Pig-Derived Lactobacillus reuteri  as an Oral Vaccine Delivery System Overcomes the Intestinal Mucus Barrier to Induce Immune Responses

preprint OA: closed
Full text JSON View at publisher
Full text 155,491 characters · extracted from preprint-html · click to expand
Pig-Derived Lactobacillus reuteri as an Oral Vaccine Delivery System Overcomes the Intestinal Mucus Barrier to Induce Immune Responses | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Pig-Derived Lactobacillus reuteri as an Oral Vaccine Delivery System Overcomes the Intestinal Mucus Barrier to Induce Immune Responses Tiantian Guo, Lifei Liu, Shuai Wang, Jiaxuan Li, Yanping Jiang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5141739/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 6 You are reading this latest preprint version Abstract Local mucosal immune responses play a crucial role in protecting mucosal surfaces from infections, with the mucus layer serving as a significant component of the mucosal barrier that prevents direct contact of foreign materials with epithelial cells. Research has focused on using Lactic acid bacteria (LAB) as potential carriers for oral vaccines due to their ability to colonize the intestine and stimulate high levels of mucosal antibodies against expressed foreign antigens. However, the mechanism of the interaction between LAB vector and host intestine in the process of inducing immune response remains understudied. The intestinal mucus layer is a significant component of the mucosal barrier, which can prevent direct contact of foreign materials with intestinal epithelial cells. This article addresses this gap utilizing recombinant Pig-Derived Lactobacillus reuteri ( L. reuteri ) expressing the PEDV S1 antigen as a model strain and investigates how it traverses the mucus barrier upon entering the porcine small intestine to initiate immune responses. The results demonstrate that L. reuteri can penetrate and adhere to the interior of the mucus layer, subsequently being sampled by dendritic cells (DCs) to activate the immune system, and during intestinal colonization, L. reuteri can maintain its own replication. This study provides insights into the mechanisms by which LAB, as carriers of oral vaccines, overcome the intestine mucus barrier and induce mucosal immune responses, complements the interaction between LAB and the gut, offering valuable information for the application of LAB in oral vaccines to prevent intestinal infectious diseases. Mucosal immune Intestine mucus barrier Oral vaccines Lactobacillus reuteri Dendritic cell Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Many infectious diseases result from pathogenic infiltration through the mucosal tract. Vaccines delivered to mucosal tissues can mimic natural infections, offering protection at the primary site of infection 1 . The largest mucosal surface, the GI tract, is readily accessible via oral administration. LAB, as resident gut bacteria, are widely employed as delivery carriers for oral antigens 2 . Mucosal administration of LAB through the oral route has been shown to stimulate both mucosal and systemic immune responses, as supported by extensive research data 3 , 4 . Nevertheless, the gastrointestinal system poses inherent challenges, subjecting orally administered vaccines to the same host defense barriers as microbial pathogens and other foreign macromolecules 5 . Especially, the intestine boasts a protective barrier in the form of a mucus layer, selectively permitting the permeation of luminal antigens and microbes 6 . While this mucus layer serves as a protective barrier against microbes, it also presents a complex barrier to oral delivery 7 . Although LAB are known to tolerate the intestinal environment, the mechanism by which LAB delivery carriers overcome obstacles in the GI tract, particularly the mucus layer, remains unidentified. Therefore, unraveling this mechanism will contribute to optimizing the design strategy of LAB carrier oral vaccines and enhancing the ability of such carrier vaccines to prevent intestinal infectious diseases. Mucus is a hydrogel (> 95% water) consisting of a mixture of proteins, carbohydrates, lipids, salts, and antibodies, forming a barrier against foreign particulates and pathogens 8 . The main structural component present in mucus is mucin, with over twenty different mucin molecules in this family, among which the most abundant are MUC2, MUC5AC, and MUC6 9 . Mucin is heavily glycosylated with O-linked oligosaccharides, whereas the C- and N-terminal regions consist primarily of N-linked oligosaccharides 10 . Each glycan side chain may consist of up to 20 sugars, including sialic acid [N-acetylneuraminic acid and N-glycolylneuraminic acid] (NANA), fucose, N-acetyl-galactosamine (GalNAc), mannose, galactose, glucose, and N-acetylglucosamine (GlcNAc) 11 . Some bacteria can utilize adhesins that interact and bind to these oligosaccharide side chains on mucins, thereby becoming immobilized in mucus 12 . In addition, some bacteria harbored specific glycosyl hydrolases (GH) can enzymatically cleave mucin glycan structures and utilize mucin as a carbohydrate source 13 . GH families cleave O-linked mucin-glycans, including NANA (GH 33), GalNAc (GH 101 and 129), GlcNAc (GH 84, 85, 89, and 98), galactose (GH 2, 20, and 42), or fucose (GH 29 and 85). Additionally, the N-linked mucin glycans mannose can be removed with GH families 38 and 125. Both commensal and pathogenic bacteria can degrade and utilize mucin glycans as an energy source and attachment sites, promoting their replication and colonization. However, pathogenic bacteria are also capable of causing infection 14 . In this study, we aimed to address the question of how LAB overcomes the intestinal mucus of piglets to promote an immune response. The model strains utilized include L. reuteri J31 and recombinant L. reuteri S1/J31 expressing the PEDV S1 protein. These strains were employed to investigate their penetration into the mucus layer, interaction with mucin glycan, and pathways for overcoming the mucus barrier using both in vivo and in vitro methods. It is hoped that this study will contribute to our understanding of the mechanism by which L. reuteri , as an oral vaccine carrier, overcome the porcine intestinal mucus barrier and induces a mucosal immune response. Additionally, our study aimed to offer new insights for the design and enhancement of LAB oral vaccines. Methods Bacterial strains and culture conditions L. reuteri J31 (MK921700), L. reuteri S1/J31 15 , L. reuteri S1-6aa/J31 15 and L. reuteri CO21 (MK920155) were either isolated or constructed by our laboratory. All L. reuteri strains were cultured in MRS medium, with or without chloramphenicol, under aerobic conditions at 37 ℃. Bacteroides thetaiotaomicron DSM2079ATCC 29148 (bio-78496) was cultured in gifu anaerobic medium (Hopebio HB8518-3) supplemented with 0.001% hemin chloride (Hopebio 2100500) and 0.5% of 0.1% vitamin K1 (Hopebio 2100501). Bt DSM2079 was grown anaerobically in an AnaeroPack™ 7.0 L rectangular jar (Thermo Scientific™ R685070) at 37 ℃. Cell culture and mucus identification HT29-MTX-E12 (Fuhengbio FH1297), Caco-2, and IPEC J2 cell lines were maintained in DMEM medium, supplemented with 10% fetal bovine serum (FBS) (Invitrogen A5670701) at 37 ℃, in a 5% CO 2 atmosphere. For co-culture experiments, Caco-2 and HT29-MTX cells were seeded at a 3:1 ratio at 157,000 cells/cm 2 in complete DMEM and cultured for up to 21 days post-seeding, with the culture medium being changed three times each week. 24-well inserts (polyester membrane, 8 μm pore size; Corning 3422) were used for transwell assays. For the identification of mucus, the co-cultured cells were fixed using 4% paraformaldehyde (PFA) for 30 min at room temperature. The fixing solution was then replaced with alcian blue (pH 2.5) (Sigma 101647) dissolved in acetic acid to visualize acidic mucosubstances attached to the cells. Incubation in the dark at room temperature for 30 min, and subsequent rinsing of cells was performed until the supernatant was clear. Brightfield microscope images were captured for analysis. Ligated loop experiment Seven-day-old piglets (Landrace pig, purchased from the Acheng Experimental Internship Base of Northeast Agricultural University) were anesthetized with pentobarbital sodium, and a midline incision was made just anterior to the navel. All animal experiments followed Northeast Agricultural University’s (Harbin, China) regulations and guidelines for laboratory animals. Intestine segments received injections for four treatments: PBS (2 mL/segment), carboxyfluorescein diacetate, succinimidyl ester (CFDA-SE, Thermo Fisher C1157) labeled L. reuteri J31 (10 8 CFU/segment), CFDA-SE labeled recombinant L. reuteri S1/J31 (10 8 CFU/segment) and CFDA-SE labeled recombinant L. reuteri S1-6aa/J31 (10 8 CFU/segment). Throughout the procedure, piglets were kept warm on a 37 ℃ warming pad. After 1 h, the intestines were removed, embedded in paraffin or OCT, and cut into 6 μm sections for immunofluorescence, or fixed with 2.5 % glutaraldehyde for SEM, as described below. Collection and preparation of native mucus samples Native porcine intestinal mucus was extracted from 7-day-old piglets which were anesthetized after an overnight fast. The small intestine was isolated, and mucus was carefully collected and transferred into 2 mL sample vials, which were stored at -80 ℃ until experimentation. Scanning electron microscopy Ultra-structural analysis of porcine tissue was conducted using SEM. Porcine small intestinal segments were fixed with 2.5% glutaraldehyde in 0.1 M PIPES buffer (pH 7.2) overnight. The frozen ex vivo porcine mucus was thawed, and 100 μL was added to the center of a 15 × 15 × 5 mm mold containing 2% agarose and the excess agarose was trimmed. Subsequently, the porcine small intestinal segments and mucus samples were washed with 0.1 M PIPES buffer for 3 × 15 min, respectively, and dehydrated through a series of ethanol solutions (50, 70, 90,2 × 100%) in each solution for at least 15 min. Tissue and mucus samples were subjected to critical point drying in the Leica EM CPD300 (Leica Microsystems, Mannheim, Germany). Subsequently, the samples were mounted on the aluminum SEM stub with the lumen surface facing up using silver paint. The samples were then gold-plated in an agar high-resolution sputter coater. SEM imaging was performed at 5 kV using a SU8010 FEM (Hitachi, Japan). The average mucin pore size was calculated from the perimeter measured in representative images and determined using Image Pro Plus. At least 200 pores were measured from four perspectives. Examination of bacteria in small intestinal content of newborn piglets The small intestine segments of anesthetized newborn piglets (anesthetized immediately after birth) were collected and promptly immersed in a sterile PBS buffer. The intestinal segments were longitudinally cut, and the intestinal contents were cultured on LB and MRS media surfaces at 37 ℃ for 72 h. Additionally, smears of the intestinal contents were prepared for Gram staining and microscopic observation. Transwell assay to evaluate L. reuteri penetration across mucus Caco-2 and HT29-MTX cells were seeded at a 3:1 ratio on a 24-well polycarbonate membrane transwell plate with 8 µm pores for 21 days. Meanwhile, IPEC-J2 cells formed a monolayer on a similar transwell plate. Using a wiretrol applicator, 150 µL of mucus was transferred onto the IPEC-J2 cell monolayer. Subsequently, 600 µL of MRS was pipetted into the bottom transwell compartment. To each sample, 20 µL of CFDA-SE-labeled bacteria was added. The transwell plates were then incubated at 37 ℃ for 4 h. The transit of the bacteria from the mucus-containing transwell to the receiver plate was observed using a ZOE fluorescence microscope (Bio-Rad, Hercules, CA, USA). Transwell assay to evaluate L. reuteri sampling by trans-epithelial DCs As described above, IPEC-J2 cells formed a monolayer on a 24-well polycarbonate membrane transwell plate, and 150 µL of mucus was transferred onto the IPEC-J2 cell monolayer. DCs were obtained, as per a method described in previous studies 16,17 , and cultured in the bottom transwell compartment. After washing the DCs with PBS three times, they were stained with PE-labeled pig CD172a antibody (SouthernBiotech 4525-09) (1640 medium 1:100 dilution) at 37 ℃ for 30 min. Subsequently, the DCs were stained with 4,6-diamidino-2-phenylindole (DAPI) solution (Invitrogen 62248) for 10 min at room temperature, and washed again with PBS three times. To each sample, 20 µL of CFDA-SE-labeled bacteria was added. The transwell plates were incubated at 37 ℃ with 5% CO 2 for 4 h. The bottom transwell compartment was washed twice with PBS, fixed at room temperature with 4% formaldehyde for 15 min, and washed three times with PBS. Observations were made using fluorescence microscopy. The liquid and cells from the bottom transwell compartment were collected and observed by a fluorospectrophotometer (F-7100, Hitachi, Japan). Immunofluorescence staining Fluorescent immunohistology was performed on cryosections. Sections were initially blocked for 30 min with PBS containing 0.3% bovine serum albumin (BSA). Primary antibodies, including rabbit anti-MUC2 (dilution: 1:200, Cloud-Clone MAA705Hu22) and rabbit anti-DC-SIGN (dilution: 1:200, ABclonal A23593), were added to the slides for 1 h at 37 ℃. Subsequently, AlexaFluor TM 633-conjugated goat anti-rabbit IgG (dilution: 1:1000, Invitrogen A-21071) was applied for 30 min at 37 ℃. Cell nuclei were stained via 8 min incubation with DAPI solution. Each incubation step was followed by washing in PBS, with the solution refreshed every 5 min. The labelled sections were sealed with nail varnish and stored at 4 ℃. Negative control slides were treated identically. Images were acquired using either an inverted confocal microscope (FV3000; Olympus), with a typical optimal z-step size of 0.5-1 μm, or an ultra-high-resolution microscope (Deltavision OMX SR; GE). L. reuteri adherence assays in vitro To remove glycans from tissue, paraffin sections were processed as previously described 18 . Briefly, sections were incubated with 0.1 M NaOH for 30 min at room temperature and oxidized by adding 100 mM NaIO 4 in 100 mM acetate buffer (pH 4.5) overnight at 4 ℃. Reactive aldehydes were neutralized through incubation with a 2% glycine solution for 30 min, and beta-elimination was performed by adding 0.1 M NaOH for 30 min at room temperature. Mucus glycans were detected by staining with the lectin UEA-1 (Ulex Europaeus Agglutinin-1; Vector Laboratories B-1065-2; 1:200 dilution) for 30 min at room temperature. These sections were then exposed to CFDA-labeled L. reuteri at 37 ℃ for 1 h and visualized on a ZOE fluorescence microscope. 200 uL of various mucin oligosaccharides were added in a black 96-well enzyme-linked plate and maintained at 4 ℃ overnight. Subsequently, the plate was washed three times with PBS containing 0.05% Tween-20 (PBST), followed by the addition of 300 uL of protein-free blocking buffer (Thermo Scientific 37572) at room temperature for 1 h. 200 uL of CFDA-SE labeled bacterial suspension (OD 600 =1.0) was added and incubated at 4 ℃ for 4 h. Subsequently, the plate was washed three times with PBST. Next, 200 uL of 0.1 M NaOH containing 1% (w/v) SDS was added and incubated at 37 ℃ for 1 h. Finally, bacterial detection was performed using a microplate reader (SpectraMax reg iD3, Molecular Devices). Identification of microbial glycosyl hydrolases using the CAZy and PCR analysis Bacterial GH were examined using the CAZy database (http://www.cazy.org), following established protocols 19,20 . For analysis, only GH known to participate in mucin degradation (GH 2, 20, 29, 33, 38 42, 84, 85, 89, 95, 101, 125, and 129) were considered. To amplify the GH2 and GH42 genes of L. reuteri , the primer pairs TCGATGATCGTCACTCAGATTAC / AGCCATAGTAGTATCTTACCTCCT and GTCCGGTTGGCATGACTAAT / GGTGCGGATACCGTTCAAT were designed, utilizing genomic DNA extracted with a Universal Genomic DNA Purification Kit (Beyotime) as a template. Similarly, for Bt DSM2079, the primer pairs TCACTTTCTTCCACTCCGAATC / CATCGTCCGATGTCCGTAATAA and TTGCAGGTGAGACTGCTTATC / TCCAGTTCAGCCCATCATAAC were designed to amplify the GH2 and GH42 genes . Mucin degradation in vitro Hog gastric mucin (HGM) (Type Ⅱ, Sigma M2378) was subjected to repeated ethanol precipitation for purification 21 . Strains were anaerobically cultured in the following medium: 0.75% tryptone (Oxoid LP0043), 0.75% casitone (Oxoid), 0.3% yeast extract (Oxoid LP0021), 0.5% meat extract (Merck 1.32411.9025), 0.5% NaCl, 0.3% K 2 HPO 4 ·3H 2 O, 0.05% KH 2 PO 4 , 0.05% MgSO 4 ·7H 2 O, 0.05% cysteine HCI (Sigma C6852), and 0.0002% resazurin (Sigma R7017), with a pH of 7.2±0.2 (medium B). In specified cases, 0.3 % purified HGM (medium B+M) or 0.5% glucose (medium B+G) and 1.5% agarose (Sigma A9539) were included. 200 uL of the 24 h cultures of either L. reuteri or Bt DSM2079 were incubated at 37 ℃ for 48 h with 10 ml of either medium B, medium B containing 0.3% HGM with or without 0.5% glucose (medium B+M, B+M+G), or medium B containing 0.5% glucose (medium B+G). Monitoring the bacterial growth involved assessing changes in turbidity (absorbance at 600 nm) and pH values of the cultures. Each sample underwent triplicate assays. Following incubation, mucin pellets were precipitated as described in a previous study 22 , and resuspended in 0.5 ml of 10 mM Tris-HCl buffer. The electrophoretic patterns of ethanol-precipitated mucin samples following incubation with bacterial cultures were analyzed using SDS-PAGE 23 . The plate test was conducted in a petri dish as described in a previous study 22 . Briefly, HGM and agarose were incorporated into medium B at concentrations of 0.5% (w/v) and 1.5% (w/v), respectively. Ten μL of 24 h viable bacterial cultures were inoculated onto the surface of the agarose medium in a petri dish. The plates were incubated at 37 ℃ anaerobically for 72 h and subsequently stained with 0.1% amido black in 3.5 M acetic acid for 30 min. The plates were then washed with 1.2 M acetic acid. Staining of the intestinal explants in vitro The intestine was collected from anesthetized piglets, and segments of the intestine were immediately everted and gently washed with RPMI 1640. The tissue segments were stained with 125 nM CellTracker Orange CMRA Dye (Thermo Fisher C34551) for 5 min at 37 ℃, washed, and immobilized on a culture dish (Biosharp BS-20-GJM). Images were acquired using an inverted confocal microscope (FV3000; Olympus). The typical optimal z-step size was 0.5-1 μm. Serial 40-50μm Z-scan images were collected and reconstructed using Imaris software (Bitmap). Flow cytometry L. reuteri J31 and recombinant L. reuteri S1/J31, S1-6aa/J31 were added to immature DCs cultured for 5 days, and the ratio of cells and bacteria was 1:100. The cells were cultured at 37 ℃ and 5% CO 2 for 12 h, and the cells stimulated by the same amount of PBS and LPS were used as the control group. DCs in each group were collected into 1.5 mL EP tubes after repeated blowing, centrifuged at 1800 rpm for 10 min, and the supernatant was discarded. After washing twice with PBS, resuspend the pellet with 1 mL of PBS. MHC-Ⅱ-FITC (Abcam ab24882), CD80-FITC (Abcam ab95550) and CD86-FITC (Abcam ab77276) antibodies were added, incubated at 4 ℃ for 30 min, centrifuged at 1800 rpm for 10 min, the supernatant was discarded and washed twice with PBS. The cell pellet was resuspended with 500 µL PBS, and the expression of cell surface molecules was detected by flow cytometry (FACSCelesta; BECTON DICKINSON). Allogeneic mixed lymphocyte reaction (MLR) PBMCs, as the reactive cells, were isolated from the peripheral blood of piglets by Ficoll gradient centrifugation and washed three times with RPMI 1640 medium. DCs were co-cultured with L. reuteri or LPS (Sigma L4391) and treated with mitomycin C (25 µg/mL) (GlpBio GC12353) for 1 hour at 37°C. The cells were counted and resuspended in RPMI 1640 medium, which served as the stimulated cells. The reaction cells were added to 96-well plates, and the stimulated cells were introduced at ratios of 1:1, 1:10, and 1:100. DCs and lymphocytes were set as negative control wells, while RPMI 1640 culture medium served as the blank control well. Each well was replicate three times. The well plates were incubated for 72 hours in a 37°C incubator with 5% CO 2 . Finally, CCK-8 (Beyotime C0038) was added to the 96-well plates, and the OD 450 value was measured on an ELISA reader (Bio-Tech Instruments, USA). The stimulation index (SI) was calculated following the formula: SI = (OD sample well –OD blank well )/(OD negative well –OD blank well ). Statistical Analysis GraphPad Prism software was used to generate all graphs. One-way or two-way ANOVA with a Bonferroni posthoc test was employed for all assessments, and statistical significance was determined by Student’s t-test. The data are presented as mean ± SEM, and different letters (a,b, c and d) in figures 3, 4, 5 and 7 indicate significant differences (p < 0.05). Results L. reuteri penetration across porcine intestinal mucus ex vivo A transwell assay was employed to assess the permeability of L. reuteri in porcine intestinal mucus ex vivo . PEDV S1 antigen was expressed in recombinant L. reuteri S1/J31 (Additional file 1). Caco-2 and HT29-MTX-E12 cells were co-cultured in the upper compartment of the transwell to model the small intestinal epithelium in vitro . Alcian blue staining confirmed the secretion of mucus by HT29-MTX-E12 cells in this study (Additional file 2). The transwell assays revealed that no L. reuteri could traverse the Caco-2/HT29-MTX-E12 monolayer to reach the lower compartment (Fig. 1 a). To identify the factor responsible for the absence of L. reuteri in the lower compartment, an additional in vitro model of the GI tract was employed, involving the addition of small intestine mucus manually scraped onto the IPEC-J2 cell monolayer. Scanning electron microscopy (SEM) was utilized to examine porcine intestinal segments and mucus manually scraped from the porcine intestine. The results revealed similar 'net-like' structures in both, displaying pores within the mucus (Fig. 1 b). The mean mucin pores of the mucus in vivo and ex vivo ranged between 220 nm and 350 nm (Fig. 1 c). This observation suggests that the mucin polymer network is maintained following removal from the mucosal surface. Therefore, ex vivo mucus was employed to establish an in vitro model, incorporating the addition of mucus and/or IPEC-J2 in the upper compartment of the transwell. The results demonstrated that, when only mucus was present in the upper compartment, L. reuteri could be detected in the lower compartment using a fluorescence microscope. However, no L. reuteri was detected in the lower compartment when IPEC-J2 cells were present (Fig. 1 d). The findings indicate that L. reuteri can penetrate the intestinal mucus of piglets in vitro but cannot traverse IPEC-J2 cells. L. reuteri localization in the mucus layer of piglet intestinal tissue To experimentally validate our in vitro observations, in vivo tests were conducted. Initially, bacterial culture and Gram staining of the small intestine contents of newborn piglets (anesthetized immediately after birth) confirmed the sterility of the small intestine in newborn piglets (Additional file 3). Subsequently, L. reuteri was injected into the ligated small intestine of anesthetized newborn piglets. SEM results demonstrated the presence of L. reuteri in the mucus layer overlaying the villi (Fig. 2 a). Immunostaining of frozen sections, observed with an ultra-high-resolution microscope, revealed a significant number of L. reuteri in the intestinal cavity, with a small amount observed in the mucus overlaying the intestinal epithelial cells (Fig. 2 b). Subsequent Z-scan images collected using a laser confocal microscope yielded similar results (Fig. 2 c). These findings indicate that L. reuteri can indeed penetrate into the intestinal mucus; however, almost no contact with epithelial cells was observed. L. reuteri adherence to porcine intestinal mucin glycans Highly O-glycosylated mucin proteins can function as ligands for bacterial adhesins. To confirm the adhesion of L. reuteri to mucin glycans, slides containing 7 µm sections of fixed tissue from a 7-day-old porcine small intestine were incubated with fluorescently labeled L. reuteri . Glycan colocalization was examined using the lectin Ulex Europaeus Agglutinin-1 (UEA-1), which specifically recognizes fucose residues. We observed L. reuteri within the UEA-1 positive mucus (Fig. 3 a). To further demonstrate specificity for mucin glycans, tissue sections were oxidized and underwent acid-hydrolysis and beta-elimination. Incubation of fluorescently labeled L. reuteri with these glycan-removed tissue sections resulted in little to no adhesion (Fig. 3 a). These data indicate that L. reuteri adheres to the glycan component of porcine intestinal mucin. Additionally, the adhesion of L. reuteri to oligosaccharides was tested. The results demonstrated that L. reuteri J31 exhibited strong adhesion to mannose (Fig. 3 b). Meanwhile, the adhesion of L. reuteri CO21 strain and some pathogenic bacteria to mucin oligosaccharides indicated that different bacteria adhere to different oligosaccharides. These data suggest that L. reuteri preferentially adheres to mucin glycans, potentially facilitating intestinal colonization. L. reuteri enzymatic profiling in mucin glycan interaction To determine whether L. reuteri J31 possesses GH capable of degrading mucus, we examined the L. reuteri genome for GH families related to mucin glycan degradation using the carbohydrate-active enzymes Database (CAZy). The mucin-degrading bacterium Bacteroides thetaiotaomicron DSM2079 ( Bt ) served as the positive control. All strains of L. reuteri harbored GH families 2, with some also containing GH families 42, however, the copy numbers of these genes were very low, ranging from one to two copies (Fig. 4 a). The polymerase chain reaction (PCR) results confirmed the expression of GH2 and GH42 genes in L. reuteri J31 and recombinant L. reuteri pPG-S1/J31 (Fig. 4 b). To assess the degradation effect of L. reuteri on mucin, we supplemented basic culture medium B with mucin and/or glucose and monitored L. reuteri growth. The results revealed that the positive control strain Bt could utilize mucin, whereas L. reuteri could not (Fig. 4 c). SDS-PAGE analysis of mucin residues in the medium incubated with bacterial strains and mucin degradation assays in agarose petri dishes further confirmed that Bt could degrade mucin, while L. reuteri could not (Fig. 4 d and e). These findings indicate that, despite containing the GH gene, L. reuteri exhibited no significant degradation of mucin. L. reuteri utilization of oligosaccharides cleaved by mucin-degrading microbes The O- and N-glycosylated residues on mucin can provide an environment rich in nutrients 24 – 26 . Therefore, we initially tested whether L. reuteri could utilize the carbohydrates present in mucin. L. reuteri was cultivated in medium B with the addition of different carbohydrates, and the growth curves illustrated varying degrees of promotion in L. reuteri growth with various mucin oligosaccharides, with galactose exhibiting the most significant effect (Fig. 5 a and b). To identify whether mucin-degrading bacteria could liberate mucin-glycans, thereby cross-feeding L. reuteri , we cultivated L. reuteri in medium B containing mucin as the sole carbon source in the presence or absence of Bt . Consistent with our previous findings, we observed that L. reuteri was unable to grow on mucin alone. However, the addition of mucin-degrading microbes to media containing mucin resulted in increased optical density (Fig. 5 c). Given that Bt cannot grow in MRS medium, viable bacterial counting was employed to verify the increased growth of L. reuteri with Bt in mucin-containing B + M compared to inoculating L. reuteri alone in B + M (Fig. 5 c). To confirm that the degradation of mucin was responsible for the observed increase in L. reuteri growth and not bacterial metabolites, we separately cultured L. reuteri and Bt in medium B with or without mucin overnight. We then used the filtered cell-free supernatants to assess whether hydrolyzed mucin byproducts produced by Bt could influence the growth of L. reuteri . The results showed that L. reuteri grew when cultured in the presence of 25% cell-free supernatant from Bt grown in B + M (Fig. 5 d). These data indicate that the growth of L. reuteri in the intestinal mucus layer relies on mucin-degrading microbes when mucoglycans are the sole carbon source. DCs capture L. reuteri : implications for mucosal immune response induction Building upon our previous observations, L. reuteri adheres to the intestinal mucus layer but does not directly contact epithelial cells. This raises the question of how L. reuteri expressing a foreign protein induces a mucosal immune response. The key to triggering the immune response lies in the sampling of antigens by antigen-presenting cells within the intestinal lumen 27 . DCs are specialized antigen-presenting cells, prompting an investigation into whether L. reuteri is sampled by these cells. In order to more comprehensively analyze the interaction between L. reuteri and DCs, a recombinant L. reuteri fused expressing with PEDV S1 antigen and DCs targeting peptide 6aa was added and applied in subsequent experiments, and the protein expression was verified (Additional file 4). DCs were isolated and cultured from porcine peripheral blood (Additional file 5). An in vitro transwell assay demonstrated that, in the presence of DCs, L. reuteri can traverse mucus and IPEC-J2, being captured by DCs, while monocytes were added to the lower compartment of the transwell, no L. reuteri was observed (Fig. 6 a). Fluorescence value detection further confirmed that L. reuteri reached the lower compartment of the transwell in the presence of DCs (Fig. 6 b). These results indicated that the sampling of L. reuteri to the lower compartment is attributed to DCs. To further determine the capture of L. reuteri by DCs in vivo , CFDA-SE-labeled L. reuteri was injected into the small intestine of 7-day-old piglets. After one hour, the presence of L. reuteri within DCs was observed through laser confocal Z-scan images (Fig. 7 a). Additionally, intestinal explants were stained with CMRA and anti-DC-SIGN following L. reuteri injection. Using an inverted confocal microscope, serial 40–50 µm Z-scan images with a typical optimal z-step size of 0.5–1 µm were collected and reconstructed with Imaris software (Bitmap). The resulting 3D images, along with synchronous Z-scans, showed that L. reuteri (green) were captured by DCs (red) (Fig. 7 b). These findings indicate that small intestinal DCs can extend from the epithelial cell gap to the intestinal lumen for sampling of L. reuteri . Recombinant L. reuteri expressing foreign antigen activate the immune function of DCs In order to determine whether the antigen presentation ability of DCs changes, L. reuteri J31, recombinant L. reuteri S1/J31 and S1-6aa/J31 were added to DCs, respectively. After incubation for 12 h, the expression of surface marker molecules CD80, CD8 and MHC-Ⅱ on DCs were detected by flow cytometry. The results showed that recombinant L. reuteri expressing foreign proteins enhanced the antigen presentation ability of DCs, and the expression of DCs targeting peptide makes the enhancement effect more significant; But the L. reuteri without foreign protein had no effect on the antigen presentation ability of DCs (Fig. 8 a). The ability of L. reuteri to stimulate DCs mediated T cell proliferation was further tested by allogeneic mixed lymphocyte reaction. This result was consistent with the finding of antigen presentation ability of DCs (Fig. 8 b). The above results demonstrated that recombinant L. reuteri expressing foreign antigens could promote the maturation of DCs and further induce T cell proliferation, and expressing DCs targeting peptide in recombinant L. reuteri could enhance this effect. While the L. reuteri without foreign protein had no effect on the immune function of DCs. Discussion Lactobacillus , as a protein delivery carrier, can reach the intestine and elicit a specific immune response through the oral route due to its tolerance to the gastrointestinal tract 2 . As has been established, a mucus layer covers all mucosal surfaces, serving as a crucial barrier to the absorption of drugs and vaccines 28 . The question of how Lactobacillus traverses the diffusion barrier of the mucus after reaching the intestine has long been a perplexing issue. Therefore, the objective of this study was to investigate the mechanism through which oral delivery of Lactobacillus overcomes the intestinal mucus barrier and induces mucosal immunity. This enhanced understanding of how L. reuteri overcomes the intestinal mucosal barrier is expected to yield crucial insights for the design and improvement of oral Lactobacillus vaccines. L. reuteri J31 is a good probiotic strain previously isolated from the intestines of healthy piglets in our laboratory. Using it as a vector, the recombinant L. reuteri S1/J31 expressing PEDV S1 antigen was constructed, and the test proved that the recombinant strain can induce specific immune responses after oral immunization to piglets 29 . Therefore, we chosed the recombinant L. reuteri S1/J31 to study how it overcome the intestinal mucus barrier to induce immune response. In this study, we found that L. reuteri colonized the intestinal mucus layer and failed to contact with epithelial cells, suggesting that its delivery of foreign antigens to immune cells may depend on the uptake of intestinal DCs. Therefore, the recombinant L. reuteri S1-6aa/J31 with DCs targeting peptide constructed in our laboratory was used to study the interaction of L. reuteri with DCs. Selecting the above L. reuteri strains will help to clarify the mechanism of L. reuteri as an oral vaccine carrier to overcome the intestinal mucus barrier and induce immune response from multiple angles. Given the significant role of the intestinal mucus layer as a formidable barrier to the transport of orally delivered Lactobacillus carriers, our initial investigation focused on determining whether Lactobacillus could penetrate this mucus layer. Co-cultures of absorptive cells (Caco-2) and mucus-producing cells (HT29-MTX-E12), along with the supplementation of cell-based mucosal models with mucus, have been employed in numerous in vitro studies to examine the diffusion of drugs and bacteria in mucus 30 , 31 . Studies have shown that mucus has been produced in the intestine of animals at birth, but the composition of mucus changes with age 32 . According to the characteristics of PEDV with high mortality rate in piglets under 7 days of age and mainly invading small intestinal cells 33 , the small intestinal mucus of piglets at 7 days of age was selected for this study. To evaluate the mucus-penetrating ability of Lactobacillus delivery systems, we utilized the aforementioned intestinal cell models in an transwell assay for this study. The results indicate that L. reuteri can penetrate porcine intestinal mucus ex vivo , but cannot traverse epithelial cells. In order to more accurately determine the location of L. reuteri after entering the intestine of piglets, this study used the intestinal ligation model, injected L. reuteri into the ligated small intestine of piglets, and observed the localization of L. reuteri in the intestine of piglets. Whether the small intestine of newborn piglets is sterile is the key to observe L. reuteri localization in the intestine by SEM. For a long time, scholars generally believe that the intestine of newborns is sterile 34 . However, studies in recent years have found that newborns will transmit flora with the mother during pregnancy 35 , 36 . No bacteria were detected in the small intestine of newborn piglets in this study, the possible reason is that we dissected and collected tissues at the first time when the piglets were separated from the mother. Compared with the study of Dominguez 35 and Ardissone 36 , which collected samples within 24 or 48 hours, we did not give more time for bacteria to reproduce and colonize in this study. SEM of small intestine tissue fragments and immunostaining of small intestine tissue sections revealed the presence of L. reuteri within the mucus layer. This observation supplements our understanding of the specific location of L. reuteri colonization in the intestine. Previous studies have primarily relied on the theory that L. reuteri adheres to intestinal mucus or epithelial cells in vitro , suggesting its colonization in the intestine 37 , 38 . However, our findings indicate that L. reuteri is located within the mucus rather than adhering to the epithelium in the small intestine. The mucoglycan side chains on mucin have been demonstrated to serve as ligands for bacterial adhesins 12 . To confirm whether the L. reuteri adheres to mucoglycan, we incubated porcine small intestinal tissue sections with fluorescently labeled L. reuteri . The results showed that L. reuteri adhered to the tissue sections. In contrast, after removing the mucin glycans, L. reuteri exhibited almost no adhesion. This observation directly indicates that the adhesion target of L. reuteri is mucin glycans. Since each mucin glycan side chain may consist of up to 20 sugars 11 , we conducted tests to identify the specific mucin oligosaccharides in the mucin glycans that serve as the adhesion site. The results showed that the L. reuteri J31 strain strongly adheres to mannose. Interestingly, this finding contrasts with the experimental results for L. reuteri JCM1081, which was shown to strongly bind to neutral carbohydrate chains harboring a galactosyl residue 39 . Another study revealed that L. plantarum WCSF-1 exhibits mannose-specific adhesion 40 , suggesting that different strains may strongly bind to different types of mucin oligosaccharides. Our testing of the adhesion properties of other bacterial species in this study corroborates this point. In addition to providing attachment sites, mucin glycans also serve as nutrients for microorganisms, commonly referred to as ‘mucin-degrading microbes’, which promote their replication 41 , 42 . These bacteria possess the ability to digest mucoglycans through their glycosyl hydrolase 43 . Based on the experimental results in this study, we conclude that the L. reuteri J31 strain contains GH2 and GH42 with 1–2 gene copies, and it cannot directly and significantly degrade mucin glycans. However, the L. reuteri J31 strain can directly consume mucin oligosaccharides, and our data indicate that it exhibits optimal growth with galactose as the primary carbon source. We speculate that this result may correspond to GH2 and GH42 genes cleaving galactose. Research has shown that specialists in mucin degradation possess a large repertoire of glycosyl hydrolase enzymes capable of degrading mucin glycans 44 , 45 . These released glycan oligosaccharides can then be metabolized by the degrading microbe itself or by other resident microbes 46 , 47 . For example, Clostridioides difficile , lacking mucin-degrading enzymes, has been reported to metabolize mucin monosaccharides cleaved by members of mucin-degrading microbes 13 . Consistent with those findings, we observed that the L. reuteri J31 strain can utilize available mucin monosaccharides degraded by mucin-degrading microbes but cannot free these sugars from mucin on its own. These data provide new evidence that mucin oligosaccharides can serve as potent carbon sources, promoting L. reuteri growth and colonization of the intestinal mucus layer. Our data revealed that L. reuteri colonizes the mucus layer, prompting the investigation of how it induces an immune response. The specialized immune system of the gut must respond appropriately to the substantial antigenic load typically present in the form of food antigens, commensal bacteria, and occasional pathogenic organisms 27 . The first crucial moment for inducing immune responses is efficient antigen sampling from the luminal region of the intestine, with intestinal cells with antigen-presenting ability likely playing a central role in this process 27 . For example, M cells can internalize particles through various mechanisms 48 , Small intestinal goblet cells and intestinal epithelial cells can also mediate the transport of some particulate antigens 49 . According to the results of this study, L. reuteri were located in intestinal mucus and did not contact the small intestinal epithelium, and research data showed that particles below 500 nm were more easily absorbed by M cells and intestinal epithelial cells 50 , while the size of L. reuteri J31 ranged from 500 nm-2 µm. Therefore, L. reuteri is less likely to be internalized by M cells and intestinal epithelial cells after entering the intestine. DCs have been reported to express tight junction proteins and penetrate gut epithelial monolayers to sample bacteria 51 . Therefore, we investigated whether L. reuteri was sampled by DCs to induce an immune response. Our data in transwell assay showed that, in the presence of DCs, L. reuteri can penetrate the epithelium, while the addition of monocytes fails to sample bacteria. This suggests that L. reuteri is specifically sampled by trans-epithelial DCs. Although in vitro transwell model has proved that DCs play an important role in the process of recombinant L. reuteri crossing epithelial cells, in vivo test can better reflect the real situation of L. reuteri in the intestine after oral administration. In view of the diversity of tissues and cells in vivo , it is important to select specific marker proteins. DC-SIGE, a C-type lectin known as DC-specific intercellular adhesion molecule-3-grabbing non-integrin, plays a critical role in microorganism binding to DCs 52 . It has been reported that L. reuteri and L. casei can bind to DC-SIGE 52 . DC-SIGN has also been implicated in binding various viruses, including CMV, Ebola, and Dengue, as well as microorganisms such as Candida albicans , Mycobacterium and Schistosoma 53 – 58 . In this study, our section staining and the 3D images of tissue segments stained with anti-DC-SIGE revealed the capture of L. reuteri by DC-SIGN-labeled DCs. These findings demonstrate the involvement of DC-SIGN in capturing L. reuteri , signifying the crucial role of DCs in eliciting the intestinal immune response by L. reuteri . In this study, L. reuteri J31 and recombinant L. reuteri S1/J31 showed similar results in the interaction with mucus, indicating that L. reuteri does not affect its adhesion, colonization, growth and reproduction after expressing foreign antigens, suggesting the feasibility of using it as an oral vaccine carrier. DCs have been proved to phagocytose both pathogenic and non pathogenic bacteria, including intestinal commensal flora, and extract antigen components 59 . The results of this study showed that L. reuteri could be captured by DCs whether it carried foreign antigens or not, but L. reuteri could not activate the antigen-presenting function of DCs and induce subsequent immune response after being captured by DCs. Only recombinant L. reuteri carrying foreign antigen can activate intestinal DCs and the downstream T cell responses. In addition, our data showed that recombinant L. reuteri expressing DCs targeting peptide has a more significant effect on the immune function of DCs. This is consistent with our previous results, which proved that DCs targeting peptide can improve the oral immune effect of recombinant LAB 15 . In conclusion, we investigated the mechanisms by which L. reuteri overcomes the intestinal mucus barrier and induces an immune response in this study. Our findings reveal that L. reuteri can penetrate into the porcine intestinal mucus layer, where it colonizes by adhering to mucoglycans. This provides favorable conditions for the capture of intestinal DCs. Recombinant L. reuteri carrying foreign antigen can stimulate the maturation of DCs and the downstream T cell response. And the role of DCs targeting peptide in the interaction with DCs further suggests the potential of DCs targeting peptide for vaccine application. In the future design of LAB oral vaccines, priority should be given to strains that colonize the gut, and more attention should be paid to intestinal DCs targeting strategies. Declarations Ethics approval This study was approved by the Animal Experiment Ethics Committee of Northeast Agricultural University in China (Approval Number: NEAUEC20220318). All animal experiments followed Northeast Agricultural University’s regulations and guidelines for laboratory animals. Consent for publication Not applicable. Acknowledgments This research was supported by the Technology Support Program of Fourteenth Five Year Plan (2022YFD1800800) and the National Natural Science Foundation of China (Nos. 32373048). Competing Interests The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Author Contributions LW and YL conceived and initiated the study design. TG performed research and wrote the paper. LL, SW, JL, YJ, WC and DL contributed to the experiment. All authors contributed to refinement of the study protocol and approved the final manuscript. Funding This research was supported by the Technology Support Program of Fourteenth Five Year Plan (2022YFD1800800) and the National Natural Science Foundation of China (Nos. 32373048). ARRIVE Guidelines Statement We have adhered to ARRIVE guidelines and uploaded a completed checklist individually. Data Availability The datasets generated during and/or analysed during the current study are available in the Dryad repository, https://doi.org/10.5061/dryad.m63xsj49t. References Mantis, N. J., Rol, N. & Corthésy, B.(2011) Secretory IgA's complex roles in immunity and mucosal homeostasis in the gut. Mucosal Immunology 4, 603. Wang, M., Gao, Z., Zhang, Z., Pan, L. & Zhang, Y.(2014) Roles of M cells in infection and mucosal vaccines. Human Vaccines Immunotherapeutics 10. Bermúdez-Humarán, L. G., Kharrat, P., Chatel, J. M. & Langella, P.(2011) Lactococci and lactobacilli as mucosal delivery vectors for therapeutic proteins and DNA vaccines. Microbial Cell Factories 10 Suppl 1, S4. Anne, Mobergslien, Vlada, Vasovic, Geir, Mathiesen, Lasse, Fredriksen, Phuong & Westby.(2015) Recombinant Lactobacillus plantarum induces immune responses to cancer testis antigen NY-ESO-1 and maturation of dendritic cells. Human Vaccines & Immunotherapeutics. Neutra, M. R. & Kozlowski, P. A.(2006) Neutra, M.R. & Kozlowski, P.A. Mucosal vaccines: the promise and the challenge. Nat. Rev. Immunol. 6, 148-158. Nature reviews. Immunology 6, 148-158. Johansson, M. E. V., Larsson, J. M. H. & Hansson, G. C.(2011) The two mucus layers of colon are organized by the MUC2 mucin, whereas the outer layer is a legislator of host–microbial interactions. Proc Natl Acad Sci U S A 108, 4659-4665. Kamada, N., Kim, Y. G., Sham, H. P., Vallance, B. A., Puente, J. L., Martens, E. C. & Nunez, G.(2012) Regulated Virulence Controls the Ability of a Pathogen to Compete with the Gut Microbiota. Science 336, 1325-1329. N-3 polyunsaturated fatty acid attenuates cholesterol gallstones by suppressing mucin production with a high cholesterol diet in mice. Journal of Gastroenterology and Hepatology 27, 1745-1751. Lai, S. K., Wang, Y. Y. & Hanes, J.(2009) Mucus-penetrating nanoparticles for drug and gene delivery to mucosal tissues. Adv Drug Deliv Rev 61, 158-171. Takazumi, Taniguchi, Ashley, M., Woodward, Paula, Magnelli, Nicole, M. & McColgan.(2017) N -Glycosylation affects the stability and barrier function of the MUC16 mucin. Journal of Biological Chemistry. Cone, R. A.(2005) Chapter 4 - Mucus. Vol. Mucosal Immunology, Two-Volume Set. Li, B. & Yu, Y. B.(2017) Role of mucus barrier in the gut. World Chinese Journal of Digestology 25, 1764-1771. Engevik, M. A., Engevik, A. C., Engevik, K. A., Auchtung, J. M. & Versalovic, J.(2020) Mucin-Degrading Microbes Release Monosaccharides That Chemoattract Clostridioides difficile and Facilitate Colonization of the Human Intestinal Mucus Layer. ACS Infectious Diseases. Donaldson, G., Lee, S. M. & Mazmanian, S. K.(2015) Gut biogeography of the bacterial microbiota. Xia, T., Wang, N., Tang, Y., Gao, Y., Gao, C., Hao, J., Jiang, Y., Wang, X., Shan, Z., Li, J., Zhou, H., Cui, W., Qiao, X., Tang, L., Wang, L. & Li, Y.(2022) Delivery of antigen to porcine dendritic cells by fusing antigen with porcine dendritic cells targeting peptide. Front Immunol 13, 926279, doi:10.3389/fimmu.2022.926279. Carrasco, C. P., Rigden, R. C., Schaffner, R., Gerber, H. & Summerfield, A.(2010) Porcine dendritic cells generated in vitro: morphological, phenotypic and functional properties. Immunology 104. Xia, T., Yang, H., Guo, Y., Guo, T., Xin, L., Jiang, Y., Cui, W., Zhou, H., Qiao, X., Wang, X., Li, J., Shan, Z., Tang, L., Wang, L. & Li, Y.(2022) Human dendritic cell targeting peptide can be targeted to porcine dendritic cells to improve antigen capture efficiency to stimulate stronger immune response. Front Immunol 13, 950597, doi:10.3389/fimmu.2022.950597. Joe, C., HongYoung, S. & Kim.(2000) Alkali-catalyzed β-elimination of periodate-oxidized glycans: A novel method of chemical deglycosylation of mucin gene products in paraffin embedded sections. Glycoconjugate Journal. Kaoutari, A. E., Armougom, F., Gordon, J. I., Raoult, D. & Henrissat, B.The abundance and variety of carbohydrate-active enzymes in the human gut microbiota. Nature Reviews Microbiology. Lombard, V., Golaconda Ramulu, H., Drula, E., Coutinho, P. M. & Henrissat, B.(2014) The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Res 42, D490-495, doi:10.1093/nar/gkt1178. Miller, R. S. & Hoskins, L. C.(1981) Mucin degradation in human colon ecosystems. Fecal population densities of mucin-degrading bacteria estimated by a "most probable number" method. Gastroenterology 81, 759-765. Zhou, J. S., Gopal, P. K. & Gill, H. S.(2001) Potential probiotic lactic acid bacteria Lactobacillus rhamnosus (HN001), Lactobacillus acidophilus (HN017) and Bifidobacterium lactis (HN019) do not degrade gastric mucin in vitro. International Journal of Food Microbiology 63, 81-90. Laemmli, U.(1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227. Engevik, M. A., Aihara, E., Montrose, M. H., Shull, G. E. & Worrell, R. T.(2013) Loss of NHE3 alters gut microbiota composition and influences Bacteroides thetaiotaomicron growth. Am J Physiol Gastrointest Liver Physiol 305, G697-G711. Engevik, Melinda, A., Hickerson, Annelies, Shull, Gary, E., Worrell & Roger, T.(2013) Acidic Conditions in the NHE2 Mouse Intestine Result in an Altered Mucosa-Associated Bacterial Population with Changes in Mucus Oligosaccharides. Cellular Physiology & Biochemistry. Crost, E. H., Tailford, L. E., Gall, G. L., Fons, M., Henrissat, B. & Juge, N.(2013) Utilisation of Mucin Glycans by the Human Gut Symbiont Ruminococcus gnavus Is Strain-Dependent. Plos One 8. Stagg & J, A.(2003) The dendritic cell: its role in intestinal inflammation and relationship with gut bacteria. Gut 52. Carlson, T. L., Lock, J. Y. & Carrier, R. L.(2018) Engineering the Mucus Barrier. Annual review of biomedical engineering 20, 197-220. Ma Rumeng (2023). Comparative study on immune response induced by the expression of protective antigen S1 of porcine epidemic diarrhea virus by different lactobacillus receptor strains. Mahler, R. L. T. K. G. G.-R. N. H. M. J.(2020) TiO_2 Nanoparticles and Commensal Bacteria Alter Mucus Layer Thickness and Composition in a Gastrointestinal Tract Model. Small 16. Reale, O., Huguet, A. & Fessard, V.(2020) Co-culture model of Caco-2/HT29-MTX cells: A promising tool for investigation of phycotoxins toxicity on the intestinal barrier. Chemosphere. Turck, D., Feste, A. S. & Lifschitz, C. H.(1993) Age and Diet Affect the Composition of Porcine Colonic Mucins. Pediatric Research 33, 564-567. Yu Hua. in National Academic Symposium on Virology and Wuhan International Symposium on Modern Virology. Cao, S. T., Wang, C. C., Wu, H., Zhang, Q. H., Jiao, L. F. & Hu, C. H.(2018) Weaning disrupts intestinal antioxidant status, impairs intestinal barrier and mitochondrial function, and triggers mitophagy in piglets. Journal of animal science 96, 1073. Dominguez-Bello, M., G., Costello, E., K., Contreras, M., Magris & M.(2010) Delivery mode shapes the acquisition and structure of the initial microbiota across multiple body habitats in newborns. Proceedings of the National Academy of Sciences 107, 11971-11975. Ardissone, A. N., Cruz, D. M. D. L., Davis-Richardson, A. G., Rechcigl, K. T. & Li, N.(2014) Meconium Microbiome Analysis Identifies Bacteria Correlated with Premature Birth (PLoS ONE (2014) 9, 3, (e90784) DOI:10.1371/journal.pone.0090784). PLoS ONE 9. Miyoshi, Y., Okada, S., Uchimura, T. & Satoh, E.(2006) A Mucus Adhesion Promoting Protein, MapA, Mediates the Adhesion of Lactobacillus reuteri to Caco-2 Human Intestinal Epithelial Cells. Biosci Biotechnol Biochem 70, 1622-1628. Roos, S. & Jonsson, H.(2002) A high-molecular-mass cell-surface protein from Lactobacillus reuteri 1063 adheres to mucus components. Microbiology 148, 433-442. T., Mukai, S., Kaneko, H. & Ohori.(1998) Haemagglutination and glycolipid-binding activities of Lactobacillus reuteri. Letters in Applied Microbiology. Pretzer, G., Snel, J., Molenaar, D., Wiersma, A., Bron, P. A., Lambert, J., De Vos, W. M., Van, d. M., R., Smits, M. A. & Kleerebezem, M.(2005) Biodiversity-Based Identification and Functional Characterization of the Mannose-Specific Adhesin of Lactobacillus plantarum. Journal of Bacteriology 187, 6128-6136. Li, H., Limenitakis, J. P., Fuhrer, T., Geuking, M. B., Lawson, M. A., Wyss, M., Brugiroux, S., Keller, I., Macpherson, J. A. & Rupp, S.(2015) The outer mucus layer hosts a distinct intestinal microbial niche. Nature Communications 6, 8292. Etienne-Mesmin, L., Chassaing, B., Desvaux, M., Paepe, K. D., Gresse, R., Sauvaitre, T., Forano, E., Wiele, T. V. D., Stephanie.Schüller & Juge, N.(2019) Experimental models to study intestinal microbes-mucus interactions in health and disease. FEMS microbiology reviews 43, 457-489. Sommer, F. & Bckhed, F.(2013) The gut microbiota—Masters of host development and physiology. Nature Reviews Microbiology 11. Xiaolei, Ze, Fanny, Le, Mougen, Sylvia, Duncan, H., Petra, Louis & Harry.(2013) Some are more equal than others. Gut Microbes. Jean-Félix, S., Guillaume, L. B., Philippe, V., Mario, J. & Josée, H.(2017) Interactions of Intestinal Bacteria with Components of the Intestinal Mucus. Frontiers in Cellular and Infection Microbiology 7. Johansson, Malin E. V., Jakobsson, H. E., Holmén-Larsson, J., Schütte, A. & Hansson, G. C.(2015) Normalization of Host Intestinal Mucus Layers Requires Long-Term Microbial Colonization. Cell Host & Microbe 18, 582-592. Liisa, Arike, Gunnar, C. & Hansson.(2016) The Densely O-Glycosylated MUC2 Mucin Protects the Intestine and Provides Food for the Commensal Bacteria. Journal of Molecular Biology 428, 3221-3229. Corr, S. C., Gahan, C. C. G. M. & Hill, C.(2008) M‐cells: origin, morphology and role in mucosal immunity and microbial pathogenesis. FEMS Immunology & Medical Microbiology 52. Awaad, A., Nakamura, M. & Ishimura, K.(2012) Imaging of size-dependent uptake and identification of novel pathways in mouse Peyer's patches using fluorescent organosilica particles. Nanomedicine Nanotechnology Biology & Medicine 8, 627-636. Wang, T., Jiang, H., Zhao, Q., Wang, S., Zou, M. & Cheng, G.(2012) Enhanced mucosal and systemic immune responses obtained by porous silica nanoparticles used as an oral vaccine adjuvant: Effect of silica architecture on immunological properties. International Journal of Pharmaceutics 436, 351-358. Rescigno, M., Urbano, M., Valzasina, B., Francolini, M. & Ricciardi-Castagnoli, P.(2001) Dendritic cells express tight junction proteins and penetrate gut epithelial monolayers to sample bacteria. Nature Immunology 2, 361. Smits, H. H., Engering, A., Desiree, V. D. K., De Jong, E. C., Schipper, K., Van Capel, T. M. M., Zaat, B. A. J., Yazdanbakhsh, M., Wierenga, E. A. & Van Kooyk, Y.(2005) Selective probiotic bacteria induce IL-10-producing regulatory T cells in vitro by modulating dendritic cell function through dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin. Journal of Allergy and Clinical Immunology 115, 1260-1267. Halary, F., Amara, A., Lortat-Jacob, H., Messerle, M., Delaunay, T., Houlès, C., Fieschi, F., Arenzana-Seisdedos, F., Moreau, J. F. O. & Déchanet-Merville, J.(2002) Human cytomegalovirus binding to DC-SIGN is required for dendritic cell infection and target cell trans-infection. Immunity 17, 653-664. Zhang, F., Ren, S. & Zuo, Y.(2014) DC-SIGN, DC-SIGNR and LSECtin: C-type lectins for infection. International Reviews of Immunology 33, 54-66. Tassaneetrithep, B., Burgess, T. H., Granelli-Piperno, A., Trumpfheller, C., Finke, J., Sun, W., Eller, M. A., Pattanapanyasat, K., Sarasombath, S. & Birx, D. L.(2003) DC-SIGN (CD209) Mediates Dengue Virus Infection of Human Dendritic Cells. Journal of Experimental Medicine 197, 823-829. Cambi, A., Gijzen, K., Vries, I. J. M. D., Torensma, R., Joosten, B., Adema, G. J., Netea, M. G., Kullberg, B. J., Romani, L. & Figdor, C. G.(2003) The C-type lectin DC-SIGN (CD209) is an antigen-uptake receptor for Candida albicans on dendritic cells. European Journal of Immunology 33, 532-538. Tailleux, L., Schwartz, O., Herrmann, J. L., Pivert, E., Jackson, M., Amara, A., Legres, L., Dreher, D., Nicod, L. P. & Gluckman, J. C.(2003) DC-SIGN Is the Major Mycobacterium tuberculosis Receptor on Human Dendritic Cells. Journal of Experimental Medicine 197, 121-127. Irma, V. D., Van, V. S. J., Kwame, N. A., Cummings, R. D., Bank, C. M. C., Ben, A., Geijtenbeek, T. B. H. & Yvette, V. K.(2003) The dendritic cell–specific C-type lectin DC-SIGN is a receptor for Schistosoma mansoni egg antigens and recognizes the glycan antigen Lewis x. Glycobiology, 471-478. Niess, J. H.(2010) What are CX3CR1+ mononuclear cells in the intestinal mucosa? Gut Microbes 1, 396-400. Supplementary Files supplementalmaterial.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major Revision a single reviewer 15 Sep, 2025 Reviewers agreed at journal 22 Jan, 2025 Reviewers invited by journal 17 Jan, 2025 Editor invited by journal 01 Oct, 2024 First submitted to journal 29 Sep, 2024 Editor assigned by journal 26 Sep, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5141739","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":403654548,"identity":"abc07e65-0581-45b1-8db1-fce4374b10b2","order_by":0,"name":"Tiantian Guo","email":"","orcid":"","institution":"Northeast Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Tiantian","middleName":"","lastName":"Guo","suffix":""},{"id":403654549,"identity":"7e25ca57-0b59-49bb-a97a-2ea2360a591c","order_by":1,"name":"Lifei Liu","email":"","orcid":"","institution":"Northeast Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Lifei","middleName":"","lastName":"Liu","suffix":""},{"id":403654550,"identity":"6fdf20a6-6958-4e9d-882c-397c18277255","order_by":2,"name":"Shuai Wang","email":"","orcid":"","institution":"Northeast Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Shuai","middleName":"","lastName":"Wang","suffix":""},{"id":403654551,"identity":"1fe8c0f8-58aa-4539-a75e-e9a56eed4b17","order_by":3,"name":"Jiaxuan Li","email":"","orcid":"","institution":"Northeast Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jiaxuan","middleName":"","lastName":"Li","suffix":""},{"id":403654552,"identity":"71e81c4b-46d4-41f6-b44c-d106d75bdc9a","order_by":4,"name":"Yanping Jiang","email":"","orcid":"","institution":"Northeast Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yanping","middleName":"","lastName":"Jiang","suffix":""},{"id":403654553,"identity":"651bfdb9-8abe-4213-9261-0564ef3144a6","order_by":5,"name":"Wen Cui","email":"","orcid":"","institution":"Northeast Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Wen","middleName":"","lastName":"Cui","suffix":""},{"id":403654554,"identity":"f01f5ad2-8480-4a9a-886e-cbafd202c564","order_by":6,"name":"Dandan liu","email":"","orcid":"","institution":"The Eighth Affiliated Hospital of Sun Yat-Sen University","correspondingAuthor":false,"prefix":"","firstName":"Dandan","middleName":"","lastName":"liu","suffix":""},{"id":403654555,"identity":"36d0b01f-0bf8-4b02-80b1-e94d9b7937a7","order_by":7,"name":"Yijing Li","email":"","orcid":"","institution":"Northeast Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yijing","middleName":"","lastName":"Li","suffix":""},{"id":403654556,"identity":"56f1f985-e9c0-463c-ac60-934c48888370","order_by":8,"name":"Li Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyElEQVRIiWNgGAWjYLCCBwZAgr2x8eEHorUkgLTwHG42liBeC4iQSG8T4CFGtcHxs4dfJBTYyRvcfNjGIMFgJ6fbQEjLmbw0iwSDZMMNtxPbHhQwJBubHSCgxexAjplBgsEBRqCWdgMJhgOJ2whqOf8GrMV+w82DbRI8RGm5kWP8AKglccMNRiK12N94YwYM5OTkmWcSgYFsQIRfJPtzjD98+GNn23f8+MOHHyrs5AhqAQI2pAg0IKwcBJiJTyajYBSMglEwMgEAiI1HevBCmh0AAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-8682-0696","institution":"Northeast Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Li","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-09-24 04:50:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5141739/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5141739/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":74219073,"identity":"9412a29a-4d3a-4d41-8372-e6eea284568a","added_by":"auto","created_at":"2025-01-20 06:23:16","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":5597718,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eL. reuteri \u003c/em\u003epenetration across porcine intestinal mucus \u003cem\u003eex vivo\u003c/em\u003e (a) Transwell assay to evaluate \u003cem\u003eL. reuteri\u003c/em\u003e penetrating the Caco-2/HT29-MTX-E12 monolayer. (b) Scanning electron micrographs of the porcine intestinal mucus. (c) Mean mucin pore diameter as calculated by SEM. A minimum of 200 pores were measured from four perspectives. (d) Transwell assay to evaluate \u003cem\u003eL. reuteri\u003c/em\u003e penetrating the mucus \u003cem\u003eex vivo\u003c/em\u003e and/or IPEC-J2 monolayer.\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-5141739/v1/bf63ea015ca1f11b22482eab.png"},{"id":74220391,"identity":"0671c61a-1e0c-4a4b-8457-c4827470ebb2","added_by":"auto","created_at":"2025-01-20 06:31:13","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":19591128,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eL. reuteri\u003c/em\u003e penetration into porcine intestinal mucus \u003cem\u003ein vivo\u003c/em\u003e (a) SEM shows a thick layer of mucus overlaying the villus in newborn piglets. The 'net-like' nature of the mucus is evident along with the pores in the mucus (triangles indicate villi position). \u003cem\u003eL. reuteri \u003c/em\u003eJ31 and recombinant \u003cem\u003eL. reuteri\u003c/em\u003e S1/J31 were shown in mucus. (b) Immunostaining of frozen sections under ultra-high-resolution microscopy. (c) Z-scan images under laser confocal microscopy for immunostained frozen sections. Frozen sections were stained with anti-MUC2 (red) and DAPI (blue). \u003cem\u003eL. reuteri\u003c/em\u003e is labeled with CFDA-SE (green).\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-5141739/v1/54b3ca2a51da732b2cfe55cf.png"},{"id":74219069,"identity":"46a9a932-e56e-4e78-b335-70b4257400fb","added_by":"auto","created_at":"2025-01-20 06:23:16","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3016313,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eL. reuteri\u003c/em\u003e adherence to porcine intestinal mucin glycans (a) Porcine intestinal tissue sections stained with DAPI (blue) and incubated with CFDA-SE tagged \u003cem\u003eL. reuteri\u003c/em\u003e (green) for 1 h; mucin glycans stained with UEA-1 (red). (b) Adhesion of bacterium to mucin oligosaccharides. Different letters (a vs b) indicate significant differences (p \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-5141739/v1/a87b440b39369c9a0e2a51e6.png"},{"id":74220393,"identity":"11de343d-ec61-4db6-8192-7e4f68157dc7","added_by":"auto","created_at":"2025-01-20 06:31:13","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2410715,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eL. reuteri\u003c/em\u003e enzymatic profiling in mucin glycan interaction (a) \u003cem\u003eL. reuteri\u003c/em\u003e and \u003cem\u003eBt \u003c/em\u003egenome analysis for mucin-degrading GH families using CAZy. (b) PCR detection of GH2 and GH42 genes in the genome of \u003cem\u003eL. reuteri\u003c/em\u003e. (c) \u003cem\u003eL. reuteri\u003c/em\u003e cannot grow in medium B+M, while \u003cem\u003eBt\u003c/em\u003e can. Different letters (a vs b, a vs c and b vs c) indicate significant differences (p \u0026lt; 0.05) within the group, one-way ANOVA. (d) SDS-PAGE analysis of mucin residues in the medium incubated with bacterial strains. (e) Mucin degradation assay in an agarose petri dish.\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-5141739/v1/4e00540cdb87d3ebe1e40b88.png"},{"id":74219024,"identity":"10fbc76a-2ca9-4784-9f96-c70907f652d1","added_by":"auto","created_at":"2025-01-20 06:23:13","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3077291,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eL. reuteri\u003c/em\u003e utilization of oligosaccharides cleaved by mucin-degrading microbes\u003cstrong\u003e \u003c/strong\u003e(a) Determination of the growth curve of \u003cem\u003eL. reuteri\u003c/em\u003e in medium MRS. (b) Determination of the growth curve of \u003cem\u003eL. reuteri\u003c/em\u003e in medium B with various oligosaccharides added. (c) The addition of mucin-degrading microbes to media containing mucin and inoculating with \u003cem\u003eL. reuteri \u003c/em\u003eresulted in increased optical density. And viable bacterial counting was employed to verify the increased growth of \u003cem\u003eL. reuteri\u003c/em\u003e. Different letters (a vs b, a vs c, a vs d, b vs c, b vs d and c vs d) indicate significant differences (p \u0026lt; 0.05). (d) The degradation of mucin was responsible for the observed increase in \u003cem\u003eL. reuteri\u003c/em\u003e growth but not bacterial metabolites. Different letters (a vs b) indicate significant differences (p \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-5141739/v1/434cd9212b23e944a95fd2e5.png"},{"id":74219045,"identity":"28dd47b7-36c4-45ee-9ec3-4c4e25a56786","added_by":"auto","created_at":"2025-01-20 06:23:14","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3164624,"visible":true,"origin":"","legend":"\u003cp\u003eDCs capture \u003cem\u003eL. reuteri in vitro\u003c/em\u003e (a) \u003cem\u003eL. reuteri\u003c/em\u003e J31, recombinant \u003cem\u003eL. reuteri \u003c/em\u003eS1/J31, and recombinant \u003cem\u003eL. reuteri \u003c/em\u003eS1-6aa/J31 were detected in the lower compartment of the transwell in the presence of DCs, but not in the monocytes group. (b) The fluorescence value detection showed that \u003cem\u003eL. reuteri\u003c/em\u003e reached the lower compartment of the transwell in DCs.\u003c/p\u003e","description":"","filename":"Fig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-5141739/v1/bc4f7194b56496b38c3235f5.png"},{"id":74219035,"identity":"3d4f36a9-57fa-444b-bcd0-0a128182023b","added_by":"auto","created_at":"2025-01-20 06:23:13","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":13750267,"visible":true,"origin":"","legend":"\u003cp\u003eDCs capture \u003cem\u003eL. reuteri in situ\u003c/em\u003e (a) Z-scan images under laser confocal microscopy for frozen immunostained porcine intestinal tissue sections injected with CFDA-SE-labeled \u003cem\u003eL. reuteri \u003c/em\u003e(green) and stained with DAPI (blue) and anti-DC-SIGN (red). (b) The intestinal explants were stained with CMRA (blue) and anti-DC-SIGN (red). The typical optimal z-step size was 0.5–1 μm. Serial 40–50 μm Z-scan images were collected and reconstructed using Imaris software (Bitmap). Z-scan images are displayed on the right side of the 3D image.\u003c/p\u003e","description":"","filename":"Fig.7.png","url":"https://assets-eu.researchsquare.com/files/rs-5141739/v1/17744b75d1167bae5cd0fc23.png"},{"id":74219078,"identity":"80078097-07ec-4e9b-bf48-1621c21802b4","added_by":"auto","created_at":"2025-01-20 06:23:16","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":3098804,"visible":true,"origin":"","legend":"\u003cp\u003eInfluence of \u003cem\u003eL. reuteri\u003c/em\u003e on immune function of DCs (a) Detection of surface molecule expression in DCs by flow cytometry. (b) Detection of T-cell proliferation mediated by DCs stimulated by \u003cem\u003eL. reuteri.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Fig.8.png","url":"https://assets-eu.researchsquare.com/files/rs-5141739/v1/68b232302a9686ab82e50f73.png"},{"id":74221580,"identity":"4f786606-5f78-4a40-a373-40fcc09a819e","added_by":"auto","created_at":"2025-01-20 06:40:00","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":74036202,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5141739/v1/c53329ac-c4de-4e4c-afa4-7c02287a2ba3.pdf"},{"id":74219038,"identity":"454320a0-1233-49b9-842f-f73eea8e1594","added_by":"auto","created_at":"2025-01-20 06:23:13","extension":"docx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":3568875,"visible":true,"origin":"","legend":"","description":"","filename":"supplementalmaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-5141739/v1/d293d06a86c05ec72085d937.docx"}],"financialInterests":"","formattedTitle":"Pig-Derived Lactobacillus reuteri as an Oral Vaccine Delivery System Overcomes the Intestinal Mucus Barrier to Induce Immune Responses","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMany infectious diseases result from pathogenic infiltration through the mucosal tract. Vaccines delivered to mucosal tissues can mimic natural infections, offering protection at the primary site of infection\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. The largest mucosal surface, the GI tract, is readily accessible via oral administration. LAB, as resident gut bacteria, are widely employed as delivery carriers for oral antigens\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Mucosal administration of LAB through the oral route has been shown to stimulate both mucosal and systemic immune responses, as supported by extensive research data\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Nevertheless, the gastrointestinal system poses inherent challenges, subjecting orally administered vaccines to the same host defense barriers as microbial pathogens and other foreign macromolecules\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Especially, the intestine boasts a protective barrier in the form of a mucus layer, selectively permitting the permeation of luminal antigens and microbes\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. While this mucus layer serves as a protective barrier against microbes, it also presents a complex barrier to oral delivery\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Although LAB are known to tolerate the intestinal environment, the mechanism by which LAB delivery carriers overcome obstacles in the GI tract, particularly the mucus layer, remains unidentified. Therefore, unraveling this mechanism will contribute to optimizing the design strategy of LAB carrier oral vaccines and enhancing the ability of such carrier vaccines to prevent intestinal infectious diseases.\u003c/p\u003e \u003cp\u003eMucus is a hydrogel (\u0026gt;\u0026thinsp;95% water) consisting of a mixture of proteins, carbohydrates, lipids, salts, and antibodies, forming a barrier against foreign particulates and pathogens\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. The main structural component present in mucus is mucin, with over twenty different mucin molecules in this family, among which the most abundant are MUC2, MUC5AC, and MUC6\u003csup\u003e9\u003c/sup\u003e. Mucin is heavily glycosylated with O-linked oligosaccharides, whereas the C- and N-terminal regions consist primarily of N-linked oligosaccharides\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Each glycan side chain may consist of up to 20 sugars, including sialic acid [N-acetylneuraminic acid and N-glycolylneuraminic acid] (NANA), fucose, N-acetyl-galactosamine (GalNAc), mannose, galactose, glucose, and N-acetylglucosamine (GlcNAc) \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Some bacteria can utilize adhesins that interact and bind to these oligosaccharide side chains on mucins, thereby becoming immobilized in mucus\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. In addition, some bacteria harbored specific glycosyl hydrolases (GH) can enzymatically cleave mucin glycan structures and utilize mucin as a carbohydrate source\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. GH families cleave O-linked mucin-glycans, including NANA (GH 33), GalNAc (GH 101 and 129), GlcNAc (GH 84, 85, 89, and 98), galactose (GH 2, 20, and 42), or fucose (GH 29 and 85). Additionally, the N-linked mucin glycans mannose can be removed with GH families 38 and 125. Both commensal and pathogenic bacteria can degrade and utilize mucin glycans as an energy source and attachment sites, promoting their replication and colonization. However, pathogenic bacteria are also capable of causing infection\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn this study, we aimed to address the question of how LAB overcomes the intestinal mucus of piglets to promote an immune response. The model strains utilized include \u003cem\u003eL. reuteri\u003c/em\u003e J31 and recombinant \u003cem\u003eL. reuteri\u003c/em\u003e S1/J31 expressing the PEDV S1 protein. These strains were employed to investigate their penetration into the mucus layer, interaction with mucin glycan, and pathways for overcoming the mucus barrier using both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e methods. It is hoped that this study will contribute to our understanding of the mechanism by which \u003cem\u003eL. reuteri\u003c/em\u003e, as an oral vaccine carrier, overcome the porcine intestinal mucus barrier and induces a mucosal immune response. Additionally, our study aimed to offer new insights for the design and enhancement of LAB oral vaccines.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eBacterial strains and culture conditions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eL. reuteri\u003c/em\u003e J31 (MK921700), \u003cem\u003eL. reuteri\u003c/em\u003e S1/J31\u003csup\u003e15\u003c/sup\u003e, \u003cem\u003eL. reuteri\u003c/em\u003e S1-6aa/J31\u003csup\u003e15\u003c/sup\u003e and \u003cem\u003eL. reuteri\u0026nbsp;\u003c/em\u003eCO21 (MK920155) were either isolated or constructed by our laboratory. All \u003cem\u003eL. reuteri\u003c/em\u003e strains were cultured in MRS medium, with or without chloramphenicol, under aerobic conditions at 37 ℃.\u003cem\u003e\u0026nbsp;Bacteroides thetaiotaomicron\u0026nbsp;\u003c/em\u003eDSM2079ATCC 29148 (bio-78496) was cultured in gifu anaerobic medium (Hopebio HB8518-3) supplemented with 0.001% hemin chloride (Hopebio 2100500) and 0.5% of 0.1% vitamin K1 (Hopebio 2100501). \u003cem\u003eBt\u0026nbsp;\u003c/em\u003eDSM2079 was grown anaerobically in an AnaeroPack™ 7.0 L rectangular jar (Thermo Scientific™ R685070) at 37 ℃.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell culture and mucus identification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHT29-MTX-E12 (Fuhengbio FH1297), Caco-2, and IPEC J2 cell lines were maintained in DMEM medium, supplemented with 10% fetal bovine serum (FBS) (Invitrogen A5670701) at 37 ℃, in a 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere. For co-culture experiments, Caco-2 and HT29-MTX cells were seeded at a 3:1 ratio at 157,000 cells/cm\u003csup\u003e2\u003c/sup\u003e in complete DMEM and cultured for up to 21 days post-seeding, with the culture medium being changed three times each week. 24-well inserts (polyester membrane, 8 μm pore size; Corning 3422) were used for transwell assays. For the identification of mucus, the co-cultured cells were fixed using 4% paraformaldehyde (PFA) for 30 min at room temperature. The fixing solution was then replaced with alcian blue (pH 2.5) (Sigma 101647) dissolved in acetic acid to visualize acidic mucosubstances attached to the cells. Incubation in the dark at room temperature for 30 min, and subsequent rinsing of cells was performed until the supernatant was clear. Brightfield microscope images were captured for analysis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLigated loop experiment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSeven-day-old piglets (Landrace pig, purchased from the Acheng Experimental Internship Base of Northeast Agricultural University) were anesthetized with pentobarbital sodium, and a midline incision was made just anterior to the navel. All animal experiments followed Northeast Agricultural University’s (Harbin, China) regulations and guidelines for laboratory animals. Intestine segments received injections for four treatments: PBS (2 mL/segment), carboxyfluorescein diacetate, succinimidyl ester (CFDA-SE, Thermo Fisher C1157) labeled \u003cem\u003eL. reuteri\u003c/em\u003e J31 (10\u003csup\u003e8\u0026nbsp;\u003c/sup\u003eCFU/segment), CFDA-SE labeled recombinant \u003cem\u003eL. reuteri\u003c/em\u003e S1/J31 (10\u003csup\u003e8\u0026nbsp;\u003c/sup\u003eCFU/segment) and CFDA-SE labeled recombinant \u003cem\u003eL. reuteri\u003c/em\u003e S1-6aa/J31 (10\u003csup\u003e8\u0026nbsp;\u003c/sup\u003eCFU/segment). Throughout the procedure, piglets were kept warm on a 37 ℃ warming pad. After 1 h, the intestines were removed, embedded in paraffin or OCT, and cut into 6 μm sections for immunofluorescence, or fixed with 2.5 % glutaraldehyde for SEM, as described below.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCollection and preparation of native mucus samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNative porcine intestinal mucus was extracted from 7-day-old piglets which were anesthetized after an overnight fast. The small intestine was isolated, and mucus was carefully collected and transferred into 2 mL sample vials, which were stored at -80 ℃ until experimentation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eScanning electron microscopy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUltra-structural analysis of porcine tissue was conducted using SEM. Porcine small intestinal segments were fixed with 2.5% glutaraldehyde in 0.1 M PIPES buffer (pH 7.2) overnight. The frozen ex vivo porcine mucus was thawed, and 100 μL was added to the center of a 15 × 15 × 5 mm mold containing 2% agarose and the excess agarose was trimmed. Subsequently, the porcine small intestinal segments and mucus samples were washed with 0.1 M PIPES buffer for 3 × 15 min, respectively, and dehydrated through a series of ethanol solutions (50, 70, 90,2 × 100%) in each solution for at least 15 min. Tissue and mucus samples were subjected to critical point drying in the Leica EM CPD300 (Leica Microsystems, Mannheim, Germany). Subsequently, the samples were mounted on the aluminum SEM stub with the lumen surface facing up using silver paint. The samples were then gold-plated in an agar high-resolution sputter coater. SEM imaging was performed at 5 kV using a SU8010 FEM (Hitachi, Japan). The average mucin pore size was calculated from the perimeter measured in representative images and determined using Image Pro Plus. At least 200 pores were measured from four perspectives.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExamination of bacteria in small intestinal content of newborn piglets\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe small intestine segments of anesthetized newborn piglets (anesthetized immediately after birth) were collected and promptly immersed in a sterile PBS buffer. The intestinal segments were longitudinally cut, and the intestinal contents were cultured on LB and MRS media surfaces at 37 ℃ for 72 h. Additionally, smears of the intestinal contents were prepared for Gram staining and microscopic observation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranswell assay to evaluate \u003cem\u003eL. reuteri\u003c/em\u003e penetration across mucus\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCaco-2 and HT29-MTX cells were seeded at a 3:1 ratio on a 24-well polycarbonate membrane transwell plate with 8 µm pores for 21 days. Meanwhile, IPEC-J2 cells formed a monolayer on a similar transwell plate. Using a wiretrol applicator, 150 µL of mucus was transferred onto the IPEC-J2 cell monolayer. Subsequently, 600 µL of MRS was pipetted into the bottom transwell compartment. To each sample, 20 µL of CFDA-SE-labeled bacteria was added. The transwell plates were then incubated at 37 ℃ for 4 h. The transit of the bacteria from the mucus-containing transwell to the receiver plate was observed using a ZOE fluorescence microscope (Bio-Rad, Hercules, CA, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranswell assay to evaluate \u003cem\u003eL. reuteri\u0026nbsp;\u003c/em\u003esampling by trans-epithelial DCs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs described above, IPEC-J2 cells formed a monolayer on a 24-well polycarbonate membrane transwell plate, and 150 µL of mucus was transferred onto the IPEC-J2 cell monolayer. DCs were obtained, as per a method described in previous studies\u003csup\u003e16,17\u003c/sup\u003e, and cultured in the bottom transwell compartment. After washing the DCs with PBS three times, they were stained with PE-labeled pig CD172a antibody (SouthernBiotech 4525-09) (1640 medium 1:100 dilution) at 37 ℃ for 30 min. Subsequently, the DCs were stained with 4,6-diamidino-2-phenylindole (DAPI) solution (Invitrogen 62248) for 10 min at room temperature, and washed again with PBS three times. To each sample, 20 µL of CFDA-SE-labeled bacteria was added. The transwell plates were incubated at 37 ℃ with 5% CO\u003csub\u003e2\u003c/sub\u003e for 4 h. The bottom transwell compartment was washed twice with PBS, fixed at room temperature with 4% formaldehyde for 15 min, and washed three times with PBS. Observations were made using fluorescence microscopy. The liquid and cells from the bottom transwell compartment were collected and observed by a fluorospectrophotometer (F-7100, Hitachi, Japan).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFluorescent immunohistology was performed on cryosections. Sections were initially blocked for 30 min with PBS containing 0.3% bovine serum albumin (BSA). Primary antibodies, including rabbit anti-MUC2 (dilution: 1:200, Cloud-Clone MAA705Hu22) and rabbit anti-DC-SIGN (dilution: 1:200,\u0026nbsp;ABclonal A23593), were added to the slides for 1 h at 37 ℃. Subsequently, AlexaFluor\u003csup\u003eTM\u003c/sup\u003e 633-conjugated goat anti-rabbit IgG (dilution: 1:1000,\u0026nbsp;Invitrogen A-21071) was applied for 30 min at 37 ℃. Cell nuclei were stained via 8 min incubation with DAPI solution. Each incubation step was followed by washing in PBS, with the solution refreshed every 5 min. The labelled sections were sealed with nail varnish and stored at 4 ℃. Negative control slides were treated identically. Images were acquired using either an inverted confocal microscope (FV3000; Olympus), with a typical optimal z-step size of 0.5-1 μm, or an ultra-high-resolution microscope (Deltavision OMX SR; GE).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eL. reuteri\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;adherence assays \u003cem\u003ein vitro\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo remove glycans from tissue, paraffin sections were processed as previously described\u003csup\u003e18\u003c/sup\u003e. Briefly, sections were incubated with 0.1 M NaOH for 30 min at room temperature and oxidized by adding 100 mM NaIO\u003csub\u003e4\u003c/sub\u003e in 100 mM acetate buffer (pH 4.5) overnight at 4 ℃. Reactive aldehydes were neutralized through incubation with a 2% glycine solution for 30 min, and beta-elimination was performed by adding 0.1 M NaOH for 30 min at room temperature. Mucus glycans were detected by staining with the lectin UEA-1 (Ulex Europaeus Agglutinin-1; Vector Laboratories B-1065-2; 1:200 dilution) for 30 min at room temperature. These sections were then exposed to CFDA-labeled \u003cem\u003eL. reuteri\u003c/em\u003e at 37 ℃ for 1 h and visualized on a ZOE fluorescence microscope. 200 uL of various mucin oligosaccharides were added in a black 96-well enzyme-linked plate and maintained at 4 ℃ overnight. Subsequently, the plate was washed three times with PBS containing 0.05% Tween-20 (PBST), followed by the addition of 300 uL of protein-free blocking buffer (Thermo Scientific 37572) at room temperature for 1 h. 200 uL of CFDA-SE labeled bacterial suspension (OD\u003csub\u003e600\u003c/sub\u003e=1.0) was added and incubated at 4 ℃ for 4 h. Subsequently, the plate was washed three times with PBST. Next, 200 uL of 0.1 M NaOH containing 1% (w/v) SDS was added and incubated at 37 ℃ for 1 h. Finally, bacterial detection was performed using a microplate reader (SpectraMax reg iD3, Molecular Devices).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIdentification of microbial glycosyl hydrolases using the CAZy and PCR analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBacterial GH were examined using the CAZy database (http://www.cazy.org), following established protocols\u003csup\u003e19,20\u003c/sup\u003e. For analysis, only GH known to participate in mucin degradation (GH 2, 20, 29, 33, 38 42, 84, 85, 89, 95, 101, 125, and 129) were considered. To amplify the GH2 and GH42 genes of \u003cem\u003eL. reuteri\u003c/em\u003e, the primer pairs TCGATGATCGTCACTCAGATTAC / AGCCATAGTAGTATCTTACCTCCT and GTCCGGTTGGCATGACTAAT / GGTGCGGATACCGTTCAAT were designed, utilizing genomic DNA extracted with a Universal Genomic DNA Purification Kit (Beyotime) as a template. Similarly, for \u003cem\u003eBt\u0026nbsp;\u003c/em\u003eDSM2079, the primer pairs TCACTTTCTTCCACTCCGAATC / CATCGTCCGATGTCCGTAATAA and TTGCAGGTGAGACTGCTTATC / TCCAGTTCAGCCCATCATAAC were designed to amplify the GH2 and GH42 genes\u003cem\u003e.\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMucin degradation \u003cem\u003ein vitro\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHog gastric mucin (HGM) (Type Ⅱ, Sigma M2378) was subjected to repeated ethanol precipitation for purification\u003csup\u003e21\u003c/sup\u003e. Strains were anaerobically cultured in the following medium: 0.75% tryptone (Oxoid LP0043), 0.75% casitone (Oxoid), 0.3% yeast extract (Oxoid LP0021), 0.5% meat extract (Merck 1.32411.9025), 0.5% NaCl, 0.3% K\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e·3H\u003csub\u003e2\u003c/sub\u003eO, 0.05% KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 0.05% MgSO\u003csub\u003e4\u003c/sub\u003e·7H\u003csub\u003e2\u003c/sub\u003eO, 0.05% cysteine HCI (Sigma C6852), and 0.0002% resazurin (Sigma R7017), with a pH of 7.2±0.2 (medium B). In specified cases, 0.3 % purified HGM (medium B+M) or 0.5% glucose (medium B+G) and 1.5% agarose (Sigma A9539) were included. 200 uL of the 24 h cultures of either \u003cem\u003eL. reuteri\u003c/em\u003e or \u003cem\u003eBt\u0026nbsp;\u003c/em\u003eDSM2079 were incubated at 37 ℃ for 48 h with 10 ml of either medium B, medium B containing 0.3% HGM with or without 0.5% glucose (medium B+M, B+M+G), or medium B containing 0.5% glucose (medium B+G). Monitoring the bacterial growth involved assessing changes in turbidity (absorbance at 600 nm) and pH values of the cultures. Each sample underwent triplicate assays. Following incubation, mucin pellets were precipitated as described in a previous study\u003csup\u003e22\u003c/sup\u003e, and resuspended in 0.5 ml of 10 mM Tris-HCl buffer. The electrophoretic patterns of ethanol-precipitated mucin samples following incubation with bacterial cultures were analyzed using SDS-PAGE\u003csup\u003e23\u003c/sup\u003e. The plate test was conducted in a petri dish as described in a previous study\u003csup\u003e22\u003c/sup\u003e. Briefly, HGM and agarose were incorporated into medium B at concentrations of 0.5% (w/v) and 1.5% (w/v), respectively. Ten μL of 24 h viable bacterial cultures were inoculated onto the surface of the agarose medium in a petri dish. The plates were incubated at 37 ℃ anaerobically for 72 h and subsequently stained with 0.1% amido black in 3.5 M acetic acid for 30 min. The plates were then washed with 1.2 M acetic acid.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStaining of the intestinal explants \u003cem\u003ein vitro\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe intestine was collected from anesthetized piglets, and segments of the intestine were immediately everted and gently washed with RPMI 1640. The tissue segments were stained with 125 nM CellTracker Orange CMRA Dye (Thermo Fisher C34551) for 5 min at 37 ℃, washed, and immobilized on a culture dish (Biosharp BS-20-GJM). Images were acquired using an inverted confocal microscope (FV3000; Olympus). The typical optimal z-step size was 0.5-1 μm. Serial 40-50μm Z-scan images were collected and reconstructed using Imaris software (Bitmap).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eL. reuteri\u003c/em\u003e J31 and recombinant \u003cem\u003eL. reuteri\u003c/em\u003e S1/J31, S1-6aa/J31 were added to immature DCs cultured for 5 days, and the ratio of cells and bacteria was 1:100. The cells were cultured at 37 ℃ and 5% CO\u003csub\u003e2\u003c/sub\u003e for 12 h, and the cells stimulated by the same amount of PBS and LPS were used as the control group. DCs in each group were collected into 1.5 mL EP tubes after repeated blowing, centrifuged at 1800 rpm for 10 min, and the supernatant was discarded. After washing twice with PBS, resuspend the pellet with 1 mL of PBS. MHC-Ⅱ-FITC (Abcam ab24882), CD80-FITC (Abcam ab95550) and CD86-FITC (Abcam ab77276) antibodies were added, incubated at 4 ℃ for 30 min, centrifuged at 1800 rpm for 10 min, the supernatant was discarded and washed twice with PBS. The cell pellet was resuspended with 500 µL PBS, and the expression of cell surface molecules was detected by flow cytometry (FACSCelesta; BECTON DICKINSON).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAllogeneic mixed lymphocyte reaction (MLR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePBMCs, as the reactive cells, were isolated from the peripheral blood of piglets by Ficoll gradient centrifugation and washed three times with RPMI 1640 medium. DCs were co-cultured with \u003cem\u003eL. reuteri\u003c/em\u003e or LPS (Sigma L4391) and treated with mitomycin C (25 µg/mL) (GlpBio GC12353) for 1 hour at 37°C. The cells were counted and resuspended in RPMI 1640 medium, which served as the stimulated cells. The reaction cells were added to 96-well plates, and the stimulated cells were introduced at ratios of 1:1, 1:10, and 1:100. DCs and lymphocytes were set as negative control wells, while RPMI 1640 culture medium served as the blank control well. Each well was replicate three times. The well plates were incubated for 72 hours in a 37°C incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e. Finally, CCK-8 (Beyotime C0038) was added to the 96-well plates, and the OD\u003csub\u003e450\u003c/sub\u003e value was measured on an ELISA reader (Bio-Tech Instruments, USA). The stimulation index (SI) was calculated following the formula: SI = (OD\u003csub\u003esample well\u003c/sub\u003e–OD\u003csub\u003eblank well\u003c/sub\u003e)/(OD\u003csub\u003enegative well\u003c/sub\u003e–OD \u003csub\u003eblank well\u003c/sub\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGraphPad Prism software was used to generate all graphs. One-way or two-way ANOVA with a Bonferroni posthoc test was employed for all assessments, and statistical significance was determined by Student’s t-test. The data are presented as mean ± SEM, and different letters (a,b, c and d) in figures 3, 4, 5 and 7 indicate significant differences (p \u0026lt; 0.05).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eL. reuteri\u003c/b\u003e \u003cb\u003epenetration across porcine intestinal mucus\u003c/b\u003e \u003cb\u003eex vivo\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA transwell assay was employed to assess the permeability of \u003cem\u003eL. reuteri\u003c/em\u003e in porcine intestinal mucus \u003cem\u003eex vivo\u003c/em\u003e. PEDV S1 antigen was expressed in recombinant \u003cem\u003eL. reuteri\u003c/em\u003e S1/J31 (Additional file 1). Caco-2 and HT29-MTX-E12 cells were co-cultured in the upper compartment of the transwell to model the small intestinal epithelium \u003cem\u003ein vitro\u003c/em\u003e. Alcian blue staining confirmed the secretion of mucus by HT29-MTX-E12 cells in this study (Additional file 2). The transwell assays revealed that no \u003cem\u003eL. reuteri\u003c/em\u003e could traverse the Caco-2/HT29-MTX-E12 monolayer to reach the lower compartment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). To identify the factor responsible for the absence of \u003cem\u003eL. reuteri\u003c/em\u003e in the lower compartment, an additional \u003cem\u003ein vitro\u003c/em\u003e model of the GI tract was employed, involving the addition of small intestine mucus manually scraped onto the IPEC-J2 cell monolayer. Scanning electron microscopy (SEM) was utilized to examine porcine intestinal segments and mucus manually scraped from the porcine intestine. The results revealed similar 'net-like' structures in both, displaying pores within the mucus (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). The mean mucin pores of the mucus \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003eex vivo\u003c/em\u003e ranged between 220 nm and 350 nm (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). This observation suggests that the mucin polymer network is maintained following removal from the mucosal surface. Therefore, \u003cem\u003eex vivo\u003c/em\u003e mucus was employed to establish an \u003cem\u003ein vitro\u003c/em\u003e model, incorporating the addition of mucus and/or IPEC-J2 in the upper compartment of the transwell. The results demonstrated that, when only mucus was present in the upper compartment, \u003cem\u003eL. reuteri\u003c/em\u003e could be detected in the lower compartment using a fluorescence microscope. However, no \u003cem\u003eL. reuteri\u003c/em\u003e was detected in the lower compartment when IPEC-J2 cells were present (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). The findings indicate that \u003cem\u003eL. reuteri\u003c/em\u003e can penetrate the intestinal mucus of piglets \u003cem\u003ein vitro\u003c/em\u003e but cannot traverse IPEC-J2 cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eL. reuteri\u003c/b\u003e \u003cb\u003elocalization in the mucus layer of piglet intestinal tissue\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo experimentally validate our \u003cem\u003ein vitro\u003c/em\u003e observations, \u003cem\u003ein vivo\u003c/em\u003e tests were conducted. Initially, bacterial culture and Gram staining of the small intestine contents of newborn piglets (anesthetized immediately after birth) confirmed the sterility of the small intestine in newborn piglets (Additional file 3). Subsequently, \u003cem\u003eL. reuteri\u003c/em\u003e was injected into the ligated small intestine of anesthetized newborn piglets. SEM results demonstrated the presence of \u003cem\u003eL. reuteri\u003c/em\u003e in the mucus layer overlaying the villi (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Immunostaining of frozen sections, observed with an ultra-high-resolution microscope, revealed a significant number of \u003cem\u003eL. reuteri\u003c/em\u003e in the intestinal cavity, with a small amount observed in the mucus overlaying the intestinal epithelial cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). Subsequent Z-scan images collected using a laser confocal microscope yielded similar results (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). These findings indicate that \u003cem\u003eL. reuteri\u003c/em\u003e can indeed penetrate into the intestinal mucus; however, almost no contact with epithelial cells was observed.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eL. reuteri\u003c/b\u003e \u003cb\u003eadherence to porcine intestinal mucin glycans\u003c/b\u003e\u003c/p\u003e \u003cp\u003eHighly O-glycosylated mucin proteins can function as ligands for bacterial adhesins. To confirm the adhesion of \u003cem\u003eL. reuteri\u003c/em\u003e to mucin glycans, slides containing 7 \u0026micro;m sections of fixed tissue from a 7-day-old porcine small intestine were incubated with fluorescently labeled \u003cem\u003eL. reuteri\u003c/em\u003e. Glycan colocalization was examined using the lectin \u003cem\u003eUlex Europaeus\u003c/em\u003e Agglutinin-1 (UEA-1), which specifically recognizes fucose residues. We observed \u003cem\u003eL. reuteri\u003c/em\u003e within the UEA-1 positive mucus (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). To further demonstrate specificity for mucin glycans, tissue sections were oxidized and underwent acid-hydrolysis and beta-elimination. Incubation of fluorescently labeled \u003cem\u003eL. reuteri\u003c/em\u003e with these glycan-removed tissue sections resulted in little to no adhesion (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). These data indicate that \u003cem\u003eL. reuteri\u003c/em\u003e adheres to the glycan component of porcine intestinal mucin. Additionally, the adhesion of \u003cem\u003eL. reuteri\u003c/em\u003e to oligosaccharides was tested. The results demonstrated that \u003cem\u003eL. reuteri\u003c/em\u003e J31 exhibited strong adhesion to mannose (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). Meanwhile, the adhesion of \u003cem\u003eL. reuteri\u003c/em\u003e CO21 strain and some pathogenic bacteria to mucin oligosaccharides indicated that different bacteria adhere to different oligosaccharides. These data suggest that \u003cem\u003eL. reuteri\u003c/em\u003e preferentially adheres to mucin glycans, potentially facilitating intestinal colonization.\u003c/p\u003e \u003cp\u003e \u003cb\u003eL. reuteri\u003c/b\u003e \u003cb\u003eenzymatic profiling in mucin glycan interaction\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo determine whether \u003cem\u003eL. reuteri\u003c/em\u003e J31 possesses GH capable of degrading mucus, we examined the \u003cem\u003eL. reuteri\u003c/em\u003e genome for GH families related to mucin glycan degradation using the carbohydrate-active enzymes Database (CAZy). The mucin-degrading bacterium \u003cem\u003eBacteroides thetaiotaomicron\u003c/em\u003e DSM2079 (\u003cem\u003eBt\u003c/em\u003e) served as the positive control. All strains of \u003cem\u003eL. reuteri\u003c/em\u003e harbored GH families 2, with some also containing GH families 42, however, the copy numbers of these genes were very low, ranging from one to two copies (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). The polymerase chain reaction (PCR) results confirmed the expression of GH2 and GH42 genes in \u003cem\u003eL. reuteri\u003c/em\u003e J31 and recombinant \u003cem\u003eL. reuteri\u003c/em\u003e pPG-S1/J31 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). To assess the degradation effect of \u003cem\u003eL. reuteri\u003c/em\u003e on mucin, we supplemented basic culture medium B with mucin and/or glucose and monitored \u003cem\u003eL. reuteri\u003c/em\u003e growth. The results revealed that the positive control strain \u003cem\u003eBt\u003c/em\u003e could utilize mucin, whereas \u003cem\u003eL. reuteri\u003c/em\u003e could not (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). SDS-PAGE analysis of mucin residues in the medium incubated with bacterial strains and mucin degradation assays in agarose petri dishes further confirmed that \u003cem\u003eBt\u003c/em\u003e could degrade mucin, while \u003cem\u003eL. reuteri\u003c/em\u003e could not (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003ed and e). These findings indicate that, despite containing the GH gene, \u003cem\u003eL. reuteri\u003c/em\u003e exhibited no significant degradation of mucin.\u003c/p\u003e \u003cp\u003e \u003cb\u003eL. reuteri\u003c/b\u003e \u003cb\u003eutilization of oligosaccharides cleaved by mucin-degrading microbes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe O- and N-glycosylated residues on mucin can provide an environment rich in nutrients\u003csup\u003e\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Therefore, we initially tested whether \u003cem\u003eL. reuteri\u003c/em\u003e could utilize the carbohydrates present in mucin. \u003cem\u003eL. reuteri\u003c/em\u003e was cultivated in medium B with the addition of different carbohydrates, and the growth curves illustrated varying degrees of promotion in \u003cem\u003eL. reuteri\u003c/em\u003e growth with various mucin oligosaccharides, with galactose exhibiting the most significant effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e5\u003c/span\u003ea and b). To identify whether mucin-degrading bacteria could liberate mucin-glycans, thereby cross-feeding \u003cem\u003eL. reuteri\u003c/em\u003e, we cultivated \u003cem\u003eL. reuteri\u003c/em\u003e in medium B containing mucin as the sole carbon source in the presence or absence of \u003cem\u003eBt .\u003c/em\u003e Consistent with our previous findings, we observed that \u003cem\u003eL. reuteri\u003c/em\u003e was unable to grow on mucin alone. However, the addition of mucin-degrading microbes to media containing mucin resulted in increased optical density (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). Given that \u003cem\u003eBt\u003c/em\u003e cannot grow in MRS medium, viable bacterial counting was employed to verify the increased growth of \u003cem\u003eL. reuteri\u003c/em\u003e with \u003cem\u003eBt\u003c/em\u003e in mucin-containing B\u0026thinsp;+\u0026thinsp;M compared to inoculating \u003cem\u003eL. reuteri\u003c/em\u003e alone in B\u0026thinsp;+\u0026thinsp;M (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). To confirm that the degradation of mucin was responsible for the observed increase in \u003cem\u003eL. reuteri\u003c/em\u003e growth and not bacterial metabolites, we separately cultured \u003cem\u003eL. reuteri\u003c/em\u003e and \u003cem\u003eBt\u003c/em\u003e in medium B with or without mucin overnight. We then used the filtered cell-free supernatants to assess whether hydrolyzed mucin byproducts produced by \u003cem\u003eBt\u003c/em\u003e could influence the growth of \u003cem\u003eL. reuteri\u003c/em\u003e. The results showed that \u003cem\u003eL. reuteri\u003c/em\u003e grew when cultured in the presence of 25% cell-free supernatant from \u003cem\u003eBt\u003c/em\u003e grown in B\u0026thinsp;+\u0026thinsp;M (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e5\u003c/span\u003ed). These data indicate that the growth of \u003cem\u003eL. reuteri\u003c/em\u003e in the intestinal mucus layer relies on mucin-degrading microbes when mucoglycans are the sole carbon source.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDCs capture\u003c/b\u003e \u003cb\u003eL. reuteri\u003c/b\u003e: \u003cb\u003eimplications for mucosal immune response induction\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBuilding upon our previous observations, \u003cem\u003eL. reuteri\u003c/em\u003e adheres to the intestinal mucus layer but does not directly contact epithelial cells. This raises the question of how \u003cem\u003eL. reuteri\u003c/em\u003e expressing a foreign protein induces a mucosal immune response. The key to triggering the immune response lies in the sampling of antigens by antigen-presenting cells within the intestinal lumen\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. DCs are specialized antigen-presenting cells, prompting an investigation into whether \u003cem\u003eL. reuteri\u003c/em\u003e is sampled by these cells. In order to more comprehensively analyze the interaction between \u003cem\u003eL. reuteri\u003c/em\u003e and DCs, a recombinant \u003cem\u003eL. reuteri\u003c/em\u003e fused expressing with PEDV S1 antigen and DCs targeting peptide 6aa was added and applied in subsequent experiments, and the protein expression was verified (Additional file 4). DCs were isolated and cultured from porcine peripheral blood (Additional file 5). An \u003cem\u003ein vitro\u003c/em\u003e transwell assay demonstrated that, in the presence of DCs, \u003cem\u003eL. reuteri\u003c/em\u003e can traverse mucus and IPEC-J2, being captured by DCs, while monocytes were added to the lower compartment of the transwell, no \u003cem\u003eL. reuteri\u003c/em\u003e was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). Fluorescence value detection further confirmed that \u003cem\u003eL. reuteri\u003c/em\u003e reached the lower compartment of the transwell in the presence of DCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eb). These results indicated that the sampling of \u003cem\u003eL. reuteri\u003c/em\u003e to the lower compartment is attributed to DCs. To further determine the capture of \u003cem\u003eL. reuteri\u003c/em\u003e by DCs \u003cem\u003ein vivo\u003c/em\u003e, CFDA-SE-labeled \u003cem\u003eL. reuteri\u003c/em\u003e was injected into the small intestine of 7-day-old piglets. After one hour, the presence of \u003cem\u003eL. reuteri\u003c/em\u003e within DCs was observed through laser confocal Z-scan images (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e7\u003c/span\u003ea). Additionally, intestinal explants were stained with CMRA and anti-DC-SIGN following \u003cem\u003eL. reuteri\u003c/em\u003e injection. Using an inverted confocal microscope, serial 40\u0026ndash;50 \u0026micro;m Z-scan images with a typical optimal z-step size of 0.5\u0026ndash;1 \u0026micro;m were collected and reconstructed with Imaris software (Bitmap). The resulting 3D images, along with synchronous Z-scans, showed that \u003cem\u003eL. reuteri\u003c/em\u003e (green) were captured by DCs (red) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e7\u003c/span\u003eb). These findings indicate that small intestinal DCs can extend from the epithelial cell gap to the intestinal lumen for sampling of \u003cem\u003eL. reuteri\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eRecombinant\u003c/b\u003e \u003cb\u003eL. reuteri\u003c/b\u003e \u003cb\u003eexpressing foreign antigen activate the immune function of DCs\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn order to determine whether the antigen presentation ability of DCs changes, \u003cem\u003eL. reuteri\u003c/em\u003e J31, recombinant \u003cem\u003eL. reuteri\u003c/em\u003e S1/J31 and S1-6aa/J31 were added to DCs, respectively. After incubation for 12 h, the expression of surface marker molecules CD80, CD8 and MHC-Ⅱ on DCs were detected by flow cytometry. The results showed that recombinant \u003cem\u003eL. reuteri\u003c/em\u003e expressing foreign proteins enhanced the antigen presentation ability of DCs, and the expression of DCs targeting peptide makes the enhancement effect more significant; But the \u003cem\u003eL. reuteri\u003c/em\u003e without foreign protein had no effect on the antigen presentation ability of DCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ea). The ability of \u003cem\u003eL. reuteri\u003c/em\u003e to stimulate DCs mediated T cell proliferation was further tested by allogeneic mixed lymphocyte reaction. This result was consistent with the finding of antigen presentation ability of DCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eb). The above results demonstrated that recombinant \u003cem\u003eL. reuteri\u003c/em\u003e expressing foreign antigens could promote the maturation of DCs and further induce T cell proliferation, and expressing DCs targeting peptide in recombinant \u003cem\u003eL. reuteri\u003c/em\u003e could enhance this effect. While the \u003cem\u003eL. reuteri\u003c/em\u003e without foreign protein had no effect on the immune function of DCs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cem\u003eLactobacillus\u003c/em\u003e, as a protein delivery carrier, can reach the intestine and elicit a specific immune response through the oral route due to its tolerance to the gastrointestinal tract\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. As has been established, a mucus layer covers all mucosal surfaces, serving as a crucial barrier to the absorption of drugs and vaccines\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. The question of how \u003cem\u003eLactobacillus\u003c/em\u003e traverses the diffusion barrier of the mucus after reaching the intestine has long been a perplexing issue. Therefore, the objective of this study was to investigate the mechanism through which oral delivery of \u003cem\u003eLactobacillus\u003c/em\u003e overcomes the intestinal mucus barrier and induces mucosal immunity. This enhanced understanding of how L. reuteri overcomes the intestinal mucosal barrier is expected to yield crucial insights for the design and improvement of oral Lactobacillus vaccines.\u003c/p\u003e \u003cp\u003e \u003cem\u003eL. reuteri\u003c/em\u003e J31 is a good probiotic strain previously isolated from the intestines of healthy piglets in our laboratory. Using it as a vector, the recombinant \u003cem\u003eL. reuteri\u003c/em\u003e S1/J31 expressing PEDV S1 antigen was constructed, and the test proved that the recombinant strain can induce specific immune responses after oral immunization to piglets\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Therefore, we chosed the recombinant \u003cem\u003eL. reuteri\u003c/em\u003e S1/J31 to study how it overcome the intestinal mucus barrier to induce immune response. In this study, we found that \u003cem\u003eL. reuteri\u003c/em\u003e colonized the intestinal mucus layer and failed to contact with epithelial cells, suggesting that its delivery of foreign antigens to immune cells may depend on the uptake of intestinal DCs. Therefore, the recombinant \u003cem\u003eL. reuteri\u003c/em\u003e S1-6aa/J31 with DCs targeting peptide constructed in our laboratory was used to study the interaction of \u003cem\u003eL. reuteri\u003c/em\u003e with DCs. Selecting the above \u003cem\u003eL. reuteri\u003c/em\u003e strains will help to clarify the mechanism of \u003cem\u003eL. reuteri\u003c/em\u003e as an oral vaccine carrier to overcome the intestinal mucus barrier and induce immune response from multiple angles.\u003c/p\u003e \u003cp\u003eGiven the significant role of the intestinal mucus layer as a formidable barrier to the transport of orally delivered \u003cem\u003eLactobacillus\u003c/em\u003e carriers, our initial investigation focused on determining whether \u003cem\u003eLactobacillus\u003c/em\u003e could penetrate this mucus layer. Co-cultures of absorptive cells (Caco-2) and mucus-producing cells (HT29-MTX-E12), along with the supplementation of cell-based mucosal models with mucus, have been employed in numerous \u003cem\u003ein vitro\u003c/em\u003e studies to examine the diffusion of drugs and bacteria in mucus\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e,\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Studies have shown that mucus has been produced in the intestine of animals at birth, but the composition of mucus changes with age\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. According to the characteristics of PEDV with high mortality rate in piglets under 7 days of age and mainly invading small intestinal cells\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e, the small intestinal mucus of piglets at 7 days of age was selected for this study. To evaluate the mucus-penetrating ability of \u003cem\u003eLactobacillus\u003c/em\u003e delivery systems, we utilized the aforementioned intestinal cell models in an transwell assay for this study. The results indicate that \u003cem\u003eL. reuteri\u003c/em\u003e can penetrate porcine intestinal mucus ex \u003cem\u003evivo\u003c/em\u003e, but cannot traverse epithelial cells.\u003c/p\u003e \u003cp\u003eIn order to more accurately determine the location of \u003cem\u003eL. reuteri\u003c/em\u003e after entering the intestine of piglets, this study used the intestinal ligation model, injected \u003cem\u003eL. reuteri\u003c/em\u003e into the ligated small intestine of piglets, and observed the localization of \u003cem\u003eL. reuteri\u003c/em\u003e in the intestine of piglets. Whether the small intestine of newborn piglets is sterile is the key to observe \u003cem\u003eL. reuteri\u003c/em\u003e localization in the intestine by SEM. For a long time, scholars generally believe that the intestine of newborns is sterile\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. However, studies in recent years have found that newborns will transmit flora with the mother during pregnancy\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e,\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. No bacteria were detected in the small intestine of newborn piglets in this study, the possible reason is that we dissected and collected tissues at the first time when the piglets were separated from the mother. Compared with the study of Dominguez\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e and Ardissone\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e, which collected samples within 24 or 48 hours, we did not give more time for bacteria to reproduce and colonize in this study. SEM of small intestine tissue fragments and immunostaining of small intestine tissue sections revealed the presence of \u003cem\u003eL. reuteri\u003c/em\u003e within the mucus layer. This observation supplements our understanding of the specific location of \u003cem\u003eL. reuteri\u003c/em\u003e colonization in the intestine. Previous studies have primarily relied on the theory that \u003cem\u003eL. reuteri\u003c/em\u003e adheres to intestinal mucus or epithelial cells \u003cem\u003ein vitro\u003c/em\u003e, suggesting its colonization in the intestine\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e,\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. However, our findings indicate that \u003cem\u003eL. reuteri\u003c/em\u003e is located within the mucus rather than adhering to the epithelium in the small intestine.\u003c/p\u003e \u003cp\u003eThe mucoglycan side chains on mucin have been demonstrated to serve as ligands for bacterial adhesins\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. To confirm whether the \u003cem\u003eL. reuteri\u003c/em\u003e adheres to mucoglycan, we incubated porcine small intestinal tissue sections with fluorescently labeled \u003cem\u003eL. reuteri\u003c/em\u003e. The results showed that \u003cem\u003eL. reuteri\u003c/em\u003e adhered to the tissue sections. In contrast, after removing the mucin glycans, \u003cem\u003eL. reuteri\u003c/em\u003e exhibited almost no adhesion. This observation directly indicates that the adhesion target of \u003cem\u003eL. reuteri\u003c/em\u003e is mucin glycans. Since each mucin glycan side chain may consist of up to 20 sugars\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e, we conducted tests to identify the specific mucin oligosaccharides in the mucin glycans that serve as the adhesion site. The results showed that the \u003cem\u003eL. reuteri\u003c/em\u003e J31 strain strongly adheres to mannose. Interestingly, this finding contrasts with the experimental results for \u003cem\u003eL. reuteri\u003c/em\u003e JCM1081, which was shown to strongly bind to neutral carbohydrate chains harboring a galactosyl residue\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Another study revealed that \u003cem\u003eL. plantarum\u003c/em\u003e WCSF-1 exhibits mannose-specific adhesion\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e, suggesting that different strains may strongly bind to different types of mucin oligosaccharides. Our testing of the adhesion properties of other bacterial species in this study corroborates this point.\u003c/p\u003e \u003cp\u003eIn addition to providing attachment sites, mucin glycans also serve as nutrients for microorganisms, commonly referred to as \u0026lsquo;mucin-degrading microbes\u0026rsquo;, which promote their replication\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e,\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. These bacteria possess the ability to digest mucoglycans through their glycosyl hydrolase\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Based on the experimental results in this study, we conclude that the \u003cem\u003eL. reuteri\u003c/em\u003e J31 strain contains GH2 and GH42 with 1\u0026ndash;2 gene copies, and it cannot directly and significantly degrade mucin glycans. However, the \u003cem\u003eL. reuteri\u003c/em\u003e J31 strain can directly consume mucin oligosaccharides, and our data indicate that it exhibits optimal growth with galactose as the primary carbon source. We speculate that this result may correspond to GH2 and GH42 genes cleaving galactose. Research has shown that specialists in mucin degradation possess a large repertoire of glycosyl hydrolase enzymes capable of degrading mucin glycans\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e,\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. These released glycan oligosaccharides can then be metabolized by the degrading microbe itself or by other resident microbes\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e,\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. For example, \u003cem\u003eClostridioides difficile\u003c/em\u003e, lacking mucin-degrading enzymes, has been reported to metabolize mucin monosaccharides cleaved by members of mucin-degrading microbes\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Consistent with those findings, we observed that the \u003cem\u003eL. reuteri\u003c/em\u003e J31 strain can utilize available mucin monosaccharides degraded by mucin-degrading microbes but cannot free these sugars from mucin on its own. These data provide new evidence that mucin oligosaccharides can serve as potent carbon sources, promoting \u003cem\u003eL. reuteri\u003c/em\u003e growth and colonization of the intestinal mucus layer.\u003c/p\u003e \u003cp\u003eOur data revealed that \u003cem\u003eL. reuteri\u003c/em\u003e colonizes the mucus layer, prompting the investigation of how it induces an immune response. The specialized immune system of the gut must respond appropriately to the substantial antigenic load typically present in the form of food antigens, commensal bacteria, and occasional pathogenic organisms\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. The first crucial moment for inducing immune responses is efficient antigen sampling from the luminal region of the intestine, with intestinal cells with antigen-presenting ability likely playing a central role in this process\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. For example, M cells can internalize particles through various mechanisms\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e, Small intestinal goblet cells and intestinal epithelial cells can also mediate the transport of some particulate antigens\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. According to the results of this study, \u003cem\u003eL. reuteri\u003c/em\u003e were located in intestinal mucus and did not contact the small intestinal epithelium, and research data showed that particles below 500 nm were more easily absorbed by M cells and intestinal epithelial cells\u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e, while the size of \u003cem\u003eL. reuteri\u003c/em\u003e J31 ranged from 500 nm-2 \u0026micro;m. Therefore, \u003cem\u003eL. reuteri\u003c/em\u003e is less likely to be internalized by M cells and intestinal epithelial cells after entering the intestine. DCs have been reported to express tight junction proteins and penetrate gut epithelial monolayers to sample bacteria\u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e. Therefore, we investigated whether \u003cem\u003eL. reuteri\u003c/em\u003e was sampled by DCs to induce an immune response. Our data in transwell assay showed that, in the presence of DCs, \u003cem\u003eL. reuteri\u003c/em\u003e can penetrate the epithelium, while the addition of monocytes fails to sample bacteria. This suggests that \u003cem\u003eL. reuteri\u003c/em\u003e is specifically sampled by trans-epithelial DCs.\u003c/p\u003e \u003cp\u003eAlthough \u003cem\u003ein vitro\u003c/em\u003e transwell model has proved that DCs play an important role in the process of recombinant \u003cem\u003eL. reuteri\u003c/em\u003e crossing epithelial cells, \u003cem\u003ein vivo\u003c/em\u003e test can better reflect the real situation of \u003cem\u003eL. reuteri\u003c/em\u003e in the intestine after oral administration. In view of the diversity of tissues and cells \u003cem\u003ein vivo\u003c/em\u003e, it is important to select specific marker proteins. DC-SIGE, a C-type lectin known as DC-specific intercellular adhesion molecule-3-grabbing non-integrin, plays a critical role in microorganism binding to DCs\u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. It has been reported that \u003cem\u003eL. reuteri\u003c/em\u003e and \u003cem\u003eL. casei\u003c/em\u003e can bind to DC-SIGE\u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. DC-SIGN has also been implicated in binding various viruses, including CMV, Ebola, and Dengue, as well as microorganisms such as \u003cem\u003eCandida albicans\u003c/em\u003e, \u003cem\u003eMycobacterium\u003c/em\u003e and \u003cem\u003eSchistosoma\u003c/em\u003e\u003csup\u003e\u003cspan additionalcitationids=\"CR54 CR55 CR56 CR57\" citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e. In this study, our section staining and the 3D images of tissue segments stained with anti-DC-SIGE revealed the capture of \u003cem\u003eL. reuteri\u003c/em\u003e by DC-SIGN-labeled DCs. These findings demonstrate the involvement of DC-SIGN in capturing \u003cem\u003eL. reuteri\u003c/em\u003e, signifying the crucial role of DCs in eliciting the intestinal immune response by \u003cem\u003eL. reuteri\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIn this study, \u003cem\u003eL. reuteri\u003c/em\u003e J31 and recombinant \u003cem\u003eL. reuteri\u003c/em\u003e S1/J31 showed similar results in the interaction with mucus, indicating that \u003cem\u003eL. reuteri\u003c/em\u003e does not affect its adhesion, colonization, growth and reproduction after expressing foreign antigens, suggesting the feasibility of using it as an oral vaccine carrier. DCs have been proved to phagocytose both pathogenic and non pathogenic bacteria, including intestinal commensal flora, and extract antigen components\u003csup\u003e\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u003c/sup\u003e. The results of this study showed that \u003cem\u003eL. reuteri\u003c/em\u003e could be captured by DCs whether it carried foreign antigens or not, but \u003cem\u003eL. reuteri\u003c/em\u003e could not activate the antigen-presenting function of DCs and induce subsequent immune response after being captured by DCs. Only recombinant \u003cem\u003eL. reuteri\u003c/em\u003e carrying foreign antigen can activate intestinal DCs and the downstream T cell responses. In addition, our data showed that recombinant \u003cem\u003eL. reuteri\u003c/em\u003e expressing DCs targeting peptide has a more significant effect on the immune function of DCs. This is consistent with our previous results, which proved that DCs targeting peptide can improve the oral immune effect of recombinant LAB\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn conclusion, we investigated the mechanisms by which \u003cem\u003eL. reuteri\u003c/em\u003e overcomes the intestinal mucus barrier and induces an immune response in this study. Our findings reveal that \u003cem\u003eL. reuteri\u003c/em\u003e can penetrate into the porcine intestinal mucus layer, where it colonizes by adhering to mucoglycans. This provides favorable conditions for the capture of intestinal DCs. Recombinant \u003cem\u003eL. reuteri\u003c/em\u003e carrying foreign antigen can stimulate the maturation of DCs and the downstream T cell response. And the role of DCs targeting peptide in the interaction with DCs further suggests the potential of DCs targeting peptide for vaccine application. In the future design of LAB oral vaccines, priority should be given to strains that colonize the gut, and more attention should be paid to intestinal DCs targeting strategies.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Animal Experiment Ethics Committee of Northeast Agricultural University in China (Approval Number: NEAUEC20220318). All animal experiments followed Northeast Agricultural University\u0026rsquo;s regulations and guidelines for laboratory animals.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by the Technology Support Program of Fourteenth Five Year Plan (2022YFD1800800) and the National Natural Science Foundation of China (Nos. 32373048).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLW and YL conceived and initiated the study design. TG performed research and wrote the paper. LL, SW, JL, YJ, WC and DL contributed to the experiment. All authors contributed to refinement of the study protocol and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by the Technology Support Program of Fourteenth Five Year Plan (2022YFD1800800) and the National Natural Science Foundation of China (Nos. 32373048).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eARRIVE Guidelines Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe have adhered to ARRIVE guidelines and uploaded a completed checklist individually.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated during and/or analysed during the current study are available in the Dryad repository, https://doi.org/10.5061/dryad.m63xsj49t.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMantis, N. J., Rol, N. \u0026amp; Corth\u0026eacute;sy, B.(2011) Secretory IgA\u0026apos;s complex roles in immunity and mucosal homeostasis in the gut. Mucosal Immunology 4, 603.\u003c/li\u003e\n\u003cli\u003eWang, M., Gao, Z., Zhang, Z., Pan, L. \u0026amp; Zhang, Y.(2014) Roles of M cells in infection and mucosal vaccines. Human Vaccines Immunotherapeutics 10.\u003c/li\u003e\n\u003cli\u003eBerm\u0026uacute;dez-Humar\u0026aacute;n, L. G., Kharrat, P., Chatel, J. M. \u0026amp; Langella, P.(2011) Lactococci and lactobacilli as mucosal delivery vectors for therapeutic proteins and DNA vaccines. Microbial Cell Factories 10 Suppl 1, S4.\u003c/li\u003e\n\u003cli\u003eAnne, Mobergslien, Vlada, Vasovic, Geir, Mathiesen, Lasse, Fredriksen, Phuong \u0026amp; Westby.(2015) Recombinant Lactobacillus plantarum induces immune responses to cancer testis antigen NY-ESO-1 and maturation of dendritic cells. Human Vaccines \u0026amp; Immunotherapeutics.\u003c/li\u003e\n\u003cli\u003eNeutra, M. R. \u0026amp; Kozlowski, P. A.(2006) Neutra, M.R. \u0026amp; Kozlowski, P.A. Mucosal vaccines: the promise and the challenge. Nat. Rev. Immunol. 6, 148-158. Nature reviews. Immunology 6, 148-158.\u003c/li\u003e\n\u003cli\u003eJohansson, M. E. V., Larsson, J. M. H. \u0026amp; Hansson, G. C.(2011) The two mucus layers of colon are organized by the MUC2 mucin, whereas the outer layer is a legislator of host\u0026ndash;microbial interactions. Proc Natl Acad Sci U S A 108, 4659-4665.\u003c/li\u003e\n\u003cli\u003eKamada, N., Kim, Y. G., Sham, H. P., Vallance, B. A., Puente, J. L., Martens, E. C. \u0026amp; Nunez, G.(2012) Regulated Virulence Controls the Ability of a Pathogen to Compete with the Gut Microbiota. Science 336, 1325-1329.\u003c/li\u003e\n\u003cli\u003eN-3 polyunsaturated fatty acid attenuates cholesterol gallstones by suppressing mucin production with a high cholesterol diet in mice. Journal of Gastroenterology and Hepatology 27, 1745-1751.\u003c/li\u003e\n\u003cli\u003eLai, S. K., Wang, Y. Y. \u0026amp; Hanes, J.(2009) Mucus-penetrating nanoparticles for drug and gene delivery to mucosal tissues. Adv Drug Deliv Rev 61, 158-171.\u003c/li\u003e\n\u003cli\u003eTakazumi, Taniguchi, Ashley, M., Woodward, Paula, Magnelli, Nicole, M. \u0026amp; McColgan.(2017) N -Glycosylation affects the stability and barrier function of the MUC16 mucin. Journal of Biological Chemistry.\u003c/li\u003e\n\u003cli\u003eCone, R. A.(2005) Chapter 4 - Mucus. Vol. Mucosal Immunology, Two-Volume Set.\u003c/li\u003e\n\u003cli\u003eLi, B. \u0026amp; Yu, Y. B.(2017) Role of mucus barrier in the gut. World Chinese Journal of Digestology 25, 1764-1771.\u003c/li\u003e\n\u003cli\u003eEngevik, M. A., Engevik, A. C., Engevik, K. A., Auchtung, J. M. \u0026amp; Versalovic, J.(2020) Mucin-Degrading Microbes Release Monosaccharides That Chemoattract Clostridioides difficile and Facilitate Colonization of the Human Intestinal Mucus Layer. ACS Infectious Diseases.\u003c/li\u003e\n\u003cli\u003eDonaldson, G., Lee, S. M. \u0026amp; Mazmanian, S. K.(2015) Gut biogeography of the bacterial microbiota.\u003c/li\u003e\n\u003cli\u003eXia, T., Wang, N., Tang, Y., Gao, Y., Gao, C., Hao, J., Jiang, Y., Wang, X., Shan, Z., Li, J., Zhou, H., Cui, W., Qiao, X., Tang, L., Wang, L. \u0026amp; Li, Y.(2022) Delivery of antigen to porcine dendritic cells by fusing antigen with porcine dendritic cells targeting peptide. Front Immunol 13, 926279, doi:10.3389/fimmu.2022.926279.\u003c/li\u003e\n\u003cli\u003eCarrasco, C. P., Rigden, R. C., Schaffner, R., Gerber, H. \u0026amp; Summerfield, A.(2010) Porcine dendritic cells generated in vitro: morphological, phenotypic and functional properties. Immunology 104.\u003c/li\u003e\n\u003cli\u003eXia, T., Yang, H., Guo, Y., Guo, T., Xin, L., Jiang, Y., Cui, W., Zhou, H., Qiao, X., Wang, X., Li, J., Shan, Z., Tang, L., Wang, L. \u0026amp; Li, Y.(2022) Human dendritic cell targeting peptide can be targeted to porcine dendritic cells to improve antigen capture efficiency to stimulate stronger immune response. Front Immunol 13, 950597, doi:10.3389/fimmu.2022.950597.\u003c/li\u003e\n\u003cli\u003eJoe, C., HongYoung, S. \u0026amp; Kim.(2000) Alkali-catalyzed \u0026beta;-elimination of periodate-oxidized glycans: A novel method of chemical deglycosylation of mucin gene products in paraffin embedded sections. Glycoconjugate Journal.\u003c/li\u003e\n\u003cli\u003eKaoutari, A. E., Armougom, F., Gordon, J. I., Raoult, D. \u0026amp; Henrissat, B.The abundance and variety of carbohydrate-active enzymes in the human gut microbiota. Nature Reviews Microbiology.\u003c/li\u003e\n\u003cli\u003eLombard, V., Golaconda Ramulu, H., Drula, E., Coutinho, P. M. \u0026amp; Henrissat, B.(2014) The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Res 42, D490-495, doi:10.1093/nar/gkt1178.\u003c/li\u003e\n\u003cli\u003eMiller, R. S. \u0026amp; Hoskins, L. C.(1981) Mucin degradation in human colon ecosystems. Fecal population densities of mucin-degrading bacteria estimated by a \u0026quot;most probable number\u0026quot; method. Gastroenterology 81, 759-765.\u003c/li\u003e\n\u003cli\u003eZhou, J. S., Gopal, P. K. \u0026amp; Gill, H. S.(2001) Potential probiotic lactic acid bacteria Lactobacillus rhamnosus (HN001), Lactobacillus acidophilus (HN017) and Bifidobacterium lactis (HN019) do not degrade gastric mucin in vitro. International Journal of Food Microbiology 63, 81-90.\u003c/li\u003e\n\u003cli\u003eLaemmli, U.(1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227.\u003c/li\u003e\n\u003cli\u003eEngevik, M. A., Aihara, E., Montrose, M. H., Shull, G. E. \u0026amp; Worrell, R. T.(2013) Loss of NHE3 alters gut microbiota composition and influences Bacteroides thetaiotaomicron growth. Am J Physiol Gastrointest Liver Physiol 305, G697-G711.\u003c/li\u003e\n\u003cli\u003eEngevik, Melinda, A., Hickerson, Annelies, Shull, Gary, E., Worrell \u0026amp; Roger, T.(2013) Acidic Conditions in the NHE2 Mouse Intestine Result in an Altered Mucosa-Associated Bacterial Population with Changes in Mucus Oligosaccharides. Cellular Physiology \u0026amp; Biochemistry.\u003c/li\u003e\n\u003cli\u003eCrost, E. H., Tailford, L. E., Gall, G. L., Fons, M., Henrissat, B. \u0026amp; Juge, N.(2013) Utilisation of Mucin Glycans by the Human Gut Symbiont Ruminococcus gnavus Is Strain-Dependent. Plos One 8.\u003c/li\u003e\n\u003cli\u003eStagg \u0026amp; J, A.(2003) The dendritic cell: its role in intestinal inflammation and relationship with gut bacteria. Gut 52.\u003c/li\u003e\n\u003cli\u003eCarlson, T. L., Lock, J. Y. \u0026amp; Carrier, R. L.(2018) Engineering the Mucus Barrier. Annual review of biomedical engineering 20, 197-220.\u003c/li\u003e\n\u003cli\u003eMa Rumeng (2023). Comparative study on immune response induced by the expression of protective antigen S1 of porcine epidemic diarrhea virus by different lactobacillus receptor strains.\u003c/li\u003e\n\u003cli\u003eMahler, R. L. T. K. G. G.-R. N. H. M. J.(2020) TiO_2 Nanoparticles and Commensal Bacteria Alter Mucus Layer Thickness and Composition in a Gastrointestinal Tract Model. Small 16.\u003c/li\u003e\n\u003cli\u003eReale, O., Huguet, A. \u0026amp; Fessard, V.(2020) Co-culture model of Caco-2/HT29-MTX cells: A promising tool for investigation of phycotoxins toxicity on the intestinal barrier. Chemosphere.\u003c/li\u003e\n\u003cli\u003eTurck, D., Feste, A. S. \u0026amp; Lifschitz, C. H.(1993) Age and Diet Affect the Composition of Porcine Colonic Mucins. Pediatric Research 33, 564-567.\u003c/li\u003e\n\u003cli\u003eYu Hua. in National Academic Symposium on Virology and Wuhan International Symposium on Modern Virology.\u003c/li\u003e\n\u003cli\u003eCao, S. T., Wang, C. C., Wu, H., Zhang, Q. H., Jiao, L. F. \u0026amp; Hu, C. H.(2018) Weaning disrupts intestinal antioxidant status, impairs intestinal barrier and mitochondrial function, and triggers mitophagy in piglets. Journal of animal science 96, 1073.\u003c/li\u003e\n\u003cli\u003eDominguez-Bello, M., G., Costello, E., K., Contreras, M., Magris \u0026amp; M.(2010) Delivery mode shapes the acquisition and structure of the initial microbiota across multiple body habitats in newborns. Proceedings of the National Academy of Sciences 107, 11971-11975.\u003c/li\u003e\n\u003cli\u003eArdissone, A. N., Cruz, D. M. D. L., Davis-Richardson, A. G., Rechcigl, K. T. \u0026amp; Li, N.(2014) Meconium Microbiome Analysis Identifies Bacteria Correlated with Premature Birth (PLoS ONE (2014) 9, 3, (e90784) DOI:10.1371/journal.pone.0090784). PLoS ONE 9.\u003c/li\u003e\n\u003cli\u003eMiyoshi, Y., Okada, S., Uchimura, T. \u0026amp; Satoh, E.(2006) A Mucus Adhesion Promoting Protein, MapA, Mediates the Adhesion of Lactobacillus reuteri to Caco-2 Human Intestinal Epithelial Cells. Biosci Biotechnol Biochem 70, 1622-1628.\u003c/li\u003e\n\u003cli\u003eRoos, S. \u0026amp; Jonsson, H.(2002) A high-molecular-mass cell-surface protein from Lactobacillus reuteri 1063 adheres to mucus components. Microbiology 148, 433-442.\u003c/li\u003e\n\u003cli\u003eT., Mukai, S., Kaneko, H. \u0026amp; Ohori.(1998) Haemagglutination and glycolipid-binding activities of \u0026lt;em\u0026gt;Lactobacillus reuteri\u0026lt;/em\u0026gt;. Letters in Applied Microbiology.\u003c/li\u003e\n\u003cli\u003ePretzer, G., Snel, J., Molenaar, D., Wiersma, A., Bron, P. A., Lambert, J., De Vos, W. M., Van, d. M., R., Smits, M. A. \u0026amp; Kleerebezem, M.(2005) Biodiversity-Based Identification and Functional Characterization of the Mannose-Specific Adhesin of Lactobacillus plantarum. Journal of Bacteriology 187, 6128-6136.\u003c/li\u003e\n\u003cli\u003eLi, H., Limenitakis, J. P., Fuhrer, T., Geuking, M. B., Lawson, M. A., Wyss, M., Brugiroux, S., Keller, I., Macpherson, J. A. \u0026amp; Rupp, S.(2015) The outer mucus layer hosts a distinct intestinal microbial niche. Nature Communications 6, 8292.\u003c/li\u003e\n\u003cli\u003eEtienne-Mesmin, L., Chassaing, B., Desvaux, M., Paepe, K. D., Gresse, R., Sauvaitre, T., Forano, E., Wiele, T. V. D., Stephanie.Sch\u0026uuml;ller \u0026amp; Juge, N.(2019) Experimental models to study intestinal microbes-mucus interactions in health and disease. FEMS microbiology reviews 43, 457-489.\u003c/li\u003e\n\u003cli\u003eSommer, F. \u0026amp; Bckhed, F.(2013) The gut microbiota\u0026mdash;Masters of host development and physiology. Nature Reviews Microbiology 11.\u003c/li\u003e\n\u003cli\u003eXiaolei, Ze, Fanny, Le, Mougen, Sylvia, Duncan, H., Petra, Louis \u0026amp; Harry.(2013) Some are more equal than others. Gut Microbes.\u003c/li\u003e\n\u003cli\u003eJean-F\u0026eacute;lix, S., Guillaume, L. B., Philippe, V., Mario, J. \u0026amp; Jos\u0026eacute;e, H.(2017) Interactions of Intestinal Bacteria with Components of the Intestinal Mucus. Frontiers in Cellular and Infection Microbiology 7.\u003c/li\u003e\n\u003cli\u003eJohansson, Malin E. V., Jakobsson, H. E., Holm\u0026eacute;n-Larsson, J., Sch\u0026uuml;tte, A. \u0026amp; Hansson, G. C.(2015) Normalization of Host Intestinal Mucus Layers Requires Long-Term Microbial Colonization. Cell Host \u0026amp; Microbe 18, 582-592.\u003c/li\u003e\n\u003cli\u003eLiisa, Arike, Gunnar, C. \u0026amp; Hansson.(2016) The Densely O-Glycosylated MUC2 Mucin Protects the Intestine and Provides Food for the Commensal Bacteria. Journal of Molecular Biology 428, 3221-3229.\u003c/li\u003e\n\u003cli\u003eCorr, S. C., Gahan, C. C. G. M. \u0026amp; Hill, C.(2008) M‐cells: origin, morphology and role in mucosal immunity and microbial pathogenesis. FEMS Immunology \u0026amp; Medical Microbiology 52.\u003c/li\u003e\n\u003cli\u003eAwaad, A., Nakamura, M. \u0026amp; Ishimura, K.(2012) Imaging of size-dependent uptake and identification of novel pathways in mouse Peyer\u0026apos;s patches using fluorescent organosilica particles. Nanomedicine Nanotechnology Biology \u0026amp; Medicine 8, 627-636.\u003c/li\u003e\n\u003cli\u003eWang, T., Jiang, H., Zhao, Q., Wang, S., Zou, M. \u0026amp; Cheng, G.(2012) Enhanced mucosal and systemic immune responses obtained by porous silica nanoparticles used as an oral vaccine adjuvant: Effect of silica architecture on immunological properties. International Journal of Pharmaceutics 436, 351-358.\u003c/li\u003e\n\u003cli\u003eRescigno, M., Urbano, M., Valzasina, B., Francolini, M. \u0026amp; Ricciardi-Castagnoli, P.(2001) Dendritic cells express tight junction proteins and penetrate gut epithelial monolayers to sample bacteria. Nature Immunology 2, 361.\u003c/li\u003e\n\u003cli\u003eSmits, H. H., Engering, A., Desiree, V. D. K., De Jong, E. C., Schipper, K., Van Capel, T. M. M., Zaat, B. A. J., Yazdanbakhsh, M., Wierenga, E. A. \u0026amp; Van Kooyk, Y.(2005) Selective probiotic bacteria induce IL-10-producing regulatory T cells in vitro by modulating dendritic cell function through dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin. Journal of Allergy and Clinical Immunology 115, 1260-1267.\u003c/li\u003e\n\u003cli\u003eHalary, F., Amara, A., Lortat-Jacob, H., Messerle, M., Delaunay, T., Houl\u0026egrave;s, C., Fieschi, F., Arenzana-Seisdedos, F., Moreau, J. F. O. \u0026amp; D\u0026eacute;chanet-Merville, J.(2002) Human cytomegalovirus binding to DC-SIGN is required for dendritic cell infection and target cell trans-infection. Immunity 17, 653-664.\u003c/li\u003e\n\u003cli\u003eZhang, F., Ren, S. \u0026amp; Zuo, Y.(2014) DC-SIGN, DC-SIGNR and LSECtin: C-type lectins for infection. International Reviews of Immunology 33, 54-66.\u003c/li\u003e\n\u003cli\u003eTassaneetrithep, B., Burgess, T. H., Granelli-Piperno, A., Trumpfheller, C., Finke, J., Sun, W., Eller, M. A., Pattanapanyasat, K., Sarasombath, S. \u0026amp; Birx, D. L.(2003) DC-SIGN (CD209) Mediates Dengue Virus Infection of Human Dendritic Cells. Journal of Experimental Medicine 197, 823-829.\u003c/li\u003e\n\u003cli\u003eCambi, A., Gijzen, K., Vries, I. J. M. D., Torensma, R., Joosten, B., Adema, G. J., Netea, M. G., Kullberg, B. J., Romani, L. \u0026amp; Figdor, C. G.(2003) The C-type lectin DC-SIGN (CD209) is an antigen-uptake receptor for Candida albicans on dendritic cells. European Journal of Immunology 33, 532-538.\u003c/li\u003e\n\u003cli\u003eTailleux, L., Schwartz, O., Herrmann, J. L., Pivert, E., Jackson, M., Amara, A., Legres, L., Dreher, D., Nicod, L. P. \u0026amp; Gluckman, J. C.(2003) DC-SIGN Is the Major Mycobacterium tuberculosis Receptor on Human Dendritic Cells. Journal of Experimental Medicine 197, 121-127.\u003c/li\u003e\n\u003cli\u003eIrma, V. D., Van, V. S. J., Kwame, N. A., Cummings, R. D., Bank, C. M. C., Ben, A., Geijtenbeek, T. B. H. \u0026amp; Yvette, V. K.(2003) The dendritic cell\u0026ndash;specific C-type lectin DC-SIGN is a receptor for Schistosoma mansoni egg antigens and recognizes the glycan antigen Lewis x. Glycobiology, 471-478.\u003c/li\u003e\n\u003cli\u003eNiess, J. H.(2010) What are CX3CR1+ mononuclear cells in the intestinal mucosa? Gut Microbes 1, 396-400.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Mucosal immune, Intestine mucus barrier, Oral vaccines, Lactobacillus reuteri, Dendritic cell","lastPublishedDoi":"10.21203/rs.3.rs-5141739/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5141739/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eLocal mucosal immune responses play a crucial role in protecting mucosal surfaces from infections, with the mucus layer serving as a significant component of the mucosal barrier that prevents direct contact of foreign materials with epithelial cells. Research has focused on using Lactic acid bacteria (LAB) as potential carriers for oral vaccines due to their ability to colonize the intestine and stimulate high levels of mucosal antibodies against expressed foreign antigens. However, the mechanism of the interaction between LAB vector and host intestine in the process of inducing immune response remains understudied. The intestinal mucus layer is a significant component of the mucosal barrier, which can prevent direct contact of foreign materials with intestinal epithelial cells. This article addresses this gap utilizing recombinant Pig-Derived \u003cem\u003eLactobacillus reuteri\u003c/em\u003e (\u003cem\u003eL. reuteri\u003c/em\u003e) expressing the PEDV S1 antigen as a model strain and investigates how it traverses the mucus barrier upon entering the porcine small intestine to initiate immune responses. The results demonstrate that \u003cem\u003eL. reuteri\u003c/em\u003e can penetrate and adhere to the interior of the mucus layer, subsequently being sampled by dendritic cells (DCs) to activate the immune system, and during intestinal colonization, \u003cem\u003eL. reuteri\u003c/em\u003e can maintain its own replication. This study provides insights into the mechanisms by which LAB, as carriers of oral vaccines, overcome the intestine mucus barrier and induce mucosal immune responses, complements the interaction between LAB and the gut, offering valuable information for the application of LAB in oral vaccines to prevent intestinal infectious diseases.\u003c/p\u003e","manuscriptTitle":"Pig-Derived Lactobacillus reuteri as an Oral Vaccine Delivery System Overcomes the Intestinal Mucus Barrier to Induce Immune Responses","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-20 06:23:03","doi":"10.21203/rs.3.rs-5141739/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major Revision a single reviewer","date":"2025-09-15T04:01:51+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2025-01-22T16:22:56+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-01-17T17:25:16+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"BMC Veterinary Research","date":"2024-10-01T09:36:43+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Veterinary Research","date":"2024-09-29T22:10:12+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-09-26T09:08:11+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"30c27c5a-ee6f-4242-bd64-677a58d24737","owner":[],"postedDate":"January 20th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-10-10T11:15:05+00:00","versionOfRecord":[],"versionCreatedAt":"2025-01-20 06:23:03","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5141739","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5141739","identity":"rs-5141739","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00