post-treatment (Figure 4B, 4C). To further investigate which stage of the post-treatment was important, we added CQP to the PAM cells after infected with ASFV for 3h as the different treatment modes (Figure 4D). The results of qPCR and western blot showed that CQP acted mainly at 6 h during ASFV infection (Figure 4E, 4F). To assess the effect of CQP on viral adsorption and entry, we performed qPCR analysis, which revealed no significant impact on either process (Supplementary Figure 1A, 1B). The above results suggested that CQP exerts its anti-viral function mainly at the late stage of ASFV infection.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranscriptomic analysis of PAMs infected with ASFV of CQP treatment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further investigate the role of CQP in combating ASFV, we performed transcriptome sequencing to analyze the underlying mechanisms. PAMs were infected with ASFV at 0.1 MOI, and samples were collected at 0 h (no infection), 24 hpi, and 48 hpi for sequencing. DEGs were defined as those with p \u0026lt; 0.05 and |log₂ (fold change) | \u0026gt; 1,\u0026nbsp;as detailed in Supplementary Table 1, Supplementary Table 2, Supplementary Table 3. Compared with the control group, the CQP group had 96 downregulated and 25 upregulated genes at 0 h, 93 downregulated and 25 upregulated genes at 24 hpi, and 86 downregulated and 11 upregulated genes at 48 hpi (Figure 3 A, C, E). Subsequently, KEGG pathway enrichment analysis was conducted on these DEGs at the three time points. At 0 hpi, the DEGs were significantly enriched in pathways including cytokine\u0026ndash;cytokine receptor interaction, Toll-like receptor signaling pathway, chemokine signaling pathway, JAK-STAT signaling pathway, tumour necrosis factor (TNF) signaling pathway, and IL-17 signaling pathway (Figure 3B). At 24 hpi, the DEGs were significantly enriched in the TNF signaling pathway, cytokine\u0026ndash;cytokine receptor interaction, IL-17 signaling pathway, PPRA signaling pathway, Toll-like receptor signaling pathway, and NF-kappa B signaling pathway (Figure 3D). At 48 hpi, the DEGs were mainly enriched in the cytokine\u0026ndash;cytokine receptor interaction, Toll-like receptor signaling pathway, chemokine signaling pathway, PPRA signaling pathway, IL-17 signaling pathway, NF-kappa B signaling pathway, and TNF signaling pathway (Figure 3F). These results indicated that CQP primarily focused on the chemokine signaling pathway, TNF signaling pathway, Toll-like receptor signaling pathway, and IL-17 signaling pathway at 0 h, 24 hpi, and 48 hpi. We found that these signaling pathways are associated with the MAPK pathway by cross-referencing the KEGG Pathway Enrichment Analysis website (KEGG PATHWAY Database) (Figure 3H), suggesting that the MAPK signaling pathway is a key target of CQP.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCQP inhibited ASFV by regulating the MAPK-ERK signaling pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further confirm that CQP exerts its effects through the MAPK pathway[23], we examined key proteins in the MAPK signaling pathway through western blot. The MAPK signaling pathway mainly included P38, ERK, and JNK[33]. However, we did not find suitable anti-JNK or anti-p-JNK antibodies for PAMs. The results demonstrated that CQP significantly suppressed ERK phosphorylation, with no notable effects on other MAPK proteins, including P38 expression and P38 phosphorylation (Figure 6A-C). To further verify this finding, we treated cells with 10\u0026micro;M C16-PAF (MAPK agonist)[33]. Treatment with the agonist alone significantly elevated ERK phosphorylation, whereas co-treatment with CQP and the agonist decreased ERK phosphorylation and ERK phosphorylation was significantly elevated (Figure 6D-F). These results confirm that CQP indeed exerts its functions via the MAPK-ERK signaling pathway.\u003c/p\u003e\n\u003cp\u003eConsidering that the MAPK signaling pathway is a critical mediator of inflammation[34\u0026ndash;36], we subsequently quantified the mRNA levels of IL1\u0026beta; and TNF-\u0026alpha; using RT-qPCR. The results indicated that CQP treatment significantly downregulated the levels of IL-1\u0026beta; (Figure 6G) and TNF-\u0026alpha; (Figure 6H). When the cells were treated with the agonist alone, the levels of IL-1\u0026beta; and TNF-\u0026alpha; were significantly increased. In contrast, when the cells were co-treated with CQP and C16-PAF, the mRNA levels of IL-1\u0026beta; (Figure 6I) and TNF-\u0026alpha; (Figure 6J) were reduced. Collectively, these findings demonstrate that CQP exerts its antiviral activity by suppressing the MAPK-ERK signaling pathway.\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eASF has inflicted substantial economic losses on the global swine industry since its outbreak, and there are currently no commercial vaccines available for effective prevention and control of the disease[37, 38]. Given the difficult progress in vaccine development, drug-based prevention and treatment have become a key focus of current research. Various compounds have been identified to inhibit ASFV replication. For example, luteolin restricts viral proliferation by regulating the NF-\u0026kappa;B/STAT3/ATF6 signaling pathway[39], dihydromyricetin inhibits ASFV by downregulating TLR4-mediated pyroptosis[40], and rhein suppresses viral replication via activating the caspase-dependent mitochondrial apoptotic pathway[41] and so on. In the present study, we confirmed that CQP can significantly inhibit ASFV replication. Previously, Geraldes and Valdeira et al. reported that CQ exerts an inhibitory effect on the genotype I strain BAV17[42]. We further extended this finding by demonstrating that CQP is also effective against the genotype II strain SY-1, suggesting that it possesses anti-viral potential against multiple ASFV subtypes. Through transcriptomic analysis, we found that CQP possibly exerts its antiviral function by inhibiting the MAPK-ERK signaling pathway and we hypothesize that CQP is also capable of inhibiting inflammatory responses via the MAPK-ERK signaling pathway (Figure 6G-J). However, we have not yet verified the direct causal link between changes in IL-1\u0026beta;/TNF-\u0026alpha;\u0026nbsp;levels and ASFV replication\u0026mdash;for instance, through experiments involving the exogenous supplementation of IL-1\u0026beta;/TNF-\u0026alpha;. Thus, whether CQP truly suppresses virus-induced inflammation by targeting this pathway still requires further investigation. This mechanism differs from the report of Geraldes and Valdeira (1985) that CQ prevents ASFV from uncoating in acidic vesicles, causing its retention in lysosomal-like vacuoles. This difference suggests that CQP has multi-target anti-viral properties. And the selection index (SI = CC₅₀/EC₅₀) of CQP was approximately 23, which is far higher than the safety threshold for clinical use (SI \u0026gt; 10). This suggests that CQP could be administered via oral or injectable routes for emergency prevention and control of ASFV, with reference to its clinical dosage for antimalarial treatment. Future studies should verify in vivo efficacy through pig challenge experiments, thereby providing a dosage basis for its application in veterinary clinical practice.\u003c/p\u003e\n\u003cp\u003eBeyond regulating host response, some drugs can also directly target viral proteins. For instance, arctiin specifically binds to the ATP-binding domain of the viral topoisomerase P1192R to exerts its antiviral effect[43], stilbene derivatives (SD1 and SD4) inhibit replication by interfering with the binding of the viral protein pA104R to DNA[44]. Drawing on this, we adopted the method established by Lv et al.[43] and initially screened eight viral proteins that may interact with CQP compared with control, as showed in Supplementary Table 4 and Supplementary Table 5, using native electrophoresis combined with chromatography-mass spectrometry/mass spectrometry (LC-MS/MS) (Supplementary Figure 2A). We used the molecular docking simulations to analyze the docking score (Supplementary Figure 2B) and potential binding site (Supplementary Figure 2C) between these proteins and CQP, and speculated that CQP also may regulate ASFV replication by interacting with viral protein. However, these interactions still require further verification through experiments such as bio-layer interferometry.\u003c/p\u003e\n\u003cp\u003eIn summary, this study provides a new perspective and experimental basis for the development of ASFV-targeting drugs, with particular emphasis on the potential of CQP as a multi-mechanism antiviral agent. Future research should further clarify its targets and molecular mechanisms, laying a theoretical foundation for promoting the effective prevention and control of ASF.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHM conceived and designed the experiments and was a major contributor in writing the manuscript. HM and YW performed the data. WZ, KZ, ZS, LW, and XS provided the reagents. CC and SF carried out the transcriptome analysis. XH, QZ, ZZ and YZ analyzed the results. MJ provided the experimental platform and ideas. All authors contributed to the manuscript and approved the submitted version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDisclosure statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData are openly available publicly: the sequencing data generated in this study have been deposited in the NCBI Sequence Read Archive (SRA) under the accession number\u0026nbsp;PRJNA1322095.\u0026nbsp;Correspondence and requests for materials cloud be addressed to Meilin Jin.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe appreciate all members of the (ABSL-3) laboratory of Huazhong Agricultural University for their involvement in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the 2025 Hubei Provincial Natural Science Foundation Project: 2025AFB157\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eGallardo MC, Reoyo A de la T, Fern\u0026aacute;ndez-Pinero J, et al (2015) African swine fever: a global view of the current challenge. Porcine Health Management 1:21. https://doi.org/10.1186/s40813-015-0013-y\u003c/li\u003e\n\u003cli\u003eS\u0026aacute;nchez-Cord\u0026oacute;n PJ, Montoya M, Reis AL, Dixon LK (2018) African swine fever: A re-emerging viral disease threatening the global pig industry. Vet J 233:41\u0026ndash;48. https://doi.org/10.1016/j.tvjl.2017.12.025\u003c/li\u003e\n\u003cli\u003eQu H, Ge S, Zhang Y, et al (2022) A systematic review of genotypes and serogroups of African swine fever virus. Virus Genes 58:77\u0026ndash;87. https://doi.org/10.1007/s11262-021-01879-0\u003c/li\u003e\n\u003cli\u003eCwynar P, Stojkov J, Wlazlak K (2019) African Swine Fever Status in Europe. Viruses 11:310. https://doi.org/10.3390/v11040310\u003c/li\u003e\n\u003cli\u003eMulumba-Mfumu LK, Saegerman C, Dixon LK, et al (2019) African swine fever: Update on Eastern, Central and Southern Africa. Transbound Emerg Dis 66:1462\u0026ndash;1480. https://doi.org/10.1111/tbed.13187\u003c/li\u003e\n\u003cli\u003eZhou X, Li N, Luo Y, et al (2018) Emergence of African Swine Fever in China, 2018. Transbound Emerg Dis 65:1482\u0026ndash;1484. https://doi.org/10.1111/tbed.12989\u003c/li\u003e\n\u003cli\u003eWu K, Liu J, Wang L, et al (2020) Current State of Global African Swine Fever Vaccine Development under the Prevalence and Transmission of ASF in China. Vaccines (Basel) 8:531. https://doi.org/10.3390/vaccines8030531\u003c/li\u003e\n\u003cli\u003eRuedas-Torres I, Thi To Nga B, Salguero FJ (2024) Pathogenicity and virulence of African swine fever virus. Virulence 15:2375550. https://doi.org/10.1080/21505594.2024.2375550\u003c/li\u003e\n\u003cli\u003eIyer LM, Balaji S, Koonin EV, Aravind L (2006) Evolutionary genomics of nucleo-cytoplasmic large DNA viruses. Virus Res 117:156\u0026ndash;184. https://doi.org/10.1016/j.virusres.2006.01.009\u003c/li\u003e\n\u003cli\u003eGaudreault NN, Madden DW, Wilson WC, et al (2020) African Swine Fever Virus: An Emerging DNA Arbovirus. Front Vet Sci 7:. https://doi.org/10.3389/fvets.2020.00215\u003c/li\u003e\n\u003cli\u003eChapman DAG, Tcherepanov V, Upton C, Dixon LK (2008) Comparison of the genome sequences of non-pathogenic and pathogenic African swine fever virus isolates. J Gen Virol 89:397\u0026ndash;408. https://doi.org/10.1099/vir.0.83343-0\u003c/li\u003e\n\u003cli\u003eRajko-Nenow P, Batten C (2022) Genotyping of African Swine Fever Virus. Methods Mol Biol 2503:119\u0026ndash;132. https://doi.org/10.1007/978-1-0716-2333-6_8\u003c/li\u003e\n\u003cli\u003eBlome S, Gabriel C, Beer M (2014) Modern adjuvants do not enhance the efficacy of an inactivated African swine fever virus vaccine preparation. Vaccine 32:3879\u0026ndash;3882. https://doi.org/10.1016/j.vaccine.2014.05.051\u003c/li\u003e\n\u003cli\u003eChen W, Zhao D, He X, et al (2020) A seven-gene-deleted African swine fever virus is safe and effective as a live attenuated vaccine in pigs. Sci China Life Sci 63:623\u0026ndash;634. https://doi.org/10.1007/s11427-020-1657-9\u003c/li\u003e\n\u003cli\u003eYuan F, Cui J, Wang T, et al (2025) Selection, Design, and Immunogenicity Studies of ASFV Antigens for Subunit mRNA Cocktail Vaccines with Specific Immune Response Profiles. ACS Infect Dis 11:1907\u0026ndash;1921. https://doi.org/10.1021/acsinfecdis.5c00029\u003c/li\u003e\n\u003cli\u003eLopera-Madrid J, Medina-Mag\u0026uuml;es LG, Gladue DP, et al (2021) Optimization in the expression of ASFV proteins for the development of subunit vaccines using poxviruses as delivery vectors. Sci Rep 11:23476. https://doi.org/10.1038/s41598-021-02949-x\u003c/li\u003e\n\u003cli\u003eZhang Y, Mei X, Zhang C, et al (2024) ASFV subunit vaccines: Strategies and prospects for future development. Microbial Pathogenesis 197:107063. https://doi.org/10.1016/j.micpath.2024.107063\u003c/li\u003e\n\u003cli\u003eChandana MS, Nair SS, Chaturvedi VK, et al (2024) Recent progress and major gaps in the vaccine development for African swine fever. Braz J Microbiol 55:997\u0026ndash;1010. https://doi.org/10.1007/s42770-024-01264-7\u003c/li\u003e\n\u003cli\u003eHuang Z, Gong L, Zheng Z, et al (2021) GS-441524 inhibits African swine fever virus infection in vitro. Antiviral Res 191:105081. https://doi.org/10.1016/j.antiviral.2021.105081\u003c/li\u003e\n\u003cli\u003eGoulding LV, Kiss E, Goatley L, et al (2022) In vitro and in vivo antiviral activity of nucleoside analogue cHPMPC against African swine fever virus replication. Antiviral Res 208:105433. https://doi.org/10.1016/j.antiviral.2022.105433\u003c/li\u003e\n\u003cli\u003eHakobyan A, Arabyan E, Avetisyan A, et al (2016) Apigenin inhibits African swine fever virus infection in vitro. Arch Virol 161:3445\u0026ndash;3453. https://doi.org/10.1007/s00705-016-3061-y\u003c/li\u003e\n\u003cli\u003eArabyan E, Hakobyan A, Hakobyan T, et al (2021) Flavonoid Library Screening Reveals Kaempferol as a Potential Antiviral Agent Against African Swine Fever Virus. Front Microbiol 12:736780. https://doi.org/10.3389/fmicb.2021.736780\u003c/li\u003e\n\u003cli\u003eGao Q, Xu Y, Feng Y, et al (2024) Deoxycholic acid inhibits ASFV replication by inhibiting MAPK signaling pathway. International Journal of Biological Macromolecules 266:130939. https://doi.org/10.1016/j.ijbiomac.2024.130939\u003c/li\u003e\n\u003cli\u003eScherbel AL, Schuchter SL, Harrison JW (1957) Comparison of effects of two antimalarial agents, hydroxychloroquine sulfate and chloroquine phosphate, in patients with rheumatoid arthitis. Cleve Clin Q 24:98\u0026ndash;104. https://doi.org/10.3949/ccjm.24.2.98\u003c/li\u003e\n\u003cli\u003eWozniacka A, Lesiak A, Narbutt J, et al (2006) Chloroquine treatment influences proinflammatory cytokine levels in systemic lupus erythematosus patients. Lupus 15:268\u0026ndash;275. https://doi.org/10.1191/0961203306lu2299oa\u003c/li\u003e\n\u003cli\u003eYoung JP (1959) Chloroquine phosphate (Aralen) in the long-term treatment of rheumatoid arthritis. Ann Intern Med 51:1159\u0026ndash;1178. https://doi.org/10.7326/0003-4819-51-6-1159\u003c/li\u003e\n\u003cli\u003ePanayi GS, Neill WA, Duthie JJ, McCormick JN (1973) Action of chloroquine phosphate in rheumatoid arthritis. 1. Immunosuppressive effect. Ann Rheum Dis 32:316\u0026ndash;318. https://doi.org/10.1136/ard.32.4.316\u003c/li\u003e\n\u003cli\u003eMo L, Zheng P (2020) [Chloroquine phosphate: therapeutic drug for COVID-19]. Nan Fang Yi Ke Da Xue Xue Bao 40:586\u0026ndash;594. https://doi.org/10.12122/j.issn.1673-4254.2020.04.22\u003c/li\u003e\n\u003cli\u003ePaton NI, Lee L, Xu Y, et al (2011) Chloroquine for influenza prevention: a randomised, double-blind, placebo controlled trial. Lancet Infect Dis 11:677\u0026ndash;683. https://doi.org/10.1016/S1473-3099(11)70065-2\u003c/li\u003e\n\u003cli\u003eJayasekara KG, Suresh S, Goonasekara C, et al (2024) Anti-dengue viral activity of Glycyrrhiza glabra roots in Vero cells. Sci Rep 14:25922. https://doi.org/10.1038/s41598-024-76184-5\u003c/li\u003e\n\u003cli\u003eDowall SD, Bosworth A, Watson R, et al (2015) Chloroquine inhibited Ebola virus replication in vitro but failed to protect against infection and disease in the in vivo guinea pig model. J Gen Virol 96:3484\u0026ndash;3492. https://doi.org/10.1099/jgv.0.000309\u003c/li\u003e\n\u003cli\u003eRomanelli F, Smith KM, Hoven AD (2004) Chloroquine and hydroxychloroquine as inhibitors of human immunodeficiency virus (HIV-1) activity. Curr Pharm Des 10:2643\u0026ndash;2648. https://doi.org/10.2174/1381612043383791\u003c/li\u003e\n\u003cli\u003eYang Q, Guo H, Li H, et al (2025) The CXCL8/MAPK/hnRNP-K axis enables susceptibility to infection by EV-D68, rhinovirus, and influenza virus in vitro. Nat Commun 16:1715. https://doi.org/10.1038/s41467-025-57094-0\u003c/li\u003e\n\u003cli\u003eMa J-Q, Ding J, Zhang L, Liu C-M (2014) Ursolic acid protects mouse liver against CCl4-induced oxidative stress and inflammation by the MAPK/NF-\u0026kappa;B pathway. Environ Toxicol Pharmacol 37:975\u0026ndash;983. https://doi.org/10.1016/j.etap.2014.03.011\u003c/li\u003e\n\u003cli\u003eLiu J, Xu Y, Wu Q, et al (2018) Sirtuin‑1 protects hair follicle stem cells from TNF\u0026alpha;-mediated inflammatory stress via activating the MAPK-ERK-Mfn2 pathway. Life Sci 212:213\u0026ndash;224. https://doi.org/10.1016/j.lfs.2018.10.003\u003c/li\u003e\n\u003cli\u003eWang Y, Han D, Huang Y, et al (2024) Oral administration of punicalagin attenuates imiquimod-induced psoriasis by reducing ROS generation and inflammation via MAPK/ERK and NF-\u0026kappa;B signaling pathways. Phytotherapy Research 38:713\u0026ndash;726. https://doi.org/10.1002/ptr.8071\u003c/li\u003e\n\u003cli\u003eGogin A, Gerasimov V, Malogolovkin A, Kolbasov D (2013) African swine fever in the North Caucasus region and the Russian Federation in years 2007-2012. Virus Res 173:198\u0026ndash;203. https://doi.org/10.1016/j.virusres.2012.12.007\u003c/li\u003e\n\u003cli\u003eRahimi P, Sohrabi A, Ashrafihelan J, et al Emergence of African Swine Fever Virus, Northwestern Iran - Volume 16, Number 12\u0026mdash;December 2010 - Emerging Infectious Diseases journal - CDC. https://doi.org/10.3201/eid1612.100378\u003c/li\u003e\n\u003cli\u003eChen Y, Guo Y, Song Z, et al (2022) Luteolin restricts ASFV replication by regulating the NF-\u0026kappa;B/STAT3/ATF6 signaling pathway. Vet Microbiol 273:109527. https://doi.org/10.1016/j.vetmic.2022.109527\u003c/li\u003e\n\u003cli\u003eChen Y, Song Z, Chang H, et al (2023) Dihydromyricetin inhibits African swine fever virus replication by downregulating toll-like receptor 4-dependent pyroptosis in vitro. Vet Res 54:58. https://doi.org/10.1186/s13567-023-01184-8\u003c/li\u003e\n\u003cli\u003eSong Z, Chen Y, Chang H, et al (2023) Rhein suppresses African swine fever virus replication in vitro via activating the caspase-dependent mitochondrial apoptosis pathway. Virus Res 338:199238. https://doi.org/10.1016/j.virusres.2023.199238\u003c/li\u003e\n\u003cli\u003eGeraldes A, Valdeira ML (1985) Effect of chloroquine on African swine fever virus infection. J Gen Virol 66 (Pt 5):1145\u0026ndash;1148. https://doi.org/10.1099/0022-1317-66-5-1145\u003c/li\u003e\n\u003cli\u003eLv C, Yang J, Zhao L, et al (2023) Bacillus subtilis partially inhibits African swine fever virus infection in vivo and in vitro based on its metabolites arctiin and genistein interfering with the function of viral topoisomerase II. J Virol 97: e0071923. https://doi.org/10.1128/jvi.00719-23\u003c/li\u003e\n\u003cli\u003eLiu R, Sun Y, Chai Y, et al (2020) The structural basis of African swine fever virus pA104R binding to DNA and its inhibition by stilbene derivatives. Proc Natl Acad Sci U S A 117:11000\u0026ndash;11009. https://doi.org/10.1073/pnas.1922523117\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"virology-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"virj","sideBox":"Learn more about [Virology Journal](http://virologyj.biomedcentral.com/)","snPcode":"12985","submissionUrl":"https://submission.nature.com/new-submission/12985/3","title":"Virology Journal","twitterHandle":"@VirologyJ","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"ASFV, SY-1 strain, chloroquine phosphate (CQP), anti-viral drugs, MAPK-ERK pathway","lastPublishedDoi":"10.21203/rs.3.rs-8029940/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8029940/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAfrican swine fever virus (ASFV) causes a highly lethal disease in domestic pigs and wild boars, resulting in substantial economic losses on the global swine industry. However, effective vaccines against this virus remain elusive because of its large genome and high mutation frequency. Thus, drugs against ASFV infection need to be developed urgently. Chloroquine phosphate (CQP) has been demonstrated in previous studies to exert inhibitory effects against a variety of viruses, but its inhibitory effect against the SY-1 strain of ASFV remains unclear. Therefore, we selected CQP as the research subject to investigate its anti-ASFV function.\u003c/p\u003e\u003cp\u003eIn this study, we confirmed that chloroquine phosphate (CQP) exerts a significant inhibitory effect on the ASFV SY-1 strain by RT-qPCR, western blot, and HAD\u003csub\u003e50\u003c/sub\u003e. Transcriptome sequencing and KEGG pathway enrichment analysis showed that CQP treatment significantly affected multiple signaling pathways, including the cytokine\u0026ndash;cytokine receptor interaction, Toll-like receptor signaling pathway, tumour necrosis factor (TNF) signaling pathway and IL-17 signaling pathway. Western blot results further indicated that CQP can inhibit ERK phosphorylation. Treatment with the MAPK agonist C16-PAF reversed the inhibitory effect of CQP, verifying the key role of this pathway in the anti-viral mechanism of CQP. In sum, the results of this study indicate that CQP effectively inhibits ASFV replication by suppressing the MAPK-ERK signalling pathway. This study provides a theoretical basis and technical support for the development of anti-viral strategies targeting ASFV.\u003c/p\u003e","manuscriptTitle":"Chloroquine Phosphate Targets the MAPK-ERK Pathway to Inhibit ASFV SY- 1 Replication In Vitro","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-24 13:46:05","doi":"10.21203/rs.3.rs-8029940/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-11-25T18:05:01+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-24T21:41:27+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-23T18:48:07+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"258008631494274322213300181453005512289","date":"2025-11-13T02:41:12+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"300455069273923747034854342915298122745","date":"2025-11-12T14:23:25+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"54990816071080486817147554713144033044","date":"2025-11-12T14:22:51+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-11-12T14:15:32+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-11-07T00:02:16+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-06T09:08:35+00:00","index":"","fulltext":""},{"type":"submitted","content":"Virology Journal","date":"2025-11-04T14:12:32+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"virology-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"virj","sideBox":"Learn more about [Virology Journal](http://virologyj.biomedcentral.com/)","snPcode":"12985","submissionUrl":"https://submission.nature.com/new-submission/12985/3","title":"Virology Journal","twitterHandle":"@VirologyJ","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ed5223ea-847a-4414-97f9-025e4c30b44c","owner":[],"postedDate":"November 24th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-02T16:03:14+00:00","versionOfRecord":{"articleIdentity":"rs-8029940","link":"https://doi.org/10.1186/s12985-026-03114-4","journal":{"identity":"virology-journal","isVorOnly":false,"title":"Virology Journal"},"publishedOn":"2026-02-26 15:57:49","publishedOnDateReadable":"February 26th, 2026"},"versionCreatedAt":"2025-11-24 13:46:05","video":"","vorDoi":"10.1186/s12985-026-03114-4","vorDoiUrl":"https://doi.org/10.1186/s12985-026-03114-4","workflowStages":[]},"version":"v1","identity":"rs-8029940","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8029940","identity":"rs-8029940","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00