A new signal peptide with cell-penetrating and nuclear localization properties for targeted nucleolar delivery

preprint OA: closed
Full text JSON View at publisher
Full text 70,102 characters · extracted from preprint-html · click to expand
A new signal peptide with cell-penetrating and nuclear localization properties for targeted nucleolar delivery | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article A new signal peptide with cell-penetrating and nuclear localization properties for targeted nucleolar delivery Khai Nguyen, Ryo Yonezawa, Nahoko Kobayashi, Tetsuhiko Yoshida, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6398808/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The plasma membrane is a barrier of entry, regulating what comes in and out of the cell. The selective permeability of the membrane restricts macromolecule entry. Cell-penetrating peptides (CPPs) serve as a new approach to facilitate the transport of various cargoes into cells. Many CPPs have shown the capability to target specific organelles such as mitochondria, endoplasmic reticulum, or nucleus, but very few can target the nucleolus effectively. In this study, we evaluated the intracellular delivery characteristics of a novel synthetic signal peptide called Toa. The results show that Toa can effectively 5(6)-Carboxytetramethylrhodamine into the nucleolus. Toa peptide promotes cellular uptake of Green Fluorescent Protein and Azami Green when incubated with the cargoes, a partial nucleus localization was also observed for Azami Green. Toa conjugated Azami Green entered the nucleus and was localized in the nucleolus. The results confirm that Toa has cell-penetrating, nuclear and nucleolar localizing capabilities. Toa’s efficient nucleolar delivery makes it a promising tool for research and therapeutic applications. Cell-penetrating peptides (CPPs) Nuclear localization signal (NLS) Nucleolar localization signal (NoLS) Green Fluorescent Protein (GFP) Azami Green (AG) 5(6)-Carboxytetramethylrhodamine (TAMRA) Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 INTRODUCTION The cell plasma membrane serves as a selective barrier that regulates what goes in and out of the cell. Small molecules and ions can traverse the membrane via active or passive transport mechanisms, large and complex molecules such as proteins, nucleic acids, and drugs encounter much more entry restrictions due to the selective permeability of the membrane. Several strategies have been developed to bypass this selection such as electroporation (Yarmush et al. 2014 ), microinjection (Zhang & Yu 2008 ), exosomes (Yim et al. 2016 ), and nanoparticles (Scaletti et al. 2018 ). While these methods are effective, their drawbacks can limit potential applications in research and therapy. Cell-penetrating peptides (CPPs) offer a new approach for intracellular delivery. These are short peptides that can translocate the plasma membrane, carrying a wide range of molecules with them into the cell (Guidotti et al. 2017 ). CPPs are gaining more and more interest as they have low cytotoxicity and can target many cell types. CPPs are also easily controlled as their efficiency is dose-dependent (Heitz et al. 2009 ). Studies have demonstrated that CPPs can successfully deliver proteins, peptides, DNA, siRNA, and drugs into cells (Bechara & Sagan 2013 ). The delivery is facilitated by covalent conjugation or non-covalent interaction between the cargo and the CPP (Behzadipour & Hemmati 2024 ). Various types of CPPs have been shown to not only bypass the plasma membrane but also target specific organelles (Cerrato & Langel 2022 ). CPPs have been used to target mitochondria for biomedical applications such as disease diagnosis (Su et al. 2020 ), protection against oxidative stress (Cerrato et al. 2015 ), and targeted cancer therapy through disrupting mitochondrial function (Woldetsadik et al. 2017 ). Several CPPs have been identified that localize to the Golgi apparatus, endoplasmic reticulum, and lysosomes (Bonifacino & Traub 2003 ; Kang et al. 2021 ; Pouniotis et al. 2016 ; Schneider et al. 2021 ; Swiecicki et al. 2015 ; Tan et al. 2015 ). Their unique sequences enable targeted delivery through these pathways, allowing precise control over cargo fate and offering potential applications in drug delivery systems. Nucleus-targeted CPPs are relatively well-studied. Many CPPs contain nuclear localization signals to bypass the nuclear pore complex (Wagstaff et al. 2007 ). Multiple studies have been done to elucidate the mechanisms, develop applications, and enhance the efficiency of nuclear-specific delivery systems (Cerrato & Langel 2022 ). Among the most used CPPs are TAT and polyarginine, both are CPPs with nuclear-localizing properties (Fuchs & Raines 2004 ; Truant & Cullen 1999 ). Targeting the nucleolus with CPPs is a promising strategy to control protein synthesis by selectively restricting ribosomal machinery. Compared to the nucleus, CPPs targeting nucleolus are not as well investigated. Kobayashi et al. ( 2012 ) revealed that the nucleolar localization signal sequence of LimK2 possesses CPP properties. Gronewold et al. ( 2018 ) have designed a new CPP that can deliver drugs to the nucleolus. Martin et al. ( 2007 ) have employed a CPP to label nucleoli for structural studies. Herce et al. ( 2017 ) have engineered a CPP with a nanobody attached to it to carry specific proteins into the nucleolus. In this paper, we tested a novel peptide called Toa (KVLSRVVQLCREKLTRRRRSNRR). The peptide was studied by incubating or conjugating with Green Fluorescent Protein (GFP), Azami Green (AG), 5(6)-Carboxytetramethylrhodamine (TAMRA) before introducing to HeLa cells. Fluorescent confocal microscopy confirms that Toa peptide can deliver these molecules to the cell cytosol, nuclear, and nucleolus at varying effectiveness. Toa peptide serves as a novel CPP for targeted intracellular delivery in research and therapeutic applications. MATERIALS AND METHODS Cell culture HeLa cells were cultured in DMEM/F-12 (Thermo Fisher) supplemented with 10% fetal bovine serum and 100 mg/ml of penicillin and streptomycin at 37 o C and 5% CO 2 . The cells were subcultured when reaching 80-90% confluence. Toa and TAMRA conjugated Toa production Toa and TAMRA conjugated Toa were synthesized by Eurofins Genomics. In brief, peptide synthesis was performed using the 9-fluorenylmethoxycarbonyl (Fmoc) solid-phase synthesis method on an automated synthesizer, employing TGR resin. Cleavage was carried out using a trifluoroacetic acid cocktail containing triisopropylsilane and water. The peptides were then precipitated with cold ether and collected by centrifugation. Finally, they were purified to >90% purity via reverse-phase high-performance liquid chromatography using a C18 column. DNA cassette preparation The sequence of AG was obtained from NCBI, and the sequence of Toa was added to the 3’ end of AG. The product was cloned into a pUC-based standard vector (Eurofins). Two polymerase chain reactions were performed to prepare the suitable cassette for in vitro translation of AG or Toa conjugated AG following the protocol described by Yabuki et al. (2007) (figure 1). The primers used in this research are listed in Table 1. PCR products were confirmed by agarose gel electrophoresis (figure 2A). In vitro translation of GFP, Azami Green, and Toa conjugated Azami Green In vitro translation of GFP, AG, and Toa conjugated AG was performed using the Musaibo Kun N100 kit (Taiyo Nippon Sanso) according to the protocol provided with the kit with some modifications in the incubation step. The DNA cassette for GFP comes with the kit. The samples were incubated at 30 o C for 20 hours in a thermo shaker (Farvogen Biotech Corporation) at 300 rpm. Figure 2B shows the successful production of the proteins. The products were collected and centrifuged at 15000 g for 1 minute at 4oC, the supernatants were collected and used in later steps. Table 1: Primer sequences Name Sequence First PCR Fw (AG and Ag-cToa) GATCCAGCGGCTCCTCGGGAATGTCGGTAATCAAG First PCR RV (AG) GGTACCGGATTATTAACTCCCACCACCCCCAGTT First PCR RV (AG-cToa) CGGGGTACCGGATTATTAACGGCGATTGCTGCGAC Second PCR FW/RV GGGCTCTTGTCATTGTGCTTCG Cell uptake assay HeLa cells were collected, adjusted to 2 x 10 5 cells/ml, and then seeded into an 8-well Nunc Lab-Tek chamber slide (Thermo Fisher) for later use in the introduction of TAMRA, GFP, AG with Toa peptide. The culture medium was removed and replaced with the following solutions: (1) Toa conjugated TAMRA (TAMRA-cToa), (2) Toa incubated GFP (GFP-iToa), (3) Toa incubated AG (AG-iToa), and (4) Toa conjugated AG (AG-cToa). Briefly, TAMRA-cToa was diluted to a final concentration of 10 µM using the cell culture medium. For GFP-iToa, 80 µL of GFP supernatant was mixed with 500 µL of medium containing 10 µM Toa. Similarly for AG-iToa, 80 µL of AG supernatant was incubated with 500 µL of medium with 10 µM Toa for 1 hour at room temperature. Finally, for AG-cToa, 80 µL of Toa-conjugated AG supernatant was added to 500 µL of medium. After overnight incubation, Hela cells were fixed with 4% paraformaldehyde for 10 minutes and counter-stained with ProLong Gold antifade reagent with DAPI (Invitrogen). The samples were imaged by an LSM510 Meta confocal microscope (Zeiss), and the images were processed using Zen 2009 software. RESULTS Intracellular Distribution of TAMRA-Conjugated Toa Peptide To assess the cellular localization of the Toa peptide in HeLa cells, the peptide was conjugated with TAMRA and introduced into the culture. As shown in Figure 3, the fluorescent signal indicated that Toa successfully bypassed both the plasma and nuclear membranes, localizing primarily in the cytosol and nucleus. Interestingly, TAMRA fluorescence was also observed in the nucleolus. These findings suggest that Toa possesses cell-penetrating properties and exhibits nuclear and nucleolar localization. Toa Peptide Facilitates GFP Entry but Does Not Mediate Nuclear Localization To evaluate the cell-penetrating properties of the Toa peptide, in vitro translated GFP was incubated with Toa and introduced to HeLa cell culture. As shown in Figure 4, GFP fluorescence was detected inside the cells, predominantly near the plasma membrane. However, no significant signal was observed in the nucleus. These results suggest that while Toa can facilitate GFP uptake into cells, it does not efficiently mediate nuclear localization under these conditions. Toa Peptide Facilitates Azami Green Uptake with Partial Nuclear Localization To enhance intracellular fluorescence detection, AG was selected as an alternative to GFP due to its superior performance in cellular environments (Karasawa et al. 2003). In vitro translated AG was incubated with Toa for one hour before being introduced to HeLa cell culture. As shown in Figure 5, fluorescence was detected inside the cells, with most of the signal concentrated near the plasma membrane, similar to GFP. However, in some cells, fluorescence was also observed within the nucleus, primarily near the nuclear membrane. These findings suggest that Toa can facilitate the intracellular delivery of functional proteins and may enable partial nuclear localization under certain conditions. Toa Peptide Conjugation Enhances Nuclear and Nucleolar Localization of Azami Green To further investigate the intracellular transport capabilities of Toa, AG was directly conjugated with the peptide and introduced into HeLa cells. As shown in Figure 6, the fluorescent signal was strongly detected in the cytosol and nucleus, with some cells also exhibiting fluorescence in the nucleolus. These results indicate that Toa peptide can effectively facilitate protein delivery into the nucleus and, in some cases, the nucleolus, suggesting its potential for targeted intracellular transport. DISCUSSION Delivering recombinant proteins into cells targeting specific organelles is a promising application in therapy and research. However, due to the selective permeability of the plasma membrane, large molecules tend to fail to enter the targeted cells to perform their functions. This major hurdle along with the difficulty in targeting organelles are limiting factors that hinder the development of this field. CPPs have emerged as a solution to increase cellular uptake and organelle-specific localization of biomolecules. There are multiple CPPs that can carry their cargoes to specific intracellular targets (Cerrato & Langel 2022 ). In this study, we verified the efficiency of a synthetic signal peptide, Toa peptide, by utilizing it to deliver various cargoes to HeLa cells. The results show that Toa is a highly efficient CPP with nuclear and nucleolar localizing capabilities. The TAMRA-Toa complex effectively penetrated HeLa cells, showing its fluorescent signal in the cytosol, nucleus, and nucleolus. Whereas GFP and AG when added to the cell culture with the Toa peptide entered the cells but only showed partial nuclear localization. The differences suggest that the molecular size of the cargo affects transport efficiency. TAMRA is a fluorophore that is relatively smaller than both GFP and AG. Interestingly, the extended incubation with Toa peptide enhanced AG localization in the nucleus. This could be because AG and Toa form a more stable supramolecular complex, allowing more of the cargo protein to stay intact in the extracellular and intracellular environments (Scaletti et al. 2018 ), eventually reaching the nucleus. The conjugated nature of the TAMRA-Toa complex prompted another explanation for the higher effectiveness compared to incubated GFP and AG: direct conjugation between the cargo and Toa peptide enhances the transport efficiency. To test this hypothesis, AG was conjugated with Toa and then introduced to HeLa cells. Unlike AG-iToa, much more AG-cToa’s signal was found in the nucleus and nucleolus, confirming that conjugation enhances nuclear transport. A possible explanation for this observation is that, unlike the incubated variants, Toa conjugated AG does not separate from the signal peptide in the cytosolic environment, thus more of the protein gets transported into the nucleus with the peptide. This could also explain why GFP and AG when incubated with Toa peptide both formed spread signals in the cytosol, whereas AG conjugated with Toa peptide appears to have spherical shapes. The incubated variants carried the fluorescent proteins inside and might get broken down, so GFP and AG did not bind to anything specifically. The Toa conjugated AG could have bound to or trapped in endosomes in the cytosol, thus forming spots with strong fluorescent intensity. Cargoes carried by CPPs getting trapped in endosomes are a commonly known problem in many intracellular delivery systems (Varkouhi et al. 2011). The findings show that the Toa peptide is a highly effective CPP that can specifically deliver large molecular-weight cargoes to the nucleus and nucleolus. The nucleolar localization is primarily governed by electrostatic interactions between arginine-rich peptides and nucleolar RNA, and it has been observed that these principles apply in yeast and humans, potentially a conserved mechanism (Martin et al. 2015 ). This suggests that the Toa peptide could be applied to deliver biomolecules to various species. While this research confirms Toa peptide has CPP, NLS, and NoLS characteristics, the detailed entry mechanism remains to be studied. The differences between incubation and conjugation on delivery efficiency need further studies to elucidate the fate of the protein-peptide complex inside the cell. This study was performed using HeLa cells, thus the applicability of Toa peptide in other cell lines or species remains to be determined. Further research should aim to tackle these remaining challenges to develop the Toa peptide-based delivery system further. This research demonstrates a novel CPP can deliver proteins to the cell cytosol, nuclear, and nucleolus with varying effectiveness. The protein cargos retained their bioactivity in both incubated and conjugated with Toa peptide. Incubated GFP and AG successfully enter the cells with partial nucleus localization. Conjugated TAMRA and AG both showed strong localization in the nucleus and nucleolus. These findings indicate that Toa signal peptide can serve as a CPP for targeted intracellular delivery of biomolecules that can be used in both research and therapeutic contexts. Declarations Acknowledgements We extend our special thanks to Toagosei Co., LTD for the continuous support and invaluable contributions to this project. Author contributions Shuichi Asakawa, Tetsuhiko Yoshida, Ryo Yonezawa, Khai Nguyen designed the study. Nahoko Kobayashi and Tetsuhiko Yoshida designed the Toa Peptide. Khai Nguyen performed the experiments. Nahoko Kobayashi provided technical support with confocal imaging. Khai Nguyen analyzed and interpreted the data. Khai Nguyen wrote the manuscript. Nahoko Kobayashi, Tetsuhiko Yoshida, Ryo Yonezawa, and Shuichi Asakawa contributed to manuscript revision. Shuichi Asakawa supervised this study. Funding This study was financially supported by Toagosei Co., LTD. Data availability Data generated from this study are presented in the manuscript. The information not included would be shared by the corresponding author upon reasonable request. Conflict of interest The authors declare that they have no competing interests. Ethical approval This is an observational study. No endorsement from research ethics committees was deemed necessary to achieve the objectives of this study. Consent to participate This article does not contain any person’s data in any form. Consent for publication All authors agreed to publish the research in this journal. References Bechara, C., & Sagan, S. (2013). Cell-penetrating peptides: 20 years later, where do we stand? FEBS Letters , 587 (12), 1693–1702. https://doi.org/10.1016/j.febslet.2013.04.031 Behzadipour, Y., & Hemmati, S. (2024). Covalent conjugation and non-covalent complexation strategies for intracellular delivery of proteins using cell-penetrating peptides. Biomedicine and Pharmacotherapy , 176 (April), 116910. https://doi.org/10.1016/j.biopha.2024.116910 Bonifacino, J. S., & Traub, L. M. (2003). Signals for sorting of transmembrane proteins to endosomes and lysosomes. Annual Review of Biochemistry , 72 , 395–447. https://doi.org/10.1146/annurev.biochem.72.121801.161800 Cerrato, C. P., & Langel, Ü. (2022). An update on cell-penetrating peptides with intracellular organelle targeting. Expert Opinion on Drug Delivery , 19 (2), 133–146. https://doi.org/10.1080/17425247.2022.2034784 Cerrato, C. P., Pirisinu, M., Vlachos, E. N., & Langel, Ü. (2015). Novel cell-penetrating peptide targeting mitochondria. FASEB Journal , 29 (11), 4589–4599. https://doi.org/10.1096/fj.14-269225 Fuchs, S. M., & Raines, R. T. (2004). Pathway for Polyarginine Entry into Mammalian Cells. Biochemistry , 43 (9), 2438–2444. https://doi.org/10.1021/bi035933x Gronewold, A., Horn, M., & Neundorf, I. (2018). Design and biological characterization of novel cell-penetrating peptides preferentially targeting cell nuclei and subnuclear regions. Beilstein Journal of Organic Chemistry , 14 , 1378–1388. https://doi.org/10.3762/bjoc.14.116 Guidotti, G., Brambilla, L., & Rossi, D. (2017). Cell-Penetrating Peptides: From Basic Research to Clinics. Trends in Pharmacological Sciences , 38 (4), 406–424. https://doi.org/10.1016/j.tips.2017.01.003 Heitz, F., Morris, M. C., & Divita, G. (2009). Twenty years of cell-penetrating peptides: From molecular mechanisms to therapeutics. British Journal of Pharmacology , 157 (2), 195–206. https://doi.org/10.1111/j.1476-5381.2009.00057.x Herce, H. D., Schumacher, D., Schneider, A. F. L., Ludwig, A. K., Mann, F. A., Fillies, M., Kasper, M. A., Reinke, S., Krause, E., Leonhardt, H., Cardoso, M. C., & Hackenberger, C. P. R. (2017). Cell-permeable nanobodies for targeted immunolabelling and antigen manipulation in living cells. Nature Chemistry , 9 (8), 762–771. https://doi.org/10.1038/NCHEM.2811 Kang, J. Y., Kim, S., Kim, J., Kang, N. G., Yang, C. S., Min, S. J., & Kim, J. W. (2021). Cell-penetrating peptide-conjugated lipid/polymer hybrid nanovesicles for endoplasmic reticulum-targeting intracellular delivery. Journal of Materials Chemistry B , 9 (2), 464–470. https://doi.org/10.1039/d0tb01940b Karasawa, S., Araki, T., Yamamoto-Hino, M., & Miyawaki, A. (2003). A Green-emitting Fluorescent Protein from Galaxeidae Coral and Its Monomeric Version for Use in Fluorescent Labeling. Journal of Biological Chemistry , 278 (36), 34167–34171. https://doi.org/10.1074/jbc.M304063200 Kobayashi, N., Niwa, M., Yang, H., & Yoshida, T. (2012). Nucleolar Localization Signals of LIM Kinase 2 Function as a Cell- Penetrating Peptide. Protein & Peptide Letters , 17 (12), 1480–1488. https://doi.org/10.2174/0929866511009011480 Martin, R. M., Ter-Avetisyan, G., Herce, H. D., Ludwig, A. K., Lättig-Tünnemann, G., & Cardoso, M. C. (2015). Principles of protein targeting to the nucleolus. Nucleus , 6 (4), 314–325. https://doi.org/10.1080/19491034.2015.1079680 Martin, R. M., Tünnemann, G., Leonhardt, H., & Cardoso, M. C. (2007). Nucleolar marker for living cells. Histochemistry and Cell Biology , 127 (3), 243–251. https://doi.org/10.1007/s00418-006-0256-4 Pouniotis, D., Tang, C. K., Apostolopoulos, V., & Pietersz, G. (2016). Vaccine delivery by penetratin: mechanism of antigen presentation by dendritic cells. Immunologic Research , 64 (4), 887–900. https://doi.org/10.1007/s12026-016-8799-5 Scaletti, F., Hardie, J., Lee, Y. W., Luther, D. C., Ray, M., & Rotello, V. M. (2018). Protein delivery into cells using inorganic nanoparticle-protein supramolecular assemblies. Chemical Society Reviews , 47 (10), 3421–3432. https://doi.org/10.1039/c8cs00008e Schneider, A. F. L., Kithil, M., Cardoso, M. C., Lehmann, M., & Hackenberger, C. P. R. (2021). Cellular uptake of large biomolecules enabled by cell-surface-reactive cell-penetrating peptide additives. Nature Chemistry , 13 (6), 530–539. https://doi.org/10.1038/s41557-021-00661-x Su, P., Zhu, Z., Tian, Y., Liang, L., Wu, W., Cao, J., Cheng, B., Liu, W., & Tang, Y. (2020). A TAT peptide-based ratiometric two-photon fluorescent probe for detecting biothiols and sequentially distinguishing GSH in mitochondria. Talanta , 218 (February), 121127. https://doi.org/10.1016/j.talanta.2020.121127 Swiecicki, J. M., Di Pisa, M., Lippi, F., Chwetzoff, S., Mansuy, C., Trugnan, G., Chassaing, G., Lavielle, S., & Burlina, F. (2015). Unsaturated acyl chains dramatically enhanced cellular uptake by direct translocation of a minimalist oligo-arginine lipopeptide. Chemical Communications , 51 (78), 14656–14659. https://doi.org/10.1039/c5cc06116d Tan, R. S., Naruchi, K., Amano, M., Hinou, H., & Nishimura, S. I. (2015). Rapid Endolysosomal Escape and Controlled Intracellular Trafficking of Cell Surface Mimetic Quantum-Dots-Anchored Peptides and Glycopeptides. ACS Chemical Biology , 10 (9), 2073–2086. https://doi.org/10.1021/acschembio.5b00434 Truant, R., & Cullen, B. R. (1999). The Arginine-Rich Domains Present in Human Immunodeficiency Virus Type 1 Tat and Rev Function as Direct Importin β-Dependent Nuclear Localization Signals. Molecular and Cellular Biology , 19 (2), 1210–1217. https://doi.org/10.1128/mcb.19.2.1210 Wagstaff, K. M., Glover, D. J., Tremethick, D. J., & Jans, D. A. (2007). Histone-mediated transduction as an efficient means for gene delivery. Molecular Therapy , 15 (4), 721–731. https://doi.org/10.1038/sj.mt.6300093 Woldetsadik, A. D., Vogel, M. C., Rabeh, W. M., & Magzoub, M. (2017). Hexokinase II-derived cell-penetrating peptide targets mitochondria and triggers apoptosis in cancer cells. FASEB Journal , 31 (5), 2168–21874. https://doi.org/10.1096/fj.201601173R Yabuki, T., Motoda, Y., Hanada, K., Nunokawa, E., Saito, M., Seki, E., Inoue, M., Kigawa, T., & Yokoyama, S. (2007). A robust two-step PCR method of template DNA production for high-throughput cell-free protein synthesis. Journal of Structural and Functional Genomics , 8 (4), 173–191. https://doi.org/10.1007/s10969-007-9038-z Yarmush, M. L., Golberg, A., Serša, G., Kotnik, T., & Miklavčič, D. (2014). Electroporation-based technologies for medicine: Principles, applications, and challenges. Annual Review of Biomedical Engineering , 16 , 295–320. https://doi.org/10.1146/annurev-bioeng-071813-104622 Yim, N., Ryu, S. W., Choi, K., Lee, K. R., Lee, S., Choi, H., Kim, J., Shaker, M. R., Sun, W., Park, J. H., Kim, D., Do Heo, W., & Choi, C. (2016). Exosome engineering for efficient intracellular delivery of soluble proteins using optically reversible protein-protein interaction module. Nature Communications , 7 , 1–9. https://doi.org/10.1038/ncomms12277 Zhang, Y., & Yu, L. C. (2008). Microinjection as a tool of mechanical delivery. Current Opinion in Biotechnology , 19 (5), 506–510. https://doi.org/10.1016/j.copbio.2008.07.005 Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6398808","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":447114877,"identity":"b4e013b2-bf84-43ee-8041-21fc59e414c3","order_by":0,"name":"Khai Nguyen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABTUlEQVRIie2RT0rDQBSHXyjMKrXbCaOtR5gwECwGxJtMiKSbVipuXAgGCu0mttsUPUShBzBhIN3kALOseIGCm1CzMG3qH9LQtWC+zfyY4eO9Nw+gouIPgjFAkMdauFz9eqG7Ex1QkK373/f8sLJDNYhaouyhPQ1eRX8trAnxGDPX0GyMAoSVxGR04SqrBI6uCwo5jqiYjoU1fY5u3npjYDjmCAN3DBoHNc0DdFtQmphTUfeENZP2nPU8sGYYEEm5MKnkQLJZLLeodFZb5UVyg7Q9eNgoWZWtUvsoUQjuUqEmWRV8ZRBIgNOdYmQKKqui+d2+qLsd5kvH1h9drPuxNTgDx2FaHA7bHt2bBcvO/F1Nz08mvh0uk9RsNUYilGCa+ngxEDK5i4o/tkUZwqWbh82alLyT02ATaMRLt5PCxVf4oZWb9+VKRUVFxT/iExVqdFI7WzROAAAAAElFTkSuQmCC","orcid":"","institution":"The University of Tokyo","correspondingAuthor":true,"prefix":"","firstName":"Khai","middleName":"","lastName":"Nguyen","suffix":""},{"id":447114878,"identity":"3abcb38e-2b18-4a82-aae9-4a459fdc8fe9","order_by":1,"name":"Ryo Yonezawa","email":"","orcid":"","institution":"The University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Ryo","middleName":"","lastName":"Yonezawa","suffix":""},{"id":447114880,"identity":"20061373-845e-41a7-88c5-a5801e20da3a","order_by":2,"name":"Nahoko Kobayashi","email":"","orcid":"","institution":"Toagosei Co., Ltd","correspondingAuthor":false,"prefix":"","firstName":"Nahoko","middleName":"","lastName":"Kobayashi","suffix":""},{"id":447114882,"identity":"40e289c5-ffa3-42a4-94e5-7ebd030b9b1a","order_by":3,"name":"Tetsuhiko Yoshida","email":"","orcid":"","institution":"Toagosei Co., Ltd","correspondingAuthor":false,"prefix":"","firstName":"Tetsuhiko","middleName":"","lastName":"Yoshida","suffix":""},{"id":447114884,"identity":"a6ab782d-9b74-4bc0-b1c2-fb789bcf6b63","order_by":4,"name":"Shuichi Asakawa","email":"","orcid":"","institution":"The University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Shuichi","middleName":"","lastName":"Asakawa","suffix":""}],"badges":[],"createdAt":"2025-04-08 03:38:18","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-6398808/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6398808/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":81344337,"identity":"8a0a831e-bd46-46c4-a024-fe4307ef4648","added_by":"auto","created_at":"2025-04-25 04:19:41","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":90306,"visible":true,"origin":"","legend":"\u003cp\u003eTwo-step PCR process to produce DNA cassettes for in vitro translation system. 1\u003csup\u003est\u003c/sup\u003e PCR amplifies the target sequence and adds two linkers. 2\u003csup\u003end\u003c/sup\u003e PCR attaches two fragments using the linkers. The total size of two fragments is 412 bp. Adapted with permission from Yabuki et al. (2007) (Picture was edited using Microsoft PowerPoint)\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6398808/v1/e29d8362eb278c88547980e0.jpeg"},{"id":81344340,"identity":"683f2a94-d45c-4e32-a24d-7a1c0f4a51b9","added_by":"auto","created_at":"2025-04-25 04:19:41","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":345442,"visible":true,"origin":"","legend":"\u003cp\u003eSuccessful production of GFP, AG, AG-cToa using in vitro translation. (A) Agarose gel electrophoresis confirmation of PCR products for Ag-cToa and Ag. (B) In vitro translation products of GFP, Ag, Ag-cToa. (Picture was edited using Microsoft PowerPoint)\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6398808/v1/3ea8b802366fde41b81aa13b.jpeg"},{"id":81344681,"identity":"7b5cb7c4-759c-4a11-a564-fd471168a583","added_by":"auto","created_at":"2025-04-25 04:27:41","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":788176,"visible":true,"origin":"","legend":"\u003cp\u003eFluorescent confocal images of TAMRA-cToa in HeLa cell show localization in nucleolus. (Picture was edited using Microsoft PowerPoint)\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6398808/v1/d77c11222e0a8eee5848a095.png"},{"id":81344353,"identity":"f5bb5452-72d9-4e51-9542-bf23440f2268","added_by":"auto","created_at":"2025-04-25 04:19:44","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1607083,"visible":true,"origin":"","legend":"\u003cp\u003eFluorescent confocal images of GFP-iToa in HeLa cell show cytosol localization. (Picture was edited using Microsoft PowerPoint)\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6398808/v1/3db66d0640ddf9b65b156918.png"},{"id":81344682,"identity":"9ef773e4-154b-465b-868d-2482668e77f9","added_by":"auto","created_at":"2025-04-25 04:27:41","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1555867,"visible":true,"origin":"","legend":"\u003cp\u003eFluorescent confocal images of AG-iToa in HeLa cell show cytosol localization and partial nucleus localization. (Picture was edited using Microsoft PowerPoint)\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6398808/v1/ea51a08871f48b57a463bb00.png"},{"id":81344680,"identity":"95c9882b-d075-40d3-aafe-a1161f89b126","added_by":"auto","created_at":"2025-04-25 04:27:41","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":393922,"visible":true,"origin":"","legend":"\u003cp\u003eFluorescent confocal images of AG-cToa in HeLa cell show cytosol, nucleus, and nucleolus localization. (Picture was edited using Microsoft PowerPoint)\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6398808/v1/a9cda4c111f672ce36c82816.jpeg"},{"id":81344867,"identity":"6ee1453b-0c4a-40e2-95cb-c99561f4dff0","added_by":"auto","created_at":"2025-04-25 04:35:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4772887,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6398808/v1/73918386-7349-49fe-8f73-a8e3a85c1e2c.pdf"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"A new signal peptide with cell-penetrating and nuclear localization properties for targeted nucleolar delivery","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eThe cell plasma membrane serves as a selective barrier that regulates what goes in and out of the cell. Small molecules and ions can traverse the membrane via active or passive transport mechanisms, large and complex molecules such as proteins, nucleic acids, and drugs encounter much more entry restrictions due to the selective permeability of the membrane. Several strategies have been developed to bypass this selection such as electroporation (Yarmush et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), microinjection (Zhang \u0026amp; Yu \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), exosomes (Yim et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), and nanoparticles (Scaletti et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). While these methods are effective, their drawbacks can limit potential applications in research and therapy.\u003c/p\u003e \u003cp\u003eCell-penetrating peptides (CPPs) offer a new approach for intracellular delivery. These are short peptides that can translocate the plasma membrane, carrying a wide range of molecules with them into the cell (Guidotti et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). CPPs are gaining more and more interest as they have low cytotoxicity and can target many cell types. CPPs are also easily controlled as their efficiency is dose-dependent (Heitz et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Studies have demonstrated that CPPs can successfully deliver proteins, peptides, DNA, siRNA, and drugs into cells (Bechara \u0026amp; Sagan \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The delivery is facilitated by covalent conjugation or non-covalent interaction between the cargo and the CPP (Behzadipour \u0026amp; Hemmati \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eVarious types of CPPs have been shown to not only bypass the plasma membrane but also target specific organelles (Cerrato \u0026amp; Langel \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCPPs have been used to target mitochondria for biomedical applications such as disease diagnosis (Su et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), protection against oxidative stress (Cerrato et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), and targeted cancer therapy through disrupting mitochondrial function (Woldetsadik et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSeveral CPPs have been identified that localize to the Golgi apparatus, endoplasmic reticulum, and lysosomes (Bonifacino \u0026amp; Traub \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Kang et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Pouniotis et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Schneider et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Swiecicki et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Tan et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Their unique sequences enable targeted delivery through these pathways, allowing precise control over cargo fate and offering potential applications in drug delivery systems.\u003c/p\u003e \u003cp\u003eNucleus-targeted CPPs are relatively well-studied. Many CPPs contain nuclear localization signals to bypass the nuclear pore complex (Wagstaff et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Multiple studies have been done to elucidate the mechanisms, develop applications, and enhance the efficiency of nuclear-specific delivery systems (Cerrato \u0026amp; Langel \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Among the most used CPPs are TAT and polyarginine, both are CPPs with nuclear-localizing properties (Fuchs \u0026amp; Raines \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Truant \u0026amp; Cullen \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e1999\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTargeting the nucleolus with CPPs is a promising strategy to control protein synthesis by selectively restricting ribosomal machinery. Compared to the nucleus, CPPs targeting nucleolus are not as well investigated. Kobayashi et al. (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) revealed that the nucleolar localization signal sequence of LimK2 possesses CPP properties. Gronewold et al. (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) have designed a new CPP that can deliver drugs to the nucleolus. Martin et al. (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) have employed a CPP to label nucleoli for structural studies. Herce et al. (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) have engineered a CPP with a nanobody attached to it to carry specific proteins into the nucleolus.\u003c/p\u003e \u003cp\u003eIn this paper, we tested a novel peptide called Toa (KVLSRVVQLCREKLTRRRRSNRR). The peptide was studied by incubating or conjugating with Green Fluorescent Protein (GFP), Azami Green (AG), 5(6)-Carboxytetramethylrhodamine (TAMRA) before introducing to HeLa cells. Fluorescent confocal microscopy confirms that Toa peptide can deliver these molecules to the cell cytosol, nuclear, and nucleolus at varying effectiveness. Toa peptide serves as a novel CPP for targeted intracellular delivery in research and therapeutic applications.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003e\u003cstrong\u003eCell culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHeLa cells were cultured in DMEM/F-12 (Thermo Fisher) supplemented with 10% fetal bovine serum and 100 mg/ml of penicillin and streptomycin at 37\u003csup\u003eo\u003c/sup\u003eC and 5% CO\u003csub\u003e2\u003c/sub\u003e. The cells were subcultured when reaching 80-90% confluence. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eToa and TAMRA conjugated Toa production\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eToa and TAMRA conjugated Toa were synthesized by Eurofins Genomics. In brief, peptide synthesis was performed using the 9-fluorenylmethoxycarbonyl (Fmoc) solid-phase synthesis method on an automated synthesizer, employing TGR resin. Cleavage was carried out using a trifluoroacetic acid cocktail containing triisopropylsilane and water. The peptides were then precipitated with cold ether and collected by centrifugation. Finally, they were purified to \u0026gt;90% purity via reverse-phase high-performance liquid chromatography using a C18 column.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDNA cassette preparation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe sequence of AG was obtained from NCBI, and the sequence of Toa was added to the 3\u0026rsquo; end of AG. The product was cloned into a pUC-based standard vector (Eurofins). Two polymerase chain reactions were performed to prepare the suitable cassette for in vitro translation of AG or Toa conjugated AG following the protocol described by Yabuki et al. (2007) (figure 1). The primers used in this research are listed in Table 1. PCR products were confirmed by agarose gel electrophoresis (figure 2A).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIn vitro translation of GFP, Azami Green, and Toa conjugated Azami Green\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn vitro translation of GFP, AG, and Toa conjugated AG was performed using the Musaibo Kun N100 kit (Taiyo Nippon Sanso) according to the protocol provided with the kit with some modifications in the incubation step. The DNA cassette for GFP comes with the kit. The samples were incubated at 30\u003csup\u003eo\u003c/sup\u003eC for 20 hours in a thermo shaker (Farvogen Biotech Corporation) at 300 rpm. \u0026nbsp;Figure 2B shows the successful production of the proteins. The products were collected and centrifuged at 15000 g for 1 minute at 4oC, the supernatants were collected and used in later steps.\u003c/p\u003e\n\u003cp\u003eTable 1: Primer sequences\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 29.1506%;\"\u003e\n \u003cp\u003eName\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70.8494%;\"\u003e\n \u003cp\u003eSequence\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 29.1506%;\"\u003e\n \u003cp\u003eFirst PCR Fw\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e(AG and Ag-cToa)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70.8494%;\"\u003e\n \u003cp\u003eGATCCAGCGGCTCCTCGGGAATGTCGGTAATCAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 29.1506%;\"\u003e\n \u003cp\u003eFirst PCR RV (AG)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70.8494%;\"\u003e\n \u003cp\u003eGGTACCGGATTATTAACTCCCACCACCCCCAGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 29.1506%;\"\u003e\n \u003cp\u003eFirst PCR RV (AG-cToa)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70.8494%;\"\u003e\n \u003cp\u003eCGGGGTACCGGATTATTAACGGCGATTGCTGCGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 29.1506%;\"\u003e\n \u003cp\u003eSecond PCR FW/RV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70.8494%;\"\u003e\n \u003cp\u003eGGGCTCTTGTCATTGTGCTTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eCell uptake assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHeLa cells were collected, adjusted to 2 x 10\u003csup\u003e5\u0026nbsp;\u003c/sup\u003ecells/ml, and then seeded into an 8-well Nunc Lab-Tek chamber slide (Thermo Fisher) for later use in the introduction of TAMRA, GFP, AG with Toa peptide. The culture medium was removed and replaced with the following solutions: (1) Toa conjugated TAMRA (TAMRA-cToa), (2) Toa incubated GFP (GFP-iToa), (3) Toa incubated AG (AG-iToa), and (4) Toa conjugated AG (AG-cToa).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBriefly, TAMRA-cToa was diluted to a final concentration of 10 \u0026micro;M using the cell culture medium. For GFP-iToa, 80 \u0026micro;L of GFP supernatant was mixed with 500 \u0026micro;L of medium containing 10 \u0026micro;M Toa. Similarly for AG-iToa, 80 \u0026micro;L of AG supernatant was incubated with 500 \u0026micro;L of medium with 10 \u0026micro;M Toa for 1 hour at room temperature. Finally, for AG-cToa, 80 \u0026micro;L of Toa-conjugated AG supernatant was added to 500 \u0026micro;L of medium.\u003c/p\u003e\n\u003cp\u003eAfter overnight incubation, Hela cells were fixed with 4% paraformaldehyde for 10 minutes and counter-stained with ProLong Gold antifade reagent with DAPI (Invitrogen). The samples were imaged by an LSM510 Meta confocal microscope (Zeiss), and the images were processed using Zen 2009 software.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cstrong\u003eIntracellular Distribution of TAMRA-Conjugated Toa Peptide\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo assess the cellular localization of the Toa peptide in HeLa cells, the peptide was conjugated with TAMRA and introduced into the culture. As shown in Figure 3, the fluorescent signal indicated that Toa successfully bypassed both the plasma and nuclear membranes, localizing primarily in the cytosol and nucleus. Interestingly, TAMRA fluorescence was also observed in the nucleolus. These findings suggest that Toa possesses cell-penetrating properties and exhibits nuclear and nucleolar localization.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eToa Peptide Facilitates GFP Entry but Does Not Mediate Nuclear Localization\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the cell-penetrating properties of the Toa peptide, in vitro translated GFP was incubated with Toa and introduced to HeLa cell culture. As shown in Figure 4, GFP fluorescence was detected inside the cells, predominantly near the plasma membrane. However, no significant signal was observed in the nucleus. These results suggest that while Toa can facilitate GFP uptake into cells, it does not efficiently mediate nuclear localization under these conditions.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eToa Peptide Facilitates Azami Green Uptake with Partial Nuclear Localization\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo enhance intracellular fluorescence detection, AG was selected as an alternative to GFP due to its superior performance in cellular environments (Karasawa et al. 2003). In vitro translated AG was incubated with Toa for one hour before being introduced to HeLa cell culture. As shown in Figure 5, fluorescence was detected inside the cells, with most of the signal concentrated near the plasma membrane, similar to GFP. However, in some cells, fluorescence was also observed within the nucleus, primarily near the nuclear membrane. These findings suggest that Toa can facilitate the intracellular delivery of functional proteins and may enable partial nuclear localization under certain conditions.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eToa Peptide Conjugation Enhances Nuclear and Nucleolar Localization of Azami Green\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further investigate the intracellular transport capabilities of Toa, AG was directly conjugated with the peptide and introduced into HeLa cells. As shown in Figure 6, the fluorescent signal was strongly detected in the cytosol and nucleus, with some cells also exhibiting fluorescence in the nucleolus. These results indicate that Toa peptide can effectively facilitate protein delivery into the nucleus and, in some cases, the nucleolus, suggesting its potential for targeted intracellular transport.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eDelivering recombinant proteins into cells targeting specific organelles is a promising application in therapy and research. However, due to the selective permeability of the plasma membrane, large molecules tend to fail to enter the targeted cells to perform their functions. This major hurdle along with the difficulty in targeting organelles are limiting factors that hinder the development of this field. CPPs have emerged as a solution to increase cellular uptake and organelle-specific localization of biomolecules. There are multiple CPPs that can carry their cargoes to specific intracellular targets (Cerrato \u0026amp; Langel \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this study, we verified the efficiency of a synthetic signal peptide, Toa peptide, by utilizing it to deliver various cargoes to HeLa cells. The results show that Toa is a highly efficient CPP with nuclear and nucleolar localizing capabilities.\u003c/p\u003e \u003cp\u003eThe TAMRA-Toa complex effectively penetrated HeLa cells, showing its fluorescent signal in the cytosol, nucleus, and nucleolus. Whereas GFP and AG when added to the cell culture with the Toa peptide entered the cells but only showed partial nuclear localization. The differences suggest that the molecular size of the cargo affects transport efficiency. TAMRA is a fluorophore that is relatively smaller than both GFP and AG.\u003c/p\u003e \u003cp\u003eInterestingly, the extended incubation with Toa peptide enhanced AG localization in the nucleus. This could be because AG and Toa form a more stable supramolecular complex, allowing more of the cargo protein to stay intact in the extracellular and intracellular environments (Scaletti et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), eventually reaching the nucleus.\u003c/p\u003e \u003cp\u003eThe conjugated nature of the TAMRA-Toa complex prompted another explanation for the higher effectiveness compared to incubated GFP and AG: direct conjugation between the cargo and Toa peptide enhances the transport efficiency. To test this hypothesis, AG was conjugated with Toa and then introduced to HeLa cells. Unlike AG-iToa, much more AG-cToa\u0026rsquo;s signal was found in the nucleus and nucleolus, confirming that conjugation enhances nuclear transport. A possible explanation for this observation is that, unlike the incubated variants, Toa conjugated AG does not separate from the signal peptide in the cytosolic environment, thus more of the protein gets transported into the nucleus with the peptide.\u003c/p\u003e \u003cp\u003eThis could also explain why GFP and AG when incubated with Toa peptide both formed spread signals in the cytosol, whereas AG conjugated with Toa peptide appears to have spherical shapes. The incubated variants carried the fluorescent proteins inside and might get broken down, so GFP and AG did not bind to anything specifically. The Toa conjugated AG could have bound to or trapped in endosomes in the cytosol, thus forming spots with strong fluorescent intensity. Cargoes carried by CPPs getting trapped in endosomes are a commonly known problem in many intracellular delivery systems (Varkouhi et al. 2011).\u003c/p\u003e \u003cp\u003eThe findings show that the Toa peptide is a highly effective CPP that can specifically deliver large molecular-weight cargoes to the nucleus and nucleolus. The nucleolar localization is primarily governed by electrostatic interactions between arginine-rich peptides and nucleolar RNA, and it has been observed that these principles apply in yeast and humans, potentially a conserved mechanism (Martin et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). This suggests that the Toa peptide could be applied to deliver biomolecules to various species.\u003c/p\u003e \u003cp\u003eWhile this research confirms Toa peptide has CPP, NLS, and NoLS characteristics, the detailed entry mechanism remains to be studied. The differences between incubation and conjugation on delivery efficiency need further studies to elucidate the fate of the protein-peptide complex inside the cell. This study was performed using HeLa cells, thus the applicability of Toa peptide in other cell lines or species remains to be determined. Further research should aim to tackle these remaining challenges to develop the Toa peptide-based delivery system further.\u003c/p\u003e \u003cp\u003eThis research demonstrates a novel CPP can deliver proteins to the cell cytosol, nuclear, and nucleolus with varying effectiveness. The protein cargos retained their bioactivity in both incubated and conjugated with Toa peptide. Incubated GFP and AG successfully enter the cells with partial nucleus localization. Conjugated TAMRA and AG both showed strong localization in the nucleus and nucleolus. These findings indicate that Toa signal peptide can serve as a CPP for targeted intracellular delivery of biomolecules that can be used in both research and therapeutic contexts.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e We extend our special thanks to Toagosei Co., LTD for the continuous support and invaluable contributions to this project. \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003eShuichi Asakawa, Tetsuhiko Yoshida, Ryo Yonezawa, Khai Nguyen\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003edesigned the study. Nahoko Kobayashi and Tetsuhiko Yoshida designed the Toa Peptide. Khai Nguyen performed the experiments. Nahoko Kobayashi provided technical support with confocal imaging. Khai Nguyen analyzed and interpreted the data. Khai Nguyen wrote the manuscript. Nahoko Kobayashi, Tetsuhiko Yoshida, Ryo Yonezawa, and Shuichi Asakawa contributed to manuscript revision. Shuichi Asakawa supervised this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e This study was financially supported by Toagosei Co., LTD.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e Data generated from this study are presented in the manuscript. The information not included would be shared by the corresponding author upon reasonable request.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e The authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e This is an observational study. No endorsement from research ethics committees was deemed necessary to achieve the objectives of this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e This article does not contain any person\u0026rsquo;s data in any form.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e All authors agreed to publish the research in this journal.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBechara, C., \u0026amp; Sagan, S. (2013). Cell-penetrating peptides: 20 years later, where do we stand? \u003cem\u003eFEBS Letters\u003c/em\u003e, \u003cem\u003e587\u003c/em\u003e(12), 1693\u0026ndash;1702. https://doi.org/10.1016/j.febslet.2013.04.031\u003c/li\u003e\n\u003cli\u003eBehzadipour, Y., \u0026amp; Hemmati, S. (2024). Covalent conjugation and non-covalent complexation strategies for intracellular delivery of proteins using cell-penetrating peptides. \u003cem\u003eBiomedicine and Pharmacotherapy\u003c/em\u003e, \u003cem\u003e176\u003c/em\u003e(April), 116910. https://doi.org/10.1016/j.biopha.2024.116910\u003c/li\u003e\n\u003cli\u003eBonifacino, J. S., \u0026amp; Traub, L. M. (2003). Signals for sorting of transmembrane proteins to endosomes and lysosomes. \u003cem\u003eAnnual Review of Biochemistry\u003c/em\u003e, \u003cem\u003e72\u003c/em\u003e, 395\u0026ndash;447. https://doi.org/10.1146/annurev.biochem.72.121801.161800\u003c/li\u003e\n\u003cli\u003eCerrato, C. P., \u0026amp; Langel, \u0026Uuml;. (2022). An update on cell-penetrating peptides with intracellular organelle targeting. \u003cem\u003eExpert Opinion on Drug Delivery\u003c/em\u003e, \u003cem\u003e19\u003c/em\u003e(2), 133\u0026ndash;146. https://doi.org/10.1080/17425247.2022.2034784\u003c/li\u003e\n\u003cli\u003eCerrato, C. P., Pirisinu, M., Vlachos, E. N., \u0026amp; Langel, \u0026Uuml;. (2015). Novel cell-penetrating peptide targeting mitochondria. \u003cem\u003eFASEB Journal\u003c/em\u003e, \u003cem\u003e29\u003c/em\u003e(11), 4589\u0026ndash;4599. https://doi.org/10.1096/fj.14-269225\u003c/li\u003e\n\u003cli\u003eFuchs, S. M., \u0026amp; Raines, R. T. (2004). Pathway for Polyarginine Entry into Mammalian Cells. \u003cem\u003eBiochemistry\u003c/em\u003e, \u003cem\u003e43\u003c/em\u003e(9), 2438\u0026ndash;2444. https://doi.org/10.1021/bi035933x\u003c/li\u003e\n\u003cli\u003eGronewold, A., Horn, M., \u0026amp; Neundorf, I. (2018). Design and biological characterization of novel cell-penetrating peptides preferentially targeting cell nuclei and subnuclear regions. \u003cem\u003eBeilstein Journal of Organic Chemistry\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e, 1378\u0026ndash;1388. https://doi.org/10.3762/bjoc.14.116\u003c/li\u003e\n\u003cli\u003eGuidotti, G., Brambilla, L., \u0026amp; Rossi, D. (2017). Cell-Penetrating Peptides: From Basic Research to Clinics. \u003cem\u003eTrends in Pharmacological Sciences\u003c/em\u003e, \u003cem\u003e38\u003c/em\u003e(4), 406\u0026ndash;424. https://doi.org/10.1016/j.tips.2017.01.003\u003c/li\u003e\n\u003cli\u003eHeitz, F., Morris, M. C., \u0026amp; Divita, G. (2009). Twenty years of cell-penetrating peptides: From molecular mechanisms to therapeutics. \u003cem\u003eBritish Journal of Pharmacology\u003c/em\u003e, \u003cem\u003e157\u003c/em\u003e(2), 195\u0026ndash;206. https://doi.org/10.1111/j.1476-5381.2009.00057.x\u003c/li\u003e\n\u003cli\u003eHerce, H. D., Schumacher, D., Schneider, A. F. L., Ludwig, A. K., Mann, F. A., Fillies, M., Kasper, M. A., Reinke, S., Krause, E., Leonhardt, H., Cardoso, M. C., \u0026amp; Hackenberger, C. P. R. (2017). Cell-permeable nanobodies for targeted immunolabelling and antigen manipulation in living cells. \u003cem\u003eNature Chemistry\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(8), 762\u0026ndash;771. https://doi.org/10.1038/NCHEM.2811\u003c/li\u003e\n\u003cli\u003eKang, J. Y., Kim, S., Kim, J., Kang, N. G., Yang, C. S., Min, S. J., \u0026amp; Kim, J. W. (2021). Cell-penetrating peptide-conjugated lipid/polymer hybrid nanovesicles for endoplasmic reticulum-targeting intracellular delivery. \u003cem\u003eJournal of Materials Chemistry B\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(2), 464\u0026ndash;470. https://doi.org/10.1039/d0tb01940b\u003c/li\u003e\n\u003cli\u003eKarasawa, S., Araki, T., Yamamoto-Hino, M., \u0026amp; Miyawaki, A. (2003). A Green-emitting Fluorescent Protein from Galaxeidae Coral and Its Monomeric Version for Use in Fluorescent Labeling. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e, \u003cem\u003e278\u003c/em\u003e(36), 34167\u0026ndash;34171. https://doi.org/10.1074/jbc.M304063200\u003c/li\u003e\n\u003cli\u003eKobayashi, N., Niwa, M., Yang, H., \u0026amp; Yoshida, T. (2012). Nucleolar Localization Signals of LIM Kinase 2 Function as a Cell- Penetrating Peptide. \u003cem\u003eProtein \u0026amp; Peptide Letters\u003c/em\u003e, \u003cem\u003e17\u003c/em\u003e(12), 1480\u0026ndash;1488. https://doi.org/10.2174/0929866511009011480\u003c/li\u003e\n\u003cli\u003eMartin, R. M., Ter-Avetisyan, G., Herce, H. D., Ludwig, A. K., L\u0026auml;ttig-T\u0026uuml;nnemann, G., \u0026amp; Cardoso, M. C. (2015). Principles of protein targeting to the nucleolus. \u003cem\u003eNucleus\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e(4), 314\u0026ndash;325. https://doi.org/10.1080/19491034.2015.1079680\u003c/li\u003e\n\u003cli\u003eMartin, R. M., T\u0026uuml;nnemann, G., Leonhardt, H., \u0026amp; Cardoso, M. C. (2007). Nucleolar marker for living cells. \u003cem\u003eHistochemistry and Cell Biology\u003c/em\u003e, \u003cem\u003e127\u003c/em\u003e(3), 243\u0026ndash;251. https://doi.org/10.1007/s00418-006-0256-4\u003c/li\u003e\n\u003cli\u003ePouniotis, D., Tang, C. K., Apostolopoulos, V., \u0026amp; Pietersz, G. (2016). Vaccine delivery by penetratin: mechanism of antigen presentation by dendritic cells. \u003cem\u003eImmunologic Research\u003c/em\u003e, \u003cem\u003e64\u003c/em\u003e(4), 887\u0026ndash;900. https://doi.org/10.1007/s12026-016-8799-5\u003c/li\u003e\n\u003cli\u003eScaletti, F., Hardie, J., Lee, Y. W., Luther, D. C., Ray, M., \u0026amp; Rotello, V. M. (2018). Protein delivery into cells using inorganic nanoparticle-protein supramolecular assemblies. \u003cem\u003eChemical Society Reviews\u003c/em\u003e, \u003cem\u003e47\u003c/em\u003e(10), 3421\u0026ndash;3432. https://doi.org/10.1039/c8cs00008e\u003c/li\u003e\n\u003cli\u003eSchneider, A. F. L., Kithil, M., Cardoso, M. C., Lehmann, M., \u0026amp; Hackenberger, C. P. R. (2021). Cellular uptake of large biomolecules enabled by cell-surface-reactive cell-penetrating peptide additives. \u003cem\u003eNature Chemistry\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(6), 530\u0026ndash;539. https://doi.org/10.1038/s41557-021-00661-x\u003c/li\u003e\n\u003cli\u003eSu, P., Zhu, Z., Tian, Y., Liang, L., Wu, W., Cao, J., Cheng, B., Liu, W., \u0026amp; Tang, Y. (2020). A TAT peptide-based ratiometric two-photon fluorescent probe for detecting biothiols and sequentially distinguishing GSH in mitochondria. \u003cem\u003eTalanta\u003c/em\u003e, \u003cem\u003e218\u003c/em\u003e(February), 121127. https://doi.org/10.1016/j.talanta.2020.121127\u003c/li\u003e\n\u003cli\u003eSwiecicki, J. M., Di Pisa, M., Lippi, F., Chwetzoff, S., Mansuy, C., Trugnan, G., Chassaing, G., Lavielle, S., \u0026amp; Burlina, F. (2015). Unsaturated acyl chains dramatically enhanced cellular uptake by direct translocation of a minimalist oligo-arginine lipopeptide. \u003cem\u003eChemical Communications\u003c/em\u003e, \u003cem\u003e51\u003c/em\u003e(78), 14656\u0026ndash;14659. https://doi.org/10.1039/c5cc06116d\u003c/li\u003e\n\u003cli\u003eTan, R. S., Naruchi, K., Amano, M., Hinou, H., \u0026amp; Nishimura, S. I. (2015). Rapid Endolysosomal Escape and Controlled Intracellular Trafficking of Cell Surface Mimetic Quantum-Dots-Anchored Peptides and Glycopeptides. \u003cem\u003eACS Chemical Biology\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(9), 2073\u0026ndash;2086. https://doi.org/10.1021/acschembio.5b00434\u003c/li\u003e\n\u003cli\u003eTruant, R., \u0026amp; Cullen, B. R. (1999). The Arginine-Rich Domains Present in Human Immunodeficiency Virus Type 1 Tat and Rev Function as Direct Importin \u0026beta;-Dependent Nuclear Localization Signals. \u003cem\u003eMolecular and Cellular Biology\u003c/em\u003e, \u003cem\u003e19\u003c/em\u003e(2), 1210\u0026ndash;1217. https://doi.org/10.1128/mcb.19.2.1210\u003c/li\u003e\n\u003cli\u003eWagstaff, K. M., Glover, D. J., Tremethick, D. J., \u0026amp; Jans, D. A. (2007). Histone-mediated transduction as an efficient means for gene delivery. \u003cem\u003eMolecular Therapy\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(4), 721\u0026ndash;731. https://doi.org/10.1038/sj.mt.6300093\u003c/li\u003e\n\u003cli\u003eWoldetsadik, A. D., Vogel, M. C., Rabeh, W. M., \u0026amp; Magzoub, M. (2017). Hexokinase II-derived cell-penetrating peptide targets mitochondria and triggers apoptosis in cancer cells. \u003cem\u003eFASEB Journal\u003c/em\u003e, \u003cem\u003e31\u003c/em\u003e(5), 2168\u0026ndash;21874. https://doi.org/10.1096/fj.201601173R\u003c/li\u003e\n\u003cli\u003eYabuki, T., Motoda, Y., Hanada, K., Nunokawa, E., Saito, M., Seki, E., Inoue, M., Kigawa, T., \u0026amp; Yokoyama, S. (2007). A robust two-step PCR method of template DNA production for high-throughput cell-free protein synthesis. \u003cem\u003eJournal of Structural and Functional Genomics\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(4), 173\u0026ndash;191. https://doi.org/10.1007/s10969-007-9038-z\u003c/li\u003e\n\u003cli\u003eYarmush, M. L., Golberg, A., Ser\u0026scaron;a, G., Kotnik, T., \u0026amp; Miklavčič, D. (2014). Electroporation-based technologies for medicine: Principles, applications, and challenges. \u003cem\u003eAnnual Review of Biomedical Engineering\u003c/em\u003e, \u003cem\u003e16\u003c/em\u003e, 295\u0026ndash;320. https://doi.org/10.1146/annurev-bioeng-071813-104622\u003c/li\u003e\n\u003cli\u003eYim, N., Ryu, S. W., Choi, K., Lee, K. R., Lee, S., Choi, H., Kim, J., Shaker, M. R., Sun, W., Park, J. H., Kim, D., Do Heo, W., \u0026amp; Choi, C. (2016). Exosome engineering for efficient intracellular delivery of soluble proteins using optically reversible protein-protein interaction module. \u003cem\u003eNature Communications\u003c/em\u003e, \u003cem\u003e7\u003c/em\u003e, 1\u0026ndash;9. https://doi.org/10.1038/ncomms12277\u003c/li\u003e\n\u003cli\u003eZhang, Y., \u0026amp; Yu, L. C. (2008). Microinjection as a tool of mechanical delivery. \u003cem\u003eCurrent Opinion in Biotechnology\u003c/em\u003e, \u003cem\u003e19\u003c/em\u003e(5), 506\u0026ndash;510. https://doi.org/10.1016/j.copbio.2008.07.005\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"University of Tokyo","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Cell-penetrating peptides (CPPs), Nuclear localization signal (NLS), Nucleolar localization signal (NoLS), Green Fluorescent Protein (GFP), Azami Green (AG), 5(6)-Carboxytetramethylrhodamine (TAMRA)","lastPublishedDoi":"10.21203/rs.3.rs-6398808/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6398808/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe plasma membrane is a barrier of entry, regulating what comes in and out of the cell. The selective permeability of the membrane restricts macromolecule entry. Cell-penetrating peptides (CPPs) serve as a new approach to facilitate the transport of various cargoes into cells. Many CPPs have shown the capability to target specific organelles such as mitochondria, endoplasmic reticulum, or nucleus, but very few can target the nucleolus effectively. In this study, we evaluated the intracellular delivery characteristics of a novel synthetic signal peptide called Toa. The results show that Toa can effectively 5(6)-Carboxytetramethylrhodamine into the nucleolus. Toa peptide promotes cellular uptake of Green Fluorescent Protein and Azami Green when incubated with the cargoes, a partial nucleus localization was also observed for Azami Green. Toa conjugated Azami Green entered the nucleus and was localized in the nucleolus. The results confirm that Toa has cell-penetrating, nuclear and nucleolar localizing capabilities. Toa\u0026rsquo;s efficient nucleolar delivery makes it a promising tool for research and therapeutic applications.\u003c/p\u003e","manuscriptTitle":"A new signal peptide with cell-penetrating and nuclear localization properties for targeted nucleolar delivery","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-25 04:19:36","doi":"10.21203/rs.3.rs-6398808/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"900fc4d7-9708-492a-86d5-a9dd6b8b53b0","owner":[],"postedDate":"April 25th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-04-25T04:19:37+00:00","versionOfRecord":[],"versionCreatedAt":"2025-04-25 04:19:36","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6398808","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6398808","identity":"rs-6398808","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00