TET2-Driven Demethylation of ANG promotes Angiogenesis and Malignant transformation in Oligodendroglioma

TET2-Driven Demethylation of ANG promotes Angiogenesis and Malignant transformation in Oligodendroglioma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article TET2-Driven Demethylation of ANG promotes Angiogenesis and Malignant transformation in Oligodendroglioma Lin Qi, Jiamin Jin, Zhenbo Yuan, Hao Wu, Yi Wei, Luping Gao, Yan Gao, and 9 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8533226/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Oligodendrogliomas (OG) are indolent yet inevitably progressive gliomas in which angiogenesis is tightly linked to malignant transformation, but the underlying epigenetic mechanisms remain unclear. By integrating public datasets of primary and malignant transformed OG specimens, patient-derived cell lines and orthotopic xenograft models, we identify angiogenin (ANG) as a key pro-angiogenic driver whose high expression correlates with increased microvessel density, enhanced proliferation and poor overall survival. Promoter methylation analyses reveal that ANG is heavily methylated in low-grade tumors and that hypomethylation of three CpG-rich regions including the prognostic site e.g., cg10850001, associates with increased ANG expression, higher tumor grade and worse outcome. Functional studies show that ANG knockdown suppresses VEGFA and Ki67 expression, reduces endothelial tube formation and intratumoral microvessel density, and significantly prolongs survival in Oligodendroglioma PDOX mice, whereas pharmacologic demethylation with decitabine decreases ANG promoter methylation, upregulates ANG and accelerates malignant phenotypes. Among TET dioxygenases, TET2 is selectively upregulated in malignant oligodendroglioma, directly binds to the ANG promoter, and enhances its activity; TET2 depletion increases ANG promoter methylation, downregulates ANG and pro-angiogenic markers, and impairs angiogenesis, effects that are rescued by ANG re-expression. The cell-permeable itaconate derivative 4-octyl itaconate (OI), a pharmacologic TET2 inhibitor, restores ANG promoter methylation, suppresses TET2–ANG signaling and cooperates with Temozolomide (TMZ) to inhibit tumor growth and extend survival in PDOX models. These findings define a TET2–ANG–angiogenesis axis that drives malignant transformation of oligodendroglioma and highlight itaconate-based epigenetic targeting of TET2 as a promising strategy to improve outcomes in patients with oligodendroglioma. Biological sciences/Cancer/CNS cancer Biological sciences/Genetics/Gene regulation Oligodendroglioma Angiogenin TET2 DNA methylation Malignant transformation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 INTRODUCTION Oligodendrogliomas (OG) are a subtype of WHO grade II low-grade gliomas (LGG) that account for approximately 20% of adult primary brain tumors [ 1 ]. Despite a relatively long median survival exceeding 10 years, most OGs eventually undergo malignant transformation to WHO grade III or IV tumors, which ultimately leads to patient death [ 2 , 3 ]. Although radiotherapy and chemotherapy are effective in some patients, there is no universally accepted, standardized treatment regimen for OG, and the molecular mechanisms underlying malignant progression remain incompletely understood [ 3 , 4 ]. Angiogenesis is a critical hallmark of glioma progression. As early as 1971, Folkman proposed that sustained tumor growth depends on neovascularization [ 5 ]. Increased microvessel density and pro-angiogenic signaling have been repeatedly observed in high-grade gliomas, including malignantly transformed OG [ 6 , 7 ]. We previously demonstrated that ISL2 promotes malignant transformation of OG by transcriptionally activating ANGPT2 and enhancing angiogenesis[ 6 ]. These observations highlight angiogenesis as a central driver of OG progression and a potential therapeutic vulnerability. Angiogenin (ANG) selected by database and OG specimen is a secreted ribonuclease belonging to the RNase A superfamily and is one of the core regulators of angiogenesis, especially in tumors [ 8 – 14 ]. ANG is upregulated in many solid tumors and hematologic malignancies, where it induces endothelial migration, proliferation and tube formation, and can serve as both a prognostic biomarker and a therapeutic target [ 9 – 12 , 15 ]. In gliomas, elevated ANG expression has been associated with higher tumor grade and poor prognosis [ 9 , 12 , 13 ]. However, the role and regulation of ANG in OG and its malignant transformation remain largely unclear. Epigenetic dysregulation, particularly aberrant DNA methylation, is a hallmark of glioma initiation and progression [ 8 , 16 , 17 ]. OGs are characterized by mutations in isocitrate dehydrogenase 1/2 (IDH1/2) and co-deletion of 1p/19q, which together define a distinct epigenetic landscape. Mutant IDH produces the oncometabolite D-2-hydroxyglutarate (D-2HG), which inhibits α-ketoglutarate–dependent dioxygenases, including TET and histone demethylases, thereby inducing widespread DNA and histone hypermethylation[ 17 ]. In OG, this hypermethylator phenotype has been linked to favorable prognosis and treatment sensitivity, in part through silencing of genes involved in proliferation and DNA repair [ 8 , 16 – 18 ]. These observations suggest that dynamic changes in DNA methylation status, particularly demethylation of specific oncogenes, may contribute to malignant transformation. DNA methylation patterns are established and maintained by DNA methyltransferases and can be actively reversed by ten-eleven translocation (TET) dioxygenases [ 15 , 19 , 20 ]. TET proteins, especially TET2, catalyze the oxidation of 5-methylcytosine to 5-hydroxymethylcytosine, thereby promoting DNA demethylation and transcriptional activation. TET2 mutations and dysregulated expression have been implicated in hematologic malignancies and solid tumors[ 15 , 20 ]. Recent work has shown that the endogenous immunometabolite itaconate and its derivatives can directly inhibit TET dioxygenase activity though Blood-Brain Barrier [ 21 , 22 ], opening a therapeutic window for modulating DNA methylation in disease. In the present study, we identify ANG as a key pro-angiogenic gene whose expression is inversely associated with survival in OG patients and positively correlated with angiogenesis and malignant transformation. We demonstrate that TET2 directly binds to and demethylates the ANG promoter, thereby upregulating ANG expression and driving angiogenesis in OG. We further show that pharmacologic inhibition of TET2 with the itaconate derivative 4-octyl itaconate (OI), especially in combination with TMZ, suppresses angiogenesis, delays malignant progression, and prolongs survival in OG PDOX models. These findings uncover a previously unrecognized TET2–ANG–angiogenesis axis in OG and provide a rationale for targeting epigenetic regulation of angiogenesis to improve outcomes in OG patients. MATERIALS AND METHODS Cell lines and culture OG cells were derived from PDOX tumors generated from primary OG patient specimens, as described previously; Malignant OG (M-OG) cells were generated from OG cells by chronic hypoxia exposure as described [ 6 ].Tumor tissues were mechanically dissociated into single cells and cultured in Basal Medium supplemented with growth factors (20 ng/mL EGF, 20 ng/mL β-FGF, and 2 µg/mL heparin sulfate) at 37°C with 5% CO₂. Medium was changed every 3–4 days. EAhy926 endothelial cells was obtained from ATCC and authenticated prior to use. Cells were cultured according to the supplier’s recommendations. Reagents and treatments Decitabine (DNA methyltransferase inhibitor) was used at 0.8 µM for 48 h, followed by culture up to 7 days for methylation analyses. OI was used as a TET2 inhibitor at indicated concentrations and durations, optimized in preliminary experiments (10 mg/kg (5 d on-2 d off) x 2 cycle by gavage in vivo and 500 µM for 2 h in vitro ) based on TET2 expression and methylation changes. Temozolomide (TMZ, 10 mg/kg (5 d on-2 d off) x 2cycle i.p. in vivo and 200µM for 48h in vitro ) was used as a clinically typical anti-OG agent at doses optimized for in vitro and in vivo studies. Quantitative RT–PCR Total RNA was extracted using the DNA/RNA FFPE Kit (Qiagen) and reverse-transcribed using a cDNA Synthesis Kit (Thermo Fisher Scientific) according to the manufacturers’ protocols. Ki67 mRNA expression was quantitated with qPCR (forward primer 5’ AAGATTCCAGCGCCCATTCA 3’ and reverse primer 5’ TGAGGAACGAACACGACTGG 3’), Angiogenin mRNA expression was quantitated with qPCR (forward primer 5’ GCTGTTCTGCCTCCTTCACC 3’ and reverse primer 5’ CAGGGTGTCTCCTTGTACTGC 3’), CD31 mRNA expression was quantitated with qPCR (forward primer 5’ TTGAGACCAGCCTGATGAAACCCT 3’ and reverse primer 5’ TCCGTTTCCTGGGTTCAAGCGATA 3’), VEGFA mRNA expression was quantitated with qPCR (forward primer 5’ AAGGAGGAGGGCAGAATCAT 3’ and reverse primer 5’ ATCTGCATGGTGATGTTGGA 3’), TET2 mRNA expression was quantitated with qPCR (forward primer 5’ ACTCACCCATCGCATACCTC 3’ and reverse primer 5’ TCAGCATCATCAGCATCACA 3’), PTEN mRNA expression was quantitated with qPCR (forward primer 5’ GACTCTGGAATATCCCTGGACA 3’ and reverse primer 5’ AGGTTTGCTGCATCGACATCTG 3’) and normalized to GAPDH (forward primer 5’ CCTGGAGAAACCTGCCAAGT 3’ and reverse primer 5’ GCCAAATTCATTGTCGTACCA 3’) through standard ΔΔCt method as we described previously [ 6 ]. Western blotting Western blotting Protein lysates were prepared using RIPA buffer containing protease and phosphatase inhibitors. Equal amounts of protein were separated by SDS–PAGE, transferred to PVDF membranes and probed with primary antibodies against ANG (Rockland), VEGFA (Abcam Inc.), PTEN (Abcam Inc.), Ki67(1:100, Sigma-Aldrich), TET2 (CST) and GAPDH (APPLYGEN). After incubation with HRP-conjugated secondary antibodies, signals were detected by chemiluminescence. Tube formation assay EAhy926 endothelial cells were seeded on 96-well plates pre-coated with 100 µL Matrigel (Corning, #354234) at 50,000 cells per well. Conditioned media from control or ANG/TET2-manipulated OG cells were added. After 12 h, tube networks were stained with Calcein-AM (1 µM, 30 min; BioLegend, #425201) and imaged using a fluorescence microscope (Nikon Eclipse Ti2E). Tube formation was quantified by counting branch points in randomly selected fields. Methylation-specific PCR (MSP) Genomic DNA was extracted from OG cells and tumor tissues using the QIAamp DNA Mini Kit (Qiagen). Bisulfite conversion was performed with the EpiTect Fast DNA Bisulfite Kit (Qiagen). Methylation-specific and unmethylated primers targeting CpG islands in the ANG promoter were designed. MSP products were analyzed on agarose gels to estimate relative methylated (M) and unmethylated (U) levels. Bisulfite sequencing PCR (BSP) To precisely quantify ANG promoter methylation, bisulfite-converted DNA was amplified with primers spanning CpG island 5 and CpG island 6–7 of the ANG promoter. PCR products were cloned into TA vectors, and 10 clones per sample were sequenced. The methylation status of individual CpG sites was analyzed and correlated with ANG mRNA expression in OG and malignantly transformed OG samples. Luciferase reporter assays Serial deletion constructs of the ANG promoter (from − 2000 to + 199 bp relative to the transcription start site) were cloned into the pGL3-Basic luciferase vector. OG cells were co-transfected with promoter constructs and a Renilla control plasmid, with or without TET2 overexpression. Luciferase activity was measured 24–48 h post-transfection using a dual-luciferase reporter assay system and normalized to Renilla activity. Chromatin immunoprecipitation (ChIP) ChIP was carried out with a Magna Chromatin Immunoprecipitation kit (Millipore, Darmstadt, Germany). Immunoprecipitation was performed with anti-TET2 antibody. The final purified DNA fragment was subjected to PCR analysis using Hot-Start Taq DNA polymerase (TaKaRa, Dalian, China; 32 cycles). The primers used were as follows: sense TCAGCTACAGTGGCTCGTTG, antisense AGAGACTACCCCTGGCTGAG (ANG), sense GGAGCGAGATCCCTCCAAAAT, antisense GGCTGTTGTCATACTTCTCATGG(GAPDH). PCR products were analyzed using gel electrophoresis. CCK-8 cell viability assay Cell viability was assessed using the CCK-8 assay according to the manufacturer’s instructions [ 23 ]. Absorbance at 450 nm was measured after incubation with the tetrazolium reagent, and viability was expressed as a percentage of control. Patient-derived orthotopic xenograft (PDOX) models All animal experiments were approved by the Animal Ethics Committee of Sun Yat-sen University and conducted according to institutional guidelines [ 6 ]. Fresh OG surgical specimens were implanted into the corresponding anatomical location (cerebral hemisphere) of 5–6-week-old BALB/C nude mice using a 10 µL Hamilton syringe. For survival studies and pharmacologic treatments, 1 × 10⁵ tumor cells in 5 µL culture medium were stereotactically injected. Mice were monitored daily and euthanized when neurological symptoms or moribund status occurred. For subcutaneous Matrigel plug assays, a mixture of Matrigel and OG cells was injected subcutaneously into BALB/C nude mice. After 10 days, plugs were harvested for analysis of microvessel density by CD31 immunostaining. Immunohistochemistry (IHC) Paraffin-embedded tissue sections from patient samples and mouse tumors were processed for IHC as previously described[ 6 ]. Sections were incubated with primary antibodies against ANG (1:200, BOSTER), VEGFA (1:100, Abcam Inc.), CD31 (1:200, Abcam Inc.) and Ki67 (1:200, Abcam Inc., Cambridge, USA) at 4°C overnight, followed by polymer detection systems and DAB chromogen. Staining intensity and percentage of positive cells were semi-quantitatively scored, and immunoreactive scores were calculated as intensity × proportion. Bioinformatic analyses Expression and survival associations of ANG and TET2 in LGG/OG were analyzed using TCGA, UCSC Xena, and GEPIA3 databases. Gene set enrichment analysis (GSEA) was applied to evaluate associations between gene expression and angiogenesis signatures. DNA methylation beta values and probes within the ANG promoter region were extracted from TCGA; beta values were converted to M values for Cox regression to identify methylation sites associated with overall survival. A prognostic model and receiver operating characteristic (ROC) analysis were constructed based on the cg10850001 methylation site. Statistical analysis Data are presented as mean ± standard deviation (SD) from at least three independent experiments. Differences between two groups were assessed by Student’s t-test, while multiple-group comparisons were analyzed by one-way ANOVA followed by appropriate post-hoc tests where applicable. Survival curves were generated using the Kaplan–Meier method and compared by log-rank test. P values ≤ 0.05 were considered statistically significant. RESULTS ANG is upregulated in OG, correlates with angiogenesis and poor prognosis, and promotes malignant transformation TCGA analysis identified angiogenesis-related ANG among the top 15 genes most strongly associated with overall survival in OG patients (Table S1 ), with higher ANG expression predicting worse prognosis (Fig. 1 A). ANG mRNA was significantly upregulated in OG tumor tissues compared with normal brain controls (Fig. 1 B). GSEA revealed a significant positive association between ANG expression and angiogenesis-related gene sets in LGG (Fig. 1 C). Consistently, in our clinical OG cohort, IHC and qPCR analyses demonstrated that ANG expression was markedly higher in malignantly transformed OG tissues than in matched primary OG samples, accompanied by increased expression of VEGFA, the endothelial marker CD31, and the proliferation marker Ki67 at both the mRNA and protein levels (Fig. 1 D and E). Stratification of OG tumors by ANG expression further showed that ANG-high tumors exhibited significantly higher VEGFA, CD31 and Ki67 expression than ANG-low tumors (Fig. 1 F and G). Together, these data indicate that ANG is closely associated with angiogenesis, tumor proliferation, and poor prognosis in OG. To directly test the functional role of ANG, we silenced ANG in OG cells and collected conditioned medium to treat EAhy926 endothelial cells. ANG knockdown significantly reduced endothelial tube formation, as measured by Calcein-AM–stained tube length and branch points (Fig. 2 A–C). In OG cells, ANG silencing decreased VEGFA, PTEN and Ki67 expression at both mRNA and protein levels (Fig. 2 D and E), inhibited cell proliferation by CCK-8 assay (Fig. 2 F), and attenuated malignant characteristics. In PDOX models, ANG knockdown in OG cells extended median survival from 98 to 123 days for animals (Fig. 2 G). Matrigel plug assays showed that ANG-deficient OG cells formed plugs with substantially reduced CD31-positive microvessel density compared with controls (Fig. 2 H). In xenograft tumors, IHC confirmed decreased VEGFA and Ki67 expression upon ANG knockdown (Fig. 2 I). These findings establish ANG as a key mediator of angiogenesis and malignant transformation in OG. ANG promoter hypomethylation is associated with OG progression and enhanced angiogenesis TCGA methylation data indicated that higher ANG promoter methylation was associated with longer overall survival in LGG patients (Fig. 3 A). UCSC Xena analysis of ANG promoter beta value distributions showed that the upper quartile (q75) approached 0.8, exceeding the optimal cut-off (maxstat = 0.658), suggesting that ANG is heavily methylated in many low-grade tumors (Fig. 3 B). Notably, ANG promoter methylation significantly decreased from WHO grade II to grade III LGG (Fig. 3 C), consistent with promoter hypomethylation contributing to malignant progression of OG. MSP in 10 paired primary and malignantly transformed OG specimens revealed lower methylation and higher unmethylated ANG promoter levels in malignant OG compared with primary OG tissues. Similar patterns were observed in hypoxia-induced M-OG cells versus parental OG cells (Fig. 3 D). These data indicate an inverse relationship between ANG promoter methylation and OG malignancy. To assess the functional impact of ANG promoter methylation, we treated OG cells with decitabine which is a methylation inhibitor and confirmed decreased ANG promoter methylation by MSP (Fig. 3 E). Decitabine treatment markedly increased ANG, VEGFA and Ki67 expression at mRNA and protein levels and enhanced OG cell proliferation (Fig. 3 F–H). Collectively, these findings suggest that ANG promoter hypomethylation promotes ANG upregulation, angiogenesis and malignant behavior in OG, whereas maintaining high methylation levels may restrain progression. Identification of methylation-sensitive CpG islands and prognostic CpG sites in the ANG promoter To pinpoint methylation-sensitive regions, we first mapped CpG islands in the ANG promoter using MethPrimer tool, identifying 7 CpG islands (Fig. S1 ). Luciferase reporter assays with serial deletion constructs spanning − 1341 to + 197 bp of the promoter revealed that CpG island 5 (− 1383 to − 1494 bp) and CpG island 6–7 (− 1722 to − 2048 bp) conferred the strongest promoter activity and were sensitive to methylation status (Fig. 4 A). BSP analysis of CpG islands 5 and 6–7 in 10 pairs of primary OG and 10 malignant OG samples examined 20 CpG sites (10 per island). Malignant OG tissues consistently exhibited lower methylation levels at these CpG sites than primary OG tissues, especially CpG3 and CpG6 sites of Island 5 and CpG7 and CpG10 sites of Island 6–7 (Fig. 4 B). In a cohort of 10 OG patients, lower methylation at CpG3 and CpG6 sites of Island 5 and CpG7 and CpG10 sites of Island 6–7 significantly correlated with higher ANG mRNA levels (Fig. 4 C). Detailed analysis of CpG3 and CpG6 sites in Island 5 and CpG7 and CpG10 sites in Island 6–7 showed significantly higher methylation in primary OG tissues and cells compared with malignantly transformed counterparts (Fig. 4 D). Using TCGA LGG methylation data, we identified 11 CpG probes within the ANG promoter (Table S2). Cox regression on M values revealed cg10850001, located 425 bp downstream of the transcription start site between CpG island 5 and 6, as a key prognostic site with a hazard ratio of 0.697, indicating that hypomethylation at this site is associated with increased mortality risk (Table S2). High methylation at cg10850001 along with cg02939508, cg19211827 and cg21882356 located at around CpG island 6–7 (Fig. S2A) predicted significantly better survival (Fig. S2B). Although the ROC analysis for survival classification yielded a modest AUC of 0.614 for cg10850001 (Fig. S2C), patients who died had significantly lower DNA methylation at all these 4 CpG sites than long-term survivors (Fig. S2D), supporting its prognostic value. These data collectively validate ANG promoter CpG islands—especially CpG island 5–7—as clinically relevant methylation hotspots in OG. TET2 is upregulated in malignant OG, drives ANG demethylation and expression, and correlates with angiogenesis Given the observed ANG promoter hypomethylation in malignant OG, we next investigated which DNA demethylases regulate ANG. Overexpression of TET1, TET2 or TET3 in OG cells revealed that only TET2 significantly increased ANG mRNA expression (Fig. 5 A), implicating TET2 as the primary demethylase for ANG in OG. Analysis of TCGA cohorts showed significantly higher TET2 expression in LGG tissues compared with normal brain (Fig. 5 B). In our clinical samples, qPCR and Western blotting confirmed that TET2 expression was higher in malignant OG tumors than primary OG (Fig. 5 C and D). Consistently, TET2 expression was significantly increased in M-OG cells relative to parental OG cells (Fig. 5 E and F). Human Protein Atlas data supported a positive association between TET2 expression and glioma grade (Fig. 5 G). To test whether TET2 directly regulates ANG, we cloned the ANG promoter into a luciferase reporter and performed dual-luciferase assays. TET2 overexpression enhanced ANG promoter activity (Fig. 5 H). ChIP assays demonstrated enrichment of TET2 at the ANG promoter region, confirming a direct interaction (Fig. 5 I). Together, these results indicate that TET2 is upregulated during OG malignant transformation and directly activates ANG transcription via promoter binding and demethylation. TET2 promotes angiogenesis and malignant progression through ANG, and can be targeted by OI To establish the functional relationship between TET2 and ANG, we knocked down TET2 in OG cells using shRNA. TET2 silencing significantly reduced ANG, VEGFA and Ki67 expression at both mRNA and protein levels (Fig. 6 A and B). Tube formation assays using conditioned media from TET2-deficient OG cells revealed markedly impaired endothelial tube formation, demonstrating reduced pro-angiogenic capacity (Fig. S3 and Fig. 6 C). GSEA analyses further showed that TET2 expression positively correlated with angiogenesis gene signatures in LGG (Fig. 6 D). MSP analysis indicated that TET2 knockdown increased ANG promoter methylation and decreased unmethylated alleles, mirroring the effects of TET2 inhibition by OI (Fig. S4 and Fig. 6 E). Treatment of OG cells with OI significantly downregulated TET2, ANG, VEGFA and Ki67 expression (Fig. 6 F), confirming that OI effectively blocks the TET2–ANG axis. Importantly, re-expression of ANG in TET2-deficient cells partially rescued VEGFA and Ki67 expression and restored angiogenic activity, demonstrating that TET2 promotes angiogenesis and malignant progression primarily through ANG. Combined TET2 inhibition and TMZ therapy synergistically delay OG progression in vitro and in vivo In LGG cohorts, elevated ANG expression was positively correlated with improved response to temozolomide, whereas low-ANG tumors showed limited benefit, suggesting that ANG may modulate chemosensitivity (Fig. S5). To evaluate the therapeutic potential of targeting the TET2–ANG–angiogenesis axis, we treated OG and malignantly transformed OG cells with OI and TMZ alone or in combination. CCK-8 assays showed that both agents reduced cell viability, with the combination producing the most pronounced inhibitory effect in both OG and M-OG cells (Fig. 7 A). In OG and M-OG PDOX mouse models, administration of OI or TMZ alone significantly prolonged survival compared with vehicle controls, whereas the combination therapy provided the greatest survival benefit (Fig. 7 B). IHC and qPCR analyses of xenograft tumors revealed that OI and TMZ each decreased VEGFA and Ki67 expression, and combined treatment produced the strongest reduction in angiogenesis and proliferative indices (Fig. 7 C and D). These findings suggest that pharmacologic inhibition of TET2 with TMZ therapy complements OI treatment suppresses angiogenesis and malignant progression in OG. DISCUSSION In this study, we identify a previously unrecognized epigenetic mechanism driving angiogenesis and malignant transformation in oligodendroglioma. We show that TET2 is upregulated during OG progression and directly binds to and demethylates the ANG promoter, leading to ANG overexpression, enhanced angiogenesis and accelerated malignant transformation. Importantly, pharmacologic inhibition of TET2 with an itaconate derivative reverses ANG promoter hypomethylation, suppresses ANG expression and angiogenesis, and synergizes with TMZ to prolong survival in PDOX models (Schematic diagram). ANG has long been recognized as a potent angiogenic factor and is upregulated in many cancers[ 9 – 12 , 14 ]. It can induce endothelial cell proliferation, migration and tube formation, and its nuclear translocation promotes rRNA transcription and cell growth [ 8 , 9 , 12 ]. In gliomas, increased ANG expression has been associated with higher grade and poor prognosis [ 9 , 13 , 14 ]. Here, we demonstrate that ANG is also critically involved in OG, where its expression is elevated in malignantly transformed tumors and strongly correlates with VEGFA, CD31 and Ki67 expression. Functional experiments in vitro and in vivo show that ANG knockdown suppresses angiogenesis, reduces tumor proliferation and delays malignant progression, confirming ANG as a central effector of the angiogenic phenotype in OG. Our data also suggest that ANG may influence therapeutic responses. Analysis of GEPIA3 datasets indicated that LGG tumors with high ANG expression show improved response to temozolomide compared with ANG-low tumors, consistent with the concept that highly vascular, proliferative tumors may be more chemosensitive but also more aggressive. This dual role underscores the importance of contextualizing ANG as both a potential biomarker and therapeutic target. Aberrant DNA methylation is a hallmark of glioma biology, particularly in IDH-mutant LGGs [ 8 , 16 – 18 ]. OGs typically exhibit widespread CpG island hypermethylation, which has been associated with favorable prognosis. Our study reveals that, within this hypermethylated context, specific demethylation events at the ANG promoter occur during malignant transformation. We observe that ANG promoter methylation is high in lower-grade tumors and decreases with increasing grade, and that hypomethylation at key CpG islands correlates with elevated ANG expression and poor survival. By integrating MSP, BSP and TCGA methylation data, we map methylation-sensitive regions within the ANG promoter and identify cg10850001 and so on in CpG island 5–7 as a prognostic methylation site. Although the ROC AUC of 0.614 indicates only moderate discrimination, the significant difference in methylation levels between deceased and surviving patients suggests that this site—and, more broadly, ANG promoter methylation—has clinical relevance and may complement existing prognostic markers in OG. The TET family of dioxygenases regulates active DNA demethylation and has been implicated in development, immunity and cancer [ 15 , 20 ]. While TET2 is often mutated and inactivated in hematological malignancies, in our study TET2 is upregulated in OG and further increased in malignantly transformed OG. This pattern suggests a context-dependent oncogenic role for TET2 in IDH-mutant, hypermethylated gliomas, where a global hypermethylated background may sensitize cells to focal demethylation of oncogenic loci such as ANG. We demonstrate that TET2—but not TET1 or TET3—directly drives ANG expression in OG cells. TET2 overexpression activates ANG promoter reporter constructs, and ChIP confirms TET2 binding at the ANG promoter. TET2 knockdown increases ANG promoter methylation and decreases ANG expression, angiogenesis and proliferation, and ANG re-expression rescues these effects. These findings support a model in which TET2 is selectively recruited to the ANG promoter to induce locus-specific demethylation and transcriptional activation, thereby driving angiogenesis and malignant transformation. Itaconate is an endogenous immunometabolite with anti-inflammatory properties that has recently been shown to inhibit TET dioxygenases by competing with α-ketoglutarate [ 15 , 21 ]. The lipophilic derivative OI improves cell permeability and potentially crosses the blood–brain barrier, making it attractive for CNS tumors [ 22 , 24 ]. In our study, OI treatment phenocopies TET2 knockdown by increasing ANG promoter methylation and suppressing ANG, VEGFA and Ki67 expression, as well as inhibiting angiogenesis and proliferation. These data provide functional evidence that pharmacologic TET2 inhibition can re-establish a more “protective” hypermethylated state at oncogenic loci such as ANG. We further demonstrate that combining OI with bevacizumab produces additive or synergistic anti-tumor effects in OG cells and PDOX models. While TMZ is the typical treatment in clinic of OG, OI acts upstream at the epigenetic level to downregulate ANG expression. This dual targeting may reduce compensatory pro-angiogenic signaling and delay resistance, a major limitation of anti-VEGF monotherapy. Our findings therefore support further development of TET2/ANG-targeted epigenetic therapies, alone or in combination with anti-angiogenic agents, to delay malignant transformation and improve outcomes in OG. We demonstrate that TET2-mediated demethylation of the ANG promoter drives angiogenesis and malignant transformation in oligodendroglioma. ANG is upregulated in malignant OG, correlates with poor prognosis and increased angiogenesis, and is functionally required for tumor progression. TET2 is upregulated in malignant OG, binds to the ANG promoter, decreases its methylation, and thereby enhances ANG expression. Pharmacologic inhibition of TET2 with the itaconate derivative OI restores ANG promoter methylation, suppresses ANG and pro-angiogenic signaling, and, particularly when combined with TMZ, effectively delays OG progression in PDOX models. Targeting TET2-dependent epigenetic regulation of angiogenesis thus represents a promising strategy to improve the management of OG patients. Declarations ETHICS APPROVAL AND CONSENT TO PARTICIPATE Tumor specimens were obtained from 20 patients with histologically confirmed Oligodendroglioma treated at Sun Yat-sen University according to international diagnostic criteria. Primary OG tissues and their corresponding malignantly transformed OG tissues were collected when available. Clinicopathologic data were recorded for all patients. The study protocol was approved by the Ethics Committee of Sun Yat-sen University, and all procedures conformed to the Declaration of Helsinki. Written informed consent was obtained from all participants prior to sample collection. CONSENT FOR PUBLICATION The authors consent to publish the paper. COMPETING INTERESTS The authors declare that they have no competing interests. FUNDING This work was supported by the Guangxi Natural Science Foundation of China (2025JJA141321, 2025JJA130466 and 2025GXNSFAA069117), the National Natural Science Foundation of China (3256050029, 32100563 and 82202955), the Guangdong Natural Science Foundation of China (2022A1515012286 and 2025A1515012335), the Shenzhen Science and Technology Innovation Commission (JCYJ20220530145217039). AUTHOR CONTRIBUTIONS L.Q. J. J., and X.-D.Z. contributed to writing original draft, methodology, data curation and Supervision. J. J., Z.Y., H.W. performed methodology and software. L.G. and Y.W. contributed to data curation. Y.G. and X.J. performed the formal analysis. L.Q., J. J., F.X. and S.Z. provided funding acquisition and conceptualization. G.Q., N.Z., J.-C.Z., S.Z. contributed the supervision, conceptualization. Z.Z., B.H. contributed the supervision and methodology. ACKNOWLEDGEMENTS We are grateful to the Core Facilities for Medical Science, School of Medicine, Shenzhen Campus of Sun Yat-sen University, for technical support. We also wish to thank the Research Center of Guilin Medical University for their valuable assistance. DATA AVAILABILITY All data that support the findings of this study are available from the corresponding authors upon reasonable request, without any restrictions. References Coons SW, Johnson PC, Scheithauer BW, Yates AJ, Pearl DK. Improving diagnostic accuracy and interobserver concordance in the classification and grading of primary gliomas. Cancer 1997; 79: 1381–1393. Bready D, Placantonakis DG. Molecular Pathogenesis of Low-Grade Glioma. Neurosurgery clinics of North America 2019; 30: 17–25. Bromberg JE, van den Bent MJ. Oligodendrogliomas: molecular biology and treatment. The oncologist 2009; 14: 155–163. Wang TJC, Mehta MP. Low-Grade Glioma Radiotherapy Treatment and Trials. Neurosurgery clinics of North America 2019; 30: 111–118. Folkman J. Tumor angiogenesis: therapeutic implications. The New England journal of medicine 1971; 285: 1182–1186. Qi L, Wang ZY, Shao XR, Li M, Chen SN, Liu XQ et al . ISL2 modulates angiogenesis through transcriptional regulation of ANGPT2 to promote cell proliferation and malignant transformation in oligodendroglioma. Oncogene 2020; 39: 5964–5978. Guarnaccia L, Navone SE, Trombetta E, Cordiglieri C, Cherubini A, Crisà FM et al . Angiogenesis in human brain tumors: screening of drug response through a patient-specific cell platform for personalized therapy. Scientific reports 2018; 8: 8748. Reyes-Botero G, Dehais C, Idbaih A, Martin-Duverneuil N, Lahutte M, Carpentier C et al . Contrast enhancement in 1p/19q-codeleted anaplastic oligodendrogliomas is associated with 9p loss, genomic instability, and angiogenic gene expression. Neuro-oncology 2014; 16: 662–670. Sampath P, Weaver CE, Sungarian A, Cortez S, Alderson L, Stopa EG. Cerebrospinal fluid (vascular endothelial growth factor) and serologic (recoverin) tumor markers for malignant glioma. Cancer control: journal of the Moffitt Cancer Center 2004; 11: 174–180. Plate KH, Risau W. Angiogenesis in malignant gliomas. Glia 1995; 15: 339–347. Hoang TT, Raines RT. Molecular basis for the autonomous promotion of cell proliferation by angiogenin. Nucleic acids research 2017; 45: 818–831. Hu JL, Luo WJ, Wang H. Angiogenin Upregulation Independently Predicts Unfavorable Overall Survival in Proneural Subtype of Glioblastoma. Technology in cancer research & treatment 2019; 18: 1533033819846636. Rozman A, Silar M, Kosnik M. Angiogenin and vascular endothelial growth factor expression in lungs of lung cancer patients. Radiology and oncology 2012; 46: 354–359. Vanli N, Guo-Fu HU. Mechanism and Function of Angiogenin in Prostate Cancer. Zhongguo sheng wu hua xue yu fen zi sheng wu xue bao = Chinese journal of biochemistry and molecular biology 2015; 31: 1261–1266. Raghu H, Lakka SS, Gondi CS, Mohanam S, Dinh DH, Gujrati M et al . Suppression of uPA and uPAR attenuates angiogenin mediated angiogenesis in endothelial and glioblastoma cell lines. PloS one 2010; 5: e12458. Xia W, Fu W, Cai X, Wang M, Chen H, Xing W et al . Angiogenin promotes U87MG cell proliferation by activating NF-κB signaling pathway and downregulating its binding partner FHL3. PloS one 2015; 10: e0116983. Chen LL, Morcelle C, Cheng ZL, Chen X, Xu Y, Gao Y et al . Itaconate inhibits TET DNA dioxygenases to dampen inflammatory responses. Nature cell biology 2022; 24: 353–363. Jung I, An J, Ko M. Epigenetic Regulators of DNA Cytosine Modification: Promising Targets for Cancer Therapy. Biomedicines 2023; 11. Liu C, Tang H, Hu N, Li T. Methylomics and cancer: the current state of methylation profiling and marker development for clinical care. Cancer cell international 2023; 23: 242. Madala HR, Punganuru SR, Arutla V, Misra S, Thomas TJ, Srivenugopal KS. Beyond Brooding on Oncometabolic Havoc in IDH-Mutant Gliomas and AML: Current and Future Therapeutic Strategies. Cancers 2018; 10. Mazor T, Chesnelong C, Pankov A, Jalbert LE, Hong C, Hayes J et al . Clonal expansion and epigenetic reprogramming following deletion or amplification of mutant IDH1. Proc Natl Acad Sci U S A 2017; 114: 10743–10748. Moure CJ, Diplas BH, Chen LH, Yang R, Pirozzi CJ, Wang Z et al . CRISPR Editing of Mutant IDH1 R132H Induces a CpG Methylation-Low State in Patient-Derived Glioma Models of G-CIMP. Molecular cancer research: MCR 2019; 17: 2042–2050. Dang L, White DW, Gross S, Bennett BD, Bittinger MA, Driggers EM et al . Cancer-associated IDH1 mutations produce 2-hydroxyglutarate. Nature 2009; 462: 739–744. Kim D, Kim Y, Kim Y. Effects of β-carotene on Expression of Selected MicroRNAs, Histone Acetylation, and DNA Methylation in Colon Cancer Stem Cells. Journal of cancer prevention 2019; 24: 224–232. Additional Declarations There is NO conflict of interest to disclose. Supplementary Files SupplementaryTableandfigures.docx Supplementary 2 Tables and 5 Figures Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: revise 06 Feb, 2026 Review # 2 received at journal 04 Feb, 2026 Review # 1 received at journal 27 Jan, 2026 Reviewer # 2 agreed at journal 23 Jan, 2026 Reviewer # 1 agreed at journal 22 Jan, 2026 Reviewers invited by journal 18 Jan, 2026 Submission checks completed at journal 09 Jan, 2026 Editor assigned by journal 06 Jan, 2026 First submitted to journal 06 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8533226","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":576461428,"identity":"cfa5d956-dabd-45ea-b76e-608167a5c7d0","order_by":0,"name":"Lin Qi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwElEQVRIiWNgGAWjYDACZuaGAwwVDDJgDg9xWhiBWs5AFROnhYGxgYGxjRQtfMcZGw8Xzqvl0Z2RwPjgbRuDvDkhLZKHGRsOz9x2nMfsRgKz4dw2BsOdDQS0GIC08G47BtLCJs3bxpBgcIAoLXPAWth/k6CloQZsCzNRWsB+4Tl2gMfszMNmyTnnJAw3ENLCd/7w4c88NXVyZseTD354U2YjT9AWBoiCwwzgCGJgkCCkHq6ljgiVo2AUjIJRMGIBAGAsQfxtxO4sAAAAAElFTkSuQmCC","orcid":"","institution":"Guilin Medical University","correspondingAuthor":true,"prefix":"","firstName":"Lin","middleName":"","lastName":"Qi","suffix":""},{"id":576461429,"identity":"60166b87-74fc-4a93-a5a7-8c3380249b71","order_by":1,"name":"Jiamin Jin","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Jiamin","middleName":"","lastName":"Jin","suffix":""},{"id":576461430,"identity":"c2b38e2b-98ab-47d9-ac57-c54a0907a5a1","order_by":2,"name":"Zhenbo Yuan","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Zhenbo","middleName":"","lastName":"Yuan","suffix":""},{"id":576461431,"identity":"c997007c-c264-4603-a9e0-9fc5aba56dcb","order_by":3,"name":"Hao Wu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Hao","middleName":"","lastName":"Wu","suffix":""},{"id":576461432,"identity":"9c20c8d3-f78e-4f84-8185-002abfede6ef","order_by":4,"name":"Yi Wei","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Wei","suffix":""},{"id":576461433,"identity":"544b9a96-b3a7-435d-a5e7-c27ba6e9c1bf","order_by":5,"name":"Luping Gao","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Luping","middleName":"","lastName":"Gao","suffix":""},{"id":576461434,"identity":"42a45b92-2df6-45d3-b995-3377393fee96","order_by":6,"name":"Yan Gao","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Gao","suffix":""},{"id":576461435,"identity":"16374742-3689-4508-8aa4-dcb202dec370","order_by":7,"name":"Xixiu Jiang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Xixiu","middleName":"","lastName":"Jiang","suffix":""},{"id":576461436,"identity":"78194d2e-b6fa-4cd6-9544-04d3d9361073","order_by":8,"name":"Zhiguo Zhu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Zhiguo","middleName":"","lastName":"Zhu","suffix":""},{"id":576461437,"identity":"d592ef02-e1a9-4122-8335-44899462ece0","order_by":9,"name":"Bo He","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"He","suffix":""},{"id":576461438,"identity":"9fa23016-f742-42f5-a9a9-387f63b6d69a","order_by":10,"name":"Shouhong Zhou","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Shouhong","middleName":"","lastName":"Zhou","suffix":""},{"id":576461439,"identity":"5adbe547-4dd6-4daf-a4f0-2efbc8c57b03","order_by":11,"name":"Fei Xu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Fei","middleName":"","lastName":"Xu","suffix":""},{"id":576461440,"identity":"2e596abe-c987-4b1d-95c5-ae41b690ca63","order_by":12,"name":"Jin-Cheng Zeng","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Jin-Cheng","middleName":"","lastName":"Zeng","suffix":""},{"id":576461441,"identity":"90d70776-cc5d-47f9-8e2a-3775ba94f6ae","order_by":13,"name":"XINGDING ZHANG","email":"","orcid":"https://orcid.org/0000-0002-2759-5185","institution":"the School of Medicine of Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"XINGDING","middleName":"","lastName":"ZHANG","suffix":""},{"id":576461442,"identity":"3e8736e4-027e-4887-82bd-06e46dd860fd","order_by":14,"name":"Guangying Qi","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Guangying","middleName":"","lastName":"Qi","suffix":""},{"id":576461443,"identity":"3dfe7877-83a2-4f38-ba48-69c690ce8cb2","order_by":15,"name":"Ningxia Zhu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Ningxia","middleName":"","lastName":"Zhu","suffix":""}],"badges":[],"createdAt":"2026-01-06 16:05:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8533226/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8533226/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":100855739,"identity":"f471bec9-9993-4575-9913-00f5385f2525","added_by":"auto","created_at":"2026-01-22 06:56:56","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5034124,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/25ef6ce68906276ad9cab070.tif"},{"id":100855351,"identity":"5a2bf5bc-aece-402d-bc75-d9b3b55c1946","added_by":"auto","created_at":"2026-01-22 06:55:54","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1942774,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/e14770b9bd6ceb24bd55e660.tif"},{"id":100855333,"identity":"0e2a348d-91f6-4106-9eb7-6ffc02867ecb","added_by":"auto","created_at":"2026-01-22 06:55:44","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":129935,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript1626Oncongeneforsubmission.docx","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/7b0e160fa1315eefe58ce6f7.docx"},{"id":100855311,"identity":"df7f8429-326b-4b7b-8216-c6372626af48","added_by":"auto","created_at":"2026-01-22 06:55:41","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":679538,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.tif","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/ab4aff6e2fe4134a99220b82.tif"},{"id":101202435,"identity":"6fc2e431-e194-4b15-be15-b44ee822eec3","added_by":"auto","created_at":"2026-01-27 09:33:09","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":831254,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.tif","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/f5db0f40f73bb91112de4f8f.tif"},{"id":100855613,"identity":"dda7a60b-c194-49b6-8362-ade83669e155","added_by":"auto","created_at":"2026-01-22 06:56:32","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":953000,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/07cd53a5805b671048b473b3.tif"},{"id":100855721,"identity":"874b076e-7617-4a80-ac2f-04652d9a6d17","added_by":"auto","created_at":"2026-01-22 06:56:53","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":885354,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.tif","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/ccb9a23dbc6b61860e002fe5.tif"},{"id":100855342,"identity":"7e902cd7-8882-4e05-be12-9157b675e353","added_by":"auto","created_at":"2026-01-22 06:55:46","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3615778,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.tif","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/4eb45b7ffdb612824e16ee5e.tif"},{"id":100855307,"identity":"1b841c72-cdf3-4357-970b-cff83d1fd065","added_by":"auto","created_at":"2026-01-22 06:55:39","extension":"json","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15307,"visible":true,"origin":"","legend":"","description":"","filename":"ONC202600050.json","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/a29465591835dfad259928df.json"},{"id":100855667,"identity":"35ee57a6-675c-4970-9c2a-6b4872ed9a34","added_by":"auto","created_at":"2026-01-22 06:56:45","extension":"docx","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1958960,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTableandfigures.docx","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/8c259e7b030efcb1a99ad966.docx"},{"id":100855948,"identity":"9e3985cd-18a0-4030-ad7e-182d4f551828","added_by":"auto","created_at":"2026-01-22 06:57:25","extension":"xml","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":98156,"visible":true,"origin":"","legend":"","description":"","filename":"ONC2026000500enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/655081f3463d966d5f0883ef.xml"},{"id":100855340,"identity":"02926fae-9536-4165-a68d-2c118841a7f6","added_by":"auto","created_at":"2026-01-22 06:55:46","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5034124,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/58d545d2c495ece424516104.tif"},{"id":100855364,"identity":"6e1ddf7b-7267-4819-9453-c68a8fd1fce4","added_by":"auto","created_at":"2026-01-22 06:55:57","extension":"tif","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1942774,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/e0d751a123bb413648a02333.tif"},{"id":100855332,"identity":"d9fffd75-c6e8-4a62-a4a2-09103d5c80ab","added_by":"auto","created_at":"2026-01-22 06:55:44","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":679538,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.tif","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/9e1492d2abb75152b86ade66.tif"},{"id":100855361,"identity":"4bb9813b-2668-46c3-b201-0515b6ae5d8b","added_by":"auto","created_at":"2026-01-22 06:55:56","extension":"tif","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":831254,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.tif","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/6246eb80e4f0ca9a07e83046.tif"},{"id":100855535,"identity":"6520c354-9ff1-4f2e-97f1-e24f0554ec2b","added_by":"auto","created_at":"2026-01-22 06:56:25","extension":"tif","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":953000,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/c0cb8d01bf193e71e52a0028.tif"},{"id":100855442,"identity":"15e245b6-2c74-4ae8-9a6c-02821f367cfe","added_by":"auto","created_at":"2026-01-22 06:56:13","extension":"tif","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":885354,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.tif","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/3c197d69f5c54925624025e9.tif"},{"id":100855534,"identity":"8dfe912c-07fd-44a2-a891-777ea145dc19","added_by":"auto","created_at":"2026-01-22 06:56:25","extension":"tif","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3615778,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.tif","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/1a1370078214e51dac27bc5d.tif"},{"id":100855328,"identity":"293d8ba3-c652-43b7-b0ee-6b17a253bfb2","added_by":"auto","created_at":"2026-01-22 06:55:42","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":726823,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/6afdd5c3ead47aeddcdb2887.png"},{"id":100855518,"identity":"fc7cf00f-03e2-42bb-b740-f9d8dd11f2df","added_by":"auto","created_at":"2026-01-22 06:56:21","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":274089,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/0a9c5c724d6381e7b5f97073.png"},{"id":100855354,"identity":"8add13dd-d612-4ff9-aa3a-41786c0f514d","added_by":"auto","created_at":"2026-01-22 06:55:55","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":85681,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/ce1bc13aed2bc249aa6d2a41.png"},{"id":100855814,"identity":"821303fd-ffdf-43e3-b793-574f56caae95","added_by":"auto","created_at":"2026-01-22 06:57:08","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":161774,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/1acf0a84577b632fa2c64162.png"},{"id":100855306,"identity":"ca33f657-5b88-49d9-855b-b66e302dfff1","added_by":"auto","created_at":"2026-01-22 06:55:38","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":126602,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/2fdd2917d18a765d507cc745.png"},{"id":100855305,"identity":"0ec0b0fd-1184-4be2-a11f-0692871fd187","added_by":"auto","created_at":"2026-01-22 06:55:38","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":116855,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/ebd86535da0f134d4ff23fa0.png"},{"id":100855447,"identity":"01c60c6c-225b-4040-b7b5-e2d02404e472","added_by":"auto","created_at":"2026-01-22 06:56:15","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":562915,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure7.png","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/5a33474b7f0182aee25f37d8.png"},{"id":100855357,"identity":"784a803b-ca05-46f4-a5c7-d152ec186250","added_by":"auto","created_at":"2026-01-22 06:55:55","extension":"xml","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":96089,"visible":true,"origin":"","legend":"","description":"","filename":"ONC2026000500structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/a2e00a962af14322ff289cd2.xml"},{"id":100855446,"identity":"162b6fe4-850e-4a99-be54-5022852a0f06","added_by":"auto","created_at":"2026-01-22 06:56:15","extension":"html","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":110043,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/3182afb890f928db26ecd7b8.html"},{"id":100855584,"identity":"a077ff0f-15dc-46f3-b95f-e0da640d0618","added_by":"auto","created_at":"2026-01-22 06:56:27","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":20094518,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCorrelation of ANG with angiogenesis, patient survival, and malignant progression in OG based on database analyses and OG patient samples. \u003c/strong\u003e(A–B) TCGA analyses of ANG expression levels and overall survival differences between OG patients and normal controls. (C) Gene set enrichment analysis (GSEA) evaluating the association between ANG expression and angiogenesis-related gene sets in OG patients. (D–E) IHC staining and qPCR analyses comparing the protein and mRNA expression of ANG, the malignancy-associated marker Ki67, and angiogenesis markers (VEGFA and CD31) between OG and malignant OG. (F–G) IHC staining and qPCR analyses assessing the relationship between high versus low ANG expression and the protein and mRNA levels of angiogenesis- and malignant progression–related markers in OG. p\u0026lt;0.01. 20×.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/122f716e8893af2b164d2240.png"},{"id":100855336,"identity":"80a853f2-dd82-4b35-924e-5fa613fab937","added_by":"auto","created_at":"2026-01-22 06:55:44","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":7115093,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eIn vitro\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e in vivo \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003evalidation of the association among ANG, angiogenesis, and malignant progression of OG. \u003c/strong\u003e(A–C) Tube formation assays with Calcein-AM fluorescence staining to assess and quantify the impact of ANG knockout on the tube-forming capacity of EA.hy926 endothelial cells. (D–E) Western blotting and qPCR analyses to validate changes in the expression of angiogenesis- and malignancy-associated genes in OG cells after ANG knockout. (F) CCK-8 assay to evaluate the effect of ANG knockdown on OG cell proliferation. (G) Establishment of a patient-derived orthotopic xenograft (PDOX) model using OG cells with ANG knockdown, followed by analysis of survival differences between the knockdown and control groups. (H) Subcutaneous implantation of Matrigel plugs containing a mixture of Matrigel and OG cells into BALB/c nude mice; microvessel density in each group was quantified 10 days later based on CD31 staining. (I) IHC staining to determine the effects of ANG knockdown on VEGFA and Ki67 expression in tumors from PDOX mice. p\u0026lt;0.01. 20×.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/0b2f2d778c015514ff38fed2.png"},{"id":100855524,"identity":"db7132c0-3bdb-4bfe-9973-2ef97f199828","added_by":"auto","created_at":"2026-01-22 06:56:22","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1931772,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eValidation of the relationship between ANG promoter methylation and malignant progression of OG.\u003c/strong\u003e (A) TCGA analysis of the association between ANG promoter methylation levels and patient survival. (B–C) UCSC analysis of methylation status within the ANG promoter region and its relationship with tumor malignant progression. (D) The methylated (M) and unmethylated (U) status of the ANG promoter in ten paired OG patient samples and OG cells was assessed by MSP-PCR.\u003cbr\u003e\n(E) OG cells were treated with the DNA demethylating agent decitabine (0.8 μM, 48 h). After 7 days of culture, changes in promoter methylation were evaluated by MSP-PCR.\u003cbr\u003e\n(F–G) Western blotting and qPCR analyses of ANG, Ki67, and VEGF protein and mRNA expression in control and decitabine-treated OG cells. (H) CCK-8 assay to assess changes in OG cell proliferation following decitabine treatment.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/2adc159eecc0aa1709537c71.png"},{"id":100855486,"identity":"ec7bcd1c-e4cb-43fd-a0d2-e0a0e3a18783","added_by":"auto","created_at":"2026-01-22 06:56:19","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2484742,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIdentification of ANG methylation sites in OG patient samples and at the cellular level.\u003c/strong\u003e(A) A series of deletion mutants spanning +199 to −2000 were generated. Each deletion construct was individually transfected into OG cells together with the empty vector or pGL3-Basic, and promoter activity was subsequently measured. (B) Methylation of multiple CpG sites on CpGs in the upstream promoter region of ANG was tested in malignant OG cells and OG cells by BSP methylation analysis. (C) The correlation between the methylation rates at CpG 5 and 6-7 and the ANG mRNA expression was determined in the 20 OG patient samples and OG cells. (D) DNA methylation level of 2 CpG sites in the promoter of ANG in 20 OG patient samples and OG cells was determined by BSP compared with relative malignant groups.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/03462c6023525822b256801d.png"},{"id":100855674,"identity":"8f9c746a-0fc4-4469-a82f-4a4136f4671f","added_by":"auto","created_at":"2026-01-22 06:56:48","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3023950,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTET2 expression is associated with ANG expression and malignant progression of OG. \u003c/strong\u003e(A) qPCR analysis of ANG mRNA levels following overexpression of the DNA demethylases TET1, TET2, and TET3. (B) TCGA analysis of differential TET2 expression between OG tumors and normal tissues. (C–D) qPCR and Western blot analyses comparing TET2 expression in primary OG tumor tissues and malignant tumor tissues. (E–F) qPCR and Western blot analyses comparing TET2 expression in primary OG cells and malignant tumor cells. (G) Human Protein Atlas (HPA)-based analysis of the association between ANG expression in glioma and tumor malignancy grade. (H–I) Construction of a pGL3-promoter luciferase reporter containing the ANG promoter regulatory sequence; dual-luciferase reporter assays and ChIP assays were performed to examine the interaction between TET2 and the ANG promoter. p\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/81b4c464daa18bc8929c8fb6.png"},{"id":100855326,"identity":"3687a151-9468-40a7-9cb9-949bd5f1f273","added_by":"auto","created_at":"2026-01-22 06:55:42","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2809317,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTET2 promotes ANG expression and contributes to malignant progression of OG by regulating ANG promoter demethylation. \u003c/strong\u003e(A–B) qPCR and Western blot analyses of changes in ANG, VEGFA, and Ki67 expression in OG cells following TET2 knockdown. (C) EA.hy926 endothelial cell assays to assess and quantify changes in angiogenic capacity after TET2 knockout. (D) GSEA analysis of the correlation between TET2 expression and enrichment of angiogenesis-related genes. (E–F) OG cells were subjected to TET2 knockout and/or treated with a TET2 inhibitor (OI; 500 μM for 2 h). MSP assays were used to assess ANG methylation levels, and Western blotting was performed to examine the expression of TET2, ANG, VEGFA, and Ki67. p\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/d6ccbc6b4352fb9e295483ec.png"},{"id":100859342,"identity":"8897e518-d4f0-4f9f-bb1b-383c3bbb1c55","added_by":"auto","created_at":"2026-01-22 07:26:57","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":14170385,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eIn vitro\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e validation of the therapeutic effects of inhibitors targeting the TET2–ANG–angiogenesis axis.\u003c/strong\u003e(A) CCK-8 assays assessing the effects of combined treatment with the TET2 inhibitor OI and temozolomide (TMZ) on the viability of OG and malignant cells. (B) OG/malignant PDOX mice were treated with TMZ and/or OI, and changes in survival were evaluated. (C–D) IHC staining and qPCR analyses of VEGFA and Ki67 protein and mRNA levels in tumors from each treatment group. \u003cstrong\u003ep\u003c/strong\u003e\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/04d33ff8383dc8c29e74d0b5.png"},{"id":101207498,"identity":"fd1b2932-55c2-4254-94c5-f01cc82d4a5d","added_by":"auto","created_at":"2026-01-27 10:05:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":50824218,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/3c5a21c3-8f19-499a-b499-0c9701832ff8.pdf"},{"id":100855346,"identity":"63d8e6ef-437d-4e05-b24e-c920b749c3ca","added_by":"auto","created_at":"2026-01-22 06:55:47","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1958960,"visible":true,"origin":"","legend":"Supplementary 2 Tables and 5 Figures","description":"","filename":"SupplementaryTableandfigures.docx","url":"https://assets-eu.researchsquare.com/files/rs-8533226/v1/c9b504285c27b1c1646f7bd7.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.","formattedTitle":"TET2-Driven Demethylation of ANG promotes Angiogenesis and Malignant transformation in Oligodendroglioma","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eOligodendrogliomas (OG) are a subtype of WHO grade II low-grade gliomas (LGG) that account for approximately 20% of adult primary brain tumors [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Despite a relatively long median survival exceeding 10 years, most OGs eventually undergo malignant transformation to WHO grade III or IV tumors, which ultimately leads to patient death [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Although radiotherapy and chemotherapy are effective in some patients, there is no universally accepted, standardized treatment regimen for OG, and the molecular mechanisms underlying malignant progression remain incompletely understood [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAngiogenesis is a critical hallmark of glioma progression. As early as 1971, Folkman proposed that sustained tumor growth depends on neovascularization [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Increased microvessel density and pro-angiogenic signaling have been repeatedly observed in high-grade gliomas, including malignantly transformed OG [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. We previously demonstrated that ISL2 promotes malignant transformation of OG by transcriptionally activating ANGPT2 and enhancing angiogenesis[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. These observations highlight angiogenesis as a central driver of OG progression and a potential therapeutic vulnerability. Angiogenin (ANG) selected by database and OG specimen is a secreted ribonuclease belonging to the RNase A superfamily and is one of the core regulators of angiogenesis, especially in tumors [\u003cspan additionalcitationids=\"CR9 CR10 CR11 CR12 CR13\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. ANG is upregulated in many solid tumors and hematologic malignancies, where it induces endothelial migration, proliferation and tube formation, and can serve as both a prognostic biomarker and a therapeutic target [\u003cspan additionalcitationids=\"CR10 CR11\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In gliomas, elevated ANG expression has been associated with higher tumor grade and poor prognosis [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. However, the role and regulation of ANG in OG and its malignant transformation remain largely unclear.\u003c/p\u003e \u003cp\u003eEpigenetic dysregulation, particularly aberrant DNA methylation, is a hallmark of glioma initiation and progression [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. OGs are characterized by mutations in isocitrate dehydrogenase 1/2 (IDH1/2) and co-deletion of 1p/19q, which together define a distinct epigenetic landscape. Mutant IDH produces the oncometabolite D-2-hydroxyglutarate (D-2HG), which inhibits α-ketoglutarate\u0026ndash;dependent dioxygenases, including TET and histone demethylases, thereby inducing widespread DNA and histone hypermethylation[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. In OG, this hypermethylator phenotype has been linked to favorable prognosis and treatment sensitivity, in part through silencing of genes involved in proliferation and DNA repair [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. These observations suggest that dynamic changes in DNA methylation status, particularly demethylation of specific oncogenes, may contribute to malignant transformation. DNA methylation patterns are established and maintained by DNA methyltransferases and can be actively reversed by ten-eleven translocation (TET) dioxygenases [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. TET proteins, especially TET2, catalyze the oxidation of 5-methylcytosine to 5-hydroxymethylcytosine, thereby promoting DNA demethylation and transcriptional activation. TET2 mutations and dysregulated expression have been implicated in hematologic malignancies and solid tumors[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Recent work has shown that the endogenous immunometabolite itaconate and its derivatives can directly inhibit TET dioxygenase activity though Blood-Brain Barrier [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], opening a therapeutic window for modulating DNA methylation in disease.\u003c/p\u003e \u003cp\u003eIn the present study, we identify ANG as a key pro-angiogenic gene whose expression is inversely associated with survival in OG patients and positively correlated with angiogenesis and malignant transformation. We demonstrate that TET2 directly binds to and demethylates the ANG promoter, thereby upregulating ANG expression and driving angiogenesis in OG. We further show that pharmacologic inhibition of TET2 with the itaconate derivative 4-octyl itaconate (OI), especially in combination with TMZ, suppresses angiogenesis, delays malignant progression, and prolongs survival in OG PDOX models. These findings uncover a previously unrecognized TET2\u0026ndash;ANG\u0026ndash;angiogenesis axis in OG and provide a rationale for targeting epigenetic regulation of angiogenesis to improve outcomes in OG patients.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell lines and culture\u003c/h2\u003e \u003cp\u003eOG cells were derived from PDOX tumors generated from primary OG patient specimens, as described previously; Malignant OG (M-OG) cells were generated from OG cells by chronic hypoxia exposure as described [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].Tumor tissues were mechanically dissociated into single cells and cultured in Basal Medium supplemented with growth factors (20 ng/mL EGF, 20 ng/mL β-FGF, and 2 \u0026micro;g/mL heparin sulfate) at 37\u0026deg;C with 5% CO₂. Medium was changed every 3\u0026ndash;4 days. EAhy926 endothelial cells was obtained from ATCC and authenticated prior to use. Cells were cultured according to the supplier\u0026rsquo;s recommendations.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eReagents and treatments\u003c/h3\u003e\n\u003cp\u003eDecitabine (DNA methyltransferase inhibitor) was used at 0.8 \u0026micro;M for 48 h, followed by culture up to 7 days for methylation analyses. OI was used as a TET2 inhibitor at indicated concentrations and durations, optimized in preliminary experiments (10 mg/kg (5 d on-2 d off) x 2 cycle by gavage \u003cem\u003ein vivo\u003c/em\u003e and 500 \u0026micro;M for 2 h \u003cem\u003ein vitro\u003c/em\u003e) based on TET2 expression and methylation changes. Temozolomide (TMZ, 10 mg/kg (5 d on-2 d off) x 2cycle i.p. \u003cem\u003ein vivo\u003c/em\u003e and 200\u0026micro;M for 48h \u003cem\u003ein vitro\u003c/em\u003e) was used as a clinically typical anti-OG agent at doses optimized for \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e studies.\u003c/p\u003e\n\u003ch3\u003eQuantitative RT–PCR\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted using the DNA/RNA FFPE Kit (Qiagen) and reverse-transcribed using a cDNA Synthesis Kit (Thermo Fisher Scientific) according to the manufacturers\u0026rsquo; protocols. Ki67 mRNA expression was quantitated with qPCR (forward primer 5\u0026rsquo; AAGATTCCAGCGCCCATTCA 3\u0026rsquo; and reverse primer 5\u0026rsquo; TGAGGAACGAACACGACTGG 3\u0026rsquo;), Angiogenin mRNA expression was quantitated with qPCR (forward primer 5\u0026rsquo; GCTGTTCTGCCTCCTTCACC 3\u0026rsquo; and reverse primer 5\u0026rsquo; CAGGGTGTCTCCTTGTACTGC 3\u0026rsquo;), CD31 mRNA expression was quantitated with qPCR (forward primer 5\u0026rsquo; TTGAGACCAGCCTGATGAAACCCT 3\u0026rsquo; and reverse primer 5\u0026rsquo; TCCGTTTCCTGGGTTCAAGCGATA 3\u0026rsquo;), VEGFA mRNA expression was quantitated with qPCR (forward primer 5\u0026rsquo; AAGGAGGAGGGCAGAATCAT 3\u0026rsquo; and reverse primer 5\u0026rsquo; ATCTGCATGGTGATGTTGGA 3\u0026rsquo;), TET2 mRNA expression was quantitated with qPCR (forward primer 5\u0026rsquo; ACTCACCCATCGCATACCTC 3\u0026rsquo; and reverse primer 5\u0026rsquo; TCAGCATCATCAGCATCACA 3\u0026rsquo;), PTEN mRNA expression was quantitated with qPCR (forward primer 5\u0026rsquo; GACTCTGGAATATCCCTGGACA 3\u0026rsquo; and reverse primer 5\u0026rsquo; AGGTTTGCTGCATCGACATCTG 3\u0026rsquo;) and normalized to GAPDH (forward primer 5\u0026rsquo; CCTGGAGAAACCTGCCAAGT 3\u0026rsquo; and reverse primer 5\u0026rsquo; GCCAAATTCATTGTCGTACCA 3\u0026rsquo;) through standard ΔΔCt method as we described previously [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eWestern blotting\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eWestern blotting\u003c/div\u003e \u003cp\u003eProtein lysates were prepared using RIPA buffer containing protease and phosphatase inhibitors. Equal amounts of protein were separated by SDS\u0026ndash;PAGE, transferred to PVDF membranes and probed with primary antibodies against ANG (Rockland), VEGFA (Abcam Inc.), PTEN (Abcam Inc.), Ki67(1:100, Sigma-Aldrich), TET2 (CST) and GAPDH (APPLYGEN). After incubation with HRP-conjugated secondary antibodies, signals were detected by chemiluminescence.\u003c/p\u003e\n\u003ch3\u003eTube formation assay\u003c/h3\u003e\n\u003cp\u003eEAhy926 endothelial cells were seeded on 96-well plates pre-coated with 100 \u0026micro;L Matrigel (Corning, #354234) at 50,000 cells per well. Conditioned media from control or ANG/TET2-manipulated OG cells were added. After 12 h, tube networks were stained with Calcein-AM (1 \u0026micro;M, 30 min; BioLegend, #425201) and imaged using a fluorescence microscope (Nikon Eclipse Ti2E). Tube formation was quantified by counting branch points in randomly selected fields.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eMethylation-specific PCR (MSP)\u003c/h2\u003e \u003cp\u003eGenomic DNA was extracted from OG cells and tumor tissues using the QIAamp DNA Mini Kit (Qiagen). Bisulfite conversion was performed with the EpiTect Fast DNA Bisulfite Kit (Qiagen). Methylation-specific and unmethylated primers targeting CpG islands in the ANG promoter were designed. MSP products were analyzed on agarose gels to estimate relative methylated (M) and unmethylated (U) levels.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eBisulfite sequencing PCR (BSP)\u003c/h3\u003e\n\u003cp\u003eTo precisely quantify ANG promoter methylation, bisulfite-converted DNA was amplified with primers spanning CpG island 5 and CpG island 6\u0026ndash;7 of the ANG promoter. PCR products were cloned into TA vectors, and 10 clones per sample were sequenced. The methylation status of individual CpG sites was analyzed and correlated with ANG mRNA expression in OG and malignantly transformed OG samples.\u003c/p\u003e\n\u003ch3\u003eLuciferase reporter assays\u003c/h3\u003e\n\u003cp\u003eSerial deletion constructs of the ANG promoter (from \u0026minus;\u0026thinsp;2000 to +\u0026thinsp;199 bp relative to the transcription start site) were cloned into the pGL3-Basic luciferase vector. OG cells were co-transfected with promoter constructs and a Renilla control plasmid, with or without TET2 overexpression. Luciferase activity was measured 24\u0026ndash;48 h post-transfection using a dual-luciferase reporter assay system and normalized to Renilla activity.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eChromatin immunoprecipitation (ChIP)\u003c/h2\u003e \u003cp\u003eChIP was carried out with a Magna Chromatin Immunoprecipitation kit (Millipore, Darmstadt, Germany). Immunoprecipitation was performed with anti-TET2 antibody. The final purified DNA fragment was subjected to PCR analysis using Hot-Start Taq DNA polymerase (TaKaRa, Dalian, China; 32 cycles). The primers used were as follows: sense TCAGCTACAGTGGCTCGTTG, antisense AGAGACTACCCCTGGCTGAG (ANG), sense GGAGCGAGATCCCTCCAAAAT, antisense GGCTGTTGTCATACTTCTCATGG(GAPDH). PCR products were analyzed using gel electrophoresis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eCCK-8 cell viability assay\u003c/h2\u003e \u003cp\u003eCell viability was assessed using the CCK-8 assay according to the manufacturer\u0026rsquo;s instructions [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Absorbance at 450 nm was measured after incubation with the tetrazolium reagent, and viability was expressed as a percentage of control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePatient-derived orthotopic xenograft (PDOX) models\u003c/h2\u003e \u003cp\u003eAll animal experiments were approved by the Animal Ethics Committee of Sun Yat-sen University and conducted according to institutional guidelines [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Fresh OG surgical specimens were implanted into the corresponding anatomical location (cerebral hemisphere) of 5\u0026ndash;6-week-old BALB/C nude mice using a 10 \u0026micro;L Hamilton syringe. For survival studies and pharmacologic treatments, 1 \u0026times; 10⁵ tumor cells in 5 \u0026micro;L culture medium were stereotactically injected. Mice were monitored daily and euthanized when neurological symptoms or moribund status occurred. For subcutaneous Matrigel plug assays, a mixture of Matrigel and OG cells was injected subcutaneously into BALB/C nude mice. After 10 days, plugs were harvested for analysis of microvessel density by CD31 immunostaining.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry (IHC)\u003c/h2\u003e \u003cp\u003eParaffin-embedded tissue sections from patient samples and mouse tumors were processed for IHC as previously described[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Sections were incubated with primary antibodies against ANG (1:200, BOSTER), VEGFA (1:100, Abcam Inc.), CD31 (1:200, Abcam Inc.) and Ki67 (1:200, Abcam Inc., Cambridge, USA) at 4\u0026deg;C overnight, followed by polymer detection systems and DAB chromogen. Staining intensity and percentage of positive cells were semi-quantitatively scored, and immunoreactive scores were calculated as intensity \u0026times; proportion.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatic analyses\u003c/h2\u003e \u003cp\u003eExpression and survival associations of ANG and TET2 in LGG/OG were analyzed using TCGA, UCSC Xena, and GEPIA3 databases. Gene set enrichment analysis (GSEA) was applied to evaluate associations between gene expression and angiogenesis signatures. DNA methylation beta values and probes within the ANG promoter region were extracted from TCGA; beta values were converted to M values for Cox regression to identify methylation sites associated with overall survival. A prognostic model and receiver operating characteristic (ROC) analysis were constructed based on the cg10850001 methylation site.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) from at least three independent experiments. Differences between two groups were assessed by Student\u0026rsquo;s t-test, while multiple-group comparisons were analyzed by one-way ANOVA followed by appropriate post-hoc tests where applicable. Survival curves were generated using the Kaplan\u0026ndash;Meier method and compared by log-rank test. P values\u0026thinsp;\u0026le;\u0026thinsp;0.05 were considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eANG is upregulated in OG, correlates with angiogenesis and poor prognosis, and promotes malignant transformation\u003c/h2\u003e \u003cp\u003eTCGA analysis identified angiogenesis-related ANG among the top 15 genes most strongly associated with overall survival in OG patients (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e), with higher ANG expression predicting worse prognosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). ANG mRNA was significantly upregulated in OG tumor tissues compared with normal brain controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). GSEA revealed a significant positive association between ANG expression and angiogenesis-related gene sets in LGG (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Consistently, in our clinical OG cohort, IHC and qPCR analyses demonstrated that ANG expression was markedly higher in malignantly transformed OG tissues than in matched primary OG samples, accompanied by increased expression of VEGFA, the endothelial marker CD31, and the proliferation marker Ki67 at both the mRNA and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD and E). Stratification of OG tumors by ANG expression further showed that ANG-high tumors exhibited significantly higher VEGFA, CD31 and Ki67 expression than ANG-low tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF and G). Together, these data indicate that ANG is closely associated with angiogenesis, tumor proliferation, and poor prognosis in OG.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo directly test the functional role of ANG, we silenced ANG in OG cells and collected conditioned medium to treat EAhy926 endothelial cells. ANG knockdown significantly reduced endothelial tube formation, as measured by Calcein-AM\u0026ndash;stained tube length and branch points (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA\u0026ndash;C). In OG cells, ANG silencing decreased VEGFA, PTEN and Ki67 expression at both mRNA and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD and E), inhibited cell proliferation by CCK-8 assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF), and attenuated malignant characteristics. In PDOX models, ANG knockdown in OG cells extended median survival from 98 to 123 days for animals (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). Matrigel plug assays showed that ANG-deficient OG cells formed plugs with substantially reduced CD31-positive microvessel density compared with controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). In xenograft tumors, IHC confirmed decreased VEGFA and Ki67 expression upon ANG knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI). These findings establish ANG as a key mediator of angiogenesis and malignant transformation in OG.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eANG promoter hypomethylation is associated with OG progression and enhanced angiogenesis\u003c/h2\u003e \u003cp\u003eTCGA methylation data indicated that higher ANG promoter methylation was associated with longer overall survival in LGG patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). UCSC Xena analysis of ANG promoter beta value distributions showed that the upper quartile (q75) approached 0.8, exceeding the optimal cut-off (maxstat\u0026thinsp;=\u0026thinsp;0.658), suggesting that ANG is heavily methylated in many low-grade tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Notably, ANG promoter methylation significantly decreased from WHO grade II to grade III LGG (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), consistent with promoter hypomethylation contributing to malignant progression of OG.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMSP in 10 paired primary and malignantly transformed OG specimens revealed lower methylation and higher unmethylated ANG promoter levels in malignant OG compared with primary OG tissues. Similar patterns were observed in hypoxia-induced M-OG cells versus parental OG cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). These data indicate an inverse relationship between ANG promoter methylation and OG malignancy. To assess the functional impact of ANG promoter methylation, we treated OG cells with decitabine which is a methylation inhibitor and confirmed decreased ANG promoter methylation by MSP (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Decitabine treatment markedly increased ANG, VEGFA and Ki67 expression at mRNA and protein levels and enhanced OG cell proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF\u0026ndash;H). Collectively, these findings suggest that ANG promoter hypomethylation promotes ANG upregulation, angiogenesis and malignant behavior in OG, whereas maintaining high methylation levels may restrain progression.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eIdentification of methylation-sensitive CpG islands and prognostic CpG sites in the ANG promoter\u003c/h2\u003e \u003cp\u003eTo pinpoint methylation-sensitive regions, we first mapped CpG islands in the ANG promoter using MethPrimer tool, identifying 7 CpG islands (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Luciferase reporter assays with serial deletion constructs spanning \u0026minus;\u0026thinsp;1341 to +\u0026thinsp;197 bp of the promoter revealed that CpG island 5 (\u0026minus;\u0026thinsp;1383 to \u0026minus;\u0026thinsp;1494 bp) and CpG island 6\u0026ndash;7 (\u0026minus;\u0026thinsp;1722 to \u0026minus;\u0026thinsp;2048 bp) conferred the strongest promoter activity and were sensitive to methylation status (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). BSP analysis of CpG islands 5 and 6\u0026ndash;7 in 10 pairs of primary OG and 10 malignant OG samples examined 20 CpG sites (10 per island). Malignant OG tissues consistently exhibited lower methylation levels at these CpG sites than primary OG tissues, especially CpG3 and CpG6 sites of Island 5 and CpG7 and CpG10 sites of Island 6\u0026ndash;7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). In a cohort of 10 OG patients, lower methylation at CpG3 and CpG6 sites of Island 5 and CpG7 and CpG10 sites of Island 6\u0026ndash;7 significantly correlated with higher ANG mRNA levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Detailed analysis of CpG3 and CpG6 sites in Island 5 and CpG7 and CpG10 sites in Island 6\u0026ndash;7 showed significantly higher methylation in primary OG tissues and cells compared with malignantly transformed counterparts (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eUsing TCGA LGG methylation data, we identified 11 CpG probes within the ANG promoter (Table S2). Cox regression on M values revealed cg10850001, located 425 bp downstream of the transcription start site between CpG island 5 and 6, as a key prognostic site with a hazard ratio of 0.697, indicating that hypomethylation at this site is associated with increased mortality risk (Table S2). High methylation at cg10850001 along with cg02939508, cg19211827 and cg21882356 located at around CpG island 6\u0026ndash;7 (Fig. S2A) predicted significantly better survival (Fig. S2B). Although the ROC analysis for survival classification yielded a modest AUC of 0.614 for cg10850001 (Fig. S2C), patients who died had significantly lower DNA methylation at all these 4 CpG sites than long-term survivors (Fig. S2D), supporting its prognostic value.\u003c/p\u003e \u003cp\u003eThese data collectively validate ANG promoter CpG islands\u0026mdash;especially CpG island 5\u0026ndash;7\u0026mdash;as clinically relevant methylation hotspots in OG.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eTET2 is upregulated in malignant OG, drives ANG demethylation and expression, and correlates with angiogenesis\u003c/h2\u003e \u003cp\u003eGiven the observed ANG promoter hypomethylation in malignant OG, we next investigated which DNA demethylases regulate ANG. Overexpression of TET1, TET2 or TET3 in OG cells revealed that only TET2 significantly increased ANG mRNA expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), implicating TET2 as the primary demethylase for ANG in OG. Analysis of TCGA cohorts showed significantly higher TET2 expression in LGG tissues compared with normal brain (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). In our clinical samples, qPCR and Western blotting confirmed that TET2 expression was higher in malignant OG tumors than primary OG (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC and D). Consistently, TET2 expression was significantly increased in M-OG cells relative to parental OG cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE and F). Human Protein Atlas data supported a positive association between TET2 expression and glioma grade (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo test whether TET2 directly regulates ANG, we cloned the ANG promoter into a luciferase reporter and performed dual-luciferase assays. TET2 overexpression enhanced ANG promoter activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH). ChIP assays demonstrated enrichment of TET2 at the ANG promoter region, confirming a direct interaction (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eI). Together, these results indicate that TET2 is upregulated during OG malignant transformation and directly activates ANG transcription via promoter binding and demethylation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eTET2 promotes angiogenesis and malignant progression through ANG, and can be targeted by OI\u003c/h2\u003e \u003cp\u003eTo establish the functional relationship between TET2 and ANG, we knocked down TET2 in OG cells using shRNA. TET2 silencing significantly reduced ANG, VEGFA and Ki67 expression at both mRNA and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA and B). Tube formation assays using conditioned media from TET2-deficient OG cells revealed markedly impaired endothelial tube formation, demonstrating reduced pro-angiogenic capacity (Fig. S3 and Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). GSEA analyses further showed that TET2 expression positively correlated with angiogenesis gene signatures in LGG (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMSP analysis indicated that TET2 knockdown increased ANG promoter methylation and decreased unmethylated alleles, mirroring the effects of TET2 inhibition by OI (Fig. S4 and Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). Treatment of OG cells with OI significantly downregulated TET2, ANG, VEGFA and Ki67 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF), confirming that OI effectively blocks the TET2\u0026ndash;ANG axis. Importantly, re-expression of ANG in TET2-deficient cells partially rescued VEGFA and Ki67 expression and restored angiogenic activity, demonstrating that TET2 promotes angiogenesis and malignant progression primarily through ANG.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCombined TET2 inhibition and TMZ therapy synergistically delay OG progression\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn LGG cohorts, elevated ANG expression was positively correlated with improved response to temozolomide, whereas low-ANG tumors showed limited benefit, suggesting that ANG may modulate chemosensitivity (Fig. S5). To evaluate the therapeutic potential of targeting the TET2\u0026ndash;ANG\u0026ndash;angiogenesis axis, we treated OG and malignantly transformed OG cells with OI and TMZ alone or in combination. CCK-8 assays showed that both agents reduced cell viability, with the combination producing the most pronounced inhibitory effect in both OG and M-OG cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn OG and M-OG PDOX mouse models, administration of OI or TMZ alone significantly prolonged survival compared with vehicle controls, whereas the combination therapy provided the greatest survival benefit (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). IHC and qPCR analyses of xenograft tumors revealed that OI and TMZ each decreased VEGFA and Ki67 expression, and combined treatment produced the strongest reduction in angiogenesis and proliferative indices (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC and D). These findings suggest that pharmacologic inhibition of TET2 with TMZ therapy complements OI treatment suppresses angiogenesis and malignant progression in OG.\u003c/p\u003e \u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eIn this study, we identify a previously unrecognized epigenetic mechanism driving angiogenesis and malignant transformation in oligodendroglioma. We show that TET2 is upregulated during OG progression and directly binds to and demethylates the ANG promoter, leading to ANG overexpression, enhanced angiogenesis and accelerated malignant transformation. Importantly, pharmacologic inhibition of TET2 with an itaconate derivative reverses ANG promoter hypomethylation, suppresses ANG expression and angiogenesis, and synergizes with TMZ to prolong survival in PDOX models (Schematic diagram).\u003c/p\u003e \u003cp\u003eANG has long been recognized as a potent angiogenic factor and is upregulated in many cancers[\u003cspan additionalcitationids=\"CR10 CR11\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. It can induce endothelial cell proliferation, migration and tube formation, and its nuclear translocation promotes rRNA transcription and cell growth [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. In gliomas, increased ANG expression has been associated with higher grade and poor prognosis [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Here, we demonstrate that ANG is also critically involved in OG, where its expression is elevated in malignantly transformed tumors and strongly correlates with VEGFA, CD31 and Ki67 expression. Functional experiments in vitro and in vivo show that ANG knockdown suppresses angiogenesis, reduces tumor proliferation and delays malignant progression, confirming ANG as a central effector of the angiogenic phenotype in OG. Our data also suggest that ANG may influence therapeutic responses. Analysis of GEPIA3 datasets indicated that LGG tumors with high ANG expression show improved response to temozolomide compared with ANG-low tumors, consistent with the concept that highly vascular, proliferative tumors may be more chemosensitive but also more aggressive. This dual role underscores the importance of contextualizing ANG as both a potential biomarker and therapeutic target.\u003c/p\u003e \u003cp\u003eAberrant DNA methylation is a hallmark of glioma biology, particularly in IDH-mutant LGGs [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. OGs typically exhibit widespread CpG island hypermethylation, which has been associated with favorable prognosis. Our study reveals that, within this hypermethylated context, specific demethylation events at the ANG promoter occur during malignant transformation. We observe that ANG promoter methylation is high in lower-grade tumors and decreases with increasing grade, and that hypomethylation at key CpG islands correlates with elevated ANG expression and poor survival. By integrating MSP, BSP and TCGA methylation data, we map methylation-sensitive regions within the ANG promoter and identify cg10850001 and so on in CpG island 5\u0026ndash;7 as a prognostic methylation site. Although the ROC AUC of 0.614 indicates only moderate discrimination, the significant difference in methylation levels between deceased and surviving patients suggests that this site\u0026mdash;and, more broadly, ANG promoter methylation\u0026mdash;has clinical relevance and may complement existing prognostic markers in OG.\u003c/p\u003e \u003cp\u003eThe TET family of dioxygenases regulates active DNA demethylation and has been implicated in development, immunity and cancer [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. While TET2 is often mutated and inactivated in hematological malignancies, in our study TET2 is upregulated in OG and further increased in malignantly transformed OG. This pattern suggests a context-dependent oncogenic role for TET2 in IDH-mutant, hypermethylated gliomas, where a global hypermethylated background may sensitize cells to focal demethylation of oncogenic loci such as ANG. We demonstrate that TET2\u0026mdash;but not TET1 or TET3\u0026mdash;directly drives ANG expression in OG cells. TET2 overexpression activates ANG promoter reporter constructs, and ChIP confirms TET2 binding at the ANG promoter. TET2 knockdown increases ANG promoter methylation and decreases ANG expression, angiogenesis and proliferation, and ANG re-expression rescues these effects. These findings support a model in which TET2 is selectively recruited to the ANG promoter to induce locus-specific demethylation and transcriptional activation, thereby driving angiogenesis and malignant transformation.\u003c/p\u003e \u003cp\u003eItaconate is an endogenous immunometabolite with anti-inflammatory properties that has recently been shown to inhibit TET dioxygenases by competing with α-ketoglutarate [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The lipophilic derivative OI improves cell permeability and potentially crosses the blood\u0026ndash;brain barrier, making it attractive for CNS tumors [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In our study, OI treatment phenocopies TET2 knockdown by increasing ANG promoter methylation and suppressing ANG, VEGFA and Ki67 expression, as well as inhibiting angiogenesis and proliferation. These data provide functional evidence that pharmacologic TET2 inhibition can re-establish a more \u0026ldquo;protective\u0026rdquo; hypermethylated state at oncogenic loci such as ANG.\u003c/p\u003e \u003cp\u003eWe further demonstrate that combining OI with bevacizumab produces additive or synergistic anti-tumor effects in OG cells and PDOX models. While TMZ is the typical treatment in clinic of OG, OI acts upstream at the epigenetic level to downregulate ANG expression. This dual targeting may reduce compensatory pro-angiogenic signaling and delay resistance, a major limitation of anti-VEGF monotherapy. Our findings therefore support further development of TET2/ANG-targeted epigenetic therapies, alone or in combination with anti-angiogenic agents, to delay malignant transformation and improve outcomes in OG.\u003c/p\u003e \u003cp\u003eWe demonstrate that TET2-mediated demethylation of the ANG promoter drives angiogenesis and malignant transformation in oligodendroglioma. ANG is upregulated in malignant OG, correlates with poor prognosis and increased angiogenesis, and is functionally required for tumor progression. TET2 is upregulated in malignant OG, binds to the ANG promoter, decreases its methylation, and thereby enhances ANG expression. Pharmacologic inhibition of TET2 with the itaconate derivative OI restores ANG promoter methylation, suppresses ANG and pro-angiogenic signaling, and, particularly when combined with TMZ, effectively delays OG progression in PDOX models. Targeting TET2-dependent epigenetic regulation of angiogenesis thus represents a promising strategy to improve the management of OG patients.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eETHICS APPROVAL AND CONSENT TO PARTICIPATE\u003c/h2\u003e \u003cp\u003e Tumor specimens were obtained from 20 patients with histologically confirmed Oligodendroglioma treated at Sun Yat-sen University according to international diagnostic criteria. Primary OG tissues and their corresponding malignantly transformed OG tissues were collected when available. Clinicopathologic data were recorded for all patients. The study protocol was approved by the Ethics Committee of Sun Yat-sen University, and all procedures conformed to the Declaration of Helsinki. Written informed consent was obtained from all participants prior to sample collection.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eCONSENT FOR PUBLICATION\u003c/strong\u003e \u003cp\u003eThe authors consent to publish the paper.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eCOMPETING INTERESTS\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFUNDING\u003c/h2\u003e \u003cp\u003eThis work was supported by the Guangxi Natural Science Foundation of China (2025JJA141321, 2025JJA130466 and 2025GXNSFAA069117), the National Natural Science Foundation of China (3256050029, 32100563 and 82202955), the Guangdong Natural Science Foundation of China (2022A1515012286 and 2025A1515012335), the Shenzhen Science and Technology Innovation Commission (JCYJ20220530145217039).\u003c/p\u003e\u003ch2\u003eAUTHOR CONTRIBUTIONS\u003c/h2\u003e \u003cp\u003eL.Q. J. J., and X.-D.Z. contributed to writing original draft, methodology, data curation and Supervision. J. J., Z.Y., H.W. performed methodology and software. L.G. and Y.W. contributed to data curation. Y.G. and X.J. performed the formal analysis. L.Q., J. J., F.X. and S.Z. provided funding acquisition and conceptualization. G.Q., N.Z., J.-C.Z., S.Z. contributed the supervision, conceptualization. Z.Z., B.H. contributed the supervision and methodology.\u003c/p\u003e\u003ch2\u003eACKNOWLEDGEMENTS\u003c/h2\u003e \u003cp\u003eWe are grateful to the Core Facilities for Medical Science, School of Medicine, Shenzhen Campus of Sun Yat-sen University, for technical support. We also wish to thank the Research Center of Guilin Medical University for their valuable assistance.\u003c/p\u003e\u003ch2\u003eDATA AVAILABILITY\u003c/h2\u003e \u003cp\u003eAll data that support the findings of this study are available from the corresponding authors upon reasonable request, without any restrictions.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eCoons SW, Johnson PC, Scheithauer BW, Yates AJ, Pearl DK. Improving diagnostic accuracy and interobserver concordance in the classification and grading of primary gliomas. \u003cem\u003eCancer\u003c/em\u003e 1997; 79: 1381\u0026ndash;1393.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBready D, Placantonakis DG. Molecular Pathogenesis of Low-Grade Glioma. \u003cem\u003eNeurosurgery clinics of North America\u003c/em\u003e 2019; 30: 17\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBromberg JE, van den Bent MJ. Oligodendrogliomas: molecular biology and treatment. \u003cem\u003eThe oncologist\u003c/em\u003e 2009; 14: 155\u0026ndash;163.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang TJC, Mehta MP. Low-Grade Glioma Radiotherapy Treatment and Trials. \u003cem\u003eNeurosurgery clinics of North America\u003c/em\u003e 2019; 30: 111\u0026ndash;118.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFolkman J. Tumor angiogenesis: therapeutic implications. \u003cem\u003eThe New England journal of medicine\u003c/em\u003e 1971; 285: 1182\u0026ndash;1186.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQi L, Wang ZY, Shao XR, Li M, Chen SN, Liu XQ \u003cem\u003eet al\u003c/em\u003e. ISL2 modulates angiogenesis through transcriptional regulation of ANGPT2 to promote cell proliferation and malignant transformation in oligodendroglioma. \u003cem\u003eOncogene\u003c/em\u003e 2020; 39: 5964\u0026ndash;5978.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuarnaccia L, Navone SE, Trombetta E, Cordiglieri C, Cherubini A, Cris\u0026agrave; FM \u003cem\u003eet al\u003c/em\u003e. Angiogenesis in human brain tumors: screening of drug response through a patient-specific cell platform for personalized therapy. \u003cem\u003eScientific reports\u003c/em\u003e 2018; 8: 8748.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReyes-Botero G, Dehais C, Idbaih A, Martin-Duverneuil N, Lahutte M, Carpentier C \u003cem\u003eet al\u003c/em\u003e. Contrast enhancement in 1p/19q-codeleted anaplastic oligodendrogliomas is associated with 9p loss, genomic instability, and angiogenic gene expression. \u003cem\u003eNeuro-oncology\u003c/em\u003e 2014; 16: 662\u0026ndash;670.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSampath P, Weaver CE, Sungarian A, Cortez S, Alderson L, Stopa EG. Cerebrospinal fluid (vascular endothelial growth factor) and serologic (recoverin) tumor markers for malignant glioma. \u003cem\u003eCancer control: journal of the Moffitt Cancer Center\u003c/em\u003e 2004; 11: 174\u0026ndash;180.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePlate KH, Risau W. Angiogenesis in malignant gliomas. \u003cem\u003eGlia\u003c/em\u003e 1995; 15: 339\u0026ndash;347.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoang TT, Raines RT. Molecular basis for the autonomous promotion of cell proliferation by angiogenin. \u003cem\u003eNucleic acids research\u003c/em\u003e 2017; 45: 818\u0026ndash;831.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu JL, Luo WJ, Wang H. Angiogenin Upregulation Independently Predicts Unfavorable Overall Survival in Proneural Subtype of Glioblastoma. \u003cem\u003eTechnology in cancer research \u0026amp; treatment\u003c/em\u003e 2019; 18: 1533033819846636.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRozman A, Silar M, Kosnik M. Angiogenin and vascular endothelial growth factor expression in lungs of lung cancer patients. \u003cem\u003eRadiology and oncology\u003c/em\u003e 2012; 46: 354\u0026ndash;359.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVanli N, Guo-Fu HU. Mechanism and Function of Angiogenin in Prostate Cancer. \u003cem\u003eZhongguo sheng wu hua xue yu fen zi sheng wu xue bao\u0026thinsp;=\u0026thinsp;Chinese journal of biochemistry and molecular biology\u003c/em\u003e 2015; 31: 1261\u0026ndash;1266.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaghu H, Lakka SS, Gondi CS, Mohanam S, Dinh DH, Gujrati M \u003cem\u003eet al\u003c/em\u003e. Suppression of uPA and uPAR attenuates angiogenin mediated angiogenesis in endothelial and glioblastoma cell lines. \u003cem\u003ePloS one\u003c/em\u003e 2010; 5: e12458.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia W, Fu W, Cai X, Wang M, Chen H, Xing W \u003cem\u003eet al\u003c/em\u003e. Angiogenin promotes U87MG cell proliferation by activating NF-κB signaling pathway and downregulating its binding partner FHL3. \u003cem\u003ePloS one\u003c/em\u003e 2015; 10: e0116983.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen LL, Morcelle C, Cheng ZL, Chen X, Xu Y, Gao Y \u003cem\u003eet al\u003c/em\u003e. Itaconate inhibits TET DNA dioxygenases to dampen inflammatory responses. \u003cem\u003eNature cell biology\u003c/em\u003e 2022; 24: 353\u0026ndash;363.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJung I, An J, Ko M. Epigenetic Regulators of DNA Cytosine Modification: Promising Targets for Cancer Therapy. \u003cem\u003eBiomedicines\u003c/em\u003e 2023; 11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu C, Tang H, Hu N, Li T. Methylomics and cancer: the current state of methylation profiling and marker development for clinical care. \u003cem\u003eCancer cell international\u003c/em\u003e 2023; 23: 242.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMadala HR, Punganuru SR, Arutla V, Misra S, Thomas TJ, Srivenugopal KS. Beyond Brooding on Oncometabolic Havoc in IDH-Mutant Gliomas and AML: Current and Future Therapeutic Strategies. \u003cem\u003eCancers\u003c/em\u003e 2018; 10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMazor T, Chesnelong C, Pankov A, Jalbert LE, Hong C, Hayes J \u003cem\u003eet al\u003c/em\u003e. Clonal expansion and epigenetic reprogramming following deletion or amplification of mutant IDH1. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e 2017; 114: 10743\u0026ndash;10748.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoure CJ, Diplas BH, Chen LH, Yang R, Pirozzi CJ, Wang Z \u003cem\u003eet al\u003c/em\u003e. CRISPR Editing of Mutant IDH1 R132H Induces a CpG Methylation-Low State in Patient-Derived Glioma Models of G-CIMP. \u003cem\u003eMolecular cancer research: MCR\u003c/em\u003e 2019; 17: 2042\u0026ndash;2050.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDang L, White DW, Gross S, Bennett BD, Bittinger MA, Driggers EM \u003cem\u003eet al\u003c/em\u003e. Cancer-associated IDH1 mutations produce 2-hydroxyglutarate. \u003cem\u003eNature\u003c/em\u003e 2009; 462: 739\u0026ndash;744.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim D, Kim Y, Kim Y. Effects of β-carotene on Expression of Selected MicroRNAs, Histone Acetylation, and DNA Methylation in Colon Cancer Stem Cells. \u003cem\u003eJournal of cancer prevention\u003c/em\u003e 2019; 24: 224\u0026ndash;232.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"oncogene","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"onc","sideBox":"Learn more about [Oncogene](http://www.nature.com/onc/)","snPcode":"41388","submissionUrl":"https://mts-onc.nature.com/cgi-bin/main.plex","title":"Oncogene","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Oligodendroglioma, Angiogenin, TET2, DNA methylation, Malignant transformation","lastPublishedDoi":"10.21203/rs.3.rs-8533226/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8533226/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eOligodendrogliomas (OG) are indolent yet inevitably progressive gliomas in which angiogenesis is tightly linked to malignant transformation, but the underlying epigenetic mechanisms remain unclear. By integrating public datasets of primary and malignant transformed OG specimens, patient-derived cell lines and orthotopic xenograft models, we identify angiogenin (ANG) as a key pro-angiogenic driver whose high expression correlates with increased microvessel density, enhanced proliferation and poor overall survival. Promoter methylation analyses reveal that ANG is heavily methylated in low-grade tumors and that hypomethylation of three CpG-rich regions including the prognostic site e.g., cg10850001, associates with increased ANG expression, higher tumor grade and worse outcome. Functional studies show that ANG knockdown suppresses VEGFA and Ki67 expression, reduces endothelial tube formation and intratumoral microvessel density, and significantly prolongs survival in Oligodendroglioma PDOX mice, whereas pharmacologic demethylation with decitabine decreases ANG promoter methylation, upregulates ANG and accelerates malignant phenotypes. Among TET dioxygenases, TET2 is selectively upregulated in malignant oligodendroglioma, directly binds to the ANG promoter, and enhances its activity; TET2 depletion increases ANG promoter methylation, downregulates ANG and pro-angiogenic markers, and impairs angiogenesis, effects that are rescued by ANG re-expression. The cell-permeable itaconate derivative 4-octyl itaconate (OI), a pharmacologic TET2 inhibitor, restores ANG promoter methylation, suppresses TET2\u0026ndash;ANG signaling and cooperates with Temozolomide (TMZ) to inhibit tumor growth and extend survival in PDOX models. These findings define a TET2\u0026ndash;ANG\u0026ndash;angiogenesis axis that drives malignant transformation of oligodendroglioma and highlight itaconate-based epigenetic targeting of TET2 as a promising strategy to improve outcomes in patients with oligodendroglioma.\u003c/p\u003e","manuscriptTitle":"TET2-Driven Demethylation of ANG promotes Angiogenesis and Malignant transformation in Oligodendroglioma","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-22 06:53:09","doi":"10.21203/rs.3.rs-8533226/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2026-02-06T16:37:16+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-02-04T23:33:56+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-01-28T01:34:25+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-01-23T13:19:22+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-01-22T09:05:23+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2026-01-19T02:17:20+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-09T13:49:11+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-06T16:01:15+00:00","index":"","fulltext":""},{"type":"submitted","content":"Oncogene","date":"2026-01-06T16:01:14+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"oncogene","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"onc","sideBox":"Learn more about [Oncogene](http://www.nature.com/onc/)","snPcode":"41388","submissionUrl":"https://mts-onc.nature.com/cgi-bin/main.plex","title":"Oncogene","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"bd86cc94-3223-4968-9e0a-f64cc1d89260","owner":[],"postedDate":"January 22nd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":61330462,"name":"Biological sciences/Cancer/CNS cancer"},{"id":61330463,"name":"Biological sciences/Genetics/Gene regulation"}],"tags":[],"updatedAt":"2026-04-30T14:48:15+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-22 06:53:09","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8533226","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8533226","identity":"rs-8533226","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}