Antibiotics induce overexpression of alpha satellite DNA accompanied with epigenetic changes at alpha satellite arrays as well as genome-wide

preprint OA: closed
Full text JSON View at publisher
Full text 118,292 characters · extracted from preprint-html · click to expand
Antibiotics induce overexpression of alpha satellite DNA accompanied with epigenetic changes at alpha satellite arrays as well as genome-wide | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Antibiotics induce overexpression of alpha satellite DNA accompanied with epigenetic changes at alpha satellite arrays as well as genome-wide Sven Ljubić, Maja Matulić, Damir Dermic, Maria Chiara Feliciello, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6661736/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Sep, 2025 Read the published version in Epigenetics & Chromatin → Version 1 posted 12 You are reading this latest preprint version Abstract The transcription of satellite DNA is highly sensitive to environmental factors and represents a source of genomic instability. Therefore, tight regulation of (peri)centromeric transcription is essential for genome maintenance. Antibiotics are routinely used for in vitro studies and for medical treatment, however, their effect on pericentromeric satellite DNA transcription was not investigated. Here we show that antibiotics geneticin and hygromycin B, conveniently used in cell culture, as well as rifampicin, used to treat bacterial infections, increase transcription of a major human pericentromeric alpha satellite DNA in cell lines at standard concentrations. However, response differs among cell lines - maximal increase in A-1235 cells is obtained by rifampicin while in HeLa cells and fibroblasts by geneticin. There is also a positive correlation between antibiotic concentration and the level of alpha satellite transcription. The increase of transcription is accompanied with either H3K9me3 decrease or H3K18ac increase at tandemly arranged alpha satellite arrays while H3K4me2 remains unchanged. Our results suggest that induced alpha satellite DNA transcription upon antibiotic stress could be linked to epigenetic changes - histone modifications H3K9me3 and H3K18ac, which are associated with transcription of heterochromatin. satellite DNA heterochromatin transcription antibiotic histone modifications Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Antibiotics are routinely used for in vitro studies while culturing cells in order to avoid bacterial contamination and for selection purposes. However, different studies have shown that use of antibiotics can affect gene expression and could modify the results of studies focused on drug response, cell cycle regulation and cell differentiation [ 1 – 3 ]. Antibiotic rifampicin (10 µM for 24 hours) was shown to induce genome-wide drug dependent changes in gene regulation and expression in human hepatocytes, some of them linked to changes in histone marks H3K4me1 and H3K27ac [ 1 ]. Cells cultured with standard 1% Penicillin-Streptomycin (PenStrep) supplemented media showed significantly altered gene expression and regulation, as observed in a common liver cell line such as HepG2. Drug-associated genes were differentially expressed following PenStrep treatment and differential enrichment of active promoter and enhancer regions marked by H3K27ac was reported [ 2 ]. The human peripheral blood mononuclear cells (PBMCs) expressed DNA damage features such as activation of a serine/threonine kinase ATM and p53, as well as epigenetic changes - phosphorylation of H2AX and H3K4me2/3 modifications at some promoter sites after the in vitro exposure to antibiotic oxytetracycline (OTC, 2 µg/ml or 4,3 µM) [ 4 ]. Since OTC is largely employed in veterinary practices, this reveals a potential influence of OTC on animal and human health. While the effect of antibiotic treatment on gene expression was previously at least partially characterized, the influence of antibiotics on non-coding regions of genome, in particular on (peri)centromeric satellite DNAs which are related to genome stability, is poorly investigated. Therefore, the molecular consequences of growing human cell lines with antibiotics at standard cell culture concentrations as well as of antibiotics use in veterinary and medical practice have yet to be thoroughly investigated. Satellite DNAs are tandemly repeated sequences preferentially clustered in (peri)centromeric regions of eukaryotic chromosomes [ 5 ]. Recent studies reveal that their expression is highly sensitive to environmental factors such as heat stress, DNA damaging agents, genotoxic and hyperosmotic stress [ 6 – 11 ]. Satellite DNA expression is also significantly increased under different pathological conditions, such as in diverse types of cancer [ 5 , 12 , 13 ]. Transcription of satellite DNA may represent a source of genomic instability through collision between replication and transcription forks, formation of secondary structures and cytotoxic DNA–RNA hybrids known as R-loops [ 14 ]. Therefore, tight regulation of centromeric and pericentromeric transcription is essential for the maintenance of genome stability [ 15 ] and cells with aberrant satellite DNA expression can feature substantial mitotic defects and large-scale genetic aberrations, including chromosomal instability and aneuploidy [ 16 ]. Satellite DNAs located within heterochromatin seem to be at least partially under epigenetic control and their arrays in cancer cells are characterized by lower level of repressive heterochromatic histone modification H3K9me3 as well as by global DNA hypomethylation relative to normal cells [ 17 , 18 ]. On the other hand, heat stress induces the increase of silent histone mark H3K9me3 at (peri)centromeric satellite repeats as well as at the satellite repeats dispersed within euchromatin [ 9 , 19 ], resulting in downregulation of expression of nearby genes [ 19 ]. Here, we analyzed whether antibiotics such as geneticin and hygromycin B, which are conveniently used in cell culture [ 20 ], as well as rifampicin which is used to treat several types of bacterial infections [ 21 ], affect expression of a major, most abundant human alpha satellite DNA clustered in (peri)centromeric regions of all human chromosomes [ 22 ]. We also studied if potential changes in satellite DNA expression under antibiotic stress were accompanied by epigenetic changes such as histone marks at heterochromatic satellite arrays and at the satellite repeats dispersed within euchromatin, as well as genome-wide. Using different cell types, we show that all three antibiotics induce overexpression of alpha satellite DNA at concentrations routinely used for in vitro studies and for medical treatment. In addition, overexpression is accompanied by changes in epigenetic modifications on histone marks at alpha satellite arrays located in heterochromatin as well as genome-wide. We proposed that epigenetic changes in heterochromatin, such as decrease of silent histone modification H3K9me3 whose loss affects satellite DNA expression [ 23 ], and increase of H3K18ac, which is characteristic for transcriptional activation of heterochromatin [ 16 ], could be linked to induced alpha satellite DNA expression upon antibiotic stress. 2. Results 2.1. Alpha satellite DNA transcription after antibiotic treatment To investigate whether antibiotics affect the transcription of alpha satellite DNA we followed its transcription dynamics in human cell lines by RT-qPCR under standard conditions and after antibiotic treatment. Primers used for transcriptional analysis were able to amplify only tandemly arranged repeats (Figure S1) and since in human pericentromeric heterochromatin alpha satellite DNA is organized in tandemly arranged monomers [22], it is expected that the primers preferentially recognize transcripts deriving from pericentromeric regions. Cells were incubated for 48 hrs at 37 °C in complete medium with concentrations of antibiotics used for routine treatment, selection and maintenance of eukaryotic cells: geneticin 300-600 µg/ml, hygromycin B 50-100 µg/ml as well as with rifampicin 8.2-82 µg/ml (10-100 µM). The transcription of alpha satellite DNA was checked immediately after antibiotic treatment and compared with a control. The transcription of alpha satellite DNA was monitored in immortalized fibroblasts (MJ90hTERT), glioblastoma cell line A-1235 and cervix carcinoma HeLa cells. Treatment of A1235 cells with hygromycin B (50 µg/ml), geneticin (400 µg/ml) and rifampicin (82 µg/ml) revealed the increase of transcription by 1.6x (P=0.01), 1.7x (P=0.008), and 3.0x (P=0.02), respectively (Figure 1b). To test if transcription responds to antibiotic concentration, A-1235 cells were treated with three different concentrations of rifampicin (8.2, 41, and 82 µg/ml). The results showed no effect after 8.2 µg/ml treatment while 41 µg/ml and 82 µg/ml induced increase of 1.8x (P=0.009) and 3.0x (P=0.02), respectively (Figure 1c), suggesting positive correlation between transcription and antibiotic concentrations. Hela cells treated with hygromycin B (50 µg/ml), geneticin (400 µg/ml) and rifampicin (82 µg/ml) showed the increase of transcription by 3.1x (P =0.02), 4.9x (P=0.01), and 1.5x (P=0.01), respectively (Figure 1a), while decreased concentration of geneticin (300 µg/ml) showed no effect on alpha satellite transcription (Figure 1a). Immortalized fibroblast MJ90hTERT cell line showed a modest increase of transcription of 1.5x (P=0.01) after geneticin (400 µg/ml) while treatment with hygromycin B (50 µg/ml) and rifampicin (82 µg/ml) did not show a significant change of transcription. Higher concentration of hygromycin B (100 µg/ml) showed 1.5x (P=0.01) increase of alpha satellite, however, with high percentage of dead cells. On the other hand, higher concentration of geneticin (600 µg/ml) induced 1.9x (P=0.008) increase of alpha satellite transcription (Figure 1d), while preserving the number of cells and their morphology. The results revealed a general increase of alpha satellite DNA transcription in cell lines after treatment with different antibiotics at standard concentrations. However, the response differs among cell lines - maximal increase in A-1235 cells was obtained by rifampicin (82 µg/ml) while other two antibiotics showed a modest change (Figure 1b). On the contrary, in HeLa cells the maximal effect on alpha satellite DNA transcription was obtained by geneticin (400 µg/ml; Figure 1a), while in MJ90hTERT only higher concentration of geneticin (600 µg/ml) induced a significant change in transcription (Figure 1d). The results also revealed a positive correlation between antibiotic concentration and the level of alpha satellite transcription. 2. 2. H3K9me3, H3K18ac and H3K4me2 levels at alpha satellite repeats after antibiotic treatment We analysed the distribution of silent histone mark H3K9me3 characteristic for heterochromatin, H3K18ac mark which is characteristic for transcriptional activation of heterochromatin [16] and H3K4me2, typical for open euchromatin, at tandemly arranged alpha satellite repeats as well as at those dispersed within euchromatin, under standard conditions and after antibiotic treatment. We performed chromatin immunoprecipitation (ChIP) coupled with quantitative real-time PCR, using specific primers for tandemly arranged satellite repeats as well as for six alpha repeats dispersed within introns of genes: AR 1, 10, 21, 25, 29 and 31 [9], (Table S1). Sequences flanking dispersed alpha repeats were used to construct single locus-specific primers. ChIP assay was performed on chromatin isolated from A-1235, HeLa and MJ90hTERT cells subjected to antibiotic treatment of 48 hrs at 37°C. The level of tested histone modifications was measured immediately after antibiotic treatment and was compared to the level of control using the unpaired t-test. In addition, we followed the dynamics of IgG binding to dispersed alpha satellite repeats and tandemly repeated satellite arrays and the amount of bound IgG was very low, resulting in a signal below the qPCR threshold. HeLa cells were treated with geneticin 400 µg/ml which exhibited the strongest effect on alpha satellite transcription (Figure 1a) and decrease of H3K9me3 level of 2.1x (P=0.011) at tandemly arranged heterochromatic alpha repeats was observed, while no significant change at six euchromatic repeats located within introns was found (Figure 2a). Decrease of geneticin concentration to 300 µg/ml resulted in no significant change of H3K9me3 level at tandemly arranged satellite arrays (Figure S2a) corresponding to no significant change of alpha satellite transcription at this concentration (Figure 1a). The levels of H3K18ac and H3K4me2 were not significantly changed at tandemly arranged alpha satellite repeats as well as at alpha repeats dispersed within euchromatin after treatment with geneticin 400 µg/ml (Figure S4). The treatment of A-1235 cells with 82 µg/ml rifampicin revealed 2.0x (P=0.02) decrease of H3K9me3 level at tandemly arranged alpha satellite DNA repeats and no significant change at dispersed alpha satellite repeats (Figure 2b). No significant change in H3K18ac or H3K4me2 level was detected, either at tandem or dispersed alpha repeats (Figure S3a). Lower rifampicin concentration of 41 µg/ml resulted in a slight but not statistically significant decrease of H3K9me3 level at tandem alpha arrays (Figure S2a), while an increase of alpha transcription of 1.8x was detected at this concentration (Figure 1c). The treatment of MJ90hTERT cells with geneticin 600 µg/ml, which showed the strongest effect on alpha satellite transcription (Figure 1d), revealed a significant increase of 2.3x (P=0.01) of H3K18ac level at tandemly arranged alpha satellite arrays but not on dispersed alpha repeats (Figure 2d). Additionally, histone mark H3K9me3 was significantly decreased by 2.1x (P=0.02) (Figure 2c). On the other hand, no significant change in H3K4me2 level was found at tandemly arranged or dispersed alpha repeats (Figure S3b). Results from HeLa and MJ90hTERT cells treated with geneticin and A-1235 cells with rifampicin revealed a decrease of H3K9me3 at heterochromatic alpha repeats which corresponds to increased transcription of alpha satellite DNA. In MJ90hTERT cells however, alongside H3K9me3 decrease after geneticin treatment, H3K18ac was significantly increased, which also corresponds to increased transcription of alpha satellite. On alpha repeats dispersed within euchromatin we did not detect changes in tested histone modifications after any antibiotic treatment. Although at 41 µg/ml rifampicin treatment an increase of alpha satellite transcription was observed in A-1235 cells despite a slight change in H3K9me3 level, this could be explained by low sensitivity of ChIP experiments. Similar to that, we observed no statistically significant change in H3K9me3 level at tandem alpha repeats in A-1235 cells as well as in H3K9me3 and H3K18ac levels in MJ90hTERT cells after geneticin 400 µg/ml treatment (Figure S2a, b) despite the slight increase in alpha transcription level of 1.7x and 1.5x respectively (Figure 1b, d). Table 1. The genome-wide fold changes of epigenetic modifications H3K9me3, H3K18ac and H3K4me2 in different cell lines after treatment with varying concentrations of antibiotics geneticin (Gen) and rifampicin (Rif) (up-upregulation; dw-downregulation; n.s.c.-no significant change). 2.3. H3K9me3, H3K18ac and H3K4me2 levels genome-wide after antibiotic treatment To see if antibiotic treatment affects epigenetic changes genome-wide we performed immunofluorescence on HeLa, A-1235 and MJ90hTERT cells using primary antibodies against histone marks H3K9me3, H3K18ac and H3K4me2, followed by secondary antibody marked with Alexa Fluor® 488. After treatment of HeLa cells with geneticin 400 µg/ml for 48 hrs H3K9me3 level was increased genome-wide by 2.03x (P<10 -3 ), H3K18ac showed slight increase of 1.19x (P<10 -3 ), while H3K4me2 was decreased by 1.45x (P<10 -3 ) (Figure 3, Table 1). Decrease of geneticin concentration to 300 µg/ml resulted in a slight increase of H3K9me3 of 1.32x (P<10 -3 ) while H3K18ac and H3K4me2 levels were downregulated 1.81x and 1.5x (P<10 -3 ), respectively (Table 1). In MJ90hTERT cells after treatment with 600 µg/ml geneticin H3K9me3 and H3K18ac levels were increased 1.86x and 1.27x (P0.05) (Figure 4; Table 1). Decrease of geneticin concentration to 400 µg/ml induced the increase of H3K9me3 level of 2.28x (P<10 -3 ) while H3K18ac and H3K4me2 were not significantly changed (Table 1). Different profile of histone changes was detected after treatment of A-1235 cells with 82 µg/ml rifampicin. Namely, the level of H3K9me3 was slightly changed (1.08x, P<10 -3 ), while H3K18ac level was decreased by 2.38x and H3K4me2 increased 1.33x (P<10 -3 ) (Figure 5; Table 1). Decrease of rifampicin concentration to 41 µg/ml resulted in H3K9me3 and H3K18ac decrease of 2.27x and 2.28x (P<10 -3 ), respectively, while H3K4me2 was upregulated by 1.4x (P<10 -3 ) (Table 1). In the same cell line, geneticin 400 µg/ml induced the decrease of H3K9me3 level by 2.86x and the increase of H3K18ac and H3K4me2 levels by 2.58x and 1.35x (P<10 -3 ), respectively (Table 1). Changes of histone modifications genome-wide in three cell lines are summarized in Table 1. The results reveal genome-wide increase of H3K9me3 levels in HeLa and MJ90hTERT cells induced by geneticin (300-600 µg/ml), while H3K4me2 levels were either downregulated or not significantly changed (Table 1). On the other hand, the level of H3K18ac was significantly downregulated in HeLa cells treated with 300 µg/ml geneticin, while higher concentrations of geneticin only slightly changed H3K18ac levels in HeLa and MJ90hTERT cells, indicating that the effect depends on the concentration of antibiotic but is not positively correlated with it. In A-1235 cells however, geneticin in the concentration of 400 µg/ml induced genome-wide downregulation of H3K9me3 and upregulation of H3K18ac, indicating that response to the antibiotic differs among cell lines. Also, different antibiotics affect differently epigenetic marks in the same cell line as shown by rifampicin which in A-1235 cells stimulates H3K18ac decrease while geneticin induces H3K18ac upregulation (Table 1). Although different antibiotics induce overexpression of pericentromeric alpha satellite DNA, their effect on heterochromatin differs among cells, characterized either by decrease of H3K9me3 or increase of H3K18ac (Figure 2). In a similar way, the effect of antibiotics genome-wide also differs among cells. Namely, while the effect of geneticin on histone marks H3K9me3 and H3K4me2 in HeLa and MJ90hTERT cells is similar, it differs from the one observed in A-1235 cells, as well as from the effect of rifampicin on the same marks in A-1235 cells. The results suggest that the heterochromatin, as well as the rest of chromatin, respond to antibiotics in diverse ways, depending on the cell line, type of antibiotic and antibiotic concentration. 3. Discussion It is well known that antibiotics influence human microbiome and change its composition which can have a negative impact on host health including reduced microbial diversity and selection of antibiotic-resistant strains, making hosts more susceptible to infection [ 24 ]. However, besides targeting bacterial cells, antibiotics affect metabolism of eukaryotic cells as revealed by studies in vitro , on human cell lines [ 3 , 4 ]. Some in vivo studies, such as those performed on male pseudoscorpions treated with the antibiotic tetracycline, showed significantly reduced sperm viability, which was passed to the next generation and suggests that a similar effect could occur in other species [ 25 ]. It was shown that clinically relevant doses of bactericidal antibiotics quinolones, aminoglycosides and β-lactams cause mitochondrial dysfunction and ROS overproduction in mammalian cells, and mice treated with these antibiotics exhibited elevated oxidative stress markers in the blood as well as oxidative tissue damage [ 26 ]. It is also known that treatment of some diseases requires high doses of antibiotic, e.g. for tuberculosis 35 mg/kg rifampicin per day is used (which corresponds to approx. 43 µM conc.) [ 21 ], and it is therefore interesting to know how similar doses affect metabolism of mammalian cells. Rifampicin is usually well-tolerated and rarely causes serious toxicity in eukaryotic cells. In extreme doses, however, rifampicin is known to produce hepatic, renal and hematological disorders and metabolic acidosis [ 27 ]. Its toxicity is predominantly hepatic and immuno-allergic in character. Rifampicin induces a dose-dependent hepatotoxicity in HHL-17 cells (IC50; 600 µM), and increases the serum levels of liver injury markers, e.g., alanine transaminase (ALT) and aspartate transaminase (AST) [ 28 ]. Also, it was found that rifampicin at exorbitant concentration exerts adverse effects on the proliferation of MSCs in human bone marrow and the differentiation of osteoblasts [ 29 ]. Tandemly arranged satellite DNA repeats represent a challenge for the maintenance of genomic stability, during normal cellular functions such as replication and transcription [ 15 ]. It was shown that increased pericentric satellite DNA transcription has negative effects on cellular physiology, leading to defects typically associated with tumorigenesis and ageing. Overexpressed transcripts of pericentromeric major satellite DNA in mice sequester BRCA1-associated network, cause accumulation of RNA loops, DNA damage and induce breast cancer [ 30 ]. Satellite DNAs are sensitive to different exogenous and endogenous stress conditions and here we investigated if the antibiotics commonly used in cell culture studies affect the expression of non-coding major human alpha satellite DNA. We used the aminoglycoside antibiotics geneticin G418 and hygromycin B which are effective against both eukaryotic and prokaryotic cells and are used to select for cells that express antibiotic resistance. Both antibiotics affect protein synthesis. We also tested rifampicin, an ansamycin antibiotic used to treat some bacterial infections, including tuberculosis. Paradoxically, rifampicin blocks bacterial DNA transcription by inhibiting bacterial RNA polymerase, whereas in our study it had an opposite effect on human heterochromatic DNA transcription, i.e. it stimulated it. The present study revealed that alpha satellite DNA is highly susceptible to antibiotic stress. Namely, using three cell lines: glioblastoma A-1235, HeLa and MJ90hTERT, we observed increased transcription of alpha satellite DNA using all three antibiotics at standard concentrations, although the response differed among cell lines. Maximal increase in A-1235 cells was obtained by rifampicin while in MJ90hTERT and HeLa cells geneticin induced the most significant increase of transcription under standard concentrations. The results also reveal a positive correlation between antibiotic concentration and the level of alpha satellite transcription. The cell lines used as models in our research were selected for two specific reasons. First, in our previous experiments they demonstrated robustness and high viability (> 80%; using sublethal, physiological doses) during treatments and manipulations, providing results that were both highly reproducible and significant. Second, while the effect of antibiotics on satellite expression was observed in all cases, as is clearly shown in Fig. 1 ., the most significant combinations were chosen for further epigenetic testing. It should also be noted that MJ90 are fibroblasts, immortalized with hTERT, therefore considered non-transformed cells, both morphologically and physiologically. The increase of alpha satellite expression upon treatment with antibiotics is associated with significant decrease of silent histone mark H3K9me3 at heterochromatic alpha satellite repeats in HeLa and MJ90hTERT cells treated with geneticin and A-1235 cells with rifampicin, respectively, suggesting possible influence of this epigenetic change on alpha satellite DNA transcription. At concentrations of antibiotics which did not significantly affect satellite transcription, no change of H3K9me3 level in HeLa and A-1235 cells was observed, also supporting a possible relation between satellite transcription and H3K9me3 levels at heterochromatin. In MJ90hTERT cells, however, H3K18ac level was increased upon treatment with geneticin alongside the decrease of H3K9me3 level. Since it is known that H3K18 hyperacetylation leads to aberrant accumulation of pericentric transcripts [ 16 ], we propose that increased level of H3K18ac might also be responsible for overexpression of alpha satellite DNA in MJ90hTERT cells after geneticin treatment. Previous studies have shown that alpha satellite transcription seems to be controlled by the presence of centromere–nucleolar contacts [ 31 ] and by CENP-B protein which promotes the binding of the zinc-finger transcriptional regulator (ZFAT) responsible for activation of RNA Pol II transcription [ 32 ]. It was shown that Topoisomerase I (TopI) promotes the transcription of α-satellite DNAs which is also stimulated in response to DNA double-stranded breaks (DSBs) [ 33 ]. However, the results presented here, as well as the increased transcription of alpha satellite DNA in cancer which is associated with decreased H3K9me3 level at satellite repeats [ 17 ], suggest a regulation of alpha satellite transcription by epigenetic changes, in particular by histone marks H3K9me3 and H3K18ac. Loss of epigenetic heterochromatic marks was shown to be responsible for overexpression of satellite DNA in ageing [ 34 ] and neurodegenerative diseases [ 23 ]. Apart from H3K9me3 and H3K18ac we did not observe a change in histone mark H3K4me2, characteristic for open but inactive euchromatin [ 35 ], at tandemly arranged heterochromatic alpha satellite repeats. Also, no change in all three epigenetic modifications was detected on alpha satellite repeats dispersed within euchromatin upon antibiotics treatment. More diverse changes, including not only H3K9me3 and H3K18ac but also H3K4me2, were detected genome-wide using immunofluorescence and these changes depended on cell type, antibiotic and antibiotic concentration. We acknowledge that gene expression and epigenetic responses vary depending on cell type. In our study, we observed distinct regulatory patterns of alpha satellite expression across the tested cell lines, likely influenced by differences in chromatin organization, baseline transcriptional activity, and cellular metabolism. These variations may reflect intrinsic differences between cancerous and normal cells in their response to external stimuli, including antibiotics. Further studies are needed to dissect the molecular mechanisms driving these cell-type-specific effects. Different signaling pathways, overactivated in different cell lines, possibly confer resistance to certain antibiotics as well as types of stress or damage that they induce. It is likely that the level of certain type of stress the cells can resist varies between different cell lines and that their coping mechanisms against different types of stress are also diverse as a general consequence of their specific genetic background. In conclusion, antibiotics can stress human cells and disrupt their transcriptional regulation. Our results reveal that different antibiotics induce the increase of transcription of alpha satellite DNA in diverse cell lines. Since such an occurrence is accompanied with H3K9me3 decrease or H3K18ac increase at heterochromatic regions, we propose that epigenetic changes, in particular those of H3K9me3 and H3K18ac levels, could affect the expression of alpha satellite DNA upon antibiotic treatment. These findings suggest that antibiotics may influence satellite DNA transcription by modulating specific histone marks, thus impacting gene expression and genome stability. While the histone modification pathways are well known and highly conserved among all eukaryotes, the underlying mechanisms by which antibiotics potentially interact with said pathways are currently unknown. Ubiquitous effector enzymatic complexes and their functions; such as activating demethylases and acetyl-transferases; suppressing methyl-transferases and deacetylases, as well as chromatin remodeling factors such as SWI/SNF are well understood. Integrated stress response could also play a role by interacting with above-mentioned pathways. Many types of stress, including antibiotic, activate integrated stress response cellular machinery resulting in overproduction of specific transcription factors (such as ATF4), stimulating downstream chromatin remodeling of specific loci and neighboring promoter activation, consequently explaining their overexpression. It should be noted that transcription of alpha satellite DNA upon antibiotic treatment in some cases exceeded normal transcription rate almost 5-fold (e.g. HeLa cells treated with geneticin 400 µg/ml), possibly affecting cell physiology as well as genome stability in the process. Overexpression of satellite DNA could compromise genome stability and alter cell behaviour, potentially leading to carcinogenesis or accelerated aging processes, and these facts should be taken into consideration when experiments on such cell lines are performed. This paper shows that commonly used antibiotics not only affect bacterial cells but also induce significant transcriptional and epigenetic changes in eukaryotic cells, particularly at alpha satellite DNA regions. This can lead to genomic instability, which may affect cell physiology and contribute to diseases such as cancer or neurodegenerative disorders. The observed epigenetic changes, such as the reduction in H3K9me3 and increase in H3K18ac, provide a potential mechanistic explanation for the transcriptional upregulation of alpha satellite DNA. These findings suggest that researchers using antibiotics in cell culture studies should consider the results described in this paper when such experiments are performed. Our research highlights the following key points: Routine antibiotic use in cell cultures affects metabolism and genomic stability, warranting caution. Antibiotic treatment in humans may have systemic effects beyond bacterial targeting, varying across tissues. Differential antibiotic effects on cancer vs. healthy tissues could inform potential anticancer strategies. Antibiotics may influence gene expression beyond alpha satellite DNA, potentially affecting other genomic regions and regulatory elements. Understanding individual variability in antibiotic response could improve drug safety and personalized treatment strategies. Chronic antibiotic exposure may have cumulative effects on genomic stability and epigenetic regulation. These findings underscore broader implications for gene regulation, drug safety, and long-term antibiotic effects, highlighting the need for further research. 4. Materials and Methods 4.1. Human cell lines The following human cell lines were used in experiments: MJ90hTERT (immortalized human skin fibroblasts), HeLa (human cervical cancer) and A-1235 (human glioblastoma). Cells were cultured in appropriate medium (DMEM) supplemented with 10% FBS and 5% CO2 at 37°C. Cells were incubated for 48 hrs at 37°C with antibiotics geneticin, rifampicin and hygromycin B (Carl Roth) in complete medium. The concentration range of the antibiotics were: geneticin 300–600 µg/ml, hygromycin B 50–100 µg/ml, as well as with rifampicin 8.2–82 µg/ml (10–100 µM). 4.2. RNA isolation and reverse transcription For RNA isolation from cell cultures lysis buffer was added directly after the PBS washing step, avoiding trypsin treatment. RNA was quantified with the Quant-IT RNA assay kit using a Qubit fluorometer (Invitrogen). Integrity of RNA was checked by gel electrophoresis. Approximately 1 µg of RNA was reverse transcribed using the PrimeScript RT reagent Kit with gDNA Eraser (perfect Real Time, Takara) in 20 µl reaction using specifically modified primer for alpha satellite rev AATGCACATATCACTATGTAC, designed to produce cDNA molecules that differ from genomic DNA in order to avoid DNA contamination [ 36 ]. For all samples, negative controls without reverse transcriptase were used. 4.3. Quantitative real-time PCR (qPCR) analysis qPCR analysis was performed according to the previously published protocol (Feliciello et al. 2015). Primers used for transcriptional analysis of alpha satellite DNA were constructed based on consensus sequence derived from cloned alpha satellite monomers of wide-ranging chromosomal origins [ 37 ] and the same modified primer used previously in reverse transcription was used in qPCR amplification along with the second primer fw CACTCTTTTTGTAGAATCTGC. In this way, amplification was unaffected by any potential DNA contamination [ 34 ]. Glucuronidase beta (GUSB) [ 38 ] was used as an endogenous control for normalization in human samples. GUSB gene (Gene ID: 2990) was stably expressed without any variation among samples after antibiotic treatment. Sequences of GUSB gene primers are fw GAAAATACGTGGTTGGAGAGCTCATT and rev CCGAGTGAAGATCCCCTTTTTA. The following thermal cycling conditions were used: 50°C 2 min, 95°C 7 min, 95°C 15 s, 60°C 1 min for 40 cycles followed by dissociation stage: 95°C for 15 s, 60°C for 1 min, 95°C for 15 s and 60°C for 15 s. Amplification specificity was confirmed by dissociation curve analysis and specificity of amplified products was tested on agarose gel. Control without template (NTC) was included in each run. Post-run data were analysed using LinRegPCR software v.11.1. [ 39 , 40 ] which enables calculation of the starting concentration of amplicon (“N 0 value”). N 0 value is expressed in arbitrary fluorescence units and is calculated by taking into account PCR efficiency and baseline fluorescence. N 0 value determined for each technical replicate was averaged and the averaged N 0 values were divided by the N 0 values of the endogenous control. Statistical analysis of qPCR data was done using GraphPad v.6.01 and normalized N 0 values were compared using the unpaired t-test which compares the means of two unmatched groups. 4.4. Chromatin immunoprecipitation MJ90hTERT, A-1235 and HeLa cells were grown to subconfluence, washed in PBS, scraped in Nuclear Isolation buffer (10 mM MOPS; 5 mM KCl; 10 mM EDTA; 0.6% Triton X-100) with protease inhibitor cocktail CompleteMini (Roche) and chromatin immunoprecipitation was performed according to the published protocol (Feliciello et al. 2015, 2020), with the exception of sonication step which was performed 30 times for 30 s on ice, high sonicator amplitude. The antibodies used were: Anti-Histone H3 (tri methyl K9, Abcam, ab8898), Anti-Histone H3 (di methyl K4, tri methyl K4, Abcam, ab6000), Anti-Histone H3 (acetyl K18, Abcam, ab1191), Anti-Histone H3 (di methyl K4, Abcam, ab7766) and IgG (Santa Cruz Biotechnology, sc2027). Binding of precipitated target was monitored by qPCR using the SYBR Green PCR Master mix (Bio-Rad). Primers used for H3K9me3, H3K18ac and H3K4me2 level analyses at heterochromatic alpha regions as well as at dispersed alpha repeats are listed in Table S1 . The N 0 values were normalized using N 0 values of input fractions. 4.5. Immunofluorescence Cells were grown on cover slips up to 70% confluence, washed with PBS and fixed for 5 min in cold methanol. Permeabilization was done by 0.5% triton X-100 for 5 min and blocking with DAKO Protein Block Serum-free ready to use reagent for 1 h at RT. Primary antibodies anti-H3K9me3 (Abcam, ab8898), anti-H3K18ac (Abcam, ab1191) and anti-H3K4me2 (Abcam, ab7766) were diluted in DAKO Antibody Diluent according to the instructions of Abcam, and incubation was performed overnight at 4°C. After washing in PBS, goat polyclonal secondary antibody to rabbit IgG (ab150081) was diluted 1/1000 in DAKO Antibody Diluent and incubation was performed for 1 hr at RT in the dark. Cells were stained with 1 µg/ml DAPI and a drop of DAKO Anti-Fade Fluorescence Mounting Medium was added. Cell slides were sealed with nail polish and analysed by confocal microscopy (Laser Scanning Confocal Microscope Leica SP8 X FLIM). For each sample slide (control and treated), five images were taken and the mean fluorescence values of all structurally and morphologically intact nuclei were quantified using „ImageJ“ software [ 41 ]. The Shapiro–Wilk test was used to test data normality. Mean fluorescence values of treated samples and controls were tested for statistical significance using the parametric 2-tailed Welch’s t-test if the data had normal distribution and non-parametric Mann–Whitney test when it did not. P-values less than 0.05 were considered statistically significant. Declarations Supplementary Materials: The following supporting information can be downloaded at: www.mdpi.com/xxx/s1. Figure S1: Consensus sequence of 171 bp alpha satellite monomer; Figure S2a: H3K9me3 level at tandemly arranged alpha satellite arrays in HeLa cells; Figure S2b: H3K18ac level at tandemly arranged alpha satellite arrays in MJ90hTERT cells; Figure S3a: H3K18ac and H3K4me2 levels at tandemly arranged alpha satellite repeats and dispersed alpha repeats; Figure S3b: H3K4me2 levels of MJ90hTERT cells treated with geneticin; Figure S4: H3K18ac and H3K4me2 levels in HeLa cells after treatment with geneticin; Table S1: List of primers used in ChIP-qPCR experiments. Author Contributions: Conceptualization, I.F.; methodology, M.M., S.L.; formal analysis, S.L., M.M., D.Đ., M.C.F., A.P., I.F.; investigation, S.L., M.M., I.F.; writing original draft preparation, I.F. and Đ.U.; writing—review and editing, Đ.U., I.F., D.Đ.; supervision, I.F; All authors have read and agreed to the published version of the manuscript. Funding: This work was funded by the Italian Ministry of Education, University and Research (MIUR), FFABR2017, fund for Investments on Basic Research (FIRB) and by the International Staff Mobility Program of University of Naples Federico II to I. Feliciello, as well as by Croatian Science Foundation grant: IP-2019-04-6915 to Ð. Ugarković. Data Availability Statement: The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s. Acknowledgments: We thank Kristina Kovač for the technical support. Conflicts of Interest: “The authors declare no conflicts of interest.” References Smith RP, Eckalbar WL, Morrissey KM, et al. Genome-wide discovery of drug-dependent human liver regulatory elements. PLoS Genet. 2014;10:e1004648. Ryu AH, Eckalbar WL, Kreimer A, Yosef N, Ahituv N. Use antibiotics in cell culture with caution: genome-wide identification of antibiotic-induced changes in gene expression and regulation. Sci Rep. 2017;7:7533. Elliott RL, Jiang XP. The adverse effect of gentamicin on cell metabolism in three cultured mammary cell lines. Are cell Cult data skewed? PLoS One. 2019;14:e0214586. Gallo A, Landi R, Rubino V, et al. Oxytetracycline induces DNA damage and epigenetic changes: a possible risk for human and animal health? PeerJ. 2017;5:e3236. Ugarković Đ, Sermek A, Ljubić S, Feliciello I. Satellite DNAs in health and disease. Genes. 2022;13:1154. Vourc’h C, Biamonti G. Transcription of satellite DNAs in mammals. Prog Mol Subcell Biol. 2011;51:95–118. Pezer Ž, Ugarković Đ. Satellite DNA-associated siRNAs as mediators of heat shock response in insects. RNA Biol. 2012;9:587–95. Hédouin S, Grillo G, Ivkovic I, et al. CENP-A chromatin disassembly in stressed and senescent murine cells. Sci Rep. 2017;7:42520. Feliciello I, Sermek A, Pezer Ž, et al. Heat stress affects H3K9me3 level at human alpha satellite DNA repeats. Genes. 2020;11:663. Sermek A, Feliciello I, Ugarković Đ. Distinct regulation of the expression of satellite DNAs in the beetle Tribolium castaneum. Int J Mol Sci. 2021;22:296. Fonseca-Carvalho M, Veríssimo G, Lopes M, et al. Answering the cell stress call: satellite non-coding transcription as a response mechanism. Biomolecules. 2024;14:124. Ting DT, Lipson D, Paul S, et al. Aberrant overexpression of satellite repeats in pancreatic and other epithelial cancers. Science. 2011;331:593–6. Ljubić S, Sermek A, Prgomet Sečan A, et al. Alpha satellite RNA levels are upregulated in the blood of patients with metastatic castration-resistant prostate cancer. Genes. 2022;13:383. Kim N, Jinks-Robertson S. Transcription as a source of genome instability. Nat Rev Genet. 2012;13:204–14. Black EM, Giunta S. Repetitive fragile sites: centromere satellite DNA as a source of genome instability in human diseases. Genes (Basel). 2018;9:615. Tasselli L, Xi Y, Zheng W, et al. SIRT6 deacetylates H3K18ac at pericentric chromatin to prevent mitotic errors and cellular senescence. Nat Struct Mol Biol. 2016;23:434–40. Vojvoda Zeljko T, Ugarković Đ, Pezer Ž. Differential enrichment of H3K9me3 at annotated satellite DNA repeats in human cell lines and during fetal development in mouse. Epigenet Chromatin. 2021;14:47. Unoki M, Sharif J, Saito Y, et al. CDCA7 and HELLS suppress DNA:RNA hybrid-associated DNA damage at pericentromeric repeats. Sci Rep. 2020;10:17865. Feliciello I, Akrap I, Ugarković Đ. Satellite DNA modulates gene expression in the beetle Tribolium castaneum after heat stress. PLoS Genet. 2015;11:e1005466. Landers CC, Rabeler CA, Ferrari EK, et al. Ectopic expression of pericentric HSATII RNA results in nuclear RNA accumulation, MeCP2 recruitment, and cell division defects. Chromosoma. 2021;130:75–90. Boeree MJ, Heinrich N, Aarnoutse R, et al. High-dose rifampicin, moxifloxacin, and SQ109 for treating tuberculosis: a multi-arm, multi-stage randomised controlled trial. Lancet Infect Dis. 2017;17:39–49. McNulty SM, Sullivan BA. Alpha satellite DNA biology: finding function in the recesses of the genome. Chromosom Res. 2018;26:115–38. Smurova K, De Wulf P. Centromere and pericentromere transcription: roles and regulation in sickness and in health. Front Genet. 2018;9:674. Davies J, Davies D. Origins and evolution of antibiotic resistance. Microbiol Mol Biol Rev. 2010;74:417–33. Zeh JA, Bonilla MM, Adrian AJ, et al. From father to son: transgenerational effect of tetracycline on sperm viability. Sci Rep. 2012;2:375. Kalghatgi S, Spina CS, Costello JC, et al. Bactericidal antibiotics induce mitochondrial dysfunction and oxidative damage in mammalian cells. Sci Transl Med. 2013;5:192ra85. Sridhar A, Sandeep Y, Krishnakishore C, Sriramnaveen P, Manjusha Y, Sivakumar V. Fatal poisoning by isoniazid and rifampicin. Indian J Nephrol. Sep; 2012;22(5):385–7. Kainat KM, Ansari MI, Bano N, Jagdale PR, Ayanur A, Kumar M, Sharma PK. Rifampicin-induced ER stress and excessive cytoplasmic vacuolization instigate hepatotoxicity via alternate programmed cell death paraptosis in vitro and in vivo. Life Sci. 2023;15:333:122164. Zhang Z, Wang X, Luo F, Yang H, Hou T, Zhou Q, Dai F, He Q, Xu J. Effects of rifampicin on osteogenic differentiation and proliferation of human mesenchymal stem cells in the bone marrow. Genet Mol Res. 2014;25(3):6398–410. Zhu Q, Hoong N, Aslanian A, et al. Heterochromatin-encoded satellite RNAs induce breast cancer. Mol Cell. 2018;70:842–e8537. Bury L, Moodie B, Ly J, et al. Alpha-satellite RNA transcripts are repressed by centromere-nucleolus associations. Elife. 2020;9:e59770. Ishikura S, Yoshida K, Hashimoto S, et al. CENP-B promotes the centromeric localization of ZFAT to control transcription of noncoding RNA. J Biol Chem. 2021;297:101213. Teng Z, Yang L, Zhang Q, et al. Topoisomerase I is an evolutionarily conserved key regulator for satellite DNA transcription. Nat Commun. 2024;15:5151. Larson K, Yan SJ, Tsurumi A, et al. Heterochromatin formation promotes longevity and represses ribosomal RNA synthesis. PLoS Genet. 2012;8:e1002473. Soares LM, He PC, Chun Y, et al. Determinants of histone H3K4 methylation patterns. Mol Cell. 2017;68:773–e7856. Đermić D, Ljubić S, Matulić M, et al. Reverse transcription-quantitative PCR (RT-qPCR) without the need for prior removal of DNA. Sci Rep. 2023;13:11470. Choo K, Vissel B, Nagy A, et al. A survey of the genomic distribution of alpha satellite DNA on all the human chromosomes, and derivation of a new consensus sequence. Nucleic Acids Res. 1991;19:1179–82. Aerts JL, Gonzales MI, Topalian SL. Selection of appropriate control genes to assess expression of tumor antigens using real-time RT-PCR. Biotechniques. 2004;36:84–91. Ruijter JM, Ramakers C, Hoogaars WMH, et al. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009;37:e45. Ruijter JM, Pfa MW, Zhao S, et al. Evaluation of qPCR curve analysis methods for reliable biomarker discovery: bias, resolution, precision, and implications. Methods. 2013;59:32–46. Schneider C, Rasband W, Eliceiri K. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012;9:671–5. Additional Declarations No competing interests reported. Supplementary Files supplement.pdf Cite Share Download PDF Status: Published Journal Publication published 26 Sep, 2025 Read the published version in Epigenetics & Chromatin → Version 1 posted Editorial decision: Revision requested 08 Jun, 2025 Reviews received at journal 07 Jun, 2025 Reviews received at journal 25 May, 2025 Reviewers agreed at journal 18 May, 2025 Reviewers agreed at journal 17 May, 2025 Reviewers agreed at journal 16 May, 2025 Reviews received at journal 15 May, 2025 Reviewers agreed at journal 15 May, 2025 Reviewers invited by journal 15 May, 2025 Editor assigned by journal 15 May, 2025 Submission checks completed at journal 14 May, 2025 First submitted to journal 14 May, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6661736","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":458173386,"identity":"39535994-19dd-4f1f-9ccd-f9c808edb461","order_by":0,"name":"Sven Ljubić","email":"","orcid":"","institution":"Rudjer Boskovic Institute","correspondingAuthor":false,"prefix":"","firstName":"Sven","middleName":"","lastName":"Ljubić","suffix":""},{"id":458173388,"identity":"679f5123-2d9c-4707-9298-55f16d5c949b","order_by":1,"name":"Maja Matulić","email":"","orcid":"","institution":"University of Zagreb","correspondingAuthor":false,"prefix":"","firstName":"Maja","middleName":"","lastName":"Matulić","suffix":""},{"id":458173389,"identity":"2a9df028-ff69-4129-a371-6ab6fdd9f7ef","order_by":2,"name":"Damir Dermic","email":"","orcid":"","institution":"Rudjer Boskovic Institute","correspondingAuthor":false,"prefix":"","firstName":"Damir","middleName":"","lastName":"Dermic","suffix":""},{"id":458173392,"identity":"cbd5433e-2ffd-4291-ad3d-45feae27eebf","order_by":3,"name":"Maria Chiara Feliciello","email":"","orcid":"","institution":"University of Bologna","correspondingAuthor":false,"prefix":"","firstName":"Maria","middleName":"Chiara","lastName":"Feliciello","suffix":""},{"id":458173394,"identity":"b1553d00-df21-4d51-a654-2685d01ac2cc","order_by":4,"name":"Alfredo Procino","email":"","orcid":"","institution":"Rudjer Boskovic Institute","correspondingAuthor":false,"prefix":"","firstName":"Alfredo","middleName":"","lastName":"Procino","suffix":""},{"id":458173396,"identity":"a5862ea3-879e-4b11-8c05-dc6d467a0b0f","order_by":5,"name":"Durdica Ugarkovic","email":"","orcid":"","institution":"Rudjer Boskovic Institute","correspondingAuthor":false,"prefix":"","firstName":"Durdica","middleName":"","lastName":"Ugarkovic","suffix":""},{"id":458173399,"identity":"f676969b-48ba-414a-af24-2cca696a291b","order_by":6,"name":"Isidoro Feliciello","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABB0lEQVRIie3PMUsDMRTA8RcCyfJo1sBJ7ytEnMTTfhVD4SaF+wg5Cp0KXftJOjnkCOjkXtDBW26ui3QoaFIPpwTBySH/JYHwI+8B5HL/MAbEyHDhhhoLCs4mQC34CwD9haAlJ4IM2O1IEsb3Q04nA1TjQ5xMhGt37w8VIG9be2gqZHz1UTTNawlc2OhgUi8uN0MNiJ3pVqpGhs/bYqOGc5MYjEmyLNA6mEltHCiHTN5vC1SOJInovgmWfSCfntwNgcySBPRIJAnEBsIC0enBwi62RkQddpn7XR4vrjyZLylVMVKun/rd3lZT5M7tD8ebqeCL/gWP7noturfoN2MYmzmXy+Vyf+0LNF5TG+7d9bMAAAAASUVORK5CYII=","orcid":"","institution":"University of Naples Federico II","correspondingAuthor":true,"prefix":"","firstName":"Isidoro","middleName":"","lastName":"Feliciello","suffix":""}],"badges":[],"createdAt":"2025-05-14 07:53:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6661736/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6661736/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13072-025-00628-z","type":"published","date":"2025-09-26T15:58:08+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":83076464,"identity":"4db918fc-e9e0-4f54-8301-6076d5229c3e","added_by":"auto","created_at":"2025-05-19 18:15:13","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":43604,"visible":true,"origin":"","legend":"\u003cp\u003eTranscription of alpha satellite DNA in different cell lines after antibiotic treatment for 48 hrs: (A) HeLa cells treated with hygromycin B (50 µg/ml), geneticin (300 µg/ml and 400 µg/ml), rifampicin (82 µg/ml); (B) A-1235 cells treated with hygromycin B (50 µg/ml), geneticin (400 µg/ml), rifampicin (82 µg/ml); (C) A-1235 cells treated with rifampicin 8.2 µg/ml, 41 µg/ml, and 82 µg/ml;\u0026nbsp; (D) MJ90hTERT cells treated with hygromycin B (50 µg/ml and 100 µg/ml), geneticin (400 µg/ml and 600 µg/ml), rifampicin (82 µg/ml). Two independent experiments were performed on each cell line. N\u003csub\u003e0\u003c/sub\u003e represents normalized average N\u003csub\u003e0\u003c/sub\u003e value and C denotes control. Columns show averages of two different RT-qPCR experiments performed in triplicates and error bars represent standard deviations.\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6661736/v1/dc67a62d250f2b3774678774.jpg"},{"id":83076469,"identity":"9687c4b6-1c57-401a-807f-8aff9493674c","added_by":"auto","created_at":"2025-05-19 18:15:13","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":42110,"visible":true,"origin":"","legend":"\u003cp\u003eLevels of histone modifications at tandemly arranged alpha satellite repeats characteristic for heterochromatin and at alpha repeats (ARs) dispersed within euchromatin after antibiotic treatment for 48 hrs: A) H3K9me3 level in HeLa cells after treatment with geneticin (400 μg/ml); B) H3K9me3 level in A-1235 cells after treatment with rifampicin (100 μM); C) H3K9me3 level in MJ90hTERT cells after treatment with geneticin (600 μg/ml); D) H3K18ac level in MJ90hTERT cells after treatment with geneticin (600 μg/ml). Levels of histone modifications were measured by ChIP coupled with quantitative real-time PCR at standard conditions (control) and after antibiotic treatment. N\u003csub\u003e0\u003c/sub\u003e values were normalized using N\u003csub\u003e0\u003c/sub\u003e values of input fractions and represent the levels of histone modifications. Columns show averages of two independent experiments and error bars indicate standard deviations\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6661736/v1/3c963945db6ecea46950fa11.jpg"},{"id":83076466,"identity":"f5eed9a2-6148-48ee-abe1-c4d48b174211","added_by":"auto","created_at":"2025-05-19 18:15:13","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":49159,"visible":true,"origin":"","legend":"\u003cp\u003eGenome-wide analysis of H3K9me3 (a), H3K18ac (b) and H3K4me2 (c) levels in HeLa cells after geneticin treatment (400 µg/ml, left panels) and in controls (right panels). The fluorescence intensity is shown by box plots. Median values are indicated and error bars represent standard deviations.\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6661736/v1/90bf220db359a74813691018.jpg"},{"id":83076465,"identity":"3d91fdac-3983-4f1a-832d-304bf7008440","added_by":"auto","created_at":"2025-05-19 18:15:13","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":154880,"visible":true,"origin":"","legend":"\u003cp\u003eGenome-wide analysis of H3K9me3 (a), H3K18ac (b) and H3K4me2 (c) levels in MJ90hTERT cells after treatment with geneticin 600 µg/ml (left panels) and in controls (right panels). The fluorescence intensity is shown by box plots. Median values are indicated and error bars represent standard deviations.\u003c/p\u003e","description":"","filename":"Picture4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6661736/v1/099902c5b0d284091d84601a.jpg"},{"id":83076474,"identity":"e6338675-6217-4955-8254-b576faf0caf1","added_by":"auto","created_at":"2025-05-19 18:15:13","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":224043,"visible":true,"origin":"","legend":"\u003cp\u003eGenome-wide analysis of H3K9me3 (a) H3K18ac (b) and H3K4me2 (c) levels in A-1235 cells after treatment with rifampicin 100 µM (left panels) and in controls (right panels). The fluorescence intensity is shown by box plots. Median values are indicated and error bars represent standard deviations.\u003c/p\u003e","description":"","filename":"Picture5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6661736/v1/2cf9a4934c0d7caf9e58d614.jpg"},{"id":92430632,"identity":"c91bd355-1ab6-4b33-b6e1-7348b17c5d03","added_by":"auto","created_at":"2025-09-29 16:07:03","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1214137,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6661736/v1/223cc16c-94dc-4e3c-aeb2-3d40d22150c2.pdf"},{"id":83076932,"identity":"51c4e429-535e-4262-86e2-2a21d67a9cc9","added_by":"auto","created_at":"2025-05-19 18:23:13","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":535447,"visible":true,"origin":"","legend":"","description":"","filename":"supplement.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6661736/v1/a510be7faf609113b12a48b2.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Antibiotics induce overexpression of alpha satellite DNA accompanied with epigenetic changes at alpha satellite arrays as well as genome-wide","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eAntibiotics are routinely used for \u003cem\u003ein vitro\u003c/em\u003e studies while culturing cells in order to avoid bacterial contamination and for selection purposes. However, different studies have shown that use of antibiotics can affect gene expression and could modify the results of studies focused on drug response, cell cycle regulation and cell differentiation [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Antibiotic rifampicin (10 \u0026micro;M for 24 hours) was shown to induce genome-wide drug dependent changes in gene regulation and expression in human hepatocytes, some of them linked to changes in histone marks H3K4me1 and H3K27ac [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Cells cultured with standard 1% Penicillin-Streptomycin (PenStrep) supplemented media showed significantly altered gene expression and regulation, as observed in a common liver cell line such as HepG2. Drug-associated genes were differentially expressed following PenStrep treatment and differential enrichment of active promoter and enhancer regions marked by H3K27ac was reported [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The human peripheral blood mononuclear cells (PBMCs) expressed DNA damage features such as activation of a serine/threonine kinase ATM and p53, as well as epigenetic changes - phosphorylation of H2AX and H3K4me2/3 modifications at some promoter sites after the \u003cem\u003ein vitro\u003c/em\u003e exposure to antibiotic oxytetracycline (OTC, 2 \u0026micro;g/ml or 4,3 \u0026micro;M) [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Since OTC is largely employed in veterinary practices, this reveals a potential influence of OTC on animal and human health. While the effect of antibiotic treatment on gene expression was previously at least partially characterized, the influence of antibiotics on non-coding regions of genome, in particular on (peri)centromeric satellite DNAs which are related to genome stability, is poorly investigated. Therefore, the molecular consequences of growing human cell lines with antibiotics at standard cell culture concentrations as well as of antibiotics use in veterinary and medical practice have yet to be thoroughly investigated.\u003c/p\u003e \u003cp\u003eSatellite DNAs are tandemly repeated sequences preferentially clustered in (peri)centromeric regions of eukaryotic chromosomes [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Recent studies reveal that their expression is highly sensitive to environmental factors such as heat stress, DNA damaging agents, genotoxic and hyperosmotic stress [\u003cspan additionalcitationids=\"CR7 CR8 CR9 CR10\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Satellite DNA expression is also significantly increased under different pathological conditions, such as in diverse types of cancer [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Transcription of satellite DNA may represent a source of genomic instability through collision between replication and transcription forks, formation of secondary structures and cytotoxic DNA\u0026ndash;RNA hybrids known as R-loops [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Therefore, tight regulation of centromeric and pericentromeric transcription is essential for the maintenance of genome stability [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] and cells with aberrant satellite DNA expression can feature substantial mitotic defects and large-scale genetic aberrations, including chromosomal instability and aneuploidy [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Satellite DNAs located within heterochromatin seem to be at least partially under epigenetic control and their arrays in cancer cells are characterized by lower level of repressive heterochromatic histone modification H3K9me3 as well as by global DNA hypomethylation relative to normal cells [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. On the other hand, heat stress induces the increase of silent histone mark H3K9me3 at (peri)centromeric satellite repeats as well as at the satellite repeats dispersed within euchromatin [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], resulting in downregulation of expression of nearby genes [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHere, we analyzed whether antibiotics such as geneticin and hygromycin B, which are conveniently used in cell culture [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], as well as rifampicin which is used to treat several types of bacterial infections [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], affect expression of a major, most abundant human alpha satellite DNA clustered in (peri)centromeric regions of all human chromosomes [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. We also studied if potential changes in satellite DNA expression under antibiotic stress were accompanied by epigenetic changes such as histone marks at heterochromatic satellite arrays and at the satellite repeats dispersed within euchromatin, as well as genome-wide. Using different cell types, we show that all three antibiotics induce overexpression of alpha satellite DNA at concentrations routinely used for \u003cem\u003ein vitro\u003c/em\u003e studies and for medical treatment. In addition, overexpression is accompanied by changes in epigenetic modifications on histone marks at alpha satellite arrays located in heterochromatin as well as genome-wide. We proposed that epigenetic changes in heterochromatin, such as decrease of silent histone modification H3K9me3 whose loss affects satellite DNA expression [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], and increase of H3K18ac, which is characteristic for transcriptional activation of heterochromatin [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], could be linked to induced alpha satellite DNA expression upon antibiotic stress.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"2. Results","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.1. Alpha satellite DNA transcription after antibiotic treatment\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate whether antibiotics affect the transcription of alpha satellite DNA we followed its transcription dynamics in human cell lines by RT-qPCR under standard conditions and after antibiotic treatment. Primers used for transcriptional analysis were able to amplify only tandemly arranged repeats (Figure S1) and since in human pericentromeric heterochromatin alpha satellite DNA is organized in tandemly arranged monomers [22], it is expected that the primers preferentially recognize transcripts deriving from pericentromeric regions. Cells were incubated for 48 hrs at 37\u003cins cite=\"mailto:ISIDORO%20FELICIELLO\" datetime=\"2024-11-05T12:56\"\u003e\u0026nbsp;\u003c/ins\u003e\u0026deg;C in complete medium with concentrations of antibiotics used for routine treatment, selection and maintenance of eukaryotic cells: geneticin 300-600 \u0026micro;g/ml, hygromycin B 50-100 \u0026micro;g/ml as well as with rifampicin 8.2-82 \u0026micro;g/ml (10-100 \u0026micro;M). The transcription of alpha satellite DNA was checked immediately after antibiotic treatment and compared with a control. The transcription of alpha satellite DNA was monitored in immortalized fibroblasts (MJ90hTERT), glioblastoma cell line A-1235 and cervix carcinoma HeLa cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTreatment of A1235 cells with hygromycin B (50 \u0026micro;g/ml), geneticin (400 \u0026micro;g/ml) and rifampicin (82 \u0026micro;g/ml) revealed the increase of transcription by 1.6x (P=0.01), 1.7x (P=0.008), and 3.0x (P=0.02), respectively (Figure 1b). To test if transcription responds to antibiotic concentration, A-1235 cells were treated with three different concentrations of rifampicin (8.2, 41, and 82 \u0026micro;g/ml). The results showed no effect after 8.2 \u0026micro;g/ml treatment while 41 \u0026micro;g/ml and 82 \u0026micro;g/ml induced increase of 1.8x (P=0.009) and 3.0x (P=0.02), respectively (Figure 1c), suggesting positive correlation between transcription and antibiotic concentrations. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHela cells treated with hygromycin B (50 \u0026micro;g/ml), geneticin (400 \u0026micro;g/ml) and rifampicin (82 \u0026micro;g/ml) showed the increase of transcription by 3.1x (P =0.02), 4.9x (P=0.01), and 1.5x (P=0.01), respectively (Figure 1a), while decreased concentration of geneticin (300 \u0026micro;g/ml) showed no effect on alpha satellite transcription (Figure 1a).\u003c/p\u003e\n\u003cp\u003eImmortalized fibroblast MJ90hTERT cell line showed a modest increase of transcription of 1.5x (P=0.01) after geneticin (400 \u0026micro;g/ml) while treatment with hygromycin B (50 \u0026micro;g/ml) and rifampicin (82 \u0026micro;g/ml) did not show a significant change of transcription. Higher concentration of hygromycin B (100 \u0026micro;g/ml) showed 1.5x (P=0.01) increase of alpha satellite, however, with high percentage of dead cells. On the other hand, higher concentration of geneticin (600 \u0026micro;g/ml) induced 1.9x (P=0.008) increase of alpha satellite transcription (Figure 1d), while preserving the number of cells and their morphology.\u003c/p\u003e\n\u003cp\u003eThe results revealed a general increase of alpha satellite DNA transcription in cell lines after treatment with different antibiotics at standard concentrations. However, the response differs among cell lines - maximal increase in A-1235 cells was obtained by rifampicin (82 \u0026micro;g/ml) while other two antibiotics showed a modest change (Figure 1b). On the contrary, in HeLa cells the maximal effect on alpha satellite DNA transcription was obtained by geneticin (400 \u0026micro;g/ml; Figure 1a), while in MJ90hTERT only higher concentration of geneticin (600 \u0026micro;g/ml) induced a significant change in transcription (Figure 1d). The results also revealed a positive correlation between antibiotic concentration and the level of alpha satellite transcription.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2. 2.\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003cem\u003eH3K9me3, H3K18ac and H3K4me2 levels at alpha satellite repeats after antibiotic treatment\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe analysed the distribution of silent histone mark H3K9me3 characteristic for heterochromatin, H3K18ac mark which is characteristic for transcriptional activation of heterochromatin [16] and H3K4me2, typical for open euchromatin, at tandemly arranged alpha satellite repeats as well as at those dispersed within euchromatin, under standard conditions and after antibiotic treatment. We performed chromatin immunoprecipitation (ChIP) coupled with quantitative real-time PCR, using specific primers for tandemly arranged satellite repeats as well as for six alpha repeats dispersed within introns of genes: AR 1, 10, 21, 25, 29 and 31 [9], (Table S1). Sequences flanking dispersed alpha repeats were used to construct single locus-specific primers. ChIP assay was performed on chromatin isolated from A-1235, HeLa and MJ90hTERT cells subjected to antibiotic treatment of 48 hrs at 37\u0026deg;C. The level of tested histone modifications was measured immediately after antibiotic treatment and was compared to the level of control using the unpaired t-test. In addition, we followed the dynamics of IgG binding to dispersed alpha satellite repeats and tandemly repeated satellite arrays and the amount of bound IgG was very low, resulting in a signal below the qPCR threshold.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHeLa cells were treated with geneticin 400 \u0026micro;g/ml which exhibited the strongest effect on alpha satellite transcription (Figure 1a) and decrease of H3K9me3 level of 2.1x (P=0.011) at tandemly arranged heterochromatic alpha repeats was observed, while no significant change at six euchromatic repeats located within introns was found (Figure 2a).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDecrease of geneticin concentration to 300 \u0026micro;g/ml resulted in no significant change of H3K9me3 level at tandemly arranged satellite arrays (Figure S2a) corresponding to no significant change of alpha satellite transcription at this concentration (Figure 1a). The levels of H3K18ac and H3K4me2 were not significantly changed at tandemly arranged alpha satellite repeats as well as at alpha repeats dispersed within euchromatin after treatment with geneticin 400 \u0026micro;g/ml (Figure S4).\u003c/p\u003e\n\u003cp\u003eThe treatment of A-1235 cells with 82 \u0026micro;g/ml rifampicin revealed 2.0x (P=0.02) decrease of H3K9me3 level at tandemly arranged alpha satellite DNA repeats and no significant change at dispersed alpha satellite repeats (Figure 2b). No significant change in H3K18ac or H3K4me2 level was detected, either at tandem or dispersed alpha repeats (Figure S3a). Lower rifampicin concentration of 41 \u0026micro;g/ml resulted in a slight but not statistically significant decrease of H3K9me3 level at tandem alpha arrays (Figure S2a), while an increase of alpha transcription of 1.8x was detected at this concentration (Figure 1c).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe treatment of MJ90hTERT cells with geneticin 600 \u0026micro;g/ml, which showed the strongest effect on alpha satellite transcription (Figure 1d), revealed a significant increase of 2.3x (P=0.01) of H3K18ac level at tandemly arranged alpha satellite arrays but not on dispersed alpha repeats (Figure 2d). Additionally, histone mark H3K9me3 was significantly decreased by 2.1x (P=0.02) (Figure 2c). On the other hand, no significant change in H3K4me2 level was found at tandemly arranged or dispersed alpha repeats (Figure S3b).\u003c/p\u003e\n\u003cp\u003eResults from HeLa and MJ90hTERT cells treated with geneticin and A-1235 cells with rifampicin revealed a decrease of H3K9me3 at heterochromatic alpha repeats which corresponds to increased transcription of alpha satellite DNA. In MJ90hTERT cells however, alongside H3K9me3 decrease after geneticin treatment, H3K18ac was significantly increased, which also corresponds to increased transcription of alpha satellite. On alpha repeats dispersed within euchromatin we did not detect changes in tested histone modifications after any antibiotic treatment. Although at 41 \u0026micro;g/ml rifampicin treatment an increase of alpha satellite transcription was observed in A-1235 cells despite a slight change in H3K9me3 level, this could be explained by low sensitivity of ChIP experiments. Similar to that, we observed no statistically significant change in H3K9me3 level at tandem alpha repeats in A-1235 cells as well as in H3K9me3 and H3K18ac levels in MJ90hTERT cells after geneticin 400 \u0026micro;g/ml treatment (Figure S2a, b) despite the slight increase in alpha transcription level of 1.7x and 1.5x respectively (Figure 1b, d).\u003c/p\u003e\n\u003cp\u003eTable 1. The genome-wide fold changes of epigenetic modifications H3K9me3, H3K18ac and H3K4me2 in different cell lines after treatment with varying concentrations of antibiotics geneticin (Gen) and rifampicin (Rif) (up-upregulation; dw-downregulation; n.s.c.-no significant change).\u003c/p\u003e\n\u003cp\u003e\u003cimg src=\"https://myfiles.space/user_files/69519_bce2c0439cd956a6/69519_custom_files/img1747678203.png\"\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3. H3K9me3, H3K18ac and H3K4me2 levels genome-wide after antibiotic treatment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo see if antibiotic treatment affects epigenetic changes genome-wide we performed immunofluorescence on HeLa, A-1235 and MJ90hTERT cells using primary antibodies against histone marks H3K9me3, H3K18ac and H3K4me2, followed by secondary antibody marked with Alexa Fluor\u0026reg; 488.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAfter treatment of HeLa cells with geneticin 400 \u0026micro;g/ml for 48 hrs H3K9me3 level was increased genome-wide by 2.03x (P\u0026lt;10\u003csup\u003e-3\u003c/sup\u003e), H3K18ac showed slight increase of 1.19x \u0026nbsp; (P\u0026lt;10\u003csup\u003e-3\u003c/sup\u003e), while H3K4me2 was decreased by 1.45x (P\u0026lt;10\u003csup\u003e-3\u003c/sup\u003e) (Figure 3, Table 1). Decrease of geneticin concentration to 300 \u0026micro;g/ml resulted in a slight increase of H3K9me3 of 1.32x (P\u0026lt;10\u003csup\u003e-3\u003c/sup\u003e) while H3K18ac and H3K4me2 levels were downregulated 1.81x and 1.5x \u0026nbsp; \u0026nbsp;(P\u0026lt;10\u003csup\u003e-3\u003c/sup\u003e), respectively (Table 1).\u003c/p\u003e\n\u003cp\u003eIn MJ90hTERT cells after treatment with 600 \u0026micro;g/ml geneticin H3K9me3 and H3K18ac levels were increased 1.86x and 1.27x (P\u0026lt;10\u003csup\u003e-3\u003c/sup\u003e), respectively, while H3K4me2 was slightly increased, 1.1x, but not statistically significant (P\u0026gt;0.05) (Figure 4; Table 1). Decrease of geneticin concentration to 400 \u0026micro;g/ml induced the increase of H3K9me3 level of 2.28x (P\u0026lt;10\u003csup\u003e-3\u003c/sup\u003e) while H3K18ac and H3K4me2 were not significantly changed (Table 1).\u003c/p\u003e\n\u003cp\u003eDifferent profile of histone changes was detected after treatment of A-1235 cells with\u0026nbsp;82 \u0026micro;g/ml\u0026nbsp;rifampicin. Namely, the level of H3K9me3 was slightly changed (1.08x, P\u0026lt;10\u003csup\u003e-3\u003c/sup\u003e), while H3K18ac level was decreased by 2.38x and H3K4me2 increased 1.33x (P\u0026lt;10\u003csup\u003e-3\u003c/sup\u003e) (Figure 5; Table 1). Decrease of rifampicin concentration to\u0026nbsp;41 \u0026micro;g/ml\u0026nbsp;resulted in H3K9me3 and H3K18ac decrease of 2.27x and 2.28x (P\u0026lt;10\u003csup\u003e-3\u003c/sup\u003e), respectively, while H3K4me2 was upregulated by 1.4x (P\u0026lt;10\u003csup\u003e-3\u003c/sup\u003e) (Table 1). In the same cell line, geneticin 400 \u0026micro;g/ml induced the decrease of H3K9me3 level by 2.86x and the increase of H3K18ac and H3K4me2 levels by 2.58x and 1.35x (P\u0026lt;10\u003csup\u003e-3\u003c/sup\u003e), respectively (Table 1). Changes of histone modifications genome-wide in three cell lines are summarized in Table 1.\u003c/p\u003e\n\u003cp\u003eThe results reveal genome-wide increase of H3K9me3 levels in HeLa and MJ90hTERT cells induced by geneticin (300-600 \u0026micro;g/ml), while H3K4me2 levels were either downregulated or not significantly changed (Table 1). On the other hand, the level of H3K18ac was significantly downregulated in HeLa cells treated with 300 \u0026micro;g/ml geneticin, while higher concentrations of geneticin only slightly changed H3K18ac levels in HeLa and MJ90hTERT cells, indicating that the effect depends on the concentration of antibiotic but is not positively correlated with it. In A-1235 cells however, geneticin in the concentration of 400 \u0026micro;g/ml induced genome-wide downregulation of H3K9me3 and upregulation of H3K18ac, indicating that response to the antibiotic differs among cell lines. Also, different antibiotics affect differently epigenetic marks in the same cell line as shown by rifampicin which in A-1235 cells stimulates H3K18ac decrease while geneticin induces H3K18ac upregulation (Table 1).\u003c/p\u003e\n\u003cp\u003eAlthough different antibiotics induce overexpression of pericentromeric alpha satellite DNA, their effect on heterochromatin differs among cells, characterized either by decrease of H3K9me3 or increase of H3K18ac (Figure 2). In a similar way, the effect of antibiotics genome-wide also differs among cells. Namely, while the effect of geneticin on histone marks H3K9me3 and H3K4me2 in HeLa and MJ90hTERT cells is similar, it differs from the one observed in A-1235 cells, as well as from the effect of rifampicin on the same marks in A-1235 cells. The results suggest that the heterochromatin, as well as the rest of chromatin, respond to antibiotics in diverse ways, depending on the cell line, type of antibiotic and antibiotic concentration.\u003c/p\u003e"},{"header":"3. Discussion","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eIt is well known that antibiotics influence human microbiome and change its composition which can have a negative impact on host health including reduced microbial diversity and selection of antibiotic-resistant strains, making hosts more susceptible to infection [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. However, besides targeting bacterial cells, antibiotics affect metabolism of eukaryotic cells as revealed by studies \u003cem\u003ein vitro\u003c/em\u003e, on human cell lines [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Some \u003cem\u003ein vivo\u003c/em\u003e studies, such as those performed on male pseudoscorpions treated with the antibiotic tetracycline, showed significantly reduced sperm viability, which was passed to the next generation and suggests that a similar effect could occur in other species [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. It was shown that clinically relevant doses of bactericidal antibiotics quinolones, aminoglycosides and β-lactams cause mitochondrial dysfunction and ROS overproduction in mammalian cells, and mice treated with these antibiotics exhibited elevated oxidative stress markers in the blood as well as oxidative tissue damage [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. It is also known that treatment of some diseases requires high doses of antibiotic, e.g. for tuberculosis 35 mg/kg rifampicin per day is used (which corresponds to approx. 43 \u0026micro;M conc.) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], and it is therefore interesting to know how similar doses affect metabolism of mammalian cells. Rifampicin is usually well-tolerated and rarely causes serious toxicity in eukaryotic cells. In extreme doses, however, rifampicin is known to produce hepatic, renal and hematological disorders and metabolic acidosis [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Its toxicity is predominantly hepatic and immuno-allergic in character. Rifampicin induces a dose-dependent hepatotoxicity in HHL-17 cells (IC50; 600 \u0026micro;M), and increases the serum levels of liver injury markers, e.g., alanine transaminase (ALT) and aspartate transaminase (AST) [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Also, it was found that rifampicin at exorbitant concentration exerts adverse effects on the proliferation of MSCs in human bone marrow and the differentiation of osteoblasts [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTandemly arranged satellite DNA repeats represent a challenge for the maintenance of genomic stability, during normal cellular functions such as replication and transcription [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. It was shown that increased pericentric satellite DNA transcription has negative effects on cellular physiology, leading to defects typically associated with tumorigenesis and ageing. Overexpressed transcripts of pericentromeric major satellite DNA in mice sequester BRCA1-associated network, cause accumulation of RNA loops, DNA damage and induce breast cancer [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Satellite DNAs are sensitive to different exogenous and endogenous stress conditions and here we investigated if the antibiotics commonly used in cell culture studies affect the expression of non-coding major human alpha satellite DNA. We used the aminoglycoside antibiotics geneticin G418 and hygromycin B which are effective against both eukaryotic and prokaryotic cells and are used to select for cells that express antibiotic resistance. Both antibiotics affect protein synthesis. We also tested rifampicin, an ansamycin antibiotic used to treat some bacterial infections, including tuberculosis. Paradoxically, rifampicin blocks bacterial DNA transcription by inhibiting bacterial RNA polymerase, whereas in our study it had an opposite effect on human heterochromatic DNA transcription, \u003cem\u003ei.e.\u003c/em\u003e it stimulated it. The present study revealed that alpha satellite DNA is highly susceptible to antibiotic stress. Namely, using three cell lines: glioblastoma A-1235, HeLa and MJ90hTERT, we observed increased transcription of alpha satellite DNA using all three antibiotics at standard concentrations, although the response differed among cell lines. Maximal increase in A-1235 cells was obtained by rifampicin while in MJ90hTERT and HeLa cells geneticin induced the most significant increase of transcription under standard concentrations. The results also reveal a positive correlation between antibiotic concentration and the level of alpha satellite transcription.\u003c/p\u003e \u003cp\u003eThe cell lines used as models in our research were selected for two specific reasons. First, in our previous experiments they demonstrated robustness and high viability (\u0026gt;\u0026thinsp;80%; using sublethal, physiological doses) during treatments and manipulations, providing results that were both highly reproducible and significant. Second, while the effect of antibiotics on satellite expression was observed in all cases, as is clearly shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e., the most significant combinations were chosen for further epigenetic testing. It should also be noted that MJ90 are fibroblasts, immortalized with hTERT, therefore considered non-transformed cells, both morphologically and physiologically.\u003c/p\u003e \u003cp\u003eThe increase of alpha satellite expression upon treatment with antibiotics is associated with significant decrease of silent histone mark H3K9me3 at heterochromatic alpha satellite repeats in HeLa and MJ90hTERT cells treated with geneticin and A-1235 cells with rifampicin, respectively, suggesting possible influence of this epigenetic change on alpha satellite DNA transcription. At concentrations of antibiotics which did not significantly affect satellite transcription, no change of H3K9me3 level in HeLa and A-1235 cells was observed, also supporting a possible relation between satellite transcription and H3K9me3 levels at heterochromatin. In MJ90hTERT cells, however, H3K18ac level was increased upon treatment with geneticin alongside the decrease of H3K9me3 level. Since it is known that H3K18 hyperacetylation leads to aberrant accumulation of pericentric transcripts [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], we propose that increased level of H3K18ac might also be responsible for overexpression of alpha satellite DNA in MJ90hTERT cells after geneticin treatment. Previous studies have shown that alpha satellite transcription seems to be controlled by the presence of centromere\u0026ndash;nucleolar contacts [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] and by CENP-B protein which promotes the binding of the zinc-finger transcriptional regulator (ZFAT) responsible for activation of RNA Pol II transcription [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. It was shown that Topoisomerase I (TopI) promotes the transcription of α-satellite DNAs which is also stimulated in response to DNA double-stranded breaks (DSBs) [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. However, the results presented here, as well as the increased transcription of alpha satellite DNA in cancer which is associated with decreased H3K9me3 level at satellite repeats [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], suggest a regulation of alpha satellite transcription by epigenetic changes, in particular by histone marks H3K9me3 and H3K18ac. Loss of epigenetic heterochromatic marks was shown to be responsible for overexpression of satellite DNA in ageing [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] and neurodegenerative diseases [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eApart from H3K9me3 and H3K18ac we did not observe a change in histone mark H3K4me2, characteristic for open but inactive euchromatin [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], at tandemly arranged heterochromatic alpha satellite repeats. Also, no change in all three epigenetic modifications was detected on alpha satellite repeats dispersed within euchromatin upon antibiotics treatment. More diverse changes, including not only H3K9me3 and H3K18ac but also H3K4me2, were detected genome-wide using immunofluorescence and these changes depended on cell type, antibiotic and antibiotic concentration.\u003c/p\u003e \u003cp\u003eWe acknowledge that gene expression and epigenetic responses vary depending on cell type. In our study, we observed distinct regulatory patterns of alpha satellite expression across the tested cell lines, likely influenced by differences in chromatin organization, baseline transcriptional activity, and cellular metabolism. These variations may reflect intrinsic differences between cancerous and normal cells in their response to external stimuli, including antibiotics. Further studies are needed to dissect the molecular mechanisms driving these cell-type-specific effects. Different signaling pathways, overactivated in different cell lines, possibly confer resistance to certain antibiotics as well as types of stress or damage that they induce. It is likely that the level of certain type of stress the cells can resist varies between different cell lines and that their coping mechanisms against different types of stress are also diverse as a general consequence of their specific genetic background.\u003c/p\u003e \u003cp\u003eIn conclusion, antibiotics can stress human cells and disrupt their transcriptional regulation. Our results reveal that different antibiotics induce the increase of transcription of alpha satellite DNA in diverse cell lines. Since such an occurrence is accompanied with H3K9me3 decrease or H3K18ac increase at heterochromatic regions, we propose that epigenetic changes, in particular those of H3K9me3 and H3K18ac levels, could affect the expression of alpha satellite DNA upon antibiotic treatment.\u003c/p\u003e \u003cp\u003eThese findings suggest that antibiotics may influence satellite DNA transcription by modulating specific histone marks, thus impacting gene expression and genome stability. While the histone modification pathways are well known and highly conserved among all eukaryotes, the underlying mechanisms by which antibiotics potentially interact with said pathways are currently unknown. Ubiquitous effector enzymatic complexes and their functions; such as activating demethylases and acetyl-transferases; suppressing methyl-transferases and deacetylases, as well as chromatin remodeling factors such as SWI/SNF are well understood. Integrated stress response could also play a role by interacting with above-mentioned pathways. Many types of stress, including antibiotic, activate integrated stress response cellular machinery resulting in overproduction of specific transcription factors (such as ATF4), stimulating downstream chromatin remodeling of specific loci and neighboring promoter activation, consequently explaining their overexpression.\u003c/p\u003e \u003cp\u003eIt should be noted that transcription of alpha satellite DNA upon antibiotic treatment in some cases exceeded normal transcription rate almost 5-fold (e.g. HeLa cells treated with geneticin 400 \u0026micro;g/ml), possibly affecting cell physiology as well as genome stability in the process. Overexpression of satellite DNA could compromise genome stability and alter cell behaviour, potentially leading to carcinogenesis or accelerated aging processes, and these facts should be taken into consideration when experiments on such cell lines are performed. This paper shows that commonly used antibiotics not only affect bacterial cells but also induce significant transcriptional and epigenetic changes in eukaryotic cells, particularly at alpha satellite DNA regions. This can lead to genomic instability, which may affect cell physiology and contribute to diseases such as cancer or neurodegenerative disorders. The observed epigenetic changes, such as the reduction in H3K9me3 and increase in H3K18ac, provide a potential mechanistic explanation for the transcriptional upregulation of alpha satellite DNA. These findings suggest that researchers using antibiotics in cell culture studies should consider the results described in this paper when such experiments are performed.\u003c/p\u003e \u003cp\u003eOur research highlights the following key points:\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003col\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eRoutine antibiotic use in cell cultures affects metabolism and genomic stability, warranting caution.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eAntibiotic treatment in humans may have systemic effects beyond bacterial targeting, varying across tissues.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eDifferential antibiotic effects on cancer vs. healthy tissues could inform potential anticancer strategies.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eAntibiotics may influence gene expression beyond alpha satellite DNA, potentially affecting other genomic regions and regulatory elements.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eUnderstanding individual variability in antibiotic response could improve drug safety and personalized treatment strategies.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eChronic antibiotic exposure may have cumulative effects on genomic stability and epigenetic regulation.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThese findings underscore broader implications for gene regulation, drug safety, and long-term antibiotic effects, highlighting the need for further research.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"4. Materials and Methods","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e4.1. Human cell lines\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe following human cell lines were used in experiments: MJ90hTERT (immortalized human skin fibroblasts), HeLa (human cervical cancer) and A-1235 (human glioblastoma). Cells were cultured in appropriate medium (DMEM) supplemented with 10% FBS and 5% CO2 at 37\u0026deg;C. Cells were incubated for 48 hrs at 37\u0026deg;C with antibiotics geneticin, rifampicin and hygromycin B (Carl Roth) in complete medium. The concentration range of the antibiotics were: geneticin 300\u0026ndash;600 \u0026micro;g/ml, hygromycin B 50\u0026ndash;100 \u0026micro;g/ml, as well as with rifampicin 8.2\u0026ndash;82 \u0026micro;g/ml (10\u0026ndash;100 \u0026micro;M).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e4.2. RNA isolation and reverse transcription\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eFor RNA isolation from cell cultures lysis buffer was added directly after the PBS washing step, avoiding trypsin treatment. RNA was quantified with the Quant-IT RNA assay kit using a Qubit fluorometer (Invitrogen). Integrity of RNA was checked by gel electrophoresis. Approximately 1 \u0026micro;g of RNA was reverse transcribed using the PrimeScript RT reagent Kit with gDNA Eraser (perfect Real Time, Takara) in 20 \u0026micro;l reaction using specifically modified primer for alpha satellite rev AATGCACATATCACTATGTAC, designed to produce cDNA molecules that differ from genomic DNA in order to avoid DNA contamination [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. For all samples, negative controls without reverse transcriptase were used.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e4.3. Quantitative real-time PCR (qPCR) analysis\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eqPCR analysis was performed according to the previously published protocol (Feliciello et al. 2015). Primers used for transcriptional analysis of alpha satellite DNA were constructed based on consensus sequence derived from cloned alpha satellite monomers of wide-ranging chromosomal origins [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] and the same modified primer used previously in reverse transcription was used in qPCR amplification along with the second primer fw CACTCTTTTTGTAGAATCTGC. In this way, amplification was unaffected by any potential DNA contamination [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Glucuronidase beta (GUSB) [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] was used as an endogenous control for normalization in human samples. GUSB gene (Gene ID: 2990) was stably expressed without any variation among samples after antibiotic treatment. Sequences of GUSB gene primers are fw GAAAATACGTGGTTGGAGAGCTCATT and rev CCGAGTGAAGATCCCCTTTTTA. The following thermal cycling conditions were used: 50\u0026deg;C 2 min, 95\u0026deg;C 7 min, 95\u0026deg;C 15 s, 60\u0026deg;C 1 min for 40 cycles followed by dissociation stage: 95\u0026deg;C for 15 s, 60\u0026deg;C for 1 min, 95\u0026deg;C for 15 s and 60\u0026deg;C for 15 s. Amplification specificity was confirmed by dissociation curve analysis and specificity of amplified products was tested on agarose gel. Control without template (NTC) was included in each run. Post-run data were analysed using LinRegPCR software v.11.1. [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e] which enables calculation of the starting concentration of amplicon (\u0026ldquo;N\u003csub\u003e0\u003c/sub\u003e value\u0026rdquo;). N\u003csub\u003e0\u003c/sub\u003e value is expressed in arbitrary fluorescence units and is calculated by taking into account PCR efficiency and baseline fluorescence. N\u003csub\u003e0\u003c/sub\u003e value determined for each technical replicate was averaged and the averaged N\u003csub\u003e0\u003c/sub\u003e values were divided by the N\u003csub\u003e0\u003c/sub\u003e values of the endogenous control. Statistical analysis of qPCR data was done using GraphPad v.6.01 and normalized N\u003csub\u003e0\u003c/sub\u003e values were compared using the unpaired t-test which compares the means of two unmatched groups.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e4.4. Chromatin immunoprecipitation\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eMJ90hTERT, A-1235 and HeLa cells were grown to subconfluence, washed in PBS, scraped in Nuclear Isolation buffer (10 mM MOPS; 5 mM KCl; 10 mM EDTA; 0.6% Triton X-100) with protease inhibitor cocktail CompleteMini (Roche) and chromatin immunoprecipitation was performed according to the published protocol (Feliciello et al. 2015, 2020), with the exception of sonication step which was performed 30 times for 30 s on ice, high sonicator amplitude. The antibodies used were: Anti-Histone H3 (tri methyl K9, Abcam, ab8898), Anti-Histone H3 (di methyl K4, tri methyl K4, Abcam, ab6000), Anti-Histone H3 (acetyl K18, Abcam, ab1191), Anti-Histone H3 (di methyl K4, Abcam, ab7766) and IgG (Santa Cruz Biotechnology, sc2027). Binding of precipitated target was monitored by qPCR using the SYBR Green PCR Master mix (Bio-Rad). Primers used for H3K9me3, H3K18ac and H3K4me2 level analyses at heterochromatic alpha regions as well as at dispersed alpha repeats are listed in Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e. The N\u003csub\u003e0\u003c/sub\u003e values were normalized using N\u003csub\u003e0\u003c/sub\u003e values of input fractions.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e4.5. Immunofluorescence\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eCells were grown on cover slips up to 70% confluence, washed with PBS and fixed for 5 min in cold methanol. Permeabilization was done by 0.5% triton X-100 for 5 min and blocking with DAKO Protein Block Serum-free ready to use reagent for 1 h at RT. Primary antibodies anti-H3K9me3 (Abcam, ab8898), anti-H3K18ac (Abcam, ab1191) and anti-H3K4me2 (Abcam, ab7766) were diluted in DAKO Antibody Diluent according to the instructions of Abcam, and incubation was performed overnight at 4\u0026deg;C. After washing in PBS, goat polyclonal secondary antibody to rabbit IgG (ab150081) was diluted 1/1000 in DAKO Antibody Diluent and incubation was performed for 1 hr at RT in the dark. Cells were stained with 1 \u0026micro;g/ml DAPI and a drop of DAKO Anti-Fade Fluorescence Mounting Medium was added. Cell slides were sealed with nail polish and analysed by confocal microscopy (Laser Scanning Confocal Microscope Leica SP8 X FLIM). For each sample slide (control and treated), five images were taken and the mean fluorescence values of all structurally and morphologically intact nuclei were quantified using \u0026bdquo;ImageJ\u0026ldquo; software [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. The Shapiro\u0026ndash;Wilk test was used to test data normality. Mean fluorescence values of treated samples and controls were tested for statistical significance using the parametric 2-tailed Welch\u0026rsquo;s t-test if the data had normal distribution and non-parametric Mann\u0026ndash;Whitney test when it did not. P-values less than 0.05 were considered statistically significant.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eSupplementary Materials:\u0026nbsp;\u003c/strong\u003eThe following supporting information can be downloaded at: www.mdpi.com/xxx/s1. Figure S1: Consensus sequence of 171 bp alpha satellite monomer; Figure S2a:\u0026nbsp;H3K9me3 level at tandemly arranged alpha satellite arrays in HeLa cells; Figure S2b: H3K18ac level at tandemly arranged alpha satellite arrays in MJ90hTERT cells; Figure S3a:\u0026nbsp;H3K18ac and H3K4me2 levels at tandemly arranged alpha satellite repeats and dispersed alpha repeats; Figure S3b: H3K4me2 levels of MJ90hTERT cells treated with geneticin; Figure S4:\u0026nbsp;H3K18ac and H3K4me2 levels in HeLa cells after treatment with geneticin;\u0026nbsp;Table S1:\u0026nbsp;List of primers used in ChIP-qPCR experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u003c/strong\u003e Conceptualization, I.F.; methodology, M.M., S.L.; formal analysis, S.L., M.M., D.Đ., M.C.F., A.P., I.F.; investigation, S.L., M.M., I.F.; writing original draft preparation, I.F. and Đ.U.; writing\u0026mdash;review and editing, Đ.U., I.F., D.Đ.; supervision, I.F; All authors have read and agreed to the published version of the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e This work was funded by the Italian Ministry of Education, University and Research (MIUR), FFABR2017, fund for Investments on Basic Research (FIRB) and by the International Staff Mobility Program of University of Naples Federico II to I. Feliciello, as well as by Croatian Science Foundation grant: IP-2019-04-6915 to \u0026ETH;. Ugarković.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement:\u003c/strong\u003e The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e We thank Kristina Kovač for the technical support.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest:\u003c/strong\u003e \u0026ldquo;The authors declare no conflicts of interest.\u0026rdquo;\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSmith RP, Eckalbar WL, Morrissey KM, et al. Genome-wide discovery of drug-dependent human liver regulatory elements. PLoS Genet. 2014;10:e1004648.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRyu AH, Eckalbar WL, Kreimer A, Yosef N, Ahituv N. Use antibiotics in cell culture with caution: genome-wide identification of antibiotic-induced changes in gene expression and regulation. Sci Rep. 2017;7:7533.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElliott RL, Jiang XP. The adverse effect of gentamicin on cell metabolism in three cultured mammary cell lines. Are cell Cult data skewed? PLoS One. 2019;14:e0214586.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGallo A, Landi R, Rubino V, et al. Oxytetracycline induces DNA damage and epigenetic changes: a possible risk for human and animal health? PeerJ. 2017;5:e3236.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUgarković Đ, Sermek A, Ljubić S, Feliciello I. Satellite DNAs in health and disease. Genes. 2022;13:1154.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVourc\u0026rsquo;h C, Biamonti G. Transcription of satellite DNAs in mammals. Prog Mol Subcell Biol. 2011;51:95\u0026ndash;118.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePezer Ž, Ugarković Đ. Satellite DNA-associated siRNAs as mediators of heat shock response in insects. RNA Biol. 2012;9:587\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eH\u0026eacute;douin S, Grillo G, Ivkovic I, et al. CENP-A chromatin disassembly in stressed and senescent murine cells. Sci Rep. 2017;7:42520.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeliciello I, Sermek A, Pezer Ž, et al. Heat stress affects H3K9me3 level at human alpha satellite DNA repeats. Genes. 2020;11:663.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSermek A, Feliciello I, Ugarković Đ. Distinct regulation of the expression of satellite DNAs in the beetle Tribolium castaneum. Int J Mol Sci. 2021;22:296.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFonseca-Carvalho M, Ver\u0026iacute;ssimo G, Lopes M, et al. Answering the cell stress call: satellite non-coding transcription as a response mechanism. Biomolecules. 2024;14:124.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTing DT, Lipson D, Paul S, et al. Aberrant overexpression of satellite repeats in pancreatic and other epithelial cancers. Science. 2011;331:593\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLjubić S, Sermek A, Prgomet Sečan A, et al. Alpha satellite RNA levels are upregulated in the blood of patients with metastatic castration-resistant prostate cancer. Genes. 2022;13:383.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim N, Jinks-Robertson S. Transcription as a source of genome instability. Nat Rev Genet. 2012;13:204\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlack EM, Giunta S. Repetitive fragile sites: centromere satellite DNA as a source of genome instability in human diseases. Genes (Basel). 2018;9:615.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTasselli L, Xi Y, Zheng W, et al. SIRT6 deacetylates H3K18ac at pericentric chromatin to prevent mitotic errors and cellular senescence. Nat Struct Mol Biol. 2016;23:434\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVojvoda Zeljko T, Ugarković Đ, Pezer Ž. Differential enrichment of H3K9me3 at annotated satellite DNA repeats in human cell lines and during fetal development in mouse. Epigenet Chromatin. 2021;14:47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUnoki M, Sharif J, Saito Y, et al. CDCA7 and HELLS suppress DNA:RNA hybrid-associated DNA damage at pericentromeric repeats. Sci Rep. 2020;10:17865.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeliciello I, Akrap I, Ugarković Đ. Satellite DNA modulates gene expression in the beetle Tribolium castaneum after heat stress. PLoS Genet. 2015;11:e1005466.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLanders CC, Rabeler CA, Ferrari EK, et al. Ectopic expression of pericentric HSATII RNA results in nuclear RNA accumulation, MeCP2 recruitment, and cell division defects. Chromosoma. 2021;130:75\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoeree MJ, Heinrich N, Aarnoutse R, et al. High-dose rifampicin, moxifloxacin, and SQ109 for treating tuberculosis: a multi-arm, multi-stage randomised controlled trial. Lancet Infect Dis. 2017;17:39\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcNulty SM, Sullivan BA. Alpha satellite DNA biology: finding function in the recesses of the genome. Chromosom Res. 2018;26:115\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmurova K, De Wulf P. Centromere and pericentromere transcription: roles and regulation in sickness and in health. Front Genet. 2018;9:674.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDavies J, Davies D. Origins and evolution of antibiotic resistance. Microbiol Mol Biol Rev. 2010;74:417\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeh JA, Bonilla MM, Adrian AJ, et al. From father to son: transgenerational effect of tetracycline on sperm viability. Sci Rep. 2012;2:375.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKalghatgi S, Spina CS, Costello JC, et al. Bactericidal antibiotics induce mitochondrial dysfunction and oxidative damage in mammalian cells. Sci Transl Med. 2013;5:192ra85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSridhar A, Sandeep Y, Krishnakishore C, Sriramnaveen P, Manjusha Y, Sivakumar V. Fatal poisoning by isoniazid and rifampicin. Indian J Nephrol. Sep; 2012;22(5):385\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKainat KM, Ansari MI, Bano N, Jagdale PR, Ayanur A, Kumar M, Sharma PK. Rifampicin-induced ER stress and excessive cytoplasmic vacuolization instigate hepatotoxicity via alternate programmed cell death paraptosis in vitro and in vivo. Life Sci. 2023;15:333:122164.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Z, Wang X, Luo F, Yang H, Hou T, Zhou Q, Dai F, He Q, Xu J. Effects of rifampicin on osteogenic differentiation and proliferation of human mesenchymal stem cells in the bone marrow. Genet Mol Res. 2014;25(3):6398\u0026ndash;410.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu Q, Hoong N, Aslanian A, et al. Heterochromatin-encoded satellite RNAs induce breast cancer. Mol Cell. 2018;70:842\u0026ndash;e8537.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBury L, Moodie B, Ly J, et al. Alpha-satellite RNA transcripts are repressed by centromere-nucleolus associations. Elife. 2020;9:e59770.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshikura S, Yoshida K, Hashimoto S, et al. CENP-B promotes the centromeric localization of ZFAT to control transcription of noncoding RNA. J Biol Chem. 2021;297:101213.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeng Z, Yang L, Zhang Q, et al. Topoisomerase I is an evolutionarily conserved key regulator for satellite DNA transcription. Nat Commun. 2024;15:5151.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLarson K, Yan SJ, Tsurumi A, et al. Heterochromatin formation promotes longevity and represses ribosomal RNA synthesis. PLoS Genet. 2012;8:e1002473.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoares LM, He PC, Chun Y, et al. Determinants of histone H3K4 methylation patterns. Mol Cell. 2017;68:773\u0026ndash;e7856.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eĐermić D, Ljubić S, Matulić M, et al. Reverse transcription-quantitative PCR (RT-qPCR) without the need for prior removal of DNA. Sci Rep. 2023;13:11470.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoo K, Vissel B, Nagy A, et al. A survey of the genomic distribution of alpha satellite DNA on all the human chromosomes, and derivation of a new consensus sequence. Nucleic Acids Res. 1991;19:1179\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAerts JL, Gonzales MI, Topalian SL. Selection of appropriate control genes to assess expression of tumor antigens using real-time RT-PCR. Biotechniques. 2004;36:84\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRuijter JM, Ramakers C, Hoogaars WMH, et al. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009;37:e45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRuijter JM, Pfa MW, Zhao S, et al. Evaluation of qPCR curve analysis methods for reliable biomarker discovery: bias, resolution, precision, and implications. Methods. 2013;59:32\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchneider C, Rasband W, Eliceiri K. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012;9:671\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"epigenetics-and-chromatin","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"epch","sideBox":"Learn more about [Epigenetics \u0026 Chromatin](http://epigeneticsandchromatin.biomedcentral.com/)","snPcode":"13072","submissionUrl":"https://submission.nature.com/new-submission/13072/3","title":"Epigenetics \u0026 Chromatin","twitterHandle":"@EpigenChromatin","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"satellite DNA, heterochromatin, transcription, antibiotic, histone modifications","lastPublishedDoi":"10.21203/rs.3.rs-6661736/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6661736/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe transcription of satellite DNA is highly sensitive to environmental factors and represents a source of genomic instability. Therefore, tight regulation of (peri)centromeric transcription is essential for genome maintenance. Antibiotics are routinely used for in vitro studies and for medical treatment, however, their effect on pericentromeric satellite DNA transcription was not investigated. Here we show that antibiotics geneticin and hygromycin B, conveniently used in cell culture, as well as rifampicin, used to treat bacterial infections, increase transcription of a major human pericentromeric alpha satellite DNA in cell lines at standard concentrations. However, response differs among cell lines - maximal increase in A-1235 cells is obtained by rifampicin while in HeLa cells and fibroblasts by geneticin. There is also a positive correlation between antibiotic concentration and the level of alpha satellite transcription. The increase of transcription is accompanied with either H3K9me3 decrease or H3K18ac increase at tandemly arranged alpha satellite arrays while H3K4me2 remains unchanged. Our results suggest that induced alpha satellite DNA transcription upon antibiotic stress could be linked to epigenetic changes - histone modifications H3K9me3 and H3K18ac, which are associated with transcription of heterochromatin.\u003c/p\u003e","manuscriptTitle":"Antibiotics induce overexpression of alpha satellite DNA accompanied with epigenetic changes at alpha satellite arrays as well as genome-wide","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-19 18:15:08","doi":"10.21203/rs.3.rs-6661736/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-06-08T06:24:49+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-07T20:02:56+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-25T18:14:26+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"131294715908321828294477578444390361010","date":"2025-05-18T07:52:14+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"2510933356419093888229832102611723311","date":"2025-05-17T13:49:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"208002628263350461362294721083285709748","date":"2025-05-16T06:22:53+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-15T10:18:14+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"33792101302874059561731621287516802441","date":"2025-05-15T07:19:13+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-05-15T05:13:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-05-15T05:10:51+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-05-14T15:04:26+00:00","index":"","fulltext":""},{"type":"submitted","content":"Epigenetics \u0026 Chromatin","date":"2025-05-14T07:48:01+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"epigenetics-and-chromatin","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"epch","sideBox":"Learn more about [Epigenetics \u0026 Chromatin](http://epigeneticsandchromatin.biomedcentral.com/)","snPcode":"13072","submissionUrl":"https://submission.nature.com/new-submission/13072/3","title":"Epigenetics \u0026 Chromatin","twitterHandle":"@EpigenChromatin","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4bcb277c-9ca6-4b24-88e3-300ee3b99baf","owner":[],"postedDate":"May 19th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-09-29T16:04:23+00:00","versionOfRecord":{"articleIdentity":"rs-6661736","link":"https://doi.org/10.1186/s13072-025-00628-z","journal":{"identity":"epigenetics-and-chromatin","isVorOnly":false,"title":"Epigenetics \u0026 Chromatin"},"publishedOn":"2025-09-26 15:58:08","publishedOnDateReadable":"September 26th, 2025"},"versionCreatedAt":"2025-05-19 18:15:08","video":"","vorDoi":"10.1186/s13072-025-00628-z","vorDoiUrl":"https://doi.org/10.1186/s13072-025-00628-z","workflowStages":[]},"version":"v1","identity":"rs-6661736","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6661736","identity":"rs-6661736","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00