ODC1 delays neurodegenerative processes in aging by promoting ammonia detoxification via neuronal urea cycle activation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article ODC1 delays neurodegenerative processes in aging by promoting ammonia detoxification via neuronal urea cycle activation Jianhua Ran, Shengyao Zhang, Meng Zhang, Junling Luo, Han Wei, and 9 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7778304/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Aging represents a natural and inevitable physiological process characterized by the gradual deterioration in the functions of various organ systems. One of the central hallmarks of aging is the dysregulation of both substance and energy metabolism. Previous research has associated the urea cycle (UC) with the development of neurodegenerative diseases. In this study, we observed elevated levels of urea, the end-product of the UC, upregulation of urea cycle enzymes, and an increase of the side-product putrescine in the elderly serum and aging models, while the initial substrate ammonia remained unchanged. Notably, region-specific accumulation of neuronal urea and activation of the UC were associated with age-related deficits in cognitive and motor functions. Mechanistically, urea accumulation in the brain appears to stem from dysregulated UC activity coupled with compensatory clearance mediated by the urea transporter UT-B. Exposing neurons to high urea levels accelerated UC flux and induced cellular senescence. Importantly, pharmacological inhibition or knockdown of ornithine decarboxylase 1 (ODC1) ameliorated urea metabolic dysregulation and reduced neuronal damage. Together, these findings reveal a novel connection between dysregulated neuronal urea cycle activity and age-related neural impairment, linking metabolic reprogramming to neurodegenerative pathology. Our results not only uncover a key metabolic mechanism underlying brain aging but also provide a promising dual-target therapeutic strategy, highlighting the urea cycle as a potential intervention point for delaying neurodegenerative processes associated with aging. Biological sciences/Neuroscience/Cognitive ageing Biological sciences/Neuroscience/Neural ageing Aging Urea metabolism Ammonia detoxification Ornithine Decarboxylase 1 Urea Transporter B Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Aging is a significant risk factor for the development of neurodegenerative disorders, including Alzheimer's and Parkinson's diseases [ 1 ] . Global demographic trends project that the population of older adults will reach approximately 2.1 billion by 2025, posing substantial public health challenges worldwide [ 2 ] . During aging, homeostatic mechanisms that maintain physiological balance across the body, organs, and tissues undergo progressive deterioration [ 3 ] . This decline contributes to nervous system and advancing neurodegeneration, which lead not only to cognitive deficits and motor impairments, but also to an increased risk of comorbidities and mortality [ 4 ] . Metabolic dysregulation is a core feature of aging and is implicated in the development of age-related pathologies, including neurodegenerative diseases, cancer, and metabolic syndromes [ 3 ] . Recent neuroscientific research has shown that aging cells display significant disruptions in metabolic enzyme expression and a reduced capacity to adapt to stress, which aggravates tissue malfunction and increases disease vulnerability [ 5 ] . Novel therapeutic approaches that target these metabolic pathways show potential in slowing the progression of age-related metabolic diseases. The urea cycle (UC), primarily known as a hepatic pathway essential for ammonia detoxification and nitrogen homeostasis [ 6 ] , has recently been shown to operate in extrahepatic tissues as well [ 7 ] . Challenging the conventional view of its liver-restricted activity, accumulating evidence indicates that a functional urea cycle exists within the nervous system [ 8 , 9 ] . Key UC enzymes—such as carbamoyl phosphate synthetase 1 (CPS1), ornithine transcarbamylase (OTC), argininosuccinate synthetase 1 (ASS1), argininosuccinate lyase (ASL), and arginase 1 (ARG1)—are expressed in the brain [ 10 ] , indicating a local system for nitrogen metabolic regulation [ 11 ] . The UC demonstrates notable metabolic flexibility in neural contexts [ 12 ] , For instance, ornithine produced via ARG1 acts as a key metabolic hub [ 13 ] , branching into two distinct pathways: decarboxylation by ornithine decarboxylase 1 (ODC1) to yield putrescine for polyamine synthesis, or re-entry into the UC for nitrogen recycling and citrulline regeneration [ 14 ] . Despite these insights, the pathological contributions of UC metabolites to neurodegeneration are not fully understood. Elevated ammonia exerts neurotoxicity by impairing glutamate recycling and mitochondrial function [ 15 ] . While putrescine is a precursor for neuronal GABA synthesis [ 16 ] , its excess may promote excitotoxicity [ 17 ] . Arginase-mediated arginine catabolism regulates nitric oxide (NO) production [ 7 ] , and CPS1 helps modulate glutamate and GABA levels [ 18 ] , highlighting the UC’s broader regulatory roles. Beyond its potential involvement in neuronal energy metabolism and amino acid synthesis, urea—the end product of the UC—may itself contribute to cognitive and motor dysfunction. Notably, elevated urea concentrations have been reported in the brains of patients with Alzheimer’s disease (AD) [ 19 ] , Parkinson's disease (PD) [ 20 ] , and Huntington's disease [ 21 , 22 ] . However, how UC activity changes with age in the brain and its implications in pathological aging require further investigation. Urea accumulation may also result from impaired clearance mechanisms [ 23 ] . Urea transporter B (UT-B), which enables urea transport in the brain, helps maintain urea homeostasis; its dysfunction is linked to urea buildup in the hippocampus and subsequent neuronal injury [ 24 ] , although its role in aging has yet to be clarified. Given the potential role of disordered urea metabolism in brain aging, identifying compounds capable of modulating this process has become a research focus. Evodiamine, a primary bioactive alkaloid from the dried fruit of Evodia rutaecarpa (Juss.) Benth., is widely employed in traditional Chinese medicine and possesses diverse pharmacological properties [ 25 ] . Nonetheless, its potential anti-aging benefits and mechanisms of action remain largely uninvestigated. Therefore, this study seeks to examine whether evodiamine can ameliorate brain aging by modulating the urea cycle. To address these issues, we first identified a widespread increase in serum urea levels within the aging population, which correlated inversely with cognitive performance and physical activity. Biochemical analyses of clinical samples further revealed upregulation of key urea cycle enzymes and elevated levels of associated metabolites. We subsequently established an aging mouse model and observed consistent activation of the urea cycle across various brain regions. Using immunofluorescence and cell-based models, we demonstrated that this enhanced urea cycle activity occurs specifically in neurons, rather than in astrocytes or microglia. Through protein interaction studies, ODC1 was identified as a critical regulator of this process. Inhibition of ODC1 suppressed urea cycle overactivation and mitigated aging phenotypes. Finally, molecular docking analysis of ODC1 and administration of evodiamine were shown to ameliorate brain aging. 2. Methods 2.1 Study subjects The analysis of all human samples was carried out at the Medical Laboratory Department of Chongqing Hospital, Jiangsu Province Hospital. Blood was collected via venipuncture into heparin-anticoagulated tubes and allowed to stand for 25 minutes. Plasma was then separated via centrifugation at 4000 rpm for 20 minutes. An automated clinical chemistry system was employed to assess serum biochemical markers such as urea and creatinine. The ethical approval for this specific study component was obtained from the Institutional Ethics Sub-committee at Chongqing Hospital, Jiangsu Province Hospital (approval number: 2025043). Subjects were categorized into two age cohorts: young adults (≤ 30 years) and older adults (≥ 50 years). Standardized tests were administered to evaluate cognitive and motor functions across all participants. An aging mouse model was established using D-galactose induction, based on established protocols [ 26 ] , including our previous work [ 27 ] . We conducted the study using male C57BL/6J mice (7–8 weeks of age; weighing 22–25 g). All animals were maintained in the institutional Laboratory Animal Center under a controlled environment with a 12-hour photoperiod (light/dark cycle). Prior to the commencement of the study, formal approval was secured from the relevant University Animal Ethics Committee. All subsequent procedures strictly followed national and institutional animal welfare policies (approval number: IACUC-CQMU-2022-0026). Euthanasia was performed under isoflurane anesthesia. Mice were randomly divided into four groups, with six animals in each group: Control, D-gal, DFMO (D-gal + DFMO), and EVO treatment (D-gal + EVO). After one week of acclimation, mice received daily intraperitoneal injections of D-galactose (120 mg/kg; Maclean Biotechnology, #D810319, purity ≥ 99%) for 42 days; control animals received saline following the same regimen. Starting from day 15, the EVO group was orally gavaged with Evodiamine (40 mg/kg daily; MedChemExpress, #518-17-2, purity ≥ 99%) alongside D-gal injections. The DFMO group received Eflornithine (600 mg/kg; MedChemExpress, #70052-12-9). The UT-B −/− mouse was generated on a C57BL/6J genetic background by breeding UT-B +/− heterozygous animals, following a previously established protocol [ 28 ] . Upon completion of behavioral tests, blood samples were collected from the ocular vein, and serum was separated. Brain tissues were harvested for subsequent analysis. 2.2 Behavior tests Following model establishment, all mice underwent a sequence of behavioral assessments. The Morris water maze (MWM) included a 4-day acquisition phase where mice were placed into the pool from different starting points to find a submerged platform (positioned in the fourth quadrant, 2 cm below the water surface and 20 cm from the pool wall). Escape latency was measured with a 90 s cut-off. Following the spatial acquisition phase, a 90-second probe trial was administered on day 5 in the absence of the platform. Measurements included time spent in the target quadrant, number of crossings over the former platform site, and crossings within a zone twice the platform's diameter. Prior to the introduction in the NOR test, mice were habituated for 5 minutes to an open-field box containing two identical objects. After a 10 min training session, memory was assessed at 1 h and 24 h by introducing a novel object. Exploration time (5 min) for each object was used to calculate the discrimination index. The Y-maze consisted of three arms evenly spaced at 120°. Each mouse was given a 5-min free exploration session while being video-tracked. For the elevated plus maze (EPM), the setup included two open and two closed arms, and the entire apparatus was raised 50 cm from the ground. Individual mice were placed at the central junction facing an open arm and allowed to explore for 5 minutes under video surveillance. To evaluate neuromuscular function, grip strength was tested by documenting the maximum force (g) exerted when a mouse, suspended by the tail, gripped a sensor. Anxiety and general locomotion were assessed employing an open-field test: after 30 min of acclimation, mice were exposed for 5 min to a brightly lit (500 lux) opaque arena (40 × 40 cm), with activity recorded by SMART software. Motor coordination and balance were tested on an accelerating rotarod (4–40 rpm over 5 min). This was preceded by a 3-day training period (4 rpm, 5 min/day), and the final score represented the average latency to fall from three trials separated by 1-hour intervals. 2.3 Western blot Serum samples, brain tissues, and PBS-washed cellular pellets were precisely weighed and homogenized using an ice-cold lysis buffer supplemented with protease inhibitors. The homogenates were sonicated, kept on ice, and subsequently centrifuged at 11,100 × g for 30 minutes at 4°C. Supernatants were carefully collected, and total protein content was quantified with a BCA assay kit (Biosharp, BL1054A). Equivalent quantities of protein (25 µg per lane) were resolved via SDS-PAGE (Beyotime, P0012A) and then transferred electrophoretically onto PVDF membranes (Beyotime, FFP19). Membranes were blocked with Quick Block Western solution (Beyotime, P0240-500ml) and probed overnight at 4°C with the following primary antibodies: anti-ARG1 (Beyotime, AF1381; 1:1200), anti-ODC1 (Proteintech, #67336-1-Ig; 1:1200), anti-OTC (Proteintech, #26470-1-AP; 1:1200), anti-UT-B (Proteintech, #25962-1-AP; 1:1200), anti-P53 (Proteintech, #10442-1-AP; 1:1200), anti-ASL (Proteintech, #16645-1-AP; 1:1200), anti-ASS1 (Abcam, ab191165; 1:1200), anti-CPS1 (Abcam, ab129076; 1:1200), and anti-β-actin (Abmart, P60709; 1:1200). After incubation with primary antibodies, the membranes were treated with an HRP-conjugated secondary antibody (Abcam, ab6721; 1:10000) for one hour at room temperature. Following extensive washing with TBST, immunoreactive bands were visualized with a chemiluminescence imaging system. Band intensities were quantified using ImageJ software. A detailed antibody table is available in the Supplementary Materials. 2.4 HE staining Brain tissue samples were post-fixed via immersion in 4% paraformaldehyde, embedded in paraffin, and sectioned at a thickness of 5 µm for further histological analysis. Following deparaffinization and rehydration, the sections were stained with hematoxylin and eosin (H&E) using a commercial staining kit (Beyotime, C0105S) and imaged under a light microscope for morphological assessment. 2.5 Immunohistochemical and immunofluorescence analysis For immunohistochemical (IHC) and immunofluorescence (IF) staining, the following primary antibodies were applied: anti-ODC1 (Proteintech, #67336-1-Ig; 1:250), anti-OTC (Proteintech, #26470-1-AP; 1:250), anti-ARG1 (Beyotime, AF1381; 1:250), anti-ASL (Proteintech, #16645-1-AP; 1:250), anti-CPS1 (Abcam, ab129076; 1:250), anti-GFAP (Beyotime, AF0156; 1:250), anti-IBA1 (Beyotime, AF7143; 1:250), anti-NeuN (Beyotime, AF1072; 1:250), and anti-ASS1 (Abcam, ab191165; 1:250). Tissue sections were probed with primary antibodies at 4°C for 12–16 hours. Following three rinses in PBS, the sections were incubated with species-matched secondary antibodies for 1 hour at 37°C. For immunohistochemical detection, a biotin-streptavidin-HRP system was employed to develop signals before mounting. For immunofluorescence, after secondary antibody treatment, sections were coverslipped with DAPI-containing antifade mounting medium (Yeasen, 40728ES03) and imaged via a Nikon confocal microscope configured for FITC and TRITC fluorescence channels. 2.6 RNA extraction and RT-qPCR For reverse transcription quantitative PCR (RT-qPCR), total RNA was extracted from tissue samples, after which its quality and concentration were measured. cDNA was then synthesized with a commercial reverse transcription kit (Beyotime, D7228) following the manufacturer's instructions. All primers, which were designed and supplied by Sangon Biotech (Shanghai, China), are listed in Table 1 . Amplification and quantification were carried out using a Bio-Rad real-time PCR detection system. Table 1 Primer sequences of target and reference genes Species Gene Sequence 5' to 3' Mouse Odc1 Forward TGCCACACTCAAAACCAGCAGG Reverse ACACTGCCTGAACGAAGGTCTC Mouse Cps1 Forward CATTGTGGGCGAATGCAACA Reverse ACAGCCTGGCATTCACTTCA Mouse Otc Forward GTCATTAGTGTTCCCAGAGGCA Reverse GGTGAGTAGTCTGTCAGCAGG Mouse Arg1 Forward CATTGGCTTGCGAGACGTAGAC Reverse GCTGAAGGTCTCTTCCATCACC Mouse Ass1 Forward CACTCTACGAGGACCGCTATCT Reverse CTCAAAGCGGACCTGGTCATTC Mouse Asl Forward GGCAGAGACTAAAGGAGTGGCT Reverse TCGACACTGGATTTCGCTGTGC Mouse P53 Forward GCGTAAACGCTTCGAGATGTT Reverse TTTTTATGGCGGGAAGTAGACTG Mouse β-actin Forward GTGCTATGTTGCTCTAGACTTCG Reverse ATGCCACAGGATTCCATACC Mouse Slc14a1 Forward AGGTGTGGCCTCAAAGTACTTGGCTA Reverse GATAGCAGCGTGCAGGCACATGAGT 2.7 Metabolites assay Urea, ammonia, and putrescine levels were quantified using commercial assay kits (BioAssay DIUR-500; UpingBio YPD1091; Gelatins JLC_K6002-96T), following the manufacturers' protocols. Additionally, concentrations of GABA, arginine, glutamate, citrulline, ornithine, and aspartate were determined using the following kits: Mlbio ml092747, ELK Biotechnology ELK7925, MeRCK MAK438-1KT, Biotopped TOPEL03427, Huabang Bio HB-P9S1559X, and MEIMIAN MM-51643H1. 2.8 Cell culture C8-D1A, BV2, Neuro-2a, SH-SY5Y, and PC12 cell lines (obtained from Procell) were cultured in high-glucose DMEM containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin at 37°C in a 5% CO₂ atmosphere. The medium was refreshed every 24 hours. When cells reached approximately 90% confluency, they were harvested using 0.25% trypsin for subculturing or experimental use. For the experiments, cells were randomly assigned to either a control group or a treatment group that received 10 mg/mL D-galactose for 24 hours prior to analysis. In parallel, Neuro-2a cells were treated with a range of concentrations of urea, putrescine, and ammonia over a 24-hour period. Neuro-2a cells were also subjected to transient transfection using siODC1 (designed and synthesized by Sangon Biotech, Shanghai, China; accession number: NM_013614), followed by a 72-hour incubation period prior to subsequent experimental procedures. 2.9 Construction of Protein-Protein Interaction (PPI) Network The PPI network was constructed based on the STRING database (version 11.5; https://string-db.org/ ). Differentially expressed proteins (or genes), represented by official gene symbols, were input into STRING. Only interactions with a composite confidence score greater than 0.7 (or an optional threshold of 0.4 or 0.9, where applicable) were deemed high-confidence and included for further analysis. The resulting interaction data, which contained pairwise relationship details and confidence scores, were retrieved in TSV format. The network was then visualized and further analyzed using Cytoscape software (version 3.9.1). Key hub genes were identified with the cytoHubba plugin through topological algorithms such as Maximal Clique Centrality (MCC) and Degree. Furthermore, the MCODE plugin was employed to identify densely connected functional modules under standard settings: degree cutoff = 2, node score cutoff = 0.2, k-core = 2, and max depth = 100. 2.10 Molecular docking Molecular docking was used to assess the binding of EVO to the target enzyme ODC1. The 3D structure of ODC1 was obtained from the Protein Data Bank (PDB) and preprocessed by removing non-protein molecules, adding hydrogen atoms, and assigning partial atomic charges. The prepared structure was then saved in PDBQT format for further docking studies. With AutoDock Vina (v1.2.2), the binding pocket was defined according to the position and size of the native ligand. The simulation produced several predicted binding poses and detailed molecular interactions, yielding estimated binding affinities as computed binding free energies for each conformation. 2.11 Statistical analysis All data are expressed as mean ± SEM from a minimum of three independent experiments. Statistical analyses were performed using GraphPad Prism 8.0, with significance levels denoted as follows: *p < 0.05, **p < 0.01, and ***p < 0.001. 3. Results 3.1 Urea cycle enzymes and metabolites are increased in the serum of aging populations Serum samples from elderly and younger adults were obtained from the Department of Medical Laboratory at Chongqing Hospital of Jiangsu Province Hospital. We excluded individuals with a history of major psychiatric disorders, such as schizophrenia or major depressive disorder, significant systemic diseases (including hepatic insufficiency [ALT > 75 U/L], renal failure [eGFR < 45 mL/min/1.73m²], or unstable cardiovascular disease), current or past alcohol or substance dependence, and any contraindications to MRI (e.g., cardiac pacemakers or severe claustrophobia). Biochemical assays showed significantly higher urea levels in the elderly group relative to the younger controls, while creatinine levels remained comparable between groups (Fig. 1 A). Serum urea concentration exhibited a positive correlation with age, whereas no significant age-dependent trend was observed for creatinine (Fig. S1 A). Assessments of cognitive and motor function revealed marked declines with aging. Higher urea levels were inversely correlated with functional performance, a relationship not seen with creatinine (Fig. S1 B–C). Western blot analysis further revealed elevated protein levels of key urea cycle enzymes and UT-B in aged subjects, accompanied by a marked upregulation of the senescence-associated marker P53 (Fig. 1 B-C). Subsequent ELISA-based metabolite profiling showed elevated aspartate (an amine donor), putrescine, and GABA, despite stable ammonia levels. The concentrations of key urea cycle intermediates, including glutamate, arginine, ornithine, and citrulline, remained unchanged, suggesting enhanced metabolic flux without accumulation of intermediates (Fig. 1 D). Ornithine was preferentially converted to putrescine rather than glutamate. 3.2 Aging mice show marked cognitive and motor dysfunction We developed a murine model of aging induced by D-galactose administration (Fig. 2 A). During the modeling process, mice in the D-gal group exhibited a marked decrease in body weight. Consistent with human findings, aged mice showed increased urea levels without significant changes in creatinine (Fig. 2 B). Behavioral assessments revealed significant impairments in both cognitive and motor function among aged mice. During the Morris water maze test, these animals exhibited a reduction in the number of platform crossings and decreased time spent in the target quadrant (Fig. 2 C). The novel object recognition test revealed reduced discrimination and recognition indices (Fig. 2 D). Y-maze performance showed decreased spontaneous alternation and center entries, suggesting impaired spatial working memory (Fig. 2 E). In the elevated plus maze, aging mice spent less time in and entered less frequently the open arms (Fig. 2 F). Motor function assessments—open field, grip strength, and rotarod tests—all indicated significant coordination and strength impairments (Fig. 2 G-H). Serum urea levels negatively correlated with cognitive and motor performance metrics, whereas creatinine showed no correlation (Fig. S1 D-E). 3.3 Urea cycle enzymes and associated metabolites show significant upregulation in the aging mouse brain The activity of the brain urea cycle remains debated. Previous reports suggest that urea metabolism is non-cyclic under physiological conditions but becomes cyclic in Alzheimer’s disease with concomitant enzyme upregulation [ 29 ] . To assess urea cycle (UC) activity in aged mice, we measured urea concentrations and expression of key UC enzymes in several functionally relevant brain regions, including the hippocampus, medial prefrontal cortex (mPFC), substantia nigra (SN), and striatum. The expression of senescence marker P53 was also increased (Fig. 3 A). Aged mice exhibited increased urea concentrations across all regions (Fig. 3 B). Transcript levels of six UC enzymes were variably elevated (Fig. 3 C-F), indicating region-specific UC activation. Metabolite analysis showed stable ammonia, elevated aspartate, putrescine, and GABA, and unchanged glutamate, arginine, ornithine, and citrulline, suggesting sustained metabolic flux without intermediate accumulation (Fig. S2A-D). Notably, UT-B, the primary urea transporter in the brain, was upregulated (Fig. 3 G). 3.4 ARG1 and ODC1 are highly expressed specifically in neurons across multiple aging brain regions Immunohistochemical findings indicated substantial upregulation of urea cycle enzymes across various brain regions, with ARG1 and ODC1 exhibiting the most prominent increases (Fig. S3A). Immunofluorescence further confirmed the age-dependent elevation of ODC1 and ARG1. Neither enzyme co-localized with astrocytes (GFAP⁺) or microglia (IBA1⁺), both of which showed aging-related activation (Fig. S3B-C). Instead, both ODC1 and ARG1 were predominantly expressed in neurons, indicated by strong co-localization with the neuronal marker NeuN within the cytoplasmic compartment, despite an overall reduction in NeuN signal (Fig. 4 A–D). In vitro studies supported these observations. Western blot analysis revealed that D-galactose-induced senescence did not alter urea cycle enzyme expression in the astrocyte line C8-D1A or the microglial line BV2. By contrast, significant upregulation was detected in neuronal cell models, including Neuro-2a, SH-SY5Y, and PC12 cells (Fig. 4 E). Metabolite profiling in D-galactose-treated Neuro-2A cells also showed changes consistent with the in vivo aging phenotype (Fig. 4 F). 3.5 Inhibition or knockdown of ODC1 suppresses aging and urea cycle activation Protein-protein interaction (PPI) network analysis indicated that the senescence-related marker P53 interacts with ODC1, but not with ARG1 (Fig. 5 A). Given that ODC1 has been previously identified as the most significantly dysregulated protein in this context, we administered the ODC1 inhibitor DFMO to aging mice (Fig. 5 B). DFMO treatment effectively normalized serum levels of urea and creatinine (Fig. 5 C) and ameliorated cognitive and motor impairments in behavioral tests (Fig. S4A-G). Interestingly, ODC1 inhibition also reduced urea content (Fig. 5 D) and downregulated major urea cycle enzymes in the brain (Fig. 5 E). Metabolite profiling showed decreased ammonia, putrescine, and GABA; unchanged arginine, citrulline, and aspartate; and elevated ornithine and glutamate (Fig. S4H-K). As a metabolic hub linking ornithine utilization, polyamine synthesis, and urea cycle function, ODC1 inhibition blocks the conversion of ornithine to putrescine, thereby disrupting putrescine synthesis and consequently GABA production. Concurrently, ornithine accumulation promotes ammonia clearance through the urea cycle. These findings underscore the central role of ODC1 in coordinating polyamine biosynthesis and nitrogen metabolism. Alongside these changes, UT-B expression was downregulated following urea treatment (Fig. 5 F), while P53 expression was decreased in the aged brain after DFMO treatment (Fig. 5 G). In vitro knockdown of ODC1 using siRNA in neuronal cells reproduced these phenotypic outcomes (Fig. 5 H-I). 3.6 The accumulation of urea cycle metabolites drives cellular senescence To investigate the direct impact of urea on neuronal function, Neuro-2A cells were exposed to a range of urea concentrations [ 23 ] . Treatment with urea led to elevated expression of P53, together with increased levels of major urea cycle enzymes, UT-B, GABA, and putrescine (Fig. 6 A–B). We treated neurons with physiological, pathological, and high concentrations of putrescine. Exposure to physiological concentrations did not promote senescence or upregulate the urea cycle; in contrast, both pathological and high concentrations markedly accelerated cellular senescence and enhanced urea cycle activity. However, the concentration of ammonia remained unchanged (Fig. 6 C-D). The treatment of cells with increasing concentrations of ammonia [ 30 ] (ammonium chloride) demonstrated that senescence was promoted and the urea cycle was enhanced only at higher concentrations, whereas lower levels had no observable effect (Fig. 6 E-F). UT-B −/− mice (Slc14a1 gene-deficient) exhibit systemically elevated urea levels despite normal renal function, providing a suitable model for studying isolated hyperuremia [ 31 ] . UT-B −/− mice exhibited elevated serum urea levels, while creatinine levels remained unchanged (Fig. 7 A). Behavioral studies revealed marked cognitive deficits in UT-B −/− mice (Fig. 7 B-E). However, UT-B −/− mice exhibited no significant motor dysfunction (Fig. 7 F-H). Elevated urea was detected in several brain regions, including the hippocampus and mPFC, but not in the substantia nigra or striatum (Fig. 7 I). Similar to aging mice, UT-B −/− mice exhibited elevated levels of the brain senescence marker P53, key urea cycle enzymes, and the contents of putrescine and GABA (Fig. 7 J-L). These results established a role for urea cycle metabolites in promoting brain aging. 3.7 Evodiamine attenuates aging mice cognitive and motor impairment via urea cycle Molecular docking results demonstrated that EVO forms stable interactions with ODC1, exhibiting a binding free energy of − 8.345 kcal/mol across multiple conformational clusters, which suggests high-affinity binding and a thermodynamically favorable interaction profile (Fig. 8 K). Following EVO treatment (Fig. 8 A), aged mice exhibited increased body weight and reduced serum urea levels, although creatinine levels remained unaltered (Fig. 8 B). Histopathological evaluation of brain tissues indicated that D-galactose-induced neuronal loss—consistent with natural aging—was attenuated by EVO administration, which also improved neuronal count and morphology (Fig. 8 C). Behavioral assessments demonstrated that EVO alleviated cognitive and motor deficits in aged mice (Fig. S5A-G). EVO intervention also led to reduced urea content across four brain regions (Fig. 8 D), accompanied by downregulation of key urea cycle enzymes (Fig. 8 E-H, S5I-K). Moreover, expression of UT-B and p53 was suppressed (Fig. 8 I-J), and concentrations of ammonia and putrescine were decreased (Fig. S5L-M). Discussion Epidemiological studies indicate that a significant proportion of the elderly population experiences coexisting cognitive and motor impairments [ 32 ] . Alterations in metabolic processes are well-established markers associated with both brain aging and neurodegenerative pathologies [ 4 ] . The urea cycle, first identified in the liver, is essential for detoxifying excess nitrogen and ammonia by converting them into urea. In neurological diseases, the UC is implicated in hyperammonemia, which can cause a loss of glutamine transporter activity and subsequently impair learning and memory [ 33 ] . Such dysregulation is increasingly regarded as instrumental in the development of neurological diseases [ 34 , 35 ] . Within this cycle, arginine is metabolized into urea and ornithine [ 36 ] , with the latter serving as a precursor for putrescine and eventually GABA. This series of reactions demonstrates a critical metabolic link, connecting the urea cycle not only to polyamine metabolism but also to the GABAergic system. Although these metabolites are indispensable for normal neural functioning, their abnormal levels have been associated with neurodegenerative mechanisms [ 37 ] . In addition to the key enzymes and intermediate products of UC, researchers are also interested in the impact of the final metabolite urea on the nervous system [ 31 ] . Our study demonstrated that elevated serum urea levels in aged mice were inversely correlated to cognitive and motor performance, suggesting that urea is a significant contributor to functional decline. In the D-gal-induced aging model, a marked increase in urea was observed in key regions governing cognitive and motor function, including the hippocampus, mPFC, SN, and Striatum, thereby recapitulating the neuropathology of human aging. Thus, urea dysregulation likely plays a direct pathogenic role rather than being a secondary epiphenomenon. Aged mouse brains showed increased expression of key enzymes involved in nitrogen clearance, an adaptive change that likely maintains stable ammonia levels and alleviates neurotoxic burden [ 29 ] . Our results showed that while this process detoxified ammonia, exposure to high concentrations of ammonia itself induced cellular senescence in neurons, revealing a dual role for the urea cycle in aging. Putrescine, a metabolic byproduct of polyamine metabolism, is a neurotoxic intermediate [ 38 ] . While it does not induce cellular senescence at physiological concentrations, it promotes senescence-related phenotypes at elevated concentrations. Following the induction of cellular senescence, neurons exhibited urea cycle activation, whereas astrocytes and microglia showed no significant changes. During aging, neurons exhibit heightened susceptibility to energy exhaustion and excitotoxicity compared to glial cells [ 39 ] . This differential vulnerability stems from their high metabolic demand, post-mitotic nature, and reliance on oxidative phosphorylation, making them more prone to mitochondrial dysfunction and calcium-mediated excitotoxic injury [ 40 ] . The results of the present study demonstrated that urea cycle-related metabolites exhibit significant differences across four brain regions: the hippocampus, cortex, substantia nigra, and striatum, suggesting pronounced regional heterogeneity in the regulation of cerebral nitrogen metabolism. These variations may be closely associated with the distinct cellular composition, functional specialization, and metabolic demands of each region. As a key center for learning and memory, the hippocampus exhibits high synaptic plasticity and frequent neural activity, which likely contribute to elevated ammonia production. This necessitates enhanced urea cycle activity to maintain nitrogen homeostasis [ 41 ] . Cortical areas, particularly advanced cognitive regions such as the prefrontal cortex, host diverse neuronal populations, which may account for the observed elevations in urea cycle intermediates [ 42 ] . The substantia nigra, rich in dopaminergic neurons, demonstrates high mitochondrial respiratory activity and elevated oxidative stress, potentially leading to increased ammonia generation and a consequent reliance on urea cycle functionality [ 43 ] . In contrast, the striatum, a central hub for motor control, comprises extensive medium spiny neurons and receives substantial glutamatergic input from the cortex. Its metabolic profile appears oriented toward rapid energy supply and neurotransmitter recycling, which may explain its relatively lower urea cycle activity. Overall, the regional disparities in urea cycle activity reflect adaptations to localized energy metabolism patterns, neurotransmitter turnover demands, and ammonia exposure levels. This can be viewed as a form of metabolic specialization within the nervous system. ODC1 is increasingly implicated as a key gene in neurodevelopmental disorders and the underlying processes of brain development [ 44 ] . Inhibition or knockdown of ODC1 alleviated the aging phenotype, concurrent with an attenuation of urea cycle activation, including reduced levels of urea, ammonia, putrescine, and GABA, and decreased activities of key urea cycle enzymes. In light of this, downregulation or knockout of ODC1 may protect neurons, particularly during metabolic stress. Similar to observations in Parkinson’s disease models, where modulation of polyamine metabolism demonstrated neuroprotective effects, reduced ODC1 activity in our study may alleviate ammonia-induced excitotoxicity and oxidative damage, thereby helping maintain neuronal function [ 34 ] . This protective mechanism could be particularly critical in vulnerable regions such as the substantia nigra, where high dopamine turnover and mitochondrial activity amplify ammonia production. Beyond endogenous metabolic regulation, our study also highlights the therapeutic potential of evodiamine, a natural alkaloid, as a novel ODC1 inhibitor. Previous research on evodiamine has primarily focused on its anti-tumor [ 45 ] , anti-inflammatory [ 46 ] , and analgesic properties [ 47 ] . Particularly in oncology, evodiamine has been shown to induce cell cycle arrest and apoptosis at high concentrations, suggesting a role in modulating cell proliferation pathways [ 48 ] . However, its effects in the context of neurological disorders, especially those associated with ammonia toxicity and polyamine dysregulation, remain largely unexplored. A key innovative aspect of our study is the integration of computational molecular docking with experimental validation. Docking simulations demonstrated that evodiamine binds stably to the active site of ODC1, forming specific hydrogen bonds and hydrophobic interactions with key residues, suggesting a direct inhibitory mechanism. This finding provides a molecular structural basis for its putative role in modulating ODC1 activity. Importantly, our functional experiments showed that evodiamine treatment significantly lowered putrescine levels in ammonia-stressed neurons, while also reducing excitotoxicity and oxidative damage—effects consistent with those seen in ODC1-knockdown models. These results not only underscore the neuroprotective effect of ODC1 inhibition but also highlight evodiamine as a promising candidate for developing therapies against hyperammonemia-related neuropathologies. To our knowledge, this is the first study to identify evodiamine as an ODC1-targeting agent with neuroprotective effects. Our combined computational and experimental approach provides a mechanistic basis for its therapeutic potential and suggests new avenues for repurposing natural compounds in treating metabolic neurological disorders. Emerging evidence indicates that high urea levels may independently contribute to the development of psychiatric disorders, including depression and anxiety, partly through impairing synaptic plasticity and promoting depressive-like behaviors [ 23 , 49 ] . Elevated urea levels during aging were associated with cognitive and motor dysfunction, and treating neurons with a high concentration of urea was found to induce an aging phenotype. Urea transporters (UTs), which mediate urea transit across membranes [ 50 ] . In young UT-B −/− mice, a stark rise in urea and its metabolic enzymes coincided with cognitive decline, while motor function remained intact—a contrast potentially explained by uneven urea distribution across brain regions [ 51 ] . However, this study has several limitations. Although D-galactose-induced aging mice serve as a valuable model for investigating metabolic disorders [ 52 ] , naturally aged mice offer a more physiologically relevant representation of aging processes and are therefore superior for translational research. The neurotoxic potential of accumulated ammonia and the signaling role of polyamines in protein aggregation pathways remain important areas for future investigation. Furthermore, investigating UT-B as a target for anti-aging therapeutics represents a promising strategic direction for future research. In conclusion, the urea cycle plays a paradoxical role in aging and neuropathy. While its excessive activation is a key driver of the aging process, it also serves the essential function of detoxifying metabolic waste. Understanding this dual nature has significant translational value, providing a strategic foundation for developing novel therapies against neuroinflammation and metabolic disorders. Declarations Declaration of competing interest The authors state that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. CRediT authorship contribution statement Shengyao Zhang: Validation, Project administration. Meng Zhang: Investigation. Junling Luo: Formal analysis. Han Wei: Formal analysis. Guoran Wan: Software. Qiongfang Wang: Resources. Jian Wang: Methodology. Jiajie Leng: Formal analysis. Jing Li: Funding acquisition. Dilong Chen: Funding acquisition. Shuliang Niu: Funding acquisition. Qiu Chen: Funding acquisition. Boyue Huang: Funding acquisition, Supervision. Jianhua Ran: Visualization, Funding acquisition, Conceptualization. Acknowledgments The authors sincerely acknowledge the financial support received from various funding agencies. This work was funded by the Key Projects of Chongqing Key Laboratory of Development and Utilization of Genuine Medicinal Materials in Three Gorges Reservoir Area (Grant Nos. KFKT2022001 to J.R. and KFKT2022010 to B.H.). Major funding was also obtained from the National Natural Science Foundation of China (Grants 81770738 and 82370739 to J.R.). Additional support was provided by the Chongqing Science and Technology Commission (Project CSTB2023NSCQ-MSX0510 to J.R.), the Chongqing Education Commission Science Foundation (Grant KJQN202400417 to B.H.), and the Chongqing Natural Science Foundation (Award CSTB2024NSCQ-KJFZMSX0075 to B.H.). D.C. was supported by the Chongqing Key Laboratory (Sys20210008), the Innovative Research Group Project of Natural Drug Antitumor of Chongqing Municipal Education Commission (CXQT20030), the Chongqing Talent Plan (cstc2022ycjh-bgzxm0226), and the Science and Technology Research Program of Chongqing Municipal Education Commission (KJZD-M202202701). Further contributions included funding from the Natural Science Foundation of Xinjiang Uygur Autonomous Region (2024D01C125 to S.N.), the Noncommunicable Chronic Diseases-National Science and Technology Major Project (2023ZD0509400 to Q.C.), and the Chongqing Municipal Special Project for Technological Innovation and Application Development (General Program) (No. CSTB2024TIAD-GPX0029, to J. L.) Data Availability statement The data supporting the findings of this study are available from the corresponding author upon reasonable request. References HOU, Y., DAN, X.: Ageing as a risk factor for neurodegenerative disease [J]. Nat. Rev. Neurol. 15 (10), 565–581 (2019) BEARD, J.R., OFFICER, A., DE CARVALHO I A, et al.: The World report on ageing and health: a policy framework for healthy ageing [J]. Lancet. 387 (10033), 2145–2154 (2016) LóPEZ-OTíN, C., BLASCO M A, PARTRIDGE, L., et al.: The hallmarks of aging [J]. Cell. 153 (6), 1194–1217 (2013) MATTSON M P, ARUMUGAM, T.V.: Hallmarks of Brain Aging: Adaptive and Pathological Modification by Metabolic States [J]. Cell. Metab. 27 (6), 1176–1199 (2018) FONTANA, L., PARTRIDGE, L., LONGO V D: Extending healthy life span–from yeast to humans [J]. Science. 328 (5976), 321–326 (2010) CANIGLIA, J.L., JALASUTRAM, A., ASUTHKAR, S., et al.: Beyond glucose: alternative sources of energy in glioblastoma [J]. Theranostics. 11 (5), 2048–2057 (2021) MORRIS S M, J.R.: Regulation of enzymes of the urea cycle and arginine metabolism [J]. Annu. Rev. Nutr. 22 , 87–105 (2002) BENSEMAIN, F., HOT, D.: Evidence for induction of the ornithine transcarbamylase expression in Alzheimer's disease [J]. Mol. Psychiatry. 14 (1), 106–116 (2009) PROKOP J W, BUPP C, P., FRISCH, A., et al.: Emerging Role of ODC1 in Neurodevelopmental Disorders and Brain Development [J]. Genes (Basel), 12 (4). (2021) WANG, H., RAN, J., Urea, J.I.A.N.G.T.: [J] Subcell. Biochem. 73 , 7–29 (2014) WANG, L., XING, X., ZENG, X., et al.: Spatially resolved isotope tracing reveals tissue metabolic activity [J]. Nat. Methods. 19 (2), 223–230 (2022) HANSMANNEL, F., LENDON, C., PASQUIER, F., et al.: Is the ornithine transcarbamylase gene a genetic determinant of Alzheimer's disease? [J]. Neurosci. Lett. 449 (1), 76–80 (2009) NEILL M A, ASCHNER, J., BARR, F., et al.: Quantitative RT-PCR comparison of the urea and nitric oxide cycle gene transcripts in adult human tissues [J]. Mol. Genet. Metab. 97 (2), 121–127 (2009) WU, G., BAZER F W, DAVIS T A, et al.: Arginine metabolism and nutrition in growth, health and disease [J]. Amino Acids. 37 (1), 153–168 (2009) OJA, S.S., SARANSAARI, P.: Neurotoxicity of Ammonia [J]. Neurochem Res. 42 (3), 713–720 (2017) SEQUERRA E B, GARDINO, P., HEDIN-PEREIRA C, et al.: Putrescine as an important source of GABA in the postnatal rat subventricular zone [J]. Neuroscience. 146 (2), 489–493 (2007) IGARASHI, K., KASHIWAGI, K.: The functional role of polyamines in eukaryotic cells [J]. Int. J. Biochem. Cell. Biol. 107 , 104–115 (2019) RANGROO THRANE V, THRANE A S, WANG, F., et al.: Ammonia triggers neuronal disinhibition and seizures by impairing astrocyte potassium buffering [J]. Nat. Med. 19 (12), 1643–1648 (2013) XU, J., BEGLEY P, C.H.U.R.C.H.S.J., et al.: Graded perturbations of metabolism in multiple regions of human brain in Alzheimer's disease: Snapshot of a pervasive metabolic disorder [J]. Biochim. Biophys. Acta. 1862 (6), 1084–1092 (2016) GLAAB E, TREZZI J P, GREUEL, A., et al.: Integrative analysis of blood metabolomics and PET brain neuroimaging data for Parkinson's disease [J]. Neurobiol. Dis. 124 , 555–562 (2019) PATASSINI, S., BEGLEY, P., REID S J, et al.: Identification of elevated urea as a severe, ubiquitous metabolic defect in the brain of patients with Huntington's disease [J]. Biochem. Biophys. Res. Commun. 468 (1–2), 161–166 (2015) HANDLEY R R, REID S J, BRAUNING, R., et al.: Brain urea increase is an early Huntington's disease pathogenic event observed in a prodromal transgenic sheep model and HD cases [J]. Proc. Natl. Acad. Sci. U S A. 114 (52), E11293–e302 (2017) WANG, H., HUANG, B., WANG, W., et al.: High urea induces depression and LTP impairment through mTOR signalling suppression caused by carbamylation [J]. EBioMedicine. 48 , 478–490 (2019) HUANG, B., WANG, H.: Expression of Urea Transporter B in Normal and Injured Brain [J]. Front. Neuroanat. 15 , 591726 (2021) YANG, C., WU, X., JIANG, Z., et al.: Evodiamine rescues lipopolysaccharide-induced cognitive impairment via C/EBP-β-COX2 axis-regulated neuroinflammation [J]. Int. J. Biol. Macromol. 300 , 139597 (2025) AZMAN K F, Z.A.K.A.R.I.A.R.: D-Galactose-induced accelerated aging model: an overview [J]. Biogerontology. 20 (6), 763–782 (2019) WU, M., HUANG, B.: Ganoderma lucidum polysaccharides ameliorates D-galactose-induced aging salivary secretion disorders by upregulating the rhythm and aquaporins [J]. Exp. Gerontol. 175 , 112147 (2023) YANG, B., BANKIR, L.: Urea-selective concentrating defect in transgenic mice lacking urea transporter UT-B [J]. J. Biol. Chem. 277 (12), 10633–10637 (2002) JU Y H, BHALLA, M.: Astrocytic urea cycle detoxifies Aβ-derived ammonia while impairing memory in Alzheimer's disease [J]. Cell. Metab. 34 (8), 1104–20e8 (2022) BODEGA, G., SUáREZ, I., LóPEZ-FERNáNDEZ, L.A., et al.: Possible implication of ciliary neurotrophic factor (CNTF) and beta-synuclein in the ammonia effect on cultured rat astroglial cells: a study using DNA and protein microarrays [J]. Neurochem Int. 48 (8), 729–738 (2006) HUANG, B., HUANG, Z., WANG, H., et al.: High urea induces anxiety disorders associated with chronic kidney disease by promoting abnormal proliferation of OPC in amygdala [J]. Eur. J. Pharmacol. 957 , 175905 (2023) OVEISGHARAN, S., WANG, T., BARNES L L, et al.: The time course of motor and cognitive decline in older adults and their associations with brain pathologies: a multicohort study [J]. Lancet Healthy Longev. 5 (5), e336–e45 (2024) NATESAN, V., MANI, R.: Clinical aspects of urea cycle dysfunction and altered brain energy metabolism on modulation of glutamate receptors and transporters in acute and chronic hyperammonemia [J]. Biomed. Pharmacother. 81 , 192–202 (2016) ZHANG, S., WAN, G., QIU, Y., et al.: Urea cycle dysregulation drives metabolic stress and neurodegeneration in Parkinson's disease [J]. NPJ Parkinsons Dis. 11 (1), 237 (2025) ELDRIDGE, R.C., UPPAL, K., SHOKOUHI, M., et al.: Multiomics Analysis of Structural Magnetic Resonance Imaging of the Brain and Cerebrospinal Fluid Metabolomics in Cognitively Normal and Impaired Adults [J]. Front. Aging Neurosci. 13 , 796067 (2021) TAKIGUCHI, M.: MORI M. Transcriptional regulation of genes for ornithine cycle enzymes [J]. Biochem J, 312 (Pt 3)(Pt 3): 649 – 59. (1995) HäBERLE, J., BURLINA, A., CHAKRAPANI, A., et al.: Suggested guidelines for the diagnosis and management of urea cycle disorders: First revision [J]. J. Inherit. Metab. Dis. 42 (6), 1192–1230 (2019) RUSHAIDHI, M., JING, Y., KENNARD J T, et al.: Aging affects L-arginine and its metabolites in memory-associated brain structures at the tissue and synaptoneurosome levels [J]. Neuroscience. 209 , 21–31 (2012) MATTSON M P, M.A.G.N.U.S.T.: Ageing and neuronal vulnerability [J]. Nat. Rev. Neurosci. 7 (4), 278–294 (2006) BONVENTO, G., BOLAñOS, J.P.: Astrocyte-neuron metabolic cooperation shapes brain activity [J]. Cell. Metab. 33 (8), 1546–1564 (2021) COOPER, A.J.: Biochemistry and physiology of brain ammonia [J]. Physiol. Rev. 67 (2), 440–519 (1987) HERTZ, L., ROTHMAN, D.L., Glucose: Lactate, β-Hydroxybutyrate, Acetate, GABA, and Succinate as Substrates for Synthesis of Glutamate and GABA in the Glutamine-Glutamate/GABA Cycle [J]. Adv. Neurobiol. 13 , 9–42 (2016) GAN Z, VAN DER STELT I, LI, W., et al.: Mitochondrial Nicotinamide Nucleotide Transhydrogenase: Role in Energy Metabolism, Redox Homeostasis, and Cancer [J]. Antioxid Redox Signal, 41(13–15): 927 – 56. (2024) RAGHAVENDRA RAO V L, DOGAN, A., BOWEN K K, et al.: Ornithine decarboxylase knockdown exacerbates transient focal cerebral ischemia-induced neuronal damage in rat brain [J]. J. Cereb. Blood Flow. Metab. 21 (8), 945–954 (2001) WANG, Z., XIONG, Y., PENG, Y., et al.: Natural product evodiamine-inspired medicinal chemistry: Anticancer activity, structural optimization and structure-activity relationship [J]. Eur. J. Med. Chem. 247 , 115031 (2023) KO H C, WANG Y H, LIOU K T, et al.: Anti-inflammatory effects and mechanisms of the ethanol extract of Evodia rutaecarpa and its bioactive components on neutrophils and microglial cells [J]. Eur. J. Pharmacol. 555 (2–3), 211–217 (2007) LIN, L., LIU, Y., TANG, R., et al.: Evodiamine: A Extremely Potential Drug Development Candidate of Alkaloids from Evodia rutaecarpa [J]. Int. J. Nanomed. 19 , 9843–9870 (2024) YU H I, CHANG H Y, LU C H, et al.: Evodiamine exerts anti-cancer activity including growth inhibition, cell cycle arrest, and apoptosis induction in human follicular thyroid cancers [J]. Am. J. Cancer Res. 14 (10), 4989–4999 (2024) ZHAO, X., ZHANG, S., WU, M., et al.: High urea promotes mitochondrial fission and functional impairments in astrocytes inducing anxiety-like behavior in chronic kidney disease mice [J]. Metab. Brain Dis. 40 (5), 186 (2025) STEWART G: The emerging physiological roles of the SLC14A family of urea transporters [J]. Br. J. Pharmacol. 164 (7), 1780–1792 (2011) SCHOLEFIELD, M., CHURCH S J, XU, J., et al.: Severe and Regionally Widespread Increases in Tissue Urea in the Human Brain Represent a Novel Finding of Pathogenic Potential in Parkinson's Disease Dementia [J]. Front. Mol. Neurosci. 14 , 711396 (2021) HO S C, LIU J H, WU, R.Y.: Establishment of the mimetic aging effect in mice caused by D-galactose [J]. Biogerontology. 4 (1), 15–18 (2003) Additional Declarations There is NO Competing Interest. Supplementary Files SupplementfileforOriginalwesternblots.pdf Supplement file for Original western blots RS356.pdf Reporting Summary Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7778304","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":527378358,"identity":"42bb0ab6-a731-445e-abb8-81c112fb1f2b","order_by":0,"name":"Jianhua Ran","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6UlEQVRIiWNgGAWjYJACgwQGBiBiPgDlJxCthQ2mlAgtUGU8BsRpMW8/e6DgQc2dPIPjZz5+eJtzmIGfPceA4ecO3FpkzuQlGCQce1ZscCZ3s+TcbYcZJHveGDD2nsGtRYIhx8Agge1w4oYDuduYeYFaDG7kGDAztuHRwv8GqOUfUMv5N8/AWuwJapEA2pLYBtRyI4cNYosEQS1AWxL7DifOvPHMGOiXdB6JM88KDvbidViOmeGPb4cT+84nP/zwdpu1HH978sYHP/FoAQI2AziTB4wYGA7g1QBMKA+QtYyCUTAKRsEowAAAcS9Vdo/2Gu8AAAAASUVORK5CYII=","orcid":"","institution":"Chongqing Medical University","correspondingAuthor":true,"prefix":"","firstName":"Jianhua","middleName":"","lastName":"Ran","suffix":""},{"id":527378359,"identity":"c4b37b00-a4ea-4747-9925-be9b97074cef","order_by":1,"name":"Shengyao Zhang","email":"","orcid":"","institution":"Chongqing Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shengyao","middleName":"","lastName":"Zhang","suffix":""},{"id":527378360,"identity":"19ab44bd-fd68-415e-94f5-99cb856d779f","order_by":2,"name":"Meng Zhang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Meng","middleName":"","lastName":"Zhang","suffix":""},{"id":527378361,"identity":"c73b27a8-dd6d-4695-a1f2-e80907b1da66","order_by":3,"name":"Junling Luo","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Junling","middleName":"","lastName":"Luo","suffix":""},{"id":527378362,"identity":"7ad24574-9b27-435a-80dc-73078ac83eaa","order_by":4,"name":"Han Wei","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Han","middleName":"","lastName":"Wei","suffix":""},{"id":527378363,"identity":"055e3842-bca0-44eb-bb5a-2ca6a95f6368","order_by":5,"name":"Guoran Wan","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Guoran","middleName":"","lastName":"Wan","suffix":""},{"id":527378364,"identity":"3f53db40-f59f-445d-a956-b62945102d22","order_by":6,"name":"Qiongfang Wang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Qiongfang","middleName":"","lastName":"Wang","suffix":""},{"id":527378365,"identity":"7f1ef4c4-2974-4531-ac5f-6a7e8344696f","order_by":7,"name":"Jian Wang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Wang","suffix":""},{"id":527378366,"identity":"25fdd842-085a-4b93-b3d0-6f45760e8406","order_by":8,"name":"Jiajie Leng","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Jiajie","middleName":"","lastName":"Leng","suffix":""},{"id":527378367,"identity":"4e8ba390-a671-4b9d-8f5e-d3e05a32947b","order_by":9,"name":"Jing Li","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Li","suffix":""},{"id":527378368,"identity":"3313b61f-b532-446a-9ea9-0f7f77d418a0","order_by":10,"name":"Dilong Chen","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Dilong","middleName":"","lastName":"Chen","suffix":""},{"id":527378369,"identity":"438cd6c7-8f10-408e-9852-3f5a6af8a74b","order_by":11,"name":"Shuliang Niu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Shuliang","middleName":"","lastName":"Niu","suffix":""},{"id":527378370,"identity":"e080984b-6742-4f61-9ab3-d7d1c1facdd1","order_by":12,"name":"Qiu Chen","email":"","orcid":"https://orcid.org/0000-0003-1089-4194","institution":"Hospital of Chengdu University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Qiu","middleName":"","lastName":"Chen","suffix":""},{"id":527378371,"identity":"7912d629-71af-47d5-88d8-b3f570408d4c","order_by":13,"name":"Boyue Huang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Boyue","middleName":"","lastName":"Huang","suffix":""}],"badges":[],"createdAt":"2025-10-04 08:05:07","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7778304/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7778304/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":96363262,"identity":"1480cc90-9fd5-47d7-b5c9-7655ab19c602","added_by":"auto","created_at":"2025-11-20 10:05:49","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6714374,"visible":true,"origin":"","legend":"","description":"","filename":"manscrupit.docx","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/a5ca6c65a068103cd391c4a1.docx"},{"id":96362988,"identity":"91dbb046-d915-4e66-8eda-cf8bcac9b306","added_by":"auto","created_at":"2025-11-20 10:03:32","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18493,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/a1836800a08befeadb3c5866.docx"},{"id":96363893,"identity":"1811562e-85f6-4584-aa9a-df90976eaeea","added_by":"auto","created_at":"2025-11-20 10:08:22","extension":"json","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14907,"visible":true,"origin":"","legend":"","description":"","filename":"COMMSBIO259668.json","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/25e416460b66acca23134600.json"},{"id":96362766,"identity":"5ec8e593-5dc5-4161-b52b-00d97ac7bc5b","added_by":"auto","created_at":"2025-11-20 09:48:37","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1670204,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementfileforOriginalwesternblots.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/8944b54829eec01a35fae122.pdf"},{"id":96264694,"identity":"292489ca-c3c4-4142-ae9a-e5d3dd745087","added_by":"auto","created_at":"2025-11-19 08:35:18","extension":"xml","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":131580,"visible":true,"origin":"","legend":"","description":"","filename":"COMMSBIO2596680enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/660ae8113f108a656c0c4d5d.xml"},{"id":96362854,"identity":"a173360e-61e7-40c6-b276-7172cb6d5f92","added_by":"auto","created_at":"2025-11-20 10:01:55","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":390422,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/0eec4da2c400cafc36396794.jpeg"},{"id":96364075,"identity":"83ea0c94-4f0a-43ef-a64c-86921608a087","added_by":"auto","created_at":"2025-11-20 10:08:51","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":514636,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/842e4d74f0a4d1e212dcbae2.jpeg"},{"id":96362778,"identity":"d38bb367-8f12-419d-82cd-dd205ec1dd94","added_by":"auto","created_at":"2025-11-20 09:49:49","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":390254,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/d2882f9ffa69d04ba79a75d3.jpeg"},{"id":96264700,"identity":"ce96aa45-0644-4806-920c-0805018278a5","added_by":"auto","created_at":"2025-11-19 08:35:19","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1699548,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/4260f2a535263329e6c6fd21.jpeg"},{"id":96363015,"identity":"b693ce53-3152-479a-83e2-fdc373d6020a","added_by":"auto","created_at":"2025-11-20 10:03:41","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":510396,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/7ae59b4e588dd8e97e433cc1.jpeg"},{"id":96264706,"identity":"513d93c2-a1f0-4a2d-9933-54c24a0147ee","added_by":"auto","created_at":"2025-11-19 08:35:19","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":867560,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/d12e0d96a2bed66a8062a42f.jpeg"},{"id":96264708,"identity":"dc12108c-a09d-496b-b575-722234d0b332","added_by":"auto","created_at":"2025-11-19 08:35:19","extension":"jpeg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":633492,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/1b16cae59c9af1448df9cd83.jpeg"},{"id":96264718,"identity":"c237c681-f2b7-481c-b1fc-7e5807e468b8","added_by":"auto","created_at":"2025-11-19 08:35:19","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1561734,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/d6118d08b6018885e29ea4ce.jpeg"},{"id":96264704,"identity":"84e6ab99-db3b-4e1d-8363-a69c0786fe53","added_by":"auto","created_at":"2025-11-19 08:35:19","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":70876,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/3a1351b6ddab58502e2ed2a8.png"},{"id":96264712,"identity":"e6b5f6d0-78d2-45d2-8f16-8b5bb1719f9b","added_by":"auto","created_at":"2025-11-19 08:35:19","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":83063,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/d404c658eda97573c8502eb7.png"},{"id":96363292,"identity":"8c7b63ad-57c3-4361-a446-b4ced24cf131","added_by":"auto","created_at":"2025-11-20 10:06:03","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":59982,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/4195974e987a412d6a26425c.png"},{"id":96264714,"identity":"19c02c2d-b210-42f2-9aca-b22f85292ee2","added_by":"auto","created_at":"2025-11-19 08:35:19","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":216046,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/d0412edaa0b8b00fd47fd1e1.png"},{"id":96363858,"identity":"22c87923-c7b4-48af-8fad-22bc10483cde","added_by":"auto","created_at":"2025-11-20 10:08:11","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":77531,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/07396b043004b76f44c7c0fd.png"},{"id":96264717,"identity":"b8755530-5adc-4cc8-9b26-7b463860ab17","added_by":"auto","created_at":"2025-11-19 08:35:19","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":136585,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/c8c2b58a305f160744045a1b.png"},{"id":96264716,"identity":"b87e3c63-7f45-4601-8a25-1678be6ab772","added_by":"auto","created_at":"2025-11-19 08:35:19","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":99810,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/65f918dd20d99db2ec23f9fe.png"},{"id":96363754,"identity":"1c32db36-8ef3-4db0-94d0-d24f1f7d5c40","added_by":"auto","created_at":"2025-11-20 10:07:56","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":239437,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/b9d04fa291042cadfcc24e19.png"},{"id":96264713,"identity":"099a03d7-9da9-4dff-8d44-7c10c9fc3d2b","added_by":"auto","created_at":"2025-11-19 08:35:19","extension":"xml","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":124709,"visible":true,"origin":"","legend":"","description":"","filename":"COMMSBIO2596680structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/a2eb7f6ff80ce930d662d15a.xml"},{"id":96264715,"identity":"489e19c2-441d-4e71-b6dc-393cb94e1cc6","added_by":"auto","created_at":"2025-11-19 08:35:19","extension":"html","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":137582,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/e5a9768c3e4116927371528d.html"},{"id":96363727,"identity":"738ecde1-b5f7-4a93-97df-d85852c23ff1","added_by":"auto","created_at":"2025-11-20 10:07:51","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1228984,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIncreased expression of urea cycle enzymes and related metabolites in the serum of aged individuals. \u003c/strong\u003e(A) Comparison of serum urea and creatinine concentrations between young and elderly cohorts (n = 30). (B) Western Blot of serum protein (n = 3). (C) Statistical plot of serum protein western blot (n = 3). (D) Detection of serum urea cycle metabolites (n = 3). Data are shown as mean ± SEM; statistical significance was assessed by Student’s t-test: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/5bde827049f6a9dfea40272a.png"},{"id":96264686,"identity":"d4faf63b-a9eb-4f7d-9b11-34abafa3f3ec","added_by":"auto","created_at":"2025-11-19 08:35:18","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1587762,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAging mice show marked cognitive and motor dysfunction. \u003c/strong\u003e(A) Establish of aging mice. (B) Body weight changes and serum urea/creatinine measurements (n = 6). (C) Mice WMN test (n = 6). (D) Mice NOR test (n = 6). (E) Mice Y-maze test (n = 6). (F) Mice EPM test (n = 6). (G) Mice OFT test (n = 6). (H) Mice rotarod test and grasp test (n = 6). Data are shown as mean ± SEM; statistical significance was assessed by Student’s t-test: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/bb5e9078b62667aee7e2730b.png"},{"id":96264689,"identity":"f4d045f1-ac8e-4fbb-8e76-9acd0e218154","added_by":"auto","created_at":"2025-11-19 08:35:18","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1029301,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUpregulation of urea cycle enzymes and associated metabolites in the brains of aged mice.\u003c/strong\u003e (A) Expression levels of P53 (n = 3).\u003cstrong\u003e \u003c/strong\u003e(B) Quantification of urea levels in brain tissue (n = 3). (C–F) Protein expression levels of major urea cycle enzymes in the hippocampus (C), medial prefrontal cortex (D), substantia nigra (E), and striatum (F) (n = 3). (G) Expression levels of UT-B (n = 3). Values represent mean ± SEM. Significant differences were evaluated using Student’s t-test: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/27628c058d4401839d526e3d.png"},{"id":96264695,"identity":"3d6d2951-e66b-491d-834f-41c8b7af0a85","added_by":"auto","created_at":"2025-11-19 08:35:18","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":6215527,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eARG1 and ODC are highly expressed specifically in neurons across multiple aging brain regions. \u003c/strong\u003e(A–D) Immunofluorescence labeling of ARG1 and ODC1 in the hippocampus (A), medial prefrontal cortex (B), substantia nigra (C), and striatum (D) (scale bar = 100 μm). (E) Western blot detection of urea cycle enzymes and urea transporters in C8-D1A, BV2, Neuro-2a, SH-SY5Y, and PC12 cells following D-galactose induction. (F) Metabolite concentrations associated with the urea cycle in D-galactose-treated Neuro-2a neurons (n = 3). Data are shown as mean ± SEM. Statistical significance was assessed by Student’s t-test: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/ce7f13dafb3ffb71056355d8.png"},{"id":96264697,"identity":"93f00b3d-aaaa-4512-a6c0-560ddb82616b","added_by":"auto","created_at":"2025-11-19 08:35:18","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1600656,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSuppression of ODC1 attenuates urea cycle activation and ameliorates aging phenotypes. \u003c/strong\u003e(A) Protein-protein interaction (PPI) network. (B) Body weight changes following DFMO administration. (C) Serum urea and creatinine concentrations after DFMO treatment. (D) Urea levels in brain tissue post-DFMO treatment (n = 3). (E) Expression profiles of key urea cycle enzymes in the brain following DFMO administration (n = 3). (F) UT-B expression changes in the brain induced by DFMO (n = 3). (G) P53 expression levels in the brain after DFMO exposure (n = 3). (H) Western blot analysis of ODC1 knockdown in Neuro2a cells (n = 3). (I) Alterations in urea cycle metabolite concentrations following ODC1 silencing (n = 3). Data are presented as mean ± SEM. Significant differences were determined using Student’s t-test: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/c4229e80dd3cca634a0ba24b.png"},{"id":96362823,"identity":"a7df4256-b6bb-4c74-8957-9d92bccca365","added_by":"auto","created_at":"2025-11-20 10:01:12","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2557267,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAccumulation of urea cycle metabolites promotes cellular senescence.\u003c/strong\u003e(A) Expression of major urea cycle enzymes and transporters in Neuro2a cells exposed to elevated urea (n = 3). (B) Metabolic changes in urea-treated Neuro2a cells (n = 3). (C) Protein expression in Neuro2a cells induced with varying doses of putrescine (n = 3). (D) Metabolite alterations in putrescine-stimulated Neuro2a cells (n = 3). (E) Western blot of urea cycle-associated proteins in Neuro2a cells under NH₄Cl stimulation (n = 3). (F) Metabolic profile of Neuro2a cells following NH₄Cl treatment (n = 3). Data are shown as mean ± SEM. Significance was assessed using Student’s t-test: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/0d2e336bab21f7770d4428ed.png"},{"id":96363762,"identity":"24314955-e71f-442f-a209-fc4e993773e3","added_by":"auto","created_at":"2025-11-20 10:07:58","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":2109615,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUT-B\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e−/−\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e mice exhibit elevated urea levels and cognitive deficits.\u003c/strong\u003e (A) Serum urea and creatinine concentrations in UT-B\u003csup\u003e−/−\u003c/sup\u003e mice (n = 3). (B–H) Behavioral performance of UT-B\u003csup\u003e−/−\u003c/sup\u003e mice in the water maze navigation (B), novel object recognition (C), Y-maze (D), elevated plus maze (E), open field (F), rotarod (G), and grip strength (H) tests (n = 6). (I) Quantification of urea levels in brain tissue of UT-B\u003csup\u003e−/−\u003c/sup\u003e mice (n = 3). (J, K) Western blot analysis of key urea cycle enzymes in the hippocampus (J) and medial prefrontal cortex (K) of UT-B\u003csup\u003e−/−\u003c/sup\u003e mice (n = 3). (L) Putrescine and GABA levels in UT-B\u003csup\u003e−/− \u003c/sup\u003emice (n = 3). Data are presented as mean ± SEM. Statistical significance was assessed by Student’s t-test: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/73d716dc2f64c9100f815d8f.png"},{"id":96363282,"identity":"983ed5c3-e5dd-4a2e-a7e7-6a01e8ae92c6","added_by":"auto","created_at":"2025-11-20 10:06:00","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":5712941,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEvodiamine improves cognitive and motor dysfunction in aging mice via urea cycle. \u003c/strong\u003e(A) Chemical structure of EVO and schematic of the treatment regimen. (B) Body weight and serum urea/creatinine ratio after EVO administration (n = 3). (C) HE staining of brain sections from EVO-treated mice. (D) Brain urea concentrations following EVO treatment (n = 3). (E-H) Western blot of key urea cycle enzymes in the hippocampus (E), medial prefrontal cortex (F), substantia nigra (G), and striatum (H) after EVO administration (n = 3). (I) UT-B protein expression post-EVO treatment (n = 3). (J) P53 expression levels after EVO intervention (n = 3). (K) Molecular docking analysis of evodiamine binding to ODC1. Values are expressed as mean ± SEM. Significant differences were determined using Student’s t-test: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/e33fcbd04d4a0f3aa0d8fe21.png"},{"id":99310958,"identity":"584c15ce-6480-48bf-842d-ecbb0f96bc86","added_by":"auto","created_at":"2025-12-31 16:13:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":22401049,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/1b680737-6b10-4d16-9a26-51cd8491c7ef.pdf"},{"id":96264693,"identity":"5699bcd1-2567-4a4e-a9b8-635e4d5dbd1e","added_by":"auto","created_at":"2025-11-19 08:35:18","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1670204,"visible":true,"origin":"","legend":"Supplement file for Original western blots","description":"","filename":"SupplementfileforOriginalwesternblots.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/2cc13241c815530afabdc6dd.pdf"},{"id":96264690,"identity":"c45d3579-586f-4150-8464-c456d775526c","added_by":"auto","created_at":"2025-11-19 08:35:18","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":2008781,"visible":true,"origin":"","legend":"Reporting Summary","description":"","filename":"RS356.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7778304/v1/8b5403e82376159a8eb2c67a.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"ODC1 delays neurodegenerative processes in aging by promoting ammonia detoxification via neuronal urea cycle activation","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAging is a significant risk factor for the development of neurodegenerative disorders, including Alzheimer's and Parkinson's diseases \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. Global demographic trends project that the population of older adults will reach approximately 2.1\u0026nbsp;billion by 2025, posing substantial public health challenges worldwide \u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. During aging, homeostatic mechanisms that maintain physiological balance across the body, organs, and tissues undergo progressive deterioration \u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. This decline contributes to nervous system and advancing neurodegeneration, which lead not only to cognitive deficits and motor impairments, but also to an increased risk of comorbidities and mortality \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eMetabolic dysregulation is a core feature of aging and is implicated in the development of age-related pathologies, including neurodegenerative diseases, cancer, and metabolic syndromes \u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. Recent neuroscientific research has shown that aging cells display significant disruptions in metabolic enzyme expression and a reduced capacity to adapt to stress, which aggravates tissue malfunction and increases disease vulnerability \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. Novel therapeutic approaches that target these metabolic pathways show potential in slowing the progression of age-related metabolic diseases.\u003c/p\u003e\u003cp\u003eThe urea cycle (UC), primarily known as a hepatic pathway essential for ammonia detoxification and nitrogen homeostasis \u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e, has recently been shown to operate in extrahepatic tissues as well \u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Challenging the conventional view of its liver-restricted activity, accumulating evidence indicates that a functional urea cycle exists within the nervous system \u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. Key UC enzymes\u0026mdash;such as carbamoyl phosphate synthetase 1 (CPS1), ornithine transcarbamylase (OTC), argininosuccinate synthetase 1 (ASS1), argininosuccinate lyase (ASL), and arginase 1 (ARG1)\u0026mdash;are expressed in the brain \u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e, indicating a local system for nitrogen metabolic regulation \u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. The UC demonstrates notable metabolic flexibility in neural contexts \u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e, For instance, ornithine produced via ARG1 acts as a key metabolic hub \u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e, branching into two distinct pathways: decarboxylation by ornithine decarboxylase 1 (ODC1) to yield putrescine for polyamine synthesis, or re-entry into the UC for nitrogen recycling and citrulline regeneration \u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. Despite these insights, the pathological contributions of UC metabolites to neurodegeneration are not fully understood. Elevated ammonia exerts neurotoxicity by impairing glutamate recycling and mitochondrial function \u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. While putrescine is a precursor for neuronal GABA synthesis \u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e, its excess may promote excitotoxicity \u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Arginase-mediated arginine catabolism regulates nitric oxide (NO) production \u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e, and CPS1 helps modulate glutamate and GABA levels \u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e, highlighting the UC\u0026rsquo;s broader regulatory roles.\u003c/p\u003e\u003cp\u003eBeyond its potential involvement in neuronal energy metabolism and amino acid synthesis, urea\u0026mdash;the end product of the UC\u0026mdash;may itself contribute to cognitive and motor dysfunction. Notably, elevated urea concentrations have been reported in the brains of patients with Alzheimer\u0026rsquo;s disease (AD) \u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e, Parkinson's disease (PD) \u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e, and Huntington's disease \u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. However, how UC activity changes with age in the brain and its implications in pathological aging require further investigation. Urea accumulation may also result from impaired clearance mechanisms \u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Urea transporter B (UT-B), which enables urea transport in the brain, helps maintain urea homeostasis; its dysfunction is linked to urea buildup in the hippocampus and subsequent neuronal injury \u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e, although its role in aging has yet to be clarified.\u003c/p\u003e\u003cp\u003eGiven the potential role of disordered urea metabolism in brain aging, identifying compounds capable of modulating this process has become a research focus. Evodiamine, a primary bioactive alkaloid from the dried fruit of \u003cem\u003eEvodia rutaecarpa\u003c/em\u003e (Juss.) Benth., is widely employed in traditional Chinese medicine and possesses diverse pharmacological properties \u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. Nonetheless, its potential anti-aging benefits and mechanisms of action remain largely uninvestigated. Therefore, this study seeks to examine whether evodiamine can ameliorate brain aging by modulating the urea cycle.\u003c/p\u003e\u003cp\u003eTo address these issues, we first identified a widespread increase in serum urea levels within the aging population, which correlated inversely with cognitive performance and physical activity. Biochemical analyses of clinical samples further revealed upregulation of key urea cycle enzymes and elevated levels of associated metabolites. We subsequently established an aging mouse model and observed consistent activation of the urea cycle across various brain regions. Using immunofluorescence and cell-based models, we demonstrated that this enhanced urea cycle activity occurs specifically in neurons, rather than in astrocytes or microglia. Through protein interaction studies, ODC1 was identified as a critical regulator of this process. Inhibition of ODC1 suppressed urea cycle overactivation and mitigated aging phenotypes. Finally, molecular docking analysis of ODC1 and administration of evodiamine were shown to ameliorate brain aging.\u003c/p\u003e"},{"header":"2. Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Study subjects\u003c/h2\u003e\u003cp\u003eThe analysis of all human samples was carried out at the Medical Laboratory Department of Chongqing Hospital, Jiangsu Province Hospital. Blood was collected via venipuncture into heparin-anticoagulated tubes and allowed to stand for 25 minutes. Plasma was then separated via centrifugation at 4000 rpm for 20 minutes. An automated clinical chemistry system was employed to assess serum biochemical markers such as urea and creatinine. The ethical approval for this specific study component was obtained from the Institutional Ethics Sub-committee at Chongqing Hospital, Jiangsu Province Hospital (approval number: 2025043). Subjects were categorized into two age cohorts: young adults (\u0026le;\u0026thinsp;30 years) and older adults (\u0026ge;\u0026thinsp;50 years). Standardized tests were administered to evaluate cognitive and motor functions across all participants.\u003c/p\u003e\u003cp\u003eAn aging mouse model was established using D-galactose induction, based on established protocols \u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e, including our previous work \u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. We conducted the study using male C57BL/6J mice (7\u0026ndash;8 weeks of age; weighing 22\u0026ndash;25 g). All animals were maintained in the institutional Laboratory Animal Center under a controlled environment with a 12-hour photoperiod (light/dark cycle). Prior to the commencement of the study, formal approval was secured from the relevant University Animal Ethics Committee. All subsequent procedures strictly followed national and institutional animal welfare policies (approval number: IACUC-CQMU-2022-0026). Euthanasia was performed under isoflurane anesthesia. Mice were randomly divided into four groups, with six animals in each group: Control, D-gal, DFMO (D-gal\u0026thinsp;+\u0026thinsp;DFMO), and EVO treatment (D-gal\u0026thinsp;+\u0026thinsp;EVO). After one week of acclimation, mice received daily intraperitoneal injections of D-galactose (120 mg/kg; Maclean Biotechnology, #D810319, purity\u0026thinsp;\u0026ge;\u0026thinsp;99%) for 42 days; control animals received saline following the same regimen. Starting from day 15, the EVO group was orally gavaged with Evodiamine (40 mg/kg daily; MedChemExpress, #518-17-2, purity\u0026thinsp;\u0026ge;\u0026thinsp;99%) alongside D-gal injections. The DFMO group received Eflornithine (600 mg/kg; MedChemExpress, #70052-12-9). The UT-B\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mouse was generated on a C57BL/6J genetic background by breeding UT-B\u003csup\u003e+/\u0026minus;\u003c/sup\u003e heterozygous animals, following a previously established protocol \u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. Upon completion of behavioral tests, blood samples were collected from the ocular vein, and serum was separated. Brain tissues were harvested for subsequent analysis.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Behavior tests\u003c/h2\u003e\u003cp\u003eFollowing model establishment, all mice underwent a sequence of behavioral assessments. The Morris water maze (MWM) included a 4-day acquisition phase where mice were placed into the pool from different starting points to find a submerged platform (positioned in the fourth quadrant, 2 cm below the water surface and 20 cm from the pool wall). Escape latency was measured with a 90 s cut-off. Following the spatial acquisition phase, a 90-second probe trial was administered on day 5 in the absence of the platform. Measurements included time spent in the target quadrant, number of crossings over the former platform site, and crossings within a zone twice the platform's diameter. Prior to the introduction in the NOR test, mice were habituated for 5 minutes to an open-field box containing two identical objects. After a 10 min training session, memory was assessed at 1 h and 24 h by introducing a novel object. Exploration time (5 min) for each object was used to calculate the discrimination index. The Y-maze consisted of three arms evenly spaced at 120\u0026deg;. Each mouse was given a 5-min free exploration session while being video-tracked. For the elevated plus maze (EPM), the setup included two open and two closed arms, and the entire apparatus was raised 50 cm from the ground. Individual mice were placed at the central junction facing an open arm and allowed to explore for 5 minutes under video surveillance. To evaluate neuromuscular function, grip strength was tested by documenting the maximum force (g) exerted when a mouse, suspended by the tail, gripped a sensor. Anxiety and general locomotion were assessed employing an open-field test: after 30 min of acclimation, mice were exposed for 5 min to a brightly lit (500 lux) opaque arena (40 \u0026times; 40 cm), with activity recorded by SMART software. Motor coordination and balance were tested on an accelerating rotarod (4\u0026ndash;40 rpm over 5 min). This was preceded by a 3-day training period (4 rpm, 5 min/day), and the final score represented the average latency to fall from three trials separated by 1-hour intervals.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 Western blot\u003c/h2\u003e\u003cp\u003eSerum samples, brain tissues, and PBS-washed cellular pellets were precisely weighed and homogenized using an ice-cold lysis buffer supplemented with protease inhibitors. The homogenates were sonicated, kept on ice, and subsequently centrifuged at 11,100 \u0026times; g for 30 minutes at 4\u0026deg;C. Supernatants were carefully collected, and total protein content was quantified with a BCA assay kit (Biosharp, BL1054A). Equivalent quantities of protein (25 \u0026micro;g per lane) were resolved via SDS-PAGE (Beyotime, P0012A) and then transferred electrophoretically onto PVDF membranes (Beyotime, FFP19). Membranes were blocked with Quick Block Western solution (Beyotime, P0240-500ml) and probed overnight at 4\u0026deg;C with the following primary antibodies: anti-ARG1 (Beyotime, AF1381; 1:1200), anti-ODC1 (Proteintech, #67336-1-Ig; 1:1200), anti-OTC (Proteintech, #26470-1-AP; 1:1200), anti-UT-B (Proteintech, #25962-1-AP; 1:1200), anti-P53 (Proteintech, #10442-1-AP; 1:1200), anti-ASL (Proteintech, #16645-1-AP; 1:1200), anti-ASS1 (Abcam, ab191165; 1:1200), anti-CPS1 (Abcam, ab129076; 1:1200), and anti-β-actin (Abmart, P60709; 1:1200). After incubation with primary antibodies, the membranes were treated with an HRP-conjugated secondary antibody (Abcam, ab6721; 1:10000) for one hour at room temperature. Following extensive washing with TBST, immunoreactive bands were visualized with a chemiluminescence imaging system. Band intensities were quantified using ImageJ software. A detailed antibody table is available in the Supplementary Materials.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4 HE staining\u003c/h2\u003e\u003cp\u003eBrain tissue samples were post-fixed via immersion in 4% paraformaldehyde, embedded in paraffin, and sectioned at a thickness of 5 \u0026micro;m for further histological analysis. Following deparaffinization and rehydration, the sections were stained with hematoxylin and eosin (H\u0026amp;E) using a commercial staining kit (Beyotime, C0105S) and imaged under a light microscope for morphological assessment.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5 Immunohistochemical and immunofluorescence analysis\u003c/h2\u003e\u003cp\u003eFor immunohistochemical (IHC) and immunofluorescence (IF) staining, the following primary antibodies were applied: anti-ODC1 (Proteintech, #67336-1-Ig; 1:250), anti-OTC (Proteintech, #26470-1-AP; 1:250), anti-ARG1 (Beyotime, AF1381; 1:250), anti-ASL (Proteintech, #16645-1-AP; 1:250), anti-CPS1 (Abcam, ab129076; 1:250), anti-GFAP (Beyotime, AF0156; 1:250), anti-IBA1 (Beyotime, AF7143; 1:250), anti-NeuN (Beyotime, AF1072; 1:250), and anti-ASS1 (Abcam, ab191165; 1:250). Tissue sections were probed with primary antibodies at 4\u0026deg;C for 12\u0026ndash;16 hours. Following three rinses in PBS, the sections were incubated with species-matched secondary antibodies for 1 hour at 37\u0026deg;C. For immunohistochemical detection, a biotin-streptavidin-HRP system was employed to develop signals before mounting. For immunofluorescence, after secondary antibody treatment, sections were coverslipped with DAPI-containing antifade mounting medium (Yeasen, 40728ES03) and imaged via a Nikon confocal microscope configured for FITC and TRITC fluorescence channels.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6 RNA extraction and RT-qPCR\u003c/h2\u003e\u003cp\u003eFor reverse transcription quantitative PCR (RT-qPCR), total RNA was extracted from tissue samples, after which its quality and concentration were measured. cDNA was then synthesized with a commercial reverse transcription kit (Beyotime, D7228) following the manufacturer's instructions. All primers, which were designed and supplied by Sangon Biotech (Shanghai, China), are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Amplification and quantification were carried out using a Bio-Rad real-time PCR detection system.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences of target and reference genes\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSpecies\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSequence\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003e5' to 3'\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eOdc1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTGCCACACTCAAAACCAGCAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eACACTGCCTGAACGAAGGTCTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCps1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCATTGTGGGCGAATGCAACA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eACAGCCTGGCATTCACTTCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eOtc\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGTCATTAGTGTTCCCAGAGGCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGGTGAGTAGTCTGTCAGCAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eArg1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCATTGGCTTGCGAGACGTAGAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGCTGAAGGTCTCTTCCATCACC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAss1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCACTCTACGAGGACCGCTATCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCTCAAAGCGGACCTGGTCATTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAsl\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGGCAGAGACTAAAGGAGTGGCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTCGACACTGGATTTCGCTGTGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eP53\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGCGTAAACGCTTCGAGATGTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTTTTTATGGCGGGAAGTAGACTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eβ-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGTGCTATGTTGCTCTAGACTTCG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eATGCCACAGGATTCCATACC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSlc14a1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAGGTGTGGCCTCAAAGTACTTGGCTA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGATAGCAGCGTGCAGGCACATGAGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7 Metabolites assay\u003c/h2\u003e\u003cp\u003eUrea, ammonia, and putrescine levels were quantified using commercial assay kits (BioAssay DIUR-500; UpingBio YPD1091; Gelatins JLC_K6002-96T), following the manufacturers' protocols. Additionally, concentrations of GABA, arginine, glutamate, citrulline, ornithine, and aspartate were determined using the following kits: Mlbio ml092747, ELK Biotechnology ELK7925, MeRCK MAK438-1KT, Biotopped TOPEL03427, Huabang Bio HB-P9S1559X, and MEIMIAN MM-51643H1.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8 Cell culture\u003c/h2\u003e\u003cp\u003eC8-D1A, BV2, Neuro-2a, SH-SY5Y, and PC12 cell lines (obtained from Procell) were cultured in high-glucose DMEM containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin at 37\u0026deg;C in a 5% CO₂ atmosphere. The medium was refreshed every 24 hours. When cells reached approximately 90% confluency, they were harvested using 0.25% trypsin for subculturing or experimental use. For the experiments, cells were randomly assigned to either a control group or a treatment group that received 10 mg/mL D-galactose for 24 hours prior to analysis. In parallel, Neuro-2a cells were treated with a range of concentrations of urea, putrescine, and ammonia over a 24-hour period. Neuro-2a cells were also subjected to transient transfection using siODC1 (designed and synthesized by Sangon Biotech, Shanghai, China; accession number: NM_013614), followed by a 72-hour incubation period prior to subsequent experimental procedures.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9 Construction of Protein-Protein Interaction (PPI) Network\u003c/h2\u003e\u003cp\u003eThe PPI network was constructed based on the STRING database (version 11.5; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://string-db.org/\u003c/span\u003e\u003cspan address=\"https://string-db.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Differentially expressed proteins (or genes), represented by official gene symbols, were input into STRING. Only interactions with a composite confidence score greater than 0.7 (or an optional threshold of 0.4 or 0.9, where applicable) were deemed high-confidence and included for further analysis. The resulting interaction data, which contained pairwise relationship details and confidence scores, were retrieved in TSV format. The network was then visualized and further analyzed using Cytoscape software (version 3.9.1). Key hub genes were identified with the cytoHubba plugin through topological algorithms such as Maximal Clique Centrality (MCC) and Degree. Furthermore, the MCODE plugin was employed to identify densely connected functional modules under standard settings: degree cutoff\u0026thinsp;=\u0026thinsp;2, node score cutoff\u0026thinsp;=\u0026thinsp;0.2, k-core\u0026thinsp;=\u0026thinsp;2, and max depth\u0026thinsp;=\u0026thinsp;100.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.10 Molecular docking\u003c/h2\u003e\u003cp\u003eMolecular docking was used to assess the binding of EVO to the target enzyme ODC1. The 3D structure of ODC1 was obtained from the Protein Data Bank (PDB) and preprocessed by removing non-protein molecules, adding hydrogen atoms, and assigning partial atomic charges. The prepared structure was then saved in PDBQT format for further docking studies. With AutoDock Vina (v1.2.2), the binding pocket was defined according to the position and size of the native ligand. The simulation produced several predicted binding poses and detailed molecular interactions, yielding estimated binding affinities as computed binding free energies for each conformation.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e2.11 Statistical analysis\u003c/h2\u003e\u003cp\u003eAll data are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM from a minimum of three independent experiments. Statistical analyses were performed using GraphPad Prism 8.0, with significance levels denoted as follows: *p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, and ***p\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e3.1 Urea cycle enzymes and metabolites are increased in the serum of aging populations\u003c/h2\u003e\u003cp\u003eSerum samples from elderly and younger adults were obtained from the Department of Medical Laboratory at Chongqing Hospital of Jiangsu Province Hospital. We excluded individuals with a history of major psychiatric disorders, such as schizophrenia or major depressive disorder, significant systemic diseases (including hepatic insufficiency [ALT\u0026thinsp;\u0026gt;\u0026thinsp;75 U/L], renal failure [eGFR\u0026thinsp;\u0026lt;\u0026thinsp;45 mL/min/1.73m\u0026sup2;], or unstable cardiovascular disease), current or past alcohol or substance dependence, and any contraindications to MRI (e.g., cardiac pacemakers or severe claustrophobia). Biochemical assays showed significantly higher urea levels in the elderly group relative to the younger controls, while creatinine levels remained comparable between groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Serum urea concentration exhibited a positive correlation with age, whereas no significant age-dependent trend was observed for creatinine (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA). Assessments of cognitive and motor function revealed marked declines with aging. Higher urea levels were inversely correlated with functional performance, a relationship not seen with creatinine (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB\u0026ndash;C). Western blot analysis further revealed elevated protein levels of key urea cycle enzymes and UT-B in aged subjects, accompanied by a marked upregulation of the senescence-associated marker P53 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-C). Subsequent ELISA-based metabolite profiling showed elevated aspartate (an amine donor), putrescine, and GABA, despite stable ammonia levels. The concentrations of key urea cycle intermediates, including glutamate, arginine, ornithine, and citrulline, remained unchanged, suggesting enhanced metabolic flux without accumulation of intermediates (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Ornithine was preferentially converted to putrescine rather than glutamate.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e3.2 Aging mice show marked cognitive and motor dysfunction\u003c/h2\u003e\u003cp\u003eWe developed a murine model of aging induced by D-galactose administration (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). During the modeling process, mice in the D-gal group exhibited a marked decrease in body weight. Consistent with human findings, aged mice showed increased urea levels without significant changes in creatinine (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Behavioral assessments revealed significant impairments in both cognitive and motor function among aged mice. During the Morris water maze test, these animals exhibited a reduction in the number of platform crossings and decreased time spent in the target quadrant (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). The novel object recognition test revealed reduced discrimination and recognition indices (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Y-maze performance showed decreased spontaneous alternation and center entries, suggesting impaired spatial working memory (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). In the elevated plus maze, aging mice spent less time in and entered less frequently the open arms (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Motor function assessments\u0026mdash;open field, grip strength, and rotarod tests\u0026mdash;all indicated significant coordination and strength impairments (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG-H). Serum urea levels negatively correlated with cognitive and motor performance metrics, whereas creatinine showed no correlation (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eD-E).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e3.3 Urea cycle enzymes and associated metabolites show significant upregulation in the aging mouse brain\u003c/h2\u003e\u003cp\u003eThe activity of the brain urea cycle remains debated. Previous reports suggest that urea metabolism is non-cyclic under physiological conditions but becomes cyclic in Alzheimer\u0026rsquo;s disease with concomitant enzyme upregulation \u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. To assess urea cycle (UC) activity in aged mice, we measured urea concentrations and expression of key UC enzymes in several functionally relevant brain regions, including the hippocampus, medial prefrontal cortex (mPFC), substantia nigra (SN), and striatum. The expression of senescence marker P53 was also increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Aged mice exhibited increased urea concentrations across all regions (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Transcript levels of six UC enzymes were variably elevated (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-F), indicating region-specific UC activation. Metabolite analysis showed stable ammonia, elevated aspartate, putrescine, and GABA, and unchanged glutamate, arginine, ornithine, and citrulline, suggesting sustained metabolic flux without intermediate accumulation (Fig. S2A-D). Notably, UT-B, the primary urea transporter in the brain, was upregulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e3.4 ARG1 and ODC1 are highly expressed specifically in neurons across multiple aging brain regions\u003c/h2\u003e\u003cp\u003eImmunohistochemical findings indicated substantial upregulation of urea cycle enzymes across various brain regions, with ARG1 and ODC1 exhibiting the most prominent increases (Fig. S3A). Immunofluorescence further confirmed the age-dependent elevation of ODC1 and ARG1. Neither enzyme co-localized with astrocytes (GFAP⁺) or microglia (IBA1⁺), both of which showed aging-related activation (Fig. S3B-C). Instead, both ODC1 and ARG1 were predominantly expressed in neurons, indicated by strong co-localization with the neuronal marker NeuN within the cytoplasmic compartment, despite an overall reduction in NeuN signal (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u0026ndash;D). In vitro studies supported these observations. Western blot analysis revealed that D-galactose-induced senescence did not alter urea cycle enzyme expression in the astrocyte line C8-D1A or the microglial line BV2. By contrast, significant upregulation was detected in neuronal cell models, including Neuro-2a, SH-SY5Y, and PC12 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Metabolite profiling in D-galactose-treated Neuro-2A cells also showed changes consistent with the in vivo aging phenotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e3.5 Inhibition or knockdown of ODC1 suppresses aging and urea cycle activation\u003c/h2\u003e\u003cp\u003eProtein-protein interaction (PPI) network analysis indicated that the senescence-related marker P53 interacts with ODC1, but not with ARG1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Given that ODC1 has been previously identified as the most significantly dysregulated protein in this context, we administered the ODC1 inhibitor DFMO to aging mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). DFMO treatment effectively normalized serum levels of urea and creatinine (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC) and ameliorated cognitive and motor impairments in behavioral tests (Fig. S4A-G). Interestingly, ODC1 inhibition also reduced urea content (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD) and downregulated major urea cycle enzymes in the brain (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). Metabolite profiling showed decreased ammonia, putrescine, and GABA; unchanged arginine, citrulline, and aspartate; and elevated ornithine and glutamate (Fig. S4H-K). As a metabolic hub linking ornithine utilization, polyamine synthesis, and urea cycle function, ODC1 inhibition blocks the conversion of ornithine to putrescine, thereby disrupting putrescine synthesis and consequently GABA production. Concurrently, ornithine accumulation promotes ammonia clearance through the urea cycle. These findings underscore the central role of ODC1 in coordinating polyamine biosynthesis and nitrogen metabolism. Alongside these changes, UT-B expression was downregulated following urea treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF), while P53 expression was decreased in the aged brain after DFMO treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG). \u003cem\u003eIn vitro\u003c/em\u003e knockdown of ODC1 using siRNA in neuronal cells reproduced these phenotypic outcomes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH-I).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e3.6 The accumulation of urea cycle metabolites drives cellular senescence\u003c/h2\u003e\u003cp\u003eTo investigate the direct impact of urea on neuronal function, Neuro-2A cells were exposed to a range of urea concentrations \u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Treatment with urea led to elevated expression of P53, together with increased levels of major urea cycle enzymes, UT-B, GABA, and putrescine (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA\u0026ndash;B). We treated neurons with physiological, pathological, and high concentrations of putrescine. Exposure to physiological concentrations did not promote senescence or upregulate the urea cycle; in contrast, both pathological and high concentrations markedly accelerated cellular senescence and enhanced urea cycle activity. However, the concentration of ammonia remained unchanged (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC-D). The treatment of cells with increasing concentrations of ammonia \u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e (ammonium chloride) demonstrated that senescence was promoted and the urea cycle was enhanced only at higher concentrations, whereas lower levels had no observable effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE-F).\u003c/p\u003e\u003cp\u003eUT-B\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice (Slc14a1 gene-deficient) exhibit systemically elevated urea levels despite normal renal function, providing a suitable model for studying isolated hyperuremia \u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. UT-B\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice exhibited elevated serum urea levels, while creatinine levels remained unchanged (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). Behavioral studies revealed marked cognitive deficits in UT-B\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB-E). However, UT-B\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice exhibited no significant motor dysfunction (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF-H). Elevated urea was detected in several brain regions, including the hippocampus and mPFC, but not in the substantia nigra or striatum (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eI). Similar to aging mice, UT-B\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice exhibited elevated levels of the brain senescence marker P53, key urea cycle enzymes, and the contents of putrescine and GABA (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eJ-L). These results established a role for urea cycle metabolites in promoting brain aging.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003e3.7 Evodiamine attenuates aging mice cognitive and motor impairment via urea cycle\u003c/h2\u003e\u003cp\u003eMolecular docking results demonstrated that EVO forms stable interactions with ODC1, exhibiting a binding free energy of \u0026minus;\u0026thinsp;8.345 kcal/mol across multiple conformational clusters, which suggests high-affinity binding and a thermodynamically favorable interaction profile (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eK). Following EVO treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA), aged mice exhibited increased body weight and reduced serum urea levels, although creatinine levels remained unaltered (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). Histopathological evaluation of brain tissues indicated that D-galactose-induced neuronal loss\u0026mdash;consistent with natural aging\u0026mdash;was attenuated by EVO administration, which also improved neuronal count and morphology (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). Behavioral assessments demonstrated that EVO alleviated cognitive and motor deficits in aged mice (Fig. S5A-G). EVO intervention also led to reduced urea content across four brain regions (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD), accompanied by downregulation of key urea cycle enzymes (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE-H, S5I-K). Moreover, expression of UT-B and p53 was suppressed (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eI-J), and concentrations of ammonia and putrescine were decreased (Fig. S5L-M).\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eEpidemiological studies indicate that a significant proportion of the elderly population experiences coexisting cognitive and motor impairments \u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. Alterations in metabolic processes are well-established markers associated with both brain aging and neurodegenerative pathologies \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. The urea cycle, first identified in the liver, is essential for detoxifying excess nitrogen and ammonia by converting them into urea. In neurological diseases, the UC is implicated in hyperammonemia, which can cause a loss of glutamine transporter activity and subsequently impair learning and memory \u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. Such dysregulation is increasingly regarded as instrumental in the development of neurological diseases \u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. Within this cycle, arginine is metabolized into urea and ornithine \u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e, with the latter serving as a precursor for putrescine and eventually GABA. This series of reactions demonstrates a critical metabolic link, connecting the urea cycle not only to polyamine metabolism but also to the GABAergic system. Although these metabolites are indispensable for normal neural functioning, their abnormal levels have been associated with neurodegenerative mechanisms \u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e. In addition to the key enzymes and intermediate products of UC, researchers are also interested in the impact of the final metabolite urea on the nervous system \u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eOur study demonstrated that elevated serum urea levels in aged mice were inversely correlated to cognitive and motor performance, suggesting that urea is a significant contributor to functional decline. In the D-gal-induced aging model, a marked increase in urea was observed in key regions governing cognitive and motor function, including the hippocampus, mPFC, SN, and Striatum, thereby recapitulating the neuropathology of human aging. Thus, urea dysregulation likely plays a direct pathogenic role rather than being a secondary epiphenomenon. Aged mouse brains showed increased expression of key enzymes involved in nitrogen clearance, an adaptive change that likely maintains stable ammonia levels and alleviates neurotoxic burden \u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. Our results showed that while this process detoxified ammonia, exposure to high concentrations of ammonia itself induced cellular senescence in neurons, revealing a dual role for the urea cycle in aging. Putrescine, a metabolic byproduct of polyamine metabolism, is a neurotoxic intermediate \u003csup\u003e[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e. While it does not induce cellular senescence at physiological concentrations, it promotes senescence-related phenotypes at elevated concentrations. Following the induction of cellular senescence, neurons exhibited urea cycle activation, whereas astrocytes and microglia showed no significant changes. During aging, neurons exhibit heightened susceptibility to energy exhaustion and excitotoxicity compared to glial cells \u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e. This differential vulnerability stems from their high metabolic demand, post-mitotic nature, and reliance on oxidative phosphorylation, making them more prone to mitochondrial dysfunction and calcium-mediated excitotoxic injury \u003csup\u003e[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e. The results of the present study demonstrated that urea cycle-related metabolites exhibit significant differences across four brain regions: the hippocampus, cortex, substantia nigra, and striatum, suggesting pronounced regional heterogeneity in the regulation of cerebral nitrogen metabolism. These variations may be closely associated with the distinct cellular composition, functional specialization, and metabolic demands of each region. As a key center for learning and memory, the hippocampus exhibits high synaptic plasticity and frequent neural activity, which likely contribute to elevated ammonia production. This necessitates enhanced urea cycle activity to maintain nitrogen homeostasis \u003csup\u003e[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e. Cortical areas, particularly advanced cognitive regions such as the prefrontal cortex, host diverse neuronal populations, which may account for the observed elevations in urea cycle intermediates \u003csup\u003e[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e. The substantia nigra, rich in dopaminergic neurons, demonstrates high mitochondrial respiratory activity and elevated oxidative stress, potentially leading to increased ammonia generation and a consequent reliance on urea cycle functionality \u003csup\u003e[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]\u003c/sup\u003e. In contrast, the striatum, a central hub for motor control, comprises extensive medium spiny neurons and receives substantial glutamatergic input from the cortex. Its metabolic profile appears oriented toward rapid energy supply and neurotransmitter recycling, which may explain its relatively lower urea cycle activity. Overall, the regional disparities in urea cycle activity reflect adaptations to localized energy metabolism patterns, neurotransmitter turnover demands, and ammonia exposure levels. This can be viewed as a form of metabolic specialization within the nervous system.\u003c/p\u003e\u003cp\u003eODC1 is increasingly implicated as a key gene in neurodevelopmental disorders and the underlying processes of brain development \u003csup\u003e[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003c/sup\u003e. Inhibition or knockdown of ODC1 alleviated the aging phenotype, concurrent with an attenuation of urea cycle activation, including reduced levels of urea, ammonia, putrescine, and GABA, and decreased activities of key urea cycle enzymes. In light of this, downregulation or knockout of ODC1 may protect neurons, particularly during metabolic stress. Similar to observations in Parkinson\u0026rsquo;s disease models, where modulation of polyamine metabolism demonstrated neuroprotective effects, reduced ODC1 activity in our study may alleviate ammonia-induced excitotoxicity and oxidative damage, thereby helping maintain neuronal function \u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. This protective mechanism could be particularly critical in vulnerable regions such as the substantia nigra, where high dopamine turnover and mitochondrial activity amplify ammonia production.\u003c/p\u003e\u003cp\u003eBeyond endogenous metabolic regulation, our study also highlights the therapeutic potential of evodiamine, a natural alkaloid, as a novel ODC1 inhibitor. Previous research on evodiamine has primarily focused on its anti-tumor \u003csup\u003e[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]\u003c/sup\u003e, anti-inflammatory \u003csup\u003e[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]\u003c/sup\u003e, and analgesic properties \u003csup\u003e[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/sup\u003e. Particularly in oncology, evodiamine has been shown to induce cell cycle arrest and apoptosis at high concentrations, suggesting a role in modulating cell proliferation pathways \u003csup\u003e[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/sup\u003e. However, its effects in the context of neurological disorders, especially those associated with ammonia toxicity and polyamine dysregulation, remain largely unexplored. A key innovative aspect of our study is the integration of computational molecular docking with experimental validation. Docking simulations demonstrated that evodiamine binds stably to the active site of ODC1, forming specific hydrogen bonds and hydrophobic interactions with key residues, suggesting a direct inhibitory mechanism. This finding provides a molecular structural basis for its putative role in modulating ODC1 activity. Importantly, our functional experiments showed that evodiamine treatment significantly lowered putrescine levels in ammonia-stressed neurons, while also reducing excitotoxicity and oxidative damage\u0026mdash;effects consistent with those seen in ODC1-knockdown models. These results not only underscore the neuroprotective effect of ODC1 inhibition but also highlight evodiamine as a promising candidate for developing therapies against hyperammonemia-related neuropathologies. To our knowledge, this is the first study to identify evodiamine as an ODC1-targeting agent with neuroprotective effects. Our combined computational and experimental approach provides a mechanistic basis for its therapeutic potential and suggests new avenues for repurposing natural compounds in treating metabolic neurological disorders.\u003c/p\u003e\u003cp\u003eEmerging evidence indicates that high urea levels may independently contribute to the development of psychiatric disorders, including depression and anxiety, partly through impairing synaptic plasticity and promoting depressive-like behaviors \u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/sup\u003e. Elevated urea levels during aging were associated with cognitive and motor dysfunction, and treating neurons with a high concentration of urea was found to induce an aging phenotype. Urea transporters (UTs), which mediate urea transit across membranes \u003csup\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/sup\u003e. In young UT-B\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice, a stark rise in urea and its metabolic enzymes coincided with cognitive decline, while motor function remained intact\u0026mdash;a contrast potentially explained by uneven urea distribution across brain regions \u003csup\u003e[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eHowever, this study has several limitations. Although D-galactose-induced aging mice serve as a valuable model for investigating metabolic disorders \u003csup\u003e[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]\u003c/sup\u003e, naturally aged mice offer a more physiologically relevant representation of aging processes and are therefore superior for translational research. The neurotoxic potential of accumulated ammonia and the signaling role of polyamines in protein aggregation pathways remain important areas for future investigation. Furthermore, investigating UT-B as a target for anti-aging therapeutics represents a promising strategic direction for future research.\u003c/p\u003e\u003cp\u003eIn conclusion, the urea cycle plays a paradoxical role in aging and neuropathy. While its excessive activation is a key driver of the aging process, it also serves the essential function of detoxifying metabolic waste. Understanding this dual nature has significant translational value, providing a strategic foundation for developing novel therapies against neuroinflammation and metabolic disorders.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eDeclaration of competing interest\u003c/h2\u003e\u003cp\u003eThe authors state that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eCRediT authorship contribution statement\u003c/h2\u003e\u003cp\u003eShengyao Zhang: Validation, Project administration. Meng Zhang: Investigation. Junling Luo: Formal analysis. Han Wei: Formal analysis. Guoran Wan: Software. Qiongfang Wang: Resources. Jian Wang: Methodology. Jiajie Leng: Formal analysis. Jing Li: Funding acquisition. Dilong Chen: Funding acquisition. Shuliang Niu: Funding acquisition. Qiu Chen: Funding acquisition. Boyue Huang: Funding acquisition, Supervision. Jianhua Ran: Visualization, Funding acquisition, Conceptualization.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e\u003cp\u003eThe authors sincerely acknowledge the financial support received from various funding agencies. This work was funded by the Key Projects of Chongqing Key Laboratory of Development and Utilization of Genuine Medicinal Materials in Three Gorges Reservoir Area (Grant Nos. KFKT2022001 to J.R. and KFKT2022010 to B.H.). Major funding was also obtained from the National Natural Science Foundation of China (Grants 81770738 and 82370739 to J.R.). Additional support was provided by the Chongqing Science and Technology Commission (Project CSTB2023NSCQ-MSX0510 to J.R.), the Chongqing Education Commission Science Foundation (Grant KJQN202400417 to B.H.), and the Chongqing Natural Science Foundation (Award CSTB2024NSCQ-KJFZMSX0075 to B.H.). D.C. was supported by the Chongqing Key Laboratory (Sys20210008), the Innovative Research Group Project of Natural Drug Antitumor of Chongqing Municipal Education Commission (CXQT20030), the Chongqing Talent Plan (cstc2022ycjh-bgzxm0226), and the Science and Technology Research Program of Chongqing Municipal Education Commission (KJZD-M202202701). Further contributions included funding from the Natural Science Foundation of Xinjiang Uygur Autonomous Region (2024D01C125 to S.N.), the Noncommunicable Chronic Diseases-National Science and Technology Major Project (2023ZD0509400 to Q.C.), and the Chongqing Municipal Special Project for Technological Innovation and Application Development (General Program) (No. CSTB2024TIAD-GPX0029, to J. L.)\u003c/p\u003e\u003ch2\u003eData Availability statement\u003c/h2\u003e\u003cp\u003eThe data supporting the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHOU, Y., DAN, X.: Ageing as a risk factor for neurodegenerative disease [J]. Nat. Rev. Neurol. \u003cb\u003e15\u003c/b\u003e(10), 565\u0026ndash;581 (2019)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBEARD, J.R., OFFICER, A., DE CARVALHO I A, et al.: The World report on ageing and health: a policy framework for healthy ageing [J]. Lancet. \u003cb\u003e387\u003c/b\u003e(10033), 2145\u0026ndash;2154 (2016)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eL\u0026oacute;PEZ-OT\u0026iacute;N, C., BLASCO M A, PARTRIDGE, L., et al.: The hallmarks of aging [J]. Cell. \u003cb\u003e153\u003c/b\u003e(6), 1194\u0026ndash;1217 (2013)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMATTSON M P, ARUMUGAM, T.V.: Hallmarks of Brain Aging: Adaptive and Pathological Modification by Metabolic States [J]. Cell. Metab. \u003cb\u003e27\u003c/b\u003e(6), 1176\u0026ndash;1199 (2018)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFONTANA, L., PARTRIDGE, L., LONGO V D: Extending healthy life span\u0026ndash;from yeast to humans [J]. Science. \u003cb\u003e328\u003c/b\u003e(5976), 321\u0026ndash;326 (2010)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCANIGLIA, J.L., JALASUTRAM, A., ASUTHKAR, S., et al.: Beyond glucose: alternative sources of energy in glioblastoma [J]. Theranostics. \u003cb\u003e11\u003c/b\u003e(5), 2048\u0026ndash;2057 (2021)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMORRIS S M, J.R.: Regulation of enzymes of the urea cycle and arginine metabolism [J]. Annu. Rev. Nutr. \u003cb\u003e22\u003c/b\u003e, 87\u0026ndash;105 (2002)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBENSEMAIN, F., HOT, D.: Evidence for induction of the ornithine transcarbamylase expression in Alzheimer's disease [J]. Mol. Psychiatry. \u003cb\u003e14\u003c/b\u003e(1), 106\u0026ndash;116 (2009)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePROKOP J W, BUPP C, P., FRISCH, A., et al.: Emerging Role of ODC1 in Neurodevelopmental Disorders and Brain Development [J]. Genes (Basel), \u003cb\u003e12\u003c/b\u003e(4). (2021)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWANG, H., RAN, J., Urea, J.I.A.N.G.T.: [J] Subcell. Biochem. \u003cb\u003e73\u003c/b\u003e, 7\u0026ndash;29 (2014)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWANG, L., XING, X., ZENG, X., et al.: Spatially resolved isotope tracing reveals tissue metabolic activity [J]. Nat. Methods. \u003cb\u003e19\u003c/b\u003e(2), 223\u0026ndash;230 (2022)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHANSMANNEL, F., LENDON, C., PASQUIER, F., et al.: Is the ornithine transcarbamylase gene a genetic determinant of Alzheimer's disease? [J]. Neurosci. Lett. \u003cb\u003e449\u003c/b\u003e(1), 76\u0026ndash;80 (2009)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNEILL M A, ASCHNER, J., BARR, F., et al.: Quantitative RT-PCR comparison of the urea and nitric oxide cycle gene transcripts in adult human tissues [J]. Mol. Genet. Metab. \u003cb\u003e97\u003c/b\u003e(2), 121\u0026ndash;127 (2009)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWU, G., BAZER F W, DAVIS T A, et al.: Arginine metabolism and nutrition in growth, health and disease [J]. Amino Acids. \u003cb\u003e37\u003c/b\u003e(1), 153\u0026ndash;168 (2009)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOJA, S.S., SARANSAARI, P.: Neurotoxicity of Ammonia [J]. Neurochem Res. \u003cb\u003e42\u003c/b\u003e(3), 713\u0026ndash;720 (2017)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSEQUERRA E B, GARDINO, P., HEDIN-PEREIRA C, et al.: Putrescine as an important source of GABA in the postnatal rat subventricular zone [J]. Neuroscience. \u003cb\u003e146\u003c/b\u003e(2), 489\u0026ndash;493 (2007)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIGARASHI, K., KASHIWAGI, K.: The functional role of polyamines in eukaryotic cells [J]. Int. J. Biochem. Cell. Biol. \u003cb\u003e107\u003c/b\u003e, 104\u0026ndash;115 (2019)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRANGROO THRANE V, THRANE A S, WANG, F., et al.: Ammonia triggers neuronal disinhibition and seizures by impairing astrocyte potassium buffering [J]. Nat. Med. \u003cb\u003e19\u003c/b\u003e(12), 1643\u0026ndash;1648 (2013)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXU, J., BEGLEY P, C.H.U.R.C.H.S.J., et al.: Graded perturbations of metabolism in multiple regions of human brain in Alzheimer's disease: Snapshot of a pervasive metabolic disorder [J]. Biochim. Biophys. Acta. \u003cb\u003e1862\u003c/b\u003e(6), 1084\u0026ndash;1092 (2016)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGLAAB E, TREZZI J P, GREUEL, A., et al.: Integrative analysis of blood metabolomics and PET brain neuroimaging data for Parkinson's disease [J]. Neurobiol. Dis. \u003cb\u003e124\u003c/b\u003e, 555\u0026ndash;562 (2019)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePATASSINI, S., BEGLEY, P., REID S J, et al.: Identification of elevated urea as a severe, ubiquitous metabolic defect in the brain of patients with Huntington's disease [J]. Biochem. Biophys. Res. Commun. \u003cb\u003e468\u003c/b\u003e(1\u0026ndash;2), 161\u0026ndash;166 (2015)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHANDLEY R R, REID S J, BRAUNING, R., et al.: Brain urea increase is an early Huntington's disease pathogenic event observed in a prodromal transgenic sheep model and HD cases [J]. Proc. Natl. Acad. Sci. U S A. \u003cb\u003e114\u003c/b\u003e(52), E11293\u0026ndash;e302 (2017)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWANG, H., HUANG, B., WANG, W., et al.: High urea induces depression and LTP impairment through mTOR signalling suppression caused by carbamylation [J]. EBioMedicine. \u003cb\u003e48\u003c/b\u003e, 478\u0026ndash;490 (2019)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHUANG, B., WANG, H.: Expression of Urea Transporter B in Normal and Injured Brain [J]. Front. Neuroanat. \u003cb\u003e15\u003c/b\u003e, 591726 (2021)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYANG, C., WU, X., JIANG, Z., et al.: Evodiamine rescues lipopolysaccharide-induced cognitive impairment via C/EBP-β-COX2 axis-regulated neuroinflammation [J]. Int. J. Biol. Macromol. \u003cb\u003e300\u003c/b\u003e, 139597 (2025)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAZMAN K F, Z.A.K.A.R.I.A.R.: D-Galactose-induced accelerated aging model: an overview [J]. Biogerontology. \u003cb\u003e20\u003c/b\u003e(6), 763\u0026ndash;782 (2019)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWU, M., HUANG, B.: Ganoderma lucidum polysaccharides ameliorates D-galactose-induced aging salivary secretion disorders by upregulating the rhythm and aquaporins [J]. Exp. Gerontol. \u003cb\u003e175\u003c/b\u003e, 112147 (2023)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYANG, B., BANKIR, L.: Urea-selective concentrating defect in transgenic mice lacking urea transporter UT-B [J]. J. Biol. Chem. \u003cb\u003e277\u003c/b\u003e(12), 10633\u0026ndash;10637 (2002)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJU Y H, BHALLA, M.: Astrocytic urea cycle detoxifies Aβ-derived ammonia while impairing memory in Alzheimer's disease [J]. Cell. Metab. \u003cb\u003e34\u003c/b\u003e(8), 1104\u0026ndash;20e8 (2022)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBODEGA, G., SU\u0026aacute;REZ, I., L\u0026oacute;PEZ-FERN\u0026aacute;NDEZ, L.A., et al.: Possible implication of ciliary neurotrophic factor (CNTF) and beta-synuclein in the ammonia effect on cultured rat astroglial cells: a study using DNA and protein microarrays [J]. Neurochem Int. \u003cb\u003e48\u003c/b\u003e(8), 729\u0026ndash;738 (2006)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHUANG, B., HUANG, Z., WANG, H., et al.: High urea induces anxiety disorders associated with chronic kidney disease by promoting abnormal proliferation of OPC in amygdala [J]. Eur. J. Pharmacol. \u003cb\u003e957\u003c/b\u003e, 175905 (2023)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOVEISGHARAN, S., WANG, T., BARNES L L, et al.: The time course of motor and cognitive decline in older adults and their associations with brain pathologies: a multicohort study [J]. Lancet Healthy Longev. \u003cb\u003e5\u003c/b\u003e(5), e336\u0026ndash;e45 (2024)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNATESAN, V., MANI, R.: Clinical aspects of urea cycle dysfunction and altered brain energy metabolism on modulation of glutamate receptors and transporters in acute and chronic hyperammonemia [J]. Biomed. Pharmacother. \u003cb\u003e81\u003c/b\u003e, 192\u0026ndash;202 (2016)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZHANG, S., WAN, G., QIU, Y., et al.: Urea cycle dysregulation drives metabolic stress and neurodegeneration in Parkinson's disease [J]. NPJ Parkinsons Dis. \u003cb\u003e11\u003c/b\u003e(1), 237 (2025)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eELDRIDGE, R.C., UPPAL, K., SHOKOUHI, M., et al.: Multiomics Analysis of Structural Magnetic Resonance Imaging of the Brain and Cerebrospinal Fluid Metabolomics in Cognitively Normal and Impaired Adults [J]. Front. Aging Neurosci. \u003cb\u003e13\u003c/b\u003e, 796067 (2021)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTAKIGUCHI, M.: MORI M. Transcriptional regulation of genes for ornithine cycle enzymes [J]. Biochem J, 312 (Pt 3)(Pt 3): 649\u0026thinsp;\u0026ndash;\u0026thinsp;59. (1995)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eH\u0026auml;BERLE, J., BURLINA, A., CHAKRAPANI, A., et al.: Suggested guidelines for the diagnosis and management of urea cycle disorders: First revision [J]. J. Inherit. Metab. Dis. \u003cb\u003e42\u003c/b\u003e(6), 1192\u0026ndash;1230 (2019)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRUSHAIDHI, M., JING, Y., KENNARD J T, et al.: Aging affects L-arginine and its metabolites in memory-associated brain structures at the tissue and synaptoneurosome levels [J]. Neuroscience. \u003cb\u003e209\u003c/b\u003e, 21\u0026ndash;31 (2012)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMATTSON M P, M.A.G.N.U.S.T.: Ageing and neuronal vulnerability [J]. Nat. Rev. Neurosci. \u003cb\u003e7\u003c/b\u003e(4), 278\u0026ndash;294 (2006)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBONVENTO, G., BOLA\u0026ntilde;OS, J.P.: Astrocyte-neuron metabolic cooperation shapes brain activity [J]. Cell. Metab. \u003cb\u003e33\u003c/b\u003e(8), 1546\u0026ndash;1564 (2021)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCOOPER, A.J.: Biochemistry and physiology of brain ammonia [J]. Physiol. Rev. \u003cb\u003e67\u003c/b\u003e(2), 440\u0026ndash;519 (1987)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHERTZ, L., ROTHMAN, D.L., Glucose: Lactate, β-Hydroxybutyrate, Acetate, GABA, and Succinate as Substrates for Synthesis of Glutamate and GABA in the Glutamine-Glutamate/GABA Cycle [J]. Adv. Neurobiol. \u003cb\u003e13\u003c/b\u003e, 9\u0026ndash;42 (2016)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGAN Z, VAN DER STELT I, LI, W., et al.: Mitochondrial Nicotinamide Nucleotide Transhydrogenase: Role in Energy Metabolism, Redox Homeostasis, and Cancer [J]. Antioxid Redox Signal, 41(13\u0026ndash;15): 927\u0026thinsp;\u0026ndash;\u0026thinsp;56. (2024)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRAGHAVENDRA RAO V L, DOGAN, A., BOWEN K K, et al.: Ornithine decarboxylase knockdown exacerbates transient focal cerebral ischemia-induced neuronal damage in rat brain [J]. J. Cereb. Blood Flow. Metab. \u003cb\u003e21\u003c/b\u003e(8), 945\u0026ndash;954 (2001)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWANG, Z., XIONG, Y., PENG, Y., et al.: Natural product evodiamine-inspired medicinal chemistry: Anticancer activity, structural optimization and structure-activity relationship [J]. Eur. J. Med. Chem. \u003cb\u003e247\u003c/b\u003e, 115031 (2023)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKO H C, WANG Y H, LIOU K T, et al.: Anti-inflammatory effects and mechanisms of the ethanol extract of Evodia rutaecarpa and its bioactive components on neutrophils and microglial cells [J]. Eur. J. Pharmacol. \u003cb\u003e555\u003c/b\u003e(2\u0026ndash;3), 211\u0026ndash;217 (2007)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLIN, L., LIU, Y., TANG, R., et al.: Evodiamine: A Extremely Potential Drug Development Candidate of Alkaloids from Evodia rutaecarpa [J]. Int. J. Nanomed. \u003cb\u003e19\u003c/b\u003e, 9843\u0026ndash;9870 (2024)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYU H I, CHANG H Y, LU C H, et al.: Evodiamine exerts anti-cancer activity including growth inhibition, cell cycle arrest, and apoptosis induction in human follicular thyroid cancers [J]. Am. J. Cancer Res. \u003cb\u003e14\u003c/b\u003e(10), 4989\u0026ndash;4999 (2024)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZHAO, X., ZHANG, S., WU, M., et al.: High urea promotes mitochondrial fission and functional impairments in astrocytes inducing anxiety-like behavior in chronic kidney disease mice [J]. Metab. Brain Dis. \u003cb\u003e40\u003c/b\u003e(5), 186 (2025)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSTEWART G: The emerging physiological roles of the SLC14A family of urea transporters [J]. Br. J. Pharmacol. \u003cb\u003e164\u003c/b\u003e(7), 1780\u0026ndash;1792 (2011)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSCHOLEFIELD, M., CHURCH S J, XU, J., et al.: Severe and Regionally Widespread Increases in Tissue Urea in the Human Brain Represent a Novel Finding of Pathogenic Potential in Parkinson's Disease Dementia [J]. Front. Mol. Neurosci. \u003cb\u003e14\u003c/b\u003e, 711396 (2021)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHO S C, LIU J H, WU, R.Y.: Establishment of the mimetic aging effect in mice caused by D-galactose [J]. Biogerontology. \u003cb\u003e4\u003c/b\u003e(1), 15\u0026ndash;18 (2003)\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Aging, Urea metabolism, Ammonia detoxification, Ornithine Decarboxylase 1, Urea Transporter B","lastPublishedDoi":"10.21203/rs.3.rs-7778304/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7778304/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAging represents a natural and inevitable physiological process characterized by the gradual deterioration in the functions of various organ systems. One of the central hallmarks of aging is the dysregulation of both substance and energy metabolism. Previous research has associated the urea cycle (UC) with the development of neurodegenerative diseases. In this study, we observed elevated levels of urea, the end-product of the UC, upregulation of urea cycle enzymes, and an increase of the side-product putrescine in the elderly serum and aging models, while the initial substrate ammonia remained unchanged. Notably, region-specific accumulation of neuronal urea and activation of the UC were associated with age-related deficits in cognitive and motor functions. Mechanistically, urea accumulation in the brain appears to stem from dysregulated UC activity coupled with compensatory clearance mediated by the urea transporter UT-B. Exposing neurons to high urea levels accelerated UC flux and induced cellular senescence. Importantly, pharmacological inhibition or knockdown of ornithine decarboxylase 1 (ODC1) ameliorated urea metabolic dysregulation and reduced neuronal damage. Together, these findings reveal a novel connection between dysregulated neuronal urea cycle activity and age-related neural impairment, linking metabolic reprogramming to neurodegenerative pathology. Our results not only uncover a key metabolic mechanism underlying brain aging but also provide a promising dual-target therapeutic strategy, highlighting the urea cycle as a potential intervention point for delaying neurodegenerative processes associated with aging.\u003c/p\u003e","manuscriptTitle":"ODC1 delays neurodegenerative processes in aging by promoting ammonia detoxification via neuronal urea cycle activation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-19 08:35:13","doi":"10.21203/rs.3.rs-7778304/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e6bb4828-2903-4bd3-b868-296a590627c1","owner":[],"postedDate":"November 19th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":56057629,"name":"Biological sciences/Neuroscience/Cognitive ageing"},{"id":56057630,"name":"Biological sciences/Neuroscience/Neural ageing"}],"tags":[],"updatedAt":"2026-02-15T19:20:18+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-19 08:35:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7778304","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7778304","identity":"rs-7778304","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.