Genetic Screening of ATP7B Gene in Iranian Wilson Disease Patients: A diverse landscape of pathogenic variants

preprint OA: closed
Full text JSON View at publisher
⚙ AI-generated deep summary by qwen3.7-flash, 2026-09-24 · read from full text ⓘ

This preprint investigates the genetic landscape of Wilson disease by screening the ATP7B gene in 23 unrelated Iranian families from northeastern Iran using direct sequencing and bioinformatic analysis. The study identified 13 distinct causative variants, including two novel mutations, with exons 12, 13, and 14 emerging as significant mutation hotspots that account for half of all detected alleles. These findings broaden the known spectrum of ATP7B mutations in this population and provide critical data for carrier screening and prenatal diagnosis within affected families. The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background/Objective: Wilson's disease (WD) is an autosomal recessive condition caused by mutations in the ATP7B gene, leading to the copper accumulation in various organs. Data on the ATP7B mutation spectrum in Iran and the Middle East is insufficient. This study aims to screen the ATP7B gene in unrelated Iranian families (n = 23) from northeastern Iran. Methods DNA was extracted from peripheral blood, and variant screening was performed using direct sequencing of the entire ATP7B gene coding region. The full 3D structure of the defective proteins was determined using the I-TASSER software. Results The overall frequency of causative variant detection was 84.7% (39/46). Among the 23 patients with WD, we identified 13 different causative variants: eight missense, two nonsense, one splicing, one deletion, and one deletion/insertion changes. Two of which were novel: c.3431delTinsAGA (p.Phe1144Ter) and c.1156G > A (p.Gly386Arg). The c.2807T > A (p.Leu936Ter) variant at exon 12 was the most prevalent in our study, with an allelic frequency of 17.39%, followed by c.3188C > T (p.Ala1063Val) at exon 14, exhibiting an allelic frequency of 13.04%. Exons 12, 13, and 14 were identified as mutation hot spots, with detection rate of 50% (23/46). Ten out of the 13 variants identified in our study were reported for the first time in Iran (this report). Conclusion We reported two novel variants that broaden the known spectrum of mutations associated with the ATP7B gene. The variants identified in this study can facilitate carrier screening and presymptomatic detection and can be used in prenatal genetic diagnosis in affected families.
Full text 148,970 characters · extracted from preprint-html · click to expand
Genetic Screening of ATP7B Gene in Iranian Wilson Disease Patients: A diverse landscape of pathogenic variants | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genetic Screening of ATP7B Gene in Iranian Wilson Disease Patients: A diverse landscape of pathogenic variants Seyyed-Saleh Hashemi, Seyed Ali Jafari, Aida Gholoobi, Tayebeh Hamzehloei This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4957273/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background/Objective: Wilson's disease (WD) is an autosomal recessive condition caused by mutations in the ATP7B gene, leading to the copper accumulation in various organs. Data on the ATP7B mutation spectrum in Iran and the Middle East is insufficient. This study aims to screen the ATP7B gene in unrelated Iranian families (n = 23) from northeastern Iran. Methods DNA was extracted from peripheral blood, and variant screening was performed using direct sequencing of the entire ATP7B gene coding region. The full 3D structure of the defective proteins was determined using the I-TASSER software. Results The overall frequency of causative variant detection was 84.7% (39/46). Among the 23 patients with WD, we identified 13 different causative variants: eight missense, two nonsense, one splicing, one deletion, and one deletion/insertion changes. Two of which were novel: c.3431delTinsAGA (p.Phe1144Ter) and c.1156G > A (p.Gly386Arg). The c.2807T > A (p.Leu936Ter) variant at exon 12 was the most prevalent in our study, with an allelic frequency of 17.39%, followed by c.3188C > T (p.Ala1063Val) at exon 14, exhibiting an allelic frequency of 13.04%. Exons 12, 13, and 14 were identified as mutation hot spots, with detection rate of 50% (23/46). Ten out of the 13 variants identified in our study were reported for the first time in Iran (this report). Conclusion We reported two novel variants that broaden the known spectrum of mutations associated with the ATP7B gene. The variants identified in this study can facilitate carrier screening and presymptomatic detection and can be used in prenatal genetic diagnosis in affected families. Wilson’s Disease ATP7B Molecular diagnosis Targeted Sequencing Mutation Figures Figure 1 Figure 2 Figure 3 Figure 4 INTRODUCTION Wilson's disease (WD) is a rare autosomal recessive disorder of copper metabolism that leads to the pathological accumulation of copper in the brain, liver, and other organs. WD is associated with mutations in the ATP7B gene, located on chromosome 13q14.3, which is the causative gene. The ATP7B gene encodes a P-type transmembrane ATPase responsible for transporting copper to the trans-Golgi network of hepatocytes and is highly expressed in the liver. This protein plays a crucial role in maintaining hepatic copper homeostasis. It comprises eight transmembrane domains (TMs), six metal-binding domains (MBDs), a nucleotide-binding domain (N-domain), a phosphorylation domain (P-domain), and an actuator domain (A-domain). (Bitter, Oh et al. 2022). In hepatocytes, ATP7B facilitates the incorporation of copper into ceruloplasmin and its excretion in bile. When ATP7B is dysfunctional, excess copper accumulates, leading to hepatocyte injury. Additionally, free copper enters the bloodstream, causing damage to other organs (Roberts and Schilsky 2008 , 2012). The prevalence of WD is estimated to be between 1 in 30,000 and 1 in 100,000 individuals worldwide (Ala, Walker et al. 2007). Since WD is autosomal recessive, an increase in cases may occur due to founder effects and consanguineous marriages. WD is a clinically heterogeneous disorder characterized by a wide spectrum of manifestations, including hepatic, neurological, and psychiatric symptoms (Ferenci, Caca et al. 2003). Early in life, patients are asymptomatic, but the gradual accumulation of copper leads to varying degrees of subclinical liver disease (Brewer 1992 ). Assessing WD patients shows variability in the age of onset, ranging from early childhood to the sixth decade. However, WD generally occurs in children and young adults (Lorincz 2010 ). The ATP7B gene consists of 21 exons, and to date, more than 1,300 different mutations throughout this gene have been reported in the Human Gene Mutation Database (HGMD professional 2023.4). Most of these mutations are rare, with a few hotspot mutations exhibiting racial and regional differences. There are notable differences in the spectrum of ATP7B mutations between populations (Gomes and Dedoussis 2016 ). Most of the mutations in the ATP7B gene are missense mutations, and their distribution is heterogeneous. However, certain hot spots have been identified, including exons 8 and 14 (Ferenci 2006 ). WD was traditionally diagnosed based on biochemical indices, including low serum ceruloplasmin levels, elevated 24-hour urinary copper excretion, and increased liver copper content. Clinical signs, such as the presence of Kayser-Fleischer (KF) rings, were also considered in the diagnostic process (Mak and Lam 2008 ). Despite their utility, biochemical markers can sometimes be misleading, posing challenges in the diagnosis of WD. Therefore, molecular examination is recommended for an accurate and definitive diagnosis of WD patients. This becomes particularly crucial in diagnosing siblings of the proband within a WD-affected family and asymptomatic individuals (Kasztelan-Szczerbinska and Cichoz-Lach 2021 ). However, the available data regarding observed mutations in the Iranian population is insufficient, and no study has been conducted on the genetic status of WD in the Northeastern region of Iran. We, therefore aimed to investigate the ATP7B gene mutations in Iranian patients with WD in the Northeast region. PATIENTS AND METHODS 1 Subjects This research was conducted in accordance with the Declaration of Helsinki and was approved by the Ethics Committee of the Mashhad University of Medical Science (MUMS) (ethical code: IR.MUMS.MEDICAL.REC.1401.358). All patients and their family members were informed about the study's purpose, and consent forms were signed. Included in this study were 23 unrelated Iranian families affected by WD were referred to Akbar Hospital, a Children's Teaching Hospital in Mashhad, for genetic analysis. Clinical data of all probands and their parents were collected when available. The diagnosis of WD was confirmed by a combination of biochemical and clinical features, including 24-hour urine copper (> 100 µg/24 h), serum ceruloplasmin ( 250 µg/g dry weight), and the presence of Kayser-Fleischer (KF) rings. 2 Genetic testing 2.1 DNA extraction and Polymerase chain reaction (PCR) Genomic DNA was extracted from whole blood samples using the salting-out method. Manual primer design was used to design 19 PCR amplicons that cover all 21 exons of the ATP7B Gene. Flanking intronic sequences were covered as much as possible, with at least 60 bp (Table 1 ). The amplification was carried out in a total volume of 25 µL, with the following steps: initial denaturation at 95°C for 5 minutes, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 59–66°C for 40 s (with primers having different annealing temperatures), extension at 72°C for 40 s, and a final extension at 72°C for 10 min. Table 1 Primer sequences used for PCR amplification of 21 exons of ATP7B gene Exon Nomber Primer Sequence (5’ > 3’) Size (bp) Annealing temperature (˚C) 1 F CGCAACTTTGAATCATCCGTG 459 62 R CAAACATCAGTTGACGGCAC 2A F CTACCCTTGGGATATTTTGACACC 844 66 R TGACCACATGGCTTCCTTGG 2B F CATTCAGCCCGAAGACCTCAG 828 65 R CCACTGTTGACATGGGAGGC 3 F TGGGAGCCGGGACAATGAAC 475 63 R GCTACCTGGTTATCAGGGCTACTG 4 F TGGGTAAGAGACCAGACATCG 473 65 R ACAAACCAGACACGTCCAAG 5 F GTCCAGGGTCTTGAGAGCAG 499 66 R ACCCATTCACTGATATCCTCCC 6 F CCCACAAAGTCTACTGAGGCAC 335 63 R CAAGGGTAAAGGCAGCTAATCC 7 F CTAGATGCTCCCTCAGATGGC 447 65 R GGAAAGCTGCAATAAAGTGCC 8 F GACTGTGCACAAAGCTAGAGG 421 59 R CTAAACATGGTGTTCAGAGGAAG 9 F TAGCAAGTAACGCCCACCTG 357 66 R CTGCCCACACTCACAAGGTC 10,11,12 F CTATTGTAACAGCTGGCCTAGAAC 955 64 R GCTGTCAATAAGAGAAGCAAGC 13 F TGACTCTGCTCCTGTAATGC 612 61 R TATGACTGGTGGCTACTCTG 14 F GAACGACAGAGGATCACGTTAG 401 59 R TAGGAGAGAAGGACATGGTGAG 15 F CCTTTCCTATCTGTTCCACCTC 447 59 R CCTTAGCCATGAACCGTCTG 16 F GAGGTGCTTACAAGGTTACAG 507 60 R TTCCAAGGTCAAGGAGACTG 17 F CCTATTCCTTGGGGAGCCACTG 472 65 R AGCAGGAGTACAGCTCAGTGC 18,19 F CAGGAGCCAGGGATAAACTGG 694 59 R GCCTTTCTAAAACGCCTCTAGC 20 F ACATCAGGGCGAGTGGAAGAG 542 66 R GAATTGCCTGCTCATGGTGC 21 F AGATGGATGAGAGGCCTTCACC 797 66 R CACACAGACAGGCGTCATCAG 2.2 Targeted Sanger sequencing Direct sequencing of the obtained PCR products was performed to detect disease-causing variants and single nucleotide variants (SNVs) using an ABI Prism 3500XL system (Applied Biosystems, Foster City, CA). The exons were sequenced in the following order, exon 8, exon 14, exons 18–19, exon 15, exon 13, exon 2, exons 10-11-12, exon 16, exons 3-7-9-20-21, and exons 1,4,5,6,17. Sequenced reads were analyzed with Sequencher 5.0 software, and detected variants were evaluated with the reference sequences available at NCBI: NM_000053.4, NC_000013.11, NP_000044.2. Co-segregation analysis of detected variants in affected families was performed by sequencing corresponding exons in the parents. 2.3 In silico analysis The pathogenic effects of variants on encoded proteins were predicted using several bioinformatic tools, including Mutation Taster, Polyphen2-HDIV, SIFT, PROVEAN, FATHMM, DANN, EIGEN, BayesDel, MetaLR, LRT, SpliceAI, and varSEAK databases. Clinical evaluation of the variants was carried out in the Franklin and Varsome databases based on the American College of Medical Genetics (ACMG) guidelines (Richards, Aziz et al. 2015). Furthermore, we utilized the ConSurf database ( https://consurfdb.tau.ac.il/ ) to evaluate the evolutionary conservation of the amino acids affected by the majority of variants identified in this study. 2.4 Protein modeling We modeled the three-dimensional structure of ATP7B wild-type protein based on NM_000053.4 transcript using I-TASSER protein structure prediction software ( https://zhanggroup.org/I-TASSER/ ). Additionally, to identify structural changes, we predicted the defective protein resulting from the novel nonsense variant c.3431delTinsAGA. Furthermore, for the eight missense variants, we illustrated the alterations in the 3D structure of the protein and the interaction of amino acids before and after the variation. The models of the wild-type and mutant ATP7B proteins were visualized using the PyMOL molecular graphics system and animated using the ChimeraX program (video files are included in supplementary file 1). RESULTS All patients met the paraclinical and biochemical criteria for inclusion in the study, as outlined in the methods section. A total of 23 probands, comprising 14 females and nine males, were categorized into three different clinical conditions: hepatic (14 cases), neurological (5 cases), and combined (4 cases). The mean age at presentation was 7.9 years, ranging from 3.5 to 14. Among these, 19 probands were born to unaffected consanguineous parents, while in four cases, the parents were non-consanguineous. Kayser-Fleischer (KF) rings were detected in 17 out of 23 (74%) probands. The median ceruloplasmin level was 6.8 mg/dL (range 1.6–15 mg/dL). Table 2 summarizes the variously identified genotypes and clinical characteristics of the patients, including their age of disease onset, presence of KF rings, form of the disease, and the involved organs (liver, brain, or both). Table 2 Clinical, biochemical, and mutation characteristics of the 23 Iranian WD patients harboring the mutations in the ATP7B gene. # Mutation(s) Zygosity Gender Consanguinity Age at examination (yrs) Age at onset (yrs) Hepatic form Neurological form Ceruloplasmin level (mg/dL) KF rings WD1 c.3431delTinsAGA Homozygous F + 11 5 + - 5 + WD2 c.2648_2649del Homozygous F + 20 4 - + 1.6 + WD3 c.3895C > T & c.4103T > C Compound heterozygous M - 14 11 - + 4.3 + WD4 c.2807T > A Homozygous F + 15 3.5 + - 8.6 - WD5 c.3188C > T Homozygous F + 9 7 + - 10 - WD6 c.813C > A & c.2621C > T Compound Heterozygous F - 23 10 + - 1.9 + WD7 c.3188C > T Homozygous F + 35 6 + + 4.3 + WD8 c.3207C > A Homozygous F + 12 7 + - 15 + WD9 c.2930C > T Homozygous F + 16 8 + - 13.6 + WD10 c.813C > A Homozygous F + 15 12 - + 7.3 + WD11 c.4103T > C Homozygous M + 26 13 - + 5.1 + WD12 c.2866-2A > C Homozygous F + 13 8 + + 4 + WD13 c.2807T > A Homozygous M + 18 7 + + 8.8 + WD14 c.2807T > A Homozygous M + 17 9 + - 9.6 + WD15 c.1924G > C Homozygous M + 8 6 + - 11 - WD16 c.2866-2A > C & ? Heterozygous M - 13 8 + - 6.1 + WD17 - - F + 14 10 + - 11.2 - WD18 c.3188C > T Homozygous F + 34 7 + + 3.5 + WD19 - - M - 16 11 + - 2.5 - WD20 c.1156G > A Homozygous M + 31? 14 - + 1.9 + WD21 c.2930C > T Homozygous F + 19 5 + - 9.1 + WD22 c.2807T > A Homozygous F + 13 6 + - 7 - WD23 - - M + 12 4 + - 6.7 + Abbreviations: F, Female; M, Male Targeted Sequencing of the entire coding region of the ATP7B gene in 23 WD families found a total of 13 different causative variants in 20/23 families, with a detection rate of 84.7% (39/46) (Table 3 ). These variants included missense, nonsense, splicing, deletion, and deletion/insertion mutations. Among these, 10 variants including p.Cys271Ter, p.Gly386Arg, p.Val883AlafsTer3, p.Leu936Ter, c.2866-2A > C, p.Thr977Met, p.Ala1063Val, p.Phe1144Ter, p.Leu1299Phe, and p.Leu1368Pro were detected for the first time in the Iranian population. Two of the 13 variants were novel p.Phe1144Ter, and c.1156G > A p.Gly386Arg (Fig. 1 ). However, eight out of 13 (61.5%) variants were missense mutations, indicating that they were the most commonly observed variants in this study. Deletion, deletion/insertion, and splicing mutations were each observed once, while two variants were nonsense mutations (Table 3 ). Of the 20 families with variants, one family had a single variant in a heterozygous state, and no pathogenic variant was found for the second allele. Table 3 Characteristics of the detected variants in the ATP7B gene in WD patients during present study (NM_000053.4). # Exon (E)/ Intron (I) Mutation type Domain Allelic frequency in genomAD Exomes Allelic frequency in this cohort Reported/ Novel ACMG criteria c.813C > A p.Cys271Ter E2 Nonsense MBD3 0.0000376 6.52% (3/46) Reported Pathogenic/ PM3, PVS1, PM2 c.1156G > A p.Gly386Arg E2 Missense MBD4 0.00000137 4.34% (2/46) Novel Likely Pathogenic/ PM2, PP3, PP2 c.1924G > C p.Asp642His E6 Missense bet MBD6/TM1 0.000012 4.34% (2/46) Reported Likely Pathogenic/ PM2, PP2, PM5, PP3, PP5 c.2621C > T p.Ala874Val E11 Missense TM5 0.0000588 2.17% (1/46) Reported Pathogenic/ PM3, PP1, PS3, PM1, PP2, PM2, PM5, PP3 c.2648_2649del p.Val883AlafsTer3 E11 Deletion TM5 NA 4.34% (2/46) Reported Likely Pathogenic/ PVS1, PM2, PM3 c.2807T > A p.Leu936Ter E12 Nonsense TM5 0.00000205 17.39% (8/46) Reported Pathogenic/ PM3, PVS1, PM2 c.2866-2A > C I12 Splicing TM6 0.00000954 6.52% (3/46) Reported Pathogenic/ PM3, PVS1, PM2 c.2930C > T p.Thr977Met E13 Missense TM6 0.000182 8.69% (4/46) Reported Pathogenic/ PM3, PP1, PS3, PM1, PP2, PM2, PP3 c.3188C > T p.Ala1063Val E14 Missense P-domain 0.0000041 13.04% (6/46) Reported Pathogenic/ PM3, PM1, PP2, PP2, PM2, PP3 c.3207C > A p.His1069Gln E14 Missense P-domain 0.000945 4.34% (2/46) Reported Pathogenic/ PM3, PP1, PS3, PM1, PP2, PM2, PM5, PP3 c.3431delTinsAGA p.Phe1144Ter E16 Deletion/Insertion N-domain NA 4.34% (2/46) Novel Likely Pathogenic/ PVS1, PM2 c.3895C > T p.Leu1299Phe E18 Missense bet N-domain/ TM7 0.0000157 2.17% (1/46) Reported Pathogenic/ PM3, PM2, PM5, PP3, PP2 c.4103T > C p.Leu1368Pro E20 Missense TM8 0.0000081 6.52% (3/46) Reported Likely Pathogenic/ PM1, PP2, PM2, PP3, PP5 Abbreviations: TM, Transmembrane; MBD, Metal Binding Domains; NA, Not Applicable The distribution of the 13 variants identified in our study of 23 WD patients can be observed in Fig. 2 . These variants were located within nine exons of the ATP7B gene, including exons 2, 6, 11, 12, 13, 14, 16, 18, and 20, as well as intron 12. The p.Leu936Ter in the exon 12 with an allelic frequency of 17.39 (8/46), was observed in 4 out of 23 probands and was considered the most common variant in the present study. The second most frequent variant, p.Ala1063Val in exon 14, was detected in 3 out of 23 patients, with an allelic frequency of 13.04% (6/46). In this research, the positioning of separate variants introduced exons 12, 13, and 14 as “hot spots” exons of the ATP7B gene in the Northeastern region of Iran. The total disease-causing variant detection rate on these three exons was 50% (23/46), suggesting their importance for molecular diagnosis of WD in this area. The compound-heterozygous form was found only in 2 out of the 23 (9%) patients, while the homozygous form was identified in 17 out of 23 (74%) patients, consistent with the pattern of consanguineous marriages in families. Our novel variant p.Phe1144Ter was absent in many public databases such as 1,000 Genomes, ExAC, gnomAD, GME Variome Project, ABraOM, HEX database, and in Iranome or more than 100 in-house exomes of the unrelated Iranians affected with non-metabolic and non-neurological disorders, (minor allele frequency (MAF) = 0). The p.Phe1144Ter variant is a null variant that causes premature termination of translation and was predicted as "likely pathogenic" by default InterVar (ACMG). Alternatively, the absence of protein expression for the p.Phe1144Ter variant could be due to degradation of the mutant mRNA via the Nonsense-mediated mRNA decay (NMD) mechanism. At the protein level, the conservation analysis with the ConSurf database showed that phenylalanyl residue in the p.Phe1144Ter variant is located in an average region, and probably following that, a large number of highly conserved amino acids are removed from the protein structure (Fig. 3 A). The p.Gly386Arg variant, another undescribed variant, is reported ultra-rarely in population databases, and we introduce it for the first time as a disease-causing variant. This variant is reported as deleterious by the majority of bioinformatic prediction tools (Supplementary Table 1). According to the ConSurf database, the p.Gly386Arg variant occurs in a conserved region (Fig. 3 B). Changes in the 3D structure of the mutated proteins compared to intact ATP7B are depicted in Fig. 3 C. The following parameters were obtained for the predicted model: C-score (a confidence score for estimating the quality of the predicted models by I-TASSER) was − 2.55. The estimated TM-score was 0.42 ± 0.14, and The Estimated RMSD (Root-Mean-Square Deviation that measures the average distance between atoms of superimposed proteins) was 16.5 ± 3.0. The c.2866-2A > C variant detected in families WD12 and WD16 is located in the conserved acceptor splice site upstream of exon 13 and is considered pathogenic by the SpliceAl and varSEAK databases, which likely leads to exon skipping and the creation of a defective ATP7B protein. The results of in silico analysis using bioinformatic tools such as Mutation Taster, Polyphen2-HDIV, SIFT, PROVEAN, FATHMM, DANN, BayesDel, EIGEN, MetaLR, and LRT are shown in Supplementary Table 1. In addition to these variants, twelve single nucleotide polymorphisms (SNPs) that do not disrupt ATP7B gene function were identified (Table 4 ). Table 4 Characteristics of the detected single nucleotide polymorphisms in the ATP7B gene during present study (NM_000053.4). # Exon (E)/ Intron (I) type Domain Reported/ Novel c.51 + 108G > A I1 Intronic - Reported c.1216T > G p.Ser406Ala E2 Missense MBD4 Reported c.1366G > C p.Val456Leu E3 Missense bet MB4/ MBD5 Reported c.2322T > C p.Ile774= E8 Silent TM4 Reported c.2495A > G p.Lys832Arg E10 Missense bet TM4/ TM5 Reported c.2855G > A p.Arg952Lys E12 Missense TM5 Reported c.2866-13G > C I12 Intronic - Reported c.2866-90G > T I12 Intronic - Reported c.2973G > A p.Thr991= E13 Silent TM6 Reported c.2976C > A p.Pro992= E13 Silent TM6 Reported c.3009G > A p.Ala1003= E13 Silent TM6 Reported c.3419T > C p.Val1140Ala E16 Missense N-domain Reported Abbreviations: TM, Transmembrane; MBD, Metal Binding Domains DISCUSSION The advent of DNA sequencing and targeted gene sequencing of the ATP7B gene made a breakthrough in the molecular diagnosis of WD, which exhibits significant allelic heterogeneity. In certain populations, the prevalence of specific mutations enables basic screening and rapid disease diagnosis. Consequently, numerous population-specific studies on WD are underway worldwide. In our study of WD patients, 74% (34/46) of causative alleles were identified through direct sequencing of five PCR amplicons, covering exons 2B, 11–12, 13, 14, and 20. This proves to be significantly cost-effective compared to sequencing all 19 PCR amplicons encompassing the entire 21 exons of the ATP7B gene coding region. Therefore, we recommend prioritizing screening of these exons in the Iranian population in the Northeast region. Our findings are consistent with previous studies in Middle Eastern countries, confirming a wide range of pathogenic variants in the ATP7B gene, most of which are rare and of low frequency (Simsek Papur, Akman et al. 2013, Barada, El Haddad et al. 2017). The absence of the p.Arg778Leu mutation, the most common mutation in the Asian pedigree, in our cohort is noteworthy. Similarly, we did not detect any mutations in exon 8, which is one of the most frequent mutational sites in the ATP7B gene and was the first exon we examined. Additionally, The p.His1069Gln, the most common mutation in Europe affecting 15_70% European WD population (Chang and Hahn 2017 ), was only found in 4.34% (2/46) of our cohort, While the other mutation located in exon 14, p.Ala1063Val, which has lower frequency in Europe, was found in 13.04% (6/46) of our cohort. The frequency of p.Leu936Ter in our study was 17.39%, which is also common in the United Kingdom (10%), and Greece (7%) population (Butler, McIntyre et al. 2001, Panagiotakaki, Tzetis et al. 2004). Additionally, the p.Leu936Ter mutation was reported in India (1–2%) and Turkey (2%) (Simsek Papur, Akman et al. 2013, Kumari, Kumar et al. 2018). Indeed, it appears that this mutation is relatively common in European and Mediterranean populations. On the other hand, the p.Ala1063Val mutation has been reported as rare in most populations, such as China (0.73%), Czech Republic and Slovakia (0.25%), France (0.5%), and Italian/Turkish (0.4%) (Loudianos, Dessi et al. 1999, Vrabelova, Letocha et al. 2005, Bost, Piguet-Lacroix et al. 2012, Cheng, Wang et al. 2017), however, the frequency of this mutation (13.04%) was notably high in our population. In the present study, we report a high detection rate (84.7%) of ATP7B causative variants in our cohort. The direct sequencing detection rate in patients with WD that has been clinically proven has varied widely in previous studies. For example, Alison J. Coffey et al . showed that the rate of mutation discovery in their study was 98% (356/362) of alleles on direct sequencing of all exons of the ATP7B gene in the 181 unrelated WD patients from the United Kingdom (Coffey, Durkie et al. 2013). Mingming Li conducted a mutational investigation of 101 WD patients from China and found that the mutation detection rate was up to 80.7% (163/202) (Li, Ma et al. 2021). A similar study conducted in China by Gu YH on 40 patients recorded an 83.8% (67/80) mutation detection rate (Gu, Kodama et al. 2003). In Iran, two separate studies on 70 and 30 WD patients, found a mutational detection rate of 30% (42/140) and 76% (46/60), respectively (Zali, Mohebbi et al. 2011, Maleki, Zali et al. 2013). However, The detection rate of direct genetic analyses of ATP7B can vary depending on the accuracy of clinical diagnosis. In this study, out of the 13 variants we identified, 6 (46.1%) were recurrent, suggesting the possibility of founder mutations. Due to the high rate of same-caste marriages in Iran, the founder mutations can be as influential as consanguineous marriages in the occurrence of recessive disorders. In families WD12 and WD16, we identified an intronic variant c.2866-13G > C in association with causative c.2866-2A > C pathogenic variant, indicating a potential founder haplotype in these patients (Fig. 4 ). Previously, Mohammed al-tobi et al ., found that the c.2866-2A > G mutation leads to the skipping of exon 13 (195 bp) from the mRNA transcript, likely rendering the protein non-functional (Al-Tobi, Kashoob et al. 2011). The c.2866-2A > C will probably have the same effect. Functional studies for this variant are required to authenticate our conjecture. In WD3 and WD11 probands, the c.2322T > C (p.Ile774=) polymorphism was detected in heterozygous and homozygous states, respectively, and is linked with the c.4103T > C (p.Leu1368Pro) causative variant in these patients. It is possible that the coexistence of c.2322T > C (p.Ile774=) polymorphism and c.4103T > C (p.Leu1368Pro) variant could have a particular effect on the ATP7B function. Further investigations are needed to confirm this claim. Additionally, the detection of the c.3009G > A (p.Ala1003=) polymorphism in all 4 patients with c.2807T > A (p.Leu936Ter) mutation was notable. This suggests that their linkage may affect the expression of the ATP7B protein. In various studies, cases with no mutations in the coding sequence of ATP7B are always reported, with variable frequency among different populations. In our study, in 3 out of 23 Iranian patients with WD, We could not find any pathogenic variant in the exons of the ATP7B gene. In these cases, Failure to detect any variant can be explained by several reasons, including the occurrence of unknown mutations located outside the coding sequence and flanking regions, such as gene regulatory elements or deep intronic sequences (Woimant, Poujois et al. 2020, Collins, Yi et al. 2021). Having one of Wilson's mimicry disorders can also be considered a rare cause (Roberts 2018 ). However, further studies using high-throughput techniques such as Whole Exome Sequencing (WES) or Whole Genome Sequencing (WGS) are needed for molecular diagnosis of WD patients with no specific mutations in coding sequences of the ATP7B gene. In conclusion, The spectrum of ATP7B gene variants in the Northeastern region of Iran is very diverse. Therefore, large-scale studies can provide more insights into the genetic status of the disease in the region. Most of the variants found in this study were previously unreported in Iran. Furthermore, we identified two novel undescribed variants in the Northeastern Iranian WD patients that could expand the previously defined spectrum of ATP7B gene mutations. Declarations We acknowledge the Mashhad of the University of Medical Sciences for funding the research (Grant No.4010194) based on the PhD thesis of Seyyed-Saleh Hashemi and thank the patients and their family members for participating in the study . Competing Interests The authors have nothing to disclose. Author Contributions Seyyed-Saleh Hashemi: DNA extraction, primer design, analysis of sanger sequencing data, mutation screening of candidate variants, writing and editing of the manuscript; Seyed Ali Jafari: Clinical evaluations; Aida Gholoobi: Principal investigator, review and editing; Tayebeh Hamzehloei: Conceptualization, supervision, methodology, validation, review and editing. All authors read and approved the final version of the manuscript. References J Hepatol (2012). "EASL Clinical Practice Guidelines: Wilson's disease." 56 (3): 671-685. Al-Tobi, M., et al. (2011). "A novel splice-site allelic variant is responsible for Wilson Disease in an Omani family." Sultan Qaboos University Medical Journal 11 (3): 357. Ala, A., et al. (2007). "Wilson's disease." The Lancet 369 (9559): 397-408. Barada, K., et al. (2017). "Wilson's disease in Lebanon and regional countries: Homozygosity and hepatic phenotype predominance." World J Gastroenterol 23 (36): 6715-6725. Bitter, R. M., et al. (2022). "Structure of the Wilson disease copper transporter ATP7B." Sci Adv 8 (9): eabl5508. Bost, M., et al. (2012). "Molecular analysis of Wilson patients: direct sequencing and MLPA analysis in the ATP7B gene and Atox1 and COMMD1 gene analysis." Journal of trace elements in Medicine and Biology 26 (2-3): 97-101. Brewer, G. (1992). "Yuzbasiyan-Gurkan V." Wilson disease. Medicine (Baltimore) 71 (3): 139-164. Butler, P., et al. (2001). "Molecular diagnosis of Wilson disease." Molecular genetics and metabolism 72 (3): 223-230. Chang, I. J. and S. H. Hahn (2017). "The genetics of Wilson disease." Handb Clin Neurol 142 : 19-34. Cheng, N., et al. (2017). "Spectrum of ATP7B mutations and genotype–phenotype correlation in large‐scale Chinese patients with Wilson Disease." Clinical Genetics 92 (1): 69-79. Coffey, A. J., et al. (2013). "A genetic study of Wilson’s disease in the United Kingdom." Brain 136 (5): 1476-1487. Collins, C. J., et al. (2021). "Direct measurement of ATP7B peptides is highly effective in the diagnosis of Wilson disease." Gastroenterology 160 (7): 2367-2382. e2361. Ferenci, P. (2006). "Regional distribution of mutations of the ATP7B gene in patients with Wilson disease: impact on genetic testing." Hum Genet 120 (2): 151-159. Ferenci, P., et al. (2003). "Diagnosis and phenotypic classification of Wilson disease 1." Liver International 23 (3): 139-142. Gomes, A. and G. V. Dedoussis (2016). "Geographic distribution of ATP7B mutations in Wilson disease." Ann Hum Biol 43 (1): 1-8. Gu, Y. H., et al. (2003). "Mutation spectrum and polymorphisms in ATP7B identified on direct sequencing of all exons in Chinese Han and Hui ethnic patients with Wilson's disease." Clinical Genetics 64 (6): 479-484. Kasztelan-Szczerbinska, B. and H. Cichoz-Lach (2021). "Wilson's Disease: An Update on the Diagnostic Workup and Management." J Clin Med 10 (21). Kumari, N., et al. (2018). "Characterization of mutation spectrum and identification of novel mutations in ATP7B gene from a cohort of Wilson disease patients: Functional and therapeutic implications." Human Mutation 39 (12): 1926-1941. Li, M., et al. (2021). "Mutation analysis of the ATP7B gene and genotype–phenotype correlation in Chinese patients with Wilson disease." BMC gastroenterology 21 : 1-21. Lorincz, M. T. (2010). "Neurologic Wilson's disease." Annals of the New York Academy of Sciences 1184 (1): 173-187. Loudianos, G., et al. (1999). "Mutation analysis in patients of Mediterranean descent with Wilson disease: identification of 19 novel mutations." Journal of medical genetics 36 (11): 833-836. Mak, C. M. and C. W. Lam (2008). "Diagnosis of Wilson's disease: a comprehensive review." Crit Rev Clin Lab Sci 45 (3): 263-290. Maleki, I., et al. (2013). "NOVEL MUTATIONS OF ATP7B GENE IN IRANIAN PATIENTS WITH WILSON'S DISEASE." Panagiotakaki, E., et al. (2004). "Genotype–phenotype correlations for a wide spectrum of mutations in the Wilson disease gene (ATP7B)." American Journal of Medical Genetics Part A 131 (2): 168-173. Richards, S., et al. (2015). "Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology." Genet Med 17 (5): 405-424. Roberts, E. A. (2018). "Update on the diagnosis and management of Wilson disease." Current gastroenterology reports 20 : 1-12. Roberts, E. A. and M. L. Schilsky (2008). "Diagnosis and treatment of Wilson disease: an update." Hepatology 47 (6): 2089-2111. Simsek Papur, O., et al. (2013). "Mutation analysis of ATP7B gene in Turkish Wilson disease patients: identification of five novel mutations." Eur J Med Genet 56 (4): 175-179. Vrabelova, S., et al. (2005). "Mutation analysis of the ATP7B gene and genotype/phenotype correlation in 227 patients with Wilson disease." Molecular genetics and metabolism 86 (1-2): 277-285. Woimant, F., et al. (2020). "A novel deep intronic variant in ATP7B in five unrelated families affected by Wilson disease." Molecular Genetics & Genomic Medicine 8 (10): e1428. Zali, N., et al. (2011). "Prevalence of ATP7B Gene Mutations in Iranian Patients With Wilson." Additional Declarations No competing interests reported. Supplementary Files SupplementaryTable1.docx Supplementary Table 1. The results of in silico analysis using several prediction tools. Supplementaryfile1.rar Supplementary file 1. Animated model of wild-type ATP7B protein (NP_000044.2), created using the ChimeraX program. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4957273","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":347599575,"identity":"1e857b53-e2f8-4789-8e3b-8495f30a1c67","order_by":0,"name":"Seyyed-Saleh Hashemi","email":"","orcid":"","institution":"Mashhad University of Medical Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Seyyed-Saleh","middleName":"","lastName":"Hashemi","suffix":""},{"id":347599576,"identity":"64c46bdb-7358-4fc9-8fda-6de2c263cda6","order_by":1,"name":"Seyed Ali Jafari","email":"","orcid":"","institution":"Mashhad University of Medical Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Seyed","middleName":"Ali","lastName":"Jafari","suffix":""},{"id":347599577,"identity":"42a3842b-2a05-4099-a799-eb5c8a9cf83a","order_by":2,"name":"Aida Gholoobi","email":"","orcid":"","institution":"Mashhad University of Medical Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Aida","middleName":"","lastName":"Gholoobi","suffix":""},{"id":347599578,"identity":"06bd4350-9b6a-4d0f-98ff-6a5e3b52e605","order_by":3,"name":"Tayebeh Hamzehloei","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6ElEQVRIiWNgGAWjYBACgwNAgrHBgoGBmf/jAyCbh49ILRJALYzNBiAtbMRrYWBsA5EMhLUcP5384eMOCTl+dsa2yq85djJsDMwPH93Ao8X+TO4Gw5lnJIwlmxnbbstuSwY6jM3YOAevw3I3JPO2SSRuOAzUIrmNGaiFh00ar5bzbzcc/gvUsh+opVhyWz0RWm7kbgQ6CWgLM2Mb48dth4nR8nYzY2+bhLHEYcZmacZtx3nYmAn55Xzu5g8/22zk+PsPNn78ua3anp+9+eFjfFpQADMPmCRWOQgw/iBF9SgYBaNgFIwYAADhv0owjSQH1AAAAABJRU5ErkJggg==","orcid":"","institution":"Mashhad University of Medical Sciences","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Tayebeh","middleName":"","lastName":"Hamzehloei","suffix":""}],"badges":[],"createdAt":"2024-08-22 10:28:38","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4957273/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4957273/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":66754235,"identity":"aa6dec2f-56d3-42da-ab3d-aa354d715f02","added_by":"auto","created_at":"2024-10-16 07:56:15","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":623355,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA)\u003c/strong\u003eSequence chromatograms of c.3431delTinsAGA p.Phe1144Ter variant in family WD1. \u003cstrong\u003eB)\u003c/strong\u003ePedigree of family WD1. M, mutant allele; N, wild-type allele\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4957273/v1/0a29603383ab30e5096bf881.png"},{"id":66754606,"identity":"5324b7b0-2c8c-44dc-a9de-6d42617f3fea","added_by":"auto","created_at":"2024-10-16 08:04:15","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":365633,"visible":true,"origin":"","legend":"\u003cp\u003eLocation of the mutations on the \u003cem\u003eATP7B\u003c/em\u003egene in this study\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4957273/v1/23ef13d844c3b82abbd8e908.png"},{"id":66754238,"identity":"74bc7e78-4f93-4d95-a9fe-c0a6dc559974","added_by":"auto","created_at":"2024-10-16 07:56:15","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2085484,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA) \u003c/strong\u003eAmino acid sequence of ATP7B protein, colored based on conservation scores with the ConSurf database. The results reveal that Phe1144 is located in an average region, but following that, a large number of highly conserved amino acids are removed from the protein structure.\u003cstrong\u003e B) \u003c/strong\u003eThe\u003cstrong\u003e \u003c/strong\u003eGly386 residue is located in a conserved region. \u003cstrong\u003eC)\u003c/strong\u003e The 3D structure of a novel nonsense variant and eight missense variants are shown. Variant-type and wild-type residues are marked in the figure.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4957273/v1/8a0ec34f0fc22b341aa98dbf.png"},{"id":66754605,"identity":"6876ad68-d35b-449b-b126-2f86c38419f6","added_by":"auto","created_at":"2024-10-16 08:04:15","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":135435,"visible":true,"origin":"","legend":"\u003cp\u003eAssociation of c.2866-2A\u0026gt;C variant and c.2866-13G\u0026gt;C polymorphism detected in WD12 and WD16.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4957273/v1/04179f90b4a2fe139d2aa3d0.png"},{"id":67032920,"identity":"d5e19c7b-43fa-4ed5-b808-5b16e38062fa","added_by":"auto","created_at":"2024-10-20 01:01:21","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3948925,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4957273/v1/2dc289b4-9c1c-4cb1-9c4a-f518d33ef16f.pdf"},{"id":66754234,"identity":"4a65aaa6-2d9c-4583-9103-20d1ea269b55","added_by":"auto","created_at":"2024-10-16 07:56:14","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":18762,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Table 1.\u003c/strong\u003e The results of in silico analysis using several prediction tools.\u003c/p\u003e","description":"","filename":"SupplementaryTable1.docx","url":"https://assets-eu.researchsquare.com/files/rs-4957273/v1/741a8b765fad6f9101b779a6.docx"},{"id":66754240,"identity":"033d354d-3f83-422f-aae2-0aff7b108f05","added_by":"auto","created_at":"2024-10-16 07:56:15","extension":"rar","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":5604148,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary file 1. \u003c/strong\u003eAnimated model of wild-type ATP7B protein (NP_000044.2), created using the ChimeraX program.\u003c/p\u003e","description":"","filename":"Supplementaryfile1.rar","url":"https://assets-eu.researchsquare.com/files/rs-4957273/v1/37321ccf8f59e34ceaf1a7b1.rar"}],"financialInterests":"No competing interests reported.","formattedTitle":"Genetic Screening of ATP7B Gene in Iranian Wilson Disease Patients: A diverse landscape of pathogenic variants","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eWilson's disease (WD) is a rare autosomal recessive disorder of copper metabolism that leads to the pathological accumulation of copper in the brain, liver, and other organs. WD is associated with mutations in the \u003cem\u003eATP7B\u003c/em\u003e gene, located on chromosome 13q14.3, which is the causative gene. The \u003cem\u003eATP7B\u003c/em\u003e gene encodes a P-type transmembrane ATPase responsible for transporting copper to the trans-Golgi network of hepatocytes and is highly expressed in the liver. This protein plays a crucial role in maintaining hepatic copper homeostasis. It comprises eight transmembrane domains (TMs), six metal-binding domains (MBDs), a nucleotide-binding domain (N-domain), a phosphorylation domain (P-domain), and an actuator domain (A-domain). (Bitter, Oh et al. 2022). In hepatocytes, ATP7B facilitates the incorporation of copper into ceruloplasmin and its excretion in bile. When ATP7B is dysfunctional, excess copper accumulates, leading to hepatocyte injury. Additionally, free copper enters the bloodstream, causing damage to other organs (Roberts and Schilsky \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2008\u003c/span\u003e, 2012).\u003c/p\u003e \u003cp\u003eThe prevalence of WD is estimated to be between 1 in 30,000 and 1 in 100,000 individuals worldwide (Ala, Walker et al. 2007). Since WD is autosomal recessive, an increase in cases may occur due to founder effects and consanguineous marriages.\u003c/p\u003e \u003cp\u003eWD is a clinically heterogeneous disorder characterized by a wide spectrum of manifestations, including hepatic, neurological, and psychiatric symptoms (Ferenci, Caca et al. 2003). Early in life, patients are asymptomatic, but the gradual accumulation of copper leads to varying degrees of subclinical liver disease (Brewer \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1992\u003c/span\u003e). Assessing WD patients shows variability in the age of onset, ranging from early childhood to the sixth decade. However, WD generally occurs in children and young adults (Lorincz \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eATP7B\u003c/em\u003e gene consists of 21 exons, and to date, more than 1,300 different mutations throughout this gene have been reported in the Human Gene Mutation Database (HGMD professional 2023.4). Most of these mutations are rare, with a few hotspot mutations exhibiting racial and regional differences. There are notable differences in the spectrum of \u003cem\u003eATP7B\u003c/em\u003e mutations between populations (Gomes and Dedoussis \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Most of the mutations in the \u003cem\u003eATP7B\u003c/em\u003e gene are missense mutations, and their distribution is heterogeneous. However, certain hot spots have been identified, including exons 8 and 14 (Ferenci \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2006\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWD was traditionally diagnosed based on biochemical indices, including low serum ceruloplasmin levels, elevated 24-hour urinary copper excretion, and increased liver copper content. Clinical signs, such as the presence of Kayser-Fleischer (KF) rings, were also considered in the diagnostic process (Mak and Lam \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Despite their utility, biochemical markers can sometimes be misleading, posing challenges in the diagnosis of WD. Therefore, molecular examination is recommended for an accurate and definitive diagnosis of WD patients. This becomes particularly crucial in diagnosing siblings of the proband within a WD-affected family and asymptomatic individuals (Kasztelan-Szczerbinska and Cichoz-Lach \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, the available data regarding observed mutations in the Iranian population is insufficient, and no study has been conducted on the genetic status of WD in the Northeastern region of Iran. We, therefore aimed to investigate the \u003cem\u003eATP7B\u003c/em\u003e gene mutations in Iranian patients with WD in the Northeast region.\u003c/p\u003e"},{"header":"PATIENTS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e1 Subjects\u003c/h2\u003e \u003cp\u003e This research was conducted in accordance with the Declaration of Helsinki and was approved by the Ethics Committee of the Mashhad University of Medical Science (MUMS) (ethical code: IR.MUMS.MEDICAL.REC.1401.358). All patients and their family members were informed about the study's purpose, and consent forms were signed. Included in this study were 23 unrelated Iranian families affected by WD were referred to Akbar Hospital, a Children's Teaching Hospital in Mashhad, for genetic analysis. Clinical data of all probands and their parents were collected when available. The diagnosis of WD was confirmed by a combination of biochemical and clinical features, including 24-hour urine copper (\u0026gt;\u0026thinsp;100 \u0026micro;g/24 h), serum ceruloplasmin (\u0026lt;\u0026thinsp;20 mg/dL), hepatic copper content (\u0026gt;\u0026thinsp;250 \u0026micro;g/g dry weight), and the presence of Kayser-Fleischer (KF) rings.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2 Genetic testing\u003c/h2\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003e2.1 DNA extraction and Polymerase chain reaction (PCR)\u003c/h2\u003e \u003cp\u003eGenomic DNA was extracted from whole blood samples using the salting-out method. Manual primer design was used to design 19 PCR amplicons that cover all 21 exons of the \u003cem\u003eATP7B\u003c/em\u003e Gene. Flanking intronic sequences were covered as much as possible, with at least 60 bp (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The amplification was carried out in a total volume of 25 \u0026micro;L, with the following steps: initial denaturation at 95\u0026deg;C for 5 minutes, followed by 40 cycles of denaturation at 94\u0026deg;C for 30 s, annealing at 59\u0026ndash;66\u0026deg;C for 40 s (with primers having different annealing temperatures), extension at 72\u0026deg;C for 40 s, and a final extension at 72\u0026deg;C for 10 min.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used for PCR amplification of 21 exons of ATP7B gene\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExon Nomber\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003ePrimer Sequence (5\u0026rsquo; \u0026gt; 3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSize (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAnnealing temperature (˚C)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCAACTTTGAATCATCCGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e459\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e62\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAAACATCAGTTGACGGCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTACCCTTGGGATATTTTGACACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e844\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e66\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGACCACATGGCTTCCTTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATTCAGCCCGAAGACCTCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e828\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e65\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCACTGTTGACATGGGAGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGGAGCCGGGACAATGAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e475\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTACCTGGTTATCAGGGCTACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGGTAAGAGACCAGACATCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e473\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e65\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACAAACCAGACACGTCCAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCCAGGGTCTTGAGAGCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e499\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e66\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCCATTCACTGATATCCTCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCACAAAGTCTACTGAGGCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e335\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAAGGGTAAAGGCAGCTAATCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTAGATGCTCCCTCAGATGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e447\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e65\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAAAGCTGCAATAAAGTGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACTGTGCACAAAGCTAGAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e421\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTAAACATGGTGTTCAGAGGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAGCAAGTAACGCCCACCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e357\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e66\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGCCCACACTCACAAGGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e10,11,12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTATTGTAACAGCTGGCCTAGAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e955\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e64\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTGTCAATAAGAGAAGCAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGACTCTGCTCCTGTAATGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e612\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e61\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTATGACTGGTGGCTACTCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAACGACAGAGGATCACGTTAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e401\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAGGAGAGAAGGACATGGTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTTTCCTATCTGTTCCACCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e447\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTTAGCCATGAACCGTCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGGTGCTTACAAGGTTACAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e507\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCCAAGGTCAAGGAGACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTATTCCTTGGGGAGCCACTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e472\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e65\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCAGGAGTACAGCTCAGTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e18,19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGGAGCCAGGGATAAACTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e694\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCTTTCTAAAACGCCTCTAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACATCAGGGCGAGTGGAAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e542\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e66\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAATTGCCTGCTCATGGTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGATGGATGAGAGGCCTTCACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e797\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e66\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACACAGACAGGCGTCATCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Targeted Sanger sequencing\u003c/h2\u003e \u003cp\u003e Direct sequencing of the obtained PCR products was performed to detect disease-causing variants and single nucleotide variants (SNVs) using an ABI Prism 3500XL system (Applied Biosystems, Foster City, CA). The exons were sequenced in the following order, exon 8, exon 14, exons 18\u0026ndash;19, exon 15, exon 13, exon 2, exons 10-11-12, exon 16, exons 3-7-9-20-21, and exons 1,4,5,6,17. Sequenced reads were analyzed with Sequencher 5.0 software, and detected variants were evaluated with the reference sequences available at NCBI: NM_000053.4, NC_000013.11, NP_000044.2. Co-segregation analysis of detected variants in affected families was performed by sequencing corresponding exons in the parents.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.3\u003c/b\u003e \u003cb\u003eIn silico\u003c/b\u003e \u003cb\u003eanalysis\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe pathogenic effects of variants on encoded proteins were predicted using several bioinformatic tools, including Mutation Taster, Polyphen2-HDIV, SIFT, PROVEAN, FATHMM, DANN, EIGEN, BayesDel, MetaLR, LRT, SpliceAI, and varSEAK databases. Clinical evaluation of the variants was carried out in the Franklin and Varsome databases based on the American College of Medical Genetics (ACMG) guidelines (Richards, Aziz et al. 2015). Furthermore, we utilized the ConSurf database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://consurfdb.tau.ac.il/\u003c/span\u003e\u003cspan address=\"https://consurfdb.tau.ac.il/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to evaluate the evolutionary conservation of the amino acids affected by the majority of variants identified in this study.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Protein modeling\u003c/h2\u003e \u003cp\u003eWe modeled the three-dimensional structure of ATP7B wild-type protein based on NM_000053.4 transcript using I-TASSER protein structure prediction software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://zhanggroup.org/I-TASSER/\u003c/span\u003e\u003cspan address=\"https://zhanggroup.org/I-TASSER/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Additionally, to identify structural changes, we predicted the defective protein resulting from the novel nonsense variant c.3431delTinsAGA. Furthermore, for the eight missense variants, we illustrated the alterations in the 3D structure of the protein and the interaction of amino acids before and after the variation. The models of the wild-type and mutant ATP7B proteins were visualized using the PyMOL molecular graphics system and animated using the ChimeraX program (video files are included in supplementary file 1).\u003c/p\u003e \u003c/div\u003e"},{"header":"RESULTS","content":"\u003cp\u003eAll patients met the paraclinical and biochemical criteria for inclusion in the study, as outlined in the methods section. A total of 23 probands, comprising 14 females and nine males, were categorized into three different clinical conditions: hepatic (14 cases), neurological (5 cases), and combined (4 cases). The mean age at presentation was 7.9 years, ranging from 3.5 to 14. Among these, 19 probands were born to unaffected consanguineous parents, while in four cases, the parents were non-consanguineous. Kayser-Fleischer (KF) rings were detected in 17 out of 23 (74%) probands. The median ceruloplasmin level was 6.8 mg/dL (range 1.6\u0026ndash;15 mg/dL). Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e summarizes the variously identified genotypes and clinical characteristics of the patients, including their age of disease onset, presence of KF rings, form of the disease, and the involved organs (liver, brain, or both).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eClinical, biochemical, and mutation characteristics of the 23 Iranian WD patients harboring the mutations in the ATP7B gene.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"11\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMutation(s)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eZygosity\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGender\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eConsanguinity\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAge at examination (yrs)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAge at onset (yrs)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eHepatic form\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eNeurological form\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eCeruloplasmin level (mg/dL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003eKF rings\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.3431delTinsAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.2648_2649del\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.3895C\u0026thinsp;\u0026gt;\u0026thinsp;T \u0026amp; c.4103T\u0026thinsp;\u0026gt;\u0026thinsp;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCompound heterozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e4.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.2807T\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e8.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.3188C\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.813C\u0026thinsp;\u0026gt;\u0026thinsp;A \u0026amp; c.2621C\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCompound Heterozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.3188C\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e4.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.3207C\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.2930C\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e13.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.813C\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e7.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.4103T\u0026thinsp;\u0026gt;\u0026thinsp;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e5.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.2866-2A\u0026thinsp;\u0026gt;\u0026thinsp;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.2807T\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e8.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.2807T\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e9.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.1924G\u0026thinsp;\u0026gt;\u0026thinsp;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.2866-2A\u0026thinsp;\u0026gt;\u0026thinsp;C \u0026amp; ?\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHeterozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e6.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e11.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.3188C\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e3.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.1156G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e31?\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.2930C\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e9.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec.2807T\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHomozygous\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWD23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e6.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c3\" namest=\"c1\"\u003e \u003cp\u003eAbbreviations: F, Female; M, Male\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTargeted Sequencing of the entire coding region of the \u003cem\u003eATP7B\u003c/em\u003e gene in 23 WD families found a total of 13 different causative variants in 20/23 families, with a detection rate of 84.7% (39/46) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). These variants included missense, nonsense, splicing, deletion, and deletion/insertion mutations. Among these, 10 variants including p.Cys271Ter, p.Gly386Arg, p.Val883AlafsTer3, p.Leu936Ter, c.2866-2A\u0026thinsp;\u0026gt;\u0026thinsp;C, p.Thr977Met, p.Ala1063Val, p.Phe1144Ter, p.Leu1299Phe, and p.Leu1368Pro were detected for the first time in the Iranian population. Two of the 13 variants were novel p.Phe1144Ter, and c.1156G\u0026thinsp;\u0026gt;\u0026thinsp;A p.Gly386Arg (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e1\u003c/span\u003e). However, eight out of 13 (61.5%) variants were missense mutations, indicating that they were the most commonly observed variants in this study. Deletion, deletion/insertion, and splicing mutations were each observed once, while two variants were nonsense mutations (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Of the 20 families with variants, one family had a single variant in a heterozygous state, and no pathogenic variant was found for the second allele.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCharacteristics of the detected variants in the ATP7B gene in WD patients during present study (NM_000053.4).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eExon (E)/ Intron (I)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMutation type\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDomain\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAllelic frequency in genomAD Exomes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAllelic frequency in this cohort\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eReported/ Novel\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eACMG criteria\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.813C\u0026thinsp;\u0026gt;\u0026thinsp;A p.Cys271Ter\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNonsense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMBD3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.0000376\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6.52% (3/46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003ePathogenic/ PM3, PVS1, PM2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.1156G\u0026thinsp;\u0026gt;\u0026thinsp;A p.Gly386Arg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMBD4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.00000137\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.34% (2/46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNovel\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eLikely Pathogenic/ PM2, PP3, PP2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.1924G\u0026thinsp;\u0026gt;\u0026thinsp;C p.Asp642His\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ebet MBD6/TM1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.000012\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.34% (2/46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eLikely Pathogenic/ PM2, PP2, PM5, PP3, PP5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.2621C\u0026thinsp;\u0026gt;\u0026thinsp;T p.Ala874Val\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTM5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.0000588\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.17% (1/46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003ePathogenic/ PM3, PP1, PS3, PM1, PP2, PM2, PM5, PP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.2648_2649del p.Val883AlafsTer3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDeletion\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTM5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.34% (2/46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eLikely Pathogenic/ PVS1, PM2, PM3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.2807T\u0026thinsp;\u0026gt;\u0026thinsp;A p.Leu936Ter\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNonsense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTM5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.00000205\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e17.39% (8/46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003ePathogenic/ PM3, PVS1, PM2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.2866-2A\u0026thinsp;\u0026gt;\u0026thinsp;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eI12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSplicing\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTM6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.00000954\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6.52% (3/46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003ePathogenic/ PM3, PVS1, PM2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.2930C\u0026thinsp;\u0026gt;\u0026thinsp;T p.Thr977Met\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTM6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.000182\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e8.69% (4/46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003ePathogenic/ PM3, PP1, PS3, PM1, PP2, PM2, PP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.3188C\u0026thinsp;\u0026gt;\u0026thinsp;T p.Ala1063Val\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eP-domain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.0000041\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e13.04% (6/46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003ePathogenic/ PM3, PM1, PP2, PP2, PM2, PP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.3207C\u0026thinsp;\u0026gt;\u0026thinsp;A p.His1069Gln\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eP-domain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.000945\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.34% (2/46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003ePathogenic/ PM3, PP1, PS3, PM1, PP2, PM2, PM5, PP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.3431delTinsAGA p.Phe1144Ter\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDeletion/Insertion\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eN-domain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.34% (2/46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNovel\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eLikely Pathogenic/ PVS1, PM2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.3895C\u0026thinsp;\u0026gt;\u0026thinsp;T p.Leu1299Phe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ebet N-domain/ TM7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.0000157\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.17% (1/46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003ePathogenic/ PM3, PM2, PM5, PP3, PP2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.4103T\u0026thinsp;\u0026gt;\u0026thinsp;C p.Leu1368Pro\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTM8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.0000081\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6.52% (3/46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eLikely Pathogenic/ PM1, PP2, PM2, PP3, PP5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003eAbbreviations: TM, Transmembrane; MBD, Metal Binding Domains; NA, Not Applicable\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe distribution of the 13 variants identified in our study of 23 WD patients can be observed in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e2\u003c/span\u003e. These variants were located within nine exons of the \u003cem\u003eATP7B\u003c/em\u003e gene, including exons 2, 6, 11, 12, 13, 14, 16, 18, and 20, as well as intron 12. The p.Leu936Ter in the exon 12 with an allelic frequency of 17.39 (8/46), was observed in 4 out of 23 probands and was considered the most common variant in the present study. The second most frequent variant, p.Ala1063Val in exon 14, was detected in 3 out of 23 patients, with an allelic frequency of 13.04% (6/46). In this research, the positioning of separate variants introduced exons 12, 13, and 14 as \u0026ldquo;hot spots\u0026rdquo; exons of the \u003cem\u003eATP7B\u003c/em\u003e gene in the Northeastern region of Iran. The total disease-causing variant detection rate on these three exons was 50% (23/46), suggesting their importance for molecular diagnosis of WD in this area.\u003c/p\u003e \u003cp\u003eThe compound-heterozygous form was found only in 2 out of the 23 (9%) patients, while the homozygous form was identified in 17 out of 23 (74%) patients, consistent with the pattern of consanguineous marriages in families. Our novel variant p.Phe1144Ter was absent in many public databases such as 1,000 Genomes, ExAC, gnomAD, GME Variome Project, ABraOM, HEX database, and in Iranome or more than 100 in-house exomes of the unrelated Iranians affected with non-metabolic and non-neurological disorders, (minor allele frequency (MAF)\u0026thinsp;=\u0026thinsp;0). The p.Phe1144Ter variant is a null variant that causes premature termination of translation and was predicted as \"likely pathogenic\" by default InterVar (ACMG). Alternatively, the absence of protein expression for the p.Phe1144Ter variant could be due to degradation of the mutant mRNA via the Nonsense-mediated mRNA decay (NMD) mechanism. At the protein level, the conservation analysis with the ConSurf database showed that phenylalanyl residue in the p.Phe1144Ter variant is located in an average region, and probably following that, a large number of highly conserved amino acids are removed from the protein structure (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). The p.Gly386Arg variant, another undescribed variant, is reported ultra-rarely in population databases, and we introduce it for the first time as a disease-causing variant. This variant is reported as deleterious by the majority of bioinformatic prediction tools (Supplementary Table\u0026nbsp;1). According to the ConSurf database, the p.Gly386Arg variant occurs in a conserved region (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Changes in the 3D structure of the mutated proteins compared to intact ATP7B are depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e3\u003c/span\u003eC. The following parameters were obtained for the predicted model: C-score (a confidence score for estimating the quality of the predicted models by I-TASSER) was \u0026minus;\u0026thinsp;2.55. The estimated TM-score was 0.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14, and The Estimated RMSD (Root-Mean-Square Deviation that measures the average distance between atoms of superimposed proteins) was 16.5\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0.\u003c/p\u003e \u003cp\u003eThe c.2866-2A\u0026thinsp;\u0026gt;\u0026thinsp;C variant detected in families WD12 and WD16 is located in the conserved acceptor splice site upstream of exon 13 and is considered pathogenic by the SpliceAl and varSEAK databases, which likely leads to exon skipping and the creation of a defective ATP7B protein. The results of \u003cem\u003ein silico\u003c/em\u003e analysis using bioinformatic tools such as Mutation Taster, Polyphen2-HDIV, SIFT, PROVEAN, FATHMM, DANN, BayesDel, EIGEN, MetaLR, and LRT are shown in Supplementary Table\u0026nbsp;1. In addition to these variants, twelve single nucleotide polymorphisms (SNPs) that do not disrupt \u003cem\u003eATP7B\u003c/em\u003e gene function were identified (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCharacteristics of the detected single nucleotide polymorphisms in the ATP7B gene during present study (NM_000053.4).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e#\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eExon (E)/ Intron (I)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003etype\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDomain\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReported/ Novel\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.51\u0026thinsp;+\u0026thinsp;108G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eI1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIntronic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.1216T\u0026thinsp;\u0026gt;\u0026thinsp;G p.Ser406Ala\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMBD4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.1366G\u0026thinsp;\u0026gt;\u0026thinsp;C p.Val456Leu\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ebet MB4/ MBD5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.2322T\u0026thinsp;\u0026gt;\u0026thinsp;C p.Ile774=\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSilent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTM4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.2495A\u0026thinsp;\u0026gt;\u0026thinsp;G p.Lys832Arg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ebet TM4/ TM5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.2855G\u0026thinsp;\u0026gt;\u0026thinsp;A p.Arg952Lys\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTM5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.2866-13G\u0026thinsp;\u0026gt;\u0026thinsp;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eI12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIntronic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.2866-90G\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eI12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIntronic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.2973G\u0026thinsp;\u0026gt;\u0026thinsp;A p.Thr991=\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSilent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTM6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.2976C\u0026thinsp;\u0026gt;\u0026thinsp;A p.Pro992=\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSilent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTM6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.3009G\u0026thinsp;\u0026gt;\u0026thinsp;A p.Ala1003=\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSilent\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTM6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.3419T\u0026thinsp;\u0026gt;\u0026thinsp;C p.Val1140Ala\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMissense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eN-domain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReported\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c4\" namest=\"c1\"\u003e \u003cp\u003eAbbreviations: TM, Transmembrane; MBD, Metal Binding Domains\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eThe advent of DNA sequencing and targeted gene sequencing of the \u003cem\u003eATP7B\u003c/em\u003e gene made a breakthrough in the molecular diagnosis of WD, which exhibits significant allelic heterogeneity. In certain populations, the prevalence of specific mutations enables basic screening and rapid disease diagnosis. Consequently, numerous population-specific studies on WD are underway worldwide. In our study of WD patients, 74% (34/46) of causative alleles were identified through direct sequencing of five PCR amplicons, covering exons 2B, 11\u0026ndash;12, 13, 14, and 20. This proves to be significantly cost-effective compared to sequencing all 19 PCR amplicons encompassing the entire 21 exons of the \u003cem\u003eATP7B\u003c/em\u003e gene coding region. Therefore, we recommend prioritizing screening of these exons in the Iranian population in the Northeast region.\u003c/p\u003e \u003cp\u003eOur findings are consistent with previous studies in Middle Eastern countries, confirming a wide range of pathogenic variants in the \u003cem\u003eATP7B\u003c/em\u003e gene, most of which are rare and of low frequency (Simsek Papur, Akman et al. 2013, Barada, El Haddad et al. 2017). The absence of the p.Arg778Leu mutation, the most common mutation in the Asian pedigree, in our cohort is noteworthy. Similarly, we did not detect any mutations in exon 8, which is one of the most frequent mutational sites in the \u003cem\u003eATP7B\u003c/em\u003e gene and was the first exon we examined. Additionally, The p.His1069Gln, the most common mutation in Europe affecting 15_70% European WD population (Chang and Hahn \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), was only found in 4.34% (2/46) of our cohort, While the other mutation located in exon 14, p.Ala1063Val, which has lower frequency in Europe, was found in 13.04% (6/46) of our cohort. The frequency of p.Leu936Ter in our study was 17.39%, which is also common in the United Kingdom (10%), and Greece (7%) population (Butler, McIntyre et al. 2001, Panagiotakaki, Tzetis et al. 2004). Additionally, the p.Leu936Ter mutation was reported in India (1\u0026ndash;2%) and Turkey (2%) (Simsek Papur, Akman et al. 2013, Kumari, Kumar et al. 2018). Indeed, it appears that this mutation is relatively common in European and Mediterranean populations. On the other hand, the p.Ala1063Val mutation has been reported as rare in most populations, such as China (0.73%), Czech Republic and Slovakia (0.25%), France (0.5%), and Italian/Turkish (0.4%) (Loudianos, Dessi et al. 1999, Vrabelova, Letocha et al. 2005, Bost, Piguet-Lacroix et al. 2012, Cheng, Wang et al. 2017), however, the frequency of this mutation (13.04%) was notably high in our population.\u003c/p\u003e \u003cp\u003eIn the present study, we report a high detection rate (84.7%) of \u003cem\u003eATP7B\u003c/em\u003e causative variants in our cohort. The direct sequencing detection rate in patients with WD that has been clinically proven has varied widely in previous studies. For example, Alison J. Coffey \u003cem\u003eet al\u003c/em\u003e. showed that the rate of mutation discovery in their study was 98% (356/362) of alleles on direct sequencing of all exons of the \u003cem\u003eATP7B\u003c/em\u003e gene in the 181 unrelated WD patients from the United Kingdom (Coffey, Durkie et al. 2013). Mingming Li conducted a mutational investigation of 101 WD patients from China and found that the mutation detection rate was up to 80.7% (163/202) (Li, Ma et al. 2021). A similar study conducted in China by Gu YH on 40 patients recorded an 83.8% (67/80) mutation detection rate (Gu, Kodama et al. 2003). In Iran, two separate studies on 70 and 30 WD patients, found a mutational detection rate of 30% (42/140) and 76% (46/60), respectively (Zali, Mohebbi et al. 2011, Maleki, Zali et al. 2013). However, The detection rate of direct genetic analyses of \u003cem\u003eATP7B\u003c/em\u003e can vary depending on the accuracy of clinical diagnosis. In this study, out of the 13 variants we identified, 6 (46.1%) were recurrent, suggesting the possibility of founder mutations. Due to the high rate of same-caste marriages in Iran, the founder mutations can be as influential as consanguineous marriages in the occurrence of recessive disorders. In families WD12 and WD16, we identified an intronic variant c.2866-13G\u0026thinsp;\u0026gt;\u0026thinsp;C in association with causative c.2866-2A\u0026thinsp;\u0026gt;\u0026thinsp;C pathogenic variant, indicating a potential founder haplotype in these patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Previously, Mohammed al-tobi \u003cem\u003eet al\u003c/em\u003e., found that the c.2866-2A\u0026thinsp;\u0026gt;\u0026thinsp;G mutation leads to the skipping of exon 13 (195 bp) from the mRNA transcript, likely rendering the protein non-functional (Al-Tobi, Kashoob et al. 2011). The c.2866-2A\u0026thinsp;\u0026gt;\u0026thinsp;C will probably have the same effect. Functional studies for this variant are required to authenticate our conjecture. In WD3 and WD11 probands, the c.2322T\u0026thinsp;\u0026gt;\u0026thinsp;C (p.Ile774=) polymorphism was detected in heterozygous and homozygous states, respectively, and is linked with the c.4103T\u0026thinsp;\u0026gt;\u0026thinsp;C (p.Leu1368Pro) causative variant in these patients. It is possible that the coexistence of c.2322T\u0026thinsp;\u0026gt;\u0026thinsp;C (p.Ile774=) polymorphism and c.4103T\u0026thinsp;\u0026gt;\u0026thinsp;C (p.Leu1368Pro) variant could have a particular effect on the ATP7B function. Further investigations are needed to confirm this claim. Additionally, the detection of the c.3009G\u0026thinsp;\u0026gt;\u0026thinsp;A (p.Ala1003=) polymorphism in all 4 patients with c.2807T\u0026thinsp;\u0026gt;\u0026thinsp;A (p.Leu936Ter) mutation was notable. This suggests that their linkage may affect the expression of the ATP7B protein.\u003c/p\u003e \u003cp\u003eIn various studies, cases with no mutations in the coding sequence of \u003cem\u003eATP7B\u003c/em\u003e are always reported, with variable frequency among different populations. In our study, in 3 out of 23 Iranian patients with WD, We could not find any pathogenic variant in the exons of the \u003cem\u003eATP7B\u003c/em\u003e gene. In these cases, Failure to detect any variant can be explained by several reasons, including the occurrence of unknown mutations located outside the coding sequence and flanking regions, such as gene regulatory elements or deep intronic sequences (Woimant, Poujois et al. 2020, Collins, Yi et al. 2021). Having one of Wilson's mimicry disorders can also be considered a rare cause (Roberts \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). However, further studies using high-throughput techniques such as Whole Exome Sequencing (WES) or Whole Genome Sequencing (WGS) are needed for molecular diagnosis of WD patients with no specific mutations in coding sequences of the \u003cem\u003eATP7B\u003c/em\u003e gene.\u003c/p\u003e \u003cp\u003eIn conclusion, The spectrum of \u003cem\u003eATP7B\u003c/em\u003e gene variants in the Northeastern region of Iran is very diverse. Therefore, large-scale studies can provide more insights into the genetic status of the disease in the region. Most of the variants found in this study were previously unreported in Iran. Furthermore, we identified two novel undescribed variants in the Northeastern Iranian WD patients that could expand the previously defined spectrum of \u003cem\u003eATP7B\u003c/em\u003e gene mutations.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cem\u003e\u0026nbsp;We acknowledge the Mashhad of the University of Medical Sciences for funding the research (Grant No.4010194) based on the PhD thesis of Seyyed-Saleh Hashemi and thank the patients and their family members for participating in the study\u003c/em\u003e\u003cem\u003e\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eThe authors have nothing to disclose.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cem\u003eSeyyed-Saleh Hashemi: DNA extraction, primer design, analysis of sanger sequencing data, mutation screening of candidate variants, writing and editing of the manuscript; Seyed Ali Jafari: Clinical evaluations; Aida Gholoobi: Principal investigator, review and editing; Tayebeh Hamzehloei: Conceptualization, supervision, methodology, validation, review and editing. All authors read and approved the final version of the manuscript.\u003c/em\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eJ Hepatol (2012). \u0026quot;EASL Clinical Practice Guidelines: Wilson\u0026apos;s disease.\u0026quot; \u003cstrong\u003e56\u003c/strong\u003e(3): 671-685.\u003c/li\u003e\n \u003cli\u003eAl-Tobi, M., et al. (2011). \u0026quot;A novel splice-site allelic variant is responsible for Wilson Disease in an Omani family.\u0026quot; \u003cu\u003eSultan Qaboos University Medical Journal\u003c/u\u003e \u003cstrong\u003e11\u003c/strong\u003e(3): 357.\u003c/li\u003e\n \u003cli\u003eAla, A., et al. (2007). \u0026quot;Wilson\u0026apos;s disease.\u0026quot; \u003cu\u003eThe Lancet\u003c/u\u003e \u003cstrong\u003e369\u003c/strong\u003e(9559): 397-408.\u003c/li\u003e\n \u003cli\u003eBarada, K., et al. (2017). \u0026quot;Wilson\u0026apos;s disease in Lebanon and regional countries: Homozygosity and hepatic phenotype predominance.\u0026quot; \u003cu\u003eWorld J Gastroenterol\u003c/u\u003e \u003cstrong\u003e23\u003c/strong\u003e(36): 6715-6725.\u003c/li\u003e\n \u003cli\u003eBitter, R. M., et al. (2022). \u0026quot;Structure of the Wilson disease copper transporter ATP7B.\u0026quot; \u003cu\u003eSci Adv\u003c/u\u003e \u003cstrong\u003e8\u003c/strong\u003e(9): eabl5508.\u003c/li\u003e\n \u003cli\u003eBost, M., et al. (2012). \u0026quot;Molecular analysis of Wilson patients: direct sequencing and MLPA analysis in the ATP7B gene and Atox1 and COMMD1 gene analysis.\u0026quot; \u003cu\u003eJournal of trace elements in Medicine and Biology\u003c/u\u003e \u003cstrong\u003e26\u003c/strong\u003e(2-3): 97-101.\u003c/li\u003e\n \u003cli\u003eBrewer, G. (1992). \u0026quot;Yuzbasiyan-Gurkan V.\u0026quot; \u003cu\u003eWilson disease. Medicine (Baltimore)\u003c/u\u003e \u003cstrong\u003e71\u003c/strong\u003e(3): 139-164.\u003c/li\u003e\n \u003cli\u003eButler, P., et al. (2001). \u0026quot;Molecular diagnosis of Wilson disease.\u0026quot; \u003cu\u003eMolecular genetics and metabolism\u003c/u\u003e \u003cstrong\u003e72\u003c/strong\u003e(3): 223-230.\u003c/li\u003e\n \u003cli\u003eChang, I. J. and S. H. Hahn (2017). \u0026quot;The genetics of Wilson disease.\u0026quot; \u003cu\u003eHandb Clin Neurol\u003c/u\u003e \u003cstrong\u003e142\u003c/strong\u003e: 19-34.\u003c/li\u003e\n \u003cli\u003eCheng, N., et al. (2017). \u0026quot;Spectrum of ATP7B mutations and genotype\u0026ndash;phenotype correlation in large‐scale Chinese patients with Wilson Disease.\u0026quot; \u003cu\u003eClinical Genetics\u003c/u\u003e \u003cstrong\u003e92\u003c/strong\u003e(1): 69-79.\u003c/li\u003e\n \u003cli\u003eCoffey, A. J., et al. (2013). \u0026quot;A genetic study of Wilson\u0026rsquo;s disease in the United Kingdom.\u0026quot; \u003cu\u003eBrain\u003c/u\u003e \u003cstrong\u003e136\u003c/strong\u003e(5): 1476-1487.\u003c/li\u003e\n \u003cli\u003eCollins, C. J., et al. (2021). \u0026quot;Direct measurement of ATP7B peptides is highly effective in the diagnosis of Wilson disease.\u0026quot; \u003cu\u003eGastroenterology\u003c/u\u003e \u003cstrong\u003e160\u003c/strong\u003e(7): 2367-2382. e2361.\u003c/li\u003e\n \u003cli\u003eFerenci, P. (2006). \u0026quot;Regional distribution of mutations of the ATP7B gene in patients with Wilson disease: impact on genetic testing.\u0026quot; \u003cu\u003eHum Genet\u003c/u\u003e \u003cstrong\u003e120\u003c/strong\u003e(2): 151-159.\u003c/li\u003e\n \u003cli\u003eFerenci, P., et al. (2003). \u0026quot;Diagnosis and phenotypic classification of Wilson disease 1.\u0026quot; \u003cu\u003eLiver International\u003c/u\u003e \u003cstrong\u003e23\u003c/strong\u003e(3): 139-142.\u003c/li\u003e\n \u003cli\u003eGomes, A. and G. V. Dedoussis (2016). \u0026quot;Geographic distribution of ATP7B mutations in Wilson disease.\u0026quot; \u003cu\u003eAnn Hum Biol\u003c/u\u003e \u003cstrong\u003e43\u003c/strong\u003e(1): 1-8.\u003c/li\u003e\n \u003cli\u003eGu, Y. H., et al. (2003). \u0026quot;Mutation spectrum and polymorphisms in ATP7B identified on direct sequencing of all exons in Chinese Han and Hui ethnic patients with Wilson\u0026apos;s disease.\u0026quot; \u003cu\u003eClinical Genetics\u003c/u\u003e \u003cstrong\u003e64\u003c/strong\u003e(6): 479-484.\u003c/li\u003e\n \u003cli\u003eKasztelan-Szczerbinska, B. and H. Cichoz-Lach (2021). \u0026quot;Wilson\u0026apos;s Disease: An Update on the Diagnostic Workup and Management.\u0026quot; \u003cu\u003eJ Clin Med\u003c/u\u003e \u003cstrong\u003e10\u003c/strong\u003e(21).\u003c/li\u003e\n \u003cli\u003eKumari, N., et al. (2018). \u0026quot;Characterization of mutation spectrum and identification of novel mutations in ATP7B gene from a cohort of Wilson disease patients: Functional and therapeutic implications.\u0026quot; \u003cu\u003eHuman Mutation\u003c/u\u003e \u003cstrong\u003e39\u003c/strong\u003e(12): 1926-1941.\u003c/li\u003e\n \u003cli\u003eLi, M., et al. (2021). \u0026quot;Mutation analysis of the ATP7B gene and genotype\u0026ndash;phenotype correlation in Chinese patients with Wilson disease.\u0026quot; \u003cu\u003eBMC gastroenterology\u003c/u\u003e \u003cstrong\u003e21\u003c/strong\u003e: 1-21.\u003c/li\u003e\n \u003cli\u003eLorincz, M. T. (2010). \u0026quot;Neurologic Wilson\u0026apos;s disease.\u0026quot; \u003cu\u003eAnnals of the New York Academy of Sciences\u003c/u\u003e \u003cstrong\u003e1184\u003c/strong\u003e(1): 173-187.\u003c/li\u003e\n \u003cli\u003eLoudianos, G., et al. (1999). \u0026quot;Mutation analysis in patients of Mediterranean descent with Wilson disease: identification of 19 novel mutations.\u0026quot; \u003cu\u003eJournal of medical genetics\u003c/u\u003e \u003cstrong\u003e36\u003c/strong\u003e(11): 833-836.\u003c/li\u003e\n \u003cli\u003eMak, C. M. and C. W. Lam (2008). \u0026quot;Diagnosis of Wilson\u0026apos;s disease: a comprehensive review.\u0026quot; \u003cu\u003eCrit Rev Clin Lab Sci\u003c/u\u003e \u003cstrong\u003e45\u003c/strong\u003e(3): 263-290.\u003c/li\u003e\n \u003cli\u003eMaleki, I., et al. (2013). \u0026quot;NOVEL MUTATIONS OF ATP7B GENE IN IRANIAN PATIENTS WITH WILSON\u0026apos;S DISEASE.\u0026quot;\u003c/li\u003e\n \u003cli\u003ePanagiotakaki, E., et al. (2004). \u0026quot;Genotype\u0026ndash;phenotype correlations for a wide spectrum of mutations in the Wilson disease gene (ATP7B).\u0026quot; \u003cu\u003eAmerican Journal of Medical Genetics Part A\u003c/u\u003e \u003cstrong\u003e131\u003c/strong\u003e(2): 168-173.\u003c/li\u003e\n \u003cli\u003eRichards, S., et al. (2015). \u0026quot;Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology.\u0026quot; \u003cu\u003eGenet Med\u003c/u\u003e \u003cstrong\u003e17\u003c/strong\u003e(5): 405-424.\u003c/li\u003e\n \u003cli\u003eRoberts, E. A. (2018). \u0026quot;Update on the diagnosis and management of Wilson disease.\u0026quot; \u003cu\u003eCurrent gastroenterology reports\u003c/u\u003e \u003cstrong\u003e20\u003c/strong\u003e: 1-12.\u003c/li\u003e\n \u003cli\u003eRoberts, E. A. and M. L. Schilsky (2008). \u0026quot;Diagnosis and treatment of Wilson disease: an update.\u0026quot; \u003cu\u003eHepatology\u003c/u\u003e \u003cstrong\u003e47\u003c/strong\u003e(6): 2089-2111.\u003c/li\u003e\n \u003cli\u003eSimsek Papur, O., et al. (2013). \u0026quot;Mutation analysis of ATP7B gene in Turkish Wilson disease patients: identification of five novel mutations.\u0026quot; \u003cu\u003eEur J Med Genet\u003c/u\u003e \u003cstrong\u003e56\u003c/strong\u003e(4): 175-179.\u003c/li\u003e\n \u003cli\u003eVrabelova, S., et al. (2005). \u0026quot;Mutation analysis of the ATP7B gene and genotype/phenotype correlation in 227 patients with Wilson disease.\u0026quot; \u003cu\u003eMolecular genetics and metabolism\u003c/u\u003e \u003cstrong\u003e86\u003c/strong\u003e(1-2): 277-285.\u003c/li\u003e\n \u003cli\u003eWoimant, F., et al. (2020). \u0026quot;A novel deep intronic variant in ATP7B in five unrelated families affected by Wilson disease.\u0026quot; \u003cu\u003eMolecular Genetics \u0026amp; Genomic Medicine\u003c/u\u003e \u003cstrong\u003e8\u003c/strong\u003e(10): e1428.\u003c/li\u003e\n \u003cli\u003eZali, N., et al. (2011). \u0026quot;Prevalence of ATP7B Gene Mutations in Iranian Patients With Wilson.\u0026quot;\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Wilson’s Disease, ATP7B, Molecular diagnosis, Targeted Sequencing, Mutation","lastPublishedDoi":"10.21203/rs.3.rs-4957273/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4957273/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground/Objective:\u003c/h2\u003e \u003cp\u003eWilson's disease (WD) is an autosomal recessive condition caused by mutations in the \u003cem\u003eATP7B\u003c/em\u003e gene, leading to the copper accumulation in various organs. Data on the \u003cem\u003eATP7B\u003c/em\u003e mutation spectrum in Iran and the Middle East is insufficient. This study aims to screen the \u003cem\u003eATP7B\u003c/em\u003e gene in unrelated Iranian families (n\u0026thinsp;=\u0026thinsp;23) from northeastern Iran.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eDNA was extracted from peripheral blood, and variant screening was performed using direct sequencing of the entire \u003cem\u003eATP7B\u003c/em\u003e gene coding region. The full 3D structure of the defective proteins was determined using the I-TASSER software.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe overall frequency of causative variant detection was 84.7% (39/46). Among the 23 patients with WD, we identified 13 different causative variants: eight missense, two nonsense, one splicing, one deletion, and one deletion/insertion changes. Two of which were novel: c.3431delTinsAGA (p.Phe1144Ter) and c.1156G\u0026thinsp;\u0026gt;\u0026thinsp;A (p.Gly386Arg). The c.2807T\u0026thinsp;\u0026gt;\u0026thinsp;A (p.Leu936Ter) variant at exon 12 was the most prevalent in our study, with an allelic frequency of 17.39%, followed by c.3188C\u0026thinsp;\u0026gt;\u0026thinsp;T (p.Ala1063Val) at exon 14, exhibiting an allelic frequency of 13.04%. Exons 12, 13, and 14 were identified as mutation hot spots, with detection rate of 50% (23/46). Ten out of the 13 variants identified in our study were reported for the first time in Iran (this report).\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eWe reported two novel variants that broaden the known spectrum of mutations associated with the \u003cem\u003eATP7B\u003c/em\u003e gene. The variants identified in this study can facilitate carrier screening and presymptomatic detection and can be used in prenatal genetic diagnosis in affected families.\u003c/p\u003e","manuscriptTitle":"Genetic Screening of ATP7B Gene in Iranian Wilson Disease Patients: A diverse landscape of pathogenic variants","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-16 07:56:10","doi":"10.21203/rs.3.rs-4957273/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"bba54f9c-b580-4d3d-a658-f10a43f42d13","owner":[],"postedDate":"October 16th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-10-20T00:53:12+00:00","versionOfRecord":[],"versionCreatedAt":"2024-10-16 07:56:10","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4957273","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4957273","identity":"rs-4957273","version":["v1"]},"buildId":"omnImTCwR2MFx8CMYfrG7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

⚙ Ask this paper AI returns verbatim quotes from the full text · source: preprint-html ⓘ

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00