Transplanting human infant gut microbiome species into Galleria mellonella | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report Transplanting human infant gut microbiome species into Galleria mellonella Harriet Gooch, Marjorie Labedan, Lindsay Hall, Anthony Maxwell This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3782451/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 29 Apr, 2024 Read the published version in BMC Research Notes → Version 1 posted 8 You are reading this latest preprint version Abstract Objective Study of the human infant gut microbiome requires the use of surrogate mammalian species such as mice. We sought to investigate the usefulness of the greater wax moth larva, Galleria mellonella , as an alternative. Results We have analysed the native gut microbiome of Galleria and developed methods for clearing the native microbiome and introducing species from human infant faecal samples. We find that some species, e.g. enterococci, are more successful at recolonisation, but that others, e.g. Bifidobacterium , are less so. The work paves the way for using Galleria rather than mice in this and similar work. Galleria microbiome Enterococcus Bifidobacterium Figures Figure 1 Figure 2 Figure 3 Introduction The greater wax moth, Galleria mellonella , is a member of the order Lepidoptera and is mostly known as a pest of beehives [ 1 ]. As G. mellonella can grow for several generations on artificial food [ 2 ], are easily inoculated with bacteria, can grow at 37°C, and have few ethical issues, it has gained in popularity as a model host, in particular to study microbial interactions such as pathogenesis [ 3 , 4 ]. Previously, most studies have used larvae supplied from pet food shops, which may have been grown with antibiotics and hormones, but recently there have been attempts to standardise G. mellonella as a model [ 5 , 6 ], including TruLarv™[ 7 ]. The bacterial population in the G. mellonella gut is low in both diversity and abundance. Most studies report the gut microbiome to be primarily composed of Enterococcus . The relationship G. mellonella has with its commensal enterococci may make it a useful model to study Enterococcus commensal bacteria from humans. Here we aimed to expand the use of G. mellonella beyond infection studies and assess its potential as a surrogate for studying the gut microbiome of human infants. Given the microbial community in human early life is relatively low diversity and is often dominated by beneficial genera such as Bifidobacterium [ 8 ], we sought to determine if G. mellonella could prove a useful model for understanding dynamics in these burgeoning ecosystems, which could also be used to test the utility of different probiotic formulations. Methods Insect rearing: Galleria mellonella larvae were obtained from a colony originally sourced from Livefood UK Ltd and maintained at the John Innes Centre Entomology Facility (Norwich, UK). Where specified, larvae were from BioSystems Technology (TruLarv™), and also from a local Norfolk beekeeper. Larval diet consisted of: 20 g brown sugar (Sainsbury’s dark soft brown sugar), 40 mL glycerol (Sigma), 20 g milk powder (Dried Skimmed Milk Powder, Marvel), 20 g wholemeal flour (Strong Stoneground 100% Wholemeal Flour, Sainsbury’s), 10 g yeast extract (Merck) 10 g wheat germ (Neal’s Yard Wholefoods Natural Wheatgerm), 40 g bran (Neal’s Yard Wholefoods Natural Wheat Bran). Unless specified, larvae were incubated at 30°C. Dissection and DNA isolation Larvae were transferred to empty 90 mm round Petri dishes for 2 h of starvation; dissection was carried out under sterile conditions [ 9 ]. Larvae were transferred individually to small centrifuge tubes and killed by flash-freezing in liquid nitrogen, then the head was removed and a cut was made down the ventral side. Gut contents were removed with forceps and placed in a sterile 2 mL tube, three guts to a tube. Both gut and whole larval samples were homogenised using an MP Biomedicals FastPrep-24™ homogeniser with 2 mL Lysing Matrix D tubes, for 40 seconds (speed 6.0). DNA was purified with the FastDNA® SPIN Kit for Soil according to instructions but with two extra homogenisation cycles followed by 15-min centrifugation. Characterisation of the native G. mellonella gut microbiome : Library preparation for 16S rRNA amplicon sequencing of whole Galleria guts was carried out according to Illumina [ 10 ]. V3-V4 amplicon sequencing was carried out by Novogene using the Novoseq 6000 PE150 platform. Taxa were assigned using Centrifuge (v0.15). Primers: 341F: CCTAYGGGRBGCASCAG; 806R: GGACTACNNGGGTATCTAAT. Clearing the native G. mellonella gut microbiome : Larvae were fed on food containing 15 mg streptomycin (Sigma) and 15 mg oxytetracycline (Sigma) per 100 g of food for 0, 1, 5 or 10 days. Larvae were dissected, guts removed, homogenised and plated. Full-length 16S rRNA amplification through PCR was carried out on gut homogenates and products run on 1% agarose gels and stained with ethidium bromide. In subsequent experiments, larvae were fed as above for 10 days, then incubated for two days without food. Primers: 8F: AGAGTTTGATCATGGCTCAG; 1492R: TACGGTTACCTTGTTACGACT Faecal slurry stock : Faecal collection from the Norfolk and Norwich University Hospital NNUH was approved by the Faculty of Medical and Health Sciences Ethics Committee at the University of East Anglia (UEA), and followed protocols laid out by the UEA Biorepository (License no: 11208) [ 11 ]. A faecal slurry stock was made using 30 unique 1 g samples from different infants. Under sterile, anaerobic conditions the samples were combined into a single 50 mL Falcon tube, and 20 mL of sterile PBS (Formedium) was added. The slurry was then vortexed until homogenous. 1 mL aliquots were flash-frozen in liquid nitrogen, and stored in cryo-vials at -80°C. Gut colonisation : A 1 g aliquot of human infant faecal slurry was mixed into 10 g of sterile food in each of 3 Petri dishes. 12 larvae were placed on food then incubated at 37°C. On day 0, guts were dissected from 9 antibiotic-treated larvae, followed by 9 larvae each from the control and faecal slurry groups on days 1, 2, 4 and 8. Guts were pooled, 3 per sample, and homogenised using glass beads in an Omni Bead Ruptor (Speed 4 for 2x 60 s, 30 s dwell time). Samples were diluted 1000x in PBS, spread on BHI plates and incubated for 24 h at 37°C. Mortality assessment : Mortality was assessed by stimulating larvae and monitoring for movement. Health was assessed using the health index [ 12 ]. Results Native gut microbiome of G. mellonella: Initially we investigated the native microbiome of our experimental colonies: in-house, TruLarv™ (a commercial source of research-grade larvae), and a wild colony. Each sample contained purified DNA from three pooled G. mellonella gut contents. 16S rRNA genus level taxonomic profiles (Fig. 1) for the larvae from our colony and the Trularv™ larvae were very similar and were dominated by Enterococcus. as usually reported [13]. During the course of this analysis a new bacterial species, E. innesii , was isolated and is reported elsewhere [9]. The composition of the gut microbiome of the wild larvae appeared very different; it was dominated by Cutibacterium and also contained Ralstonia and Staphylococcus . These bacteria are common members of the ‘kitome’ [14] and may have arisen due to contamination. Very few bacteria could be isolated from the wild larvae, so the bacterial abundance in the guts may have been very low. These larvae were melanised before sampling so may have had high immune activity, which may disrupt the gut microbiome. Clearing the G. mellonella gut of bacteria : We developed a protocol to clear the Galleria gut of its native bacteria by feeding with oxytetracycline and streptomycin. Guts were dissected out, homogenised, and DNA purified. Prior to DNA purification, the homogenate was plated at 1/100 dilution on BHI plates. No colonies grew from the 5- or 10-day gut samples. Fig. S1 shows PCR products of 16S rRNA amplification of the purified DNA. A band can be seen for the 1-day and 5-day samples but not the 10-day, showing that a 10-day antibiotic treatment is preferable. Limited colonisation of the Galleria gut can be achieved with faecal slurry: Larvae were placed on food containing faecal slurry and incubated for 1, 2, 4 and 8 days, alongside a control fed only sterile food. No colonies were apparent for larvae fed sterile food and many identical-looking colonies were observed for larvae fed faecal slurry. Using 16S PCR we identified these isolates as E. faecalis. Due to the poor resolution of 16S rRNA amplicon sequencing for differentiating at the species level, it is possible that this is a resurgence of the host Enterococcus, but we consider this unlikely due to the absence of cultures on the control plates. Faecal slurry colonisation persists over several days: Larvae fed faecal slurry have a higher proportion of Bifidobacterium than both the larvae sampled before the experiment and the larvae not fed faecal slurry (Fig. 2). The resulting bacterial composition over longer times can be seen in Fig. 3. The faecal-slurry-fed larvae had a higher abundance of Bifidobacterium , which is very abundant in the infant gut microbiome, and is similar to what was observed in the clinical study from where these samples were sourced [8]. However, both faecal-slurry-fed larvae and control larvae converge to similar profiles after 8 days. In most of the groups, the most dominant genus remains Enterococcus, perhaps reflecting its dominance in the native Galleria gut. Conclusions/Discussion We aimed to investigate the possibility of colonising G. mellonella larvae with bacteria from human infant gut. This required a number of steps. Investigation of the native gut microbiome of G. mellonella larvae showed that cultured larvae from two different sources contained similar bacterial species, but bacteria from larvae from a ‘wild’ source were potentially quite different, emphasising the importance of using well-characterised sources of larvae. Prior to the attempted colonisation with non-native species, it was necessary to clear the larvae of their resident gut microbiome. We have established a protocol for the treatment of G. mellonella to efficiently clear the microbiome using only oxytetracycline and streptomycin. Following this treatment, a break of 2–3 days days must be given to ensure the absence of antibiotic when attempting to colonise larvae. Overall it is unclear how successful colonisation of the G. mellonella gut with infant gut bacteria was. Bifidobacteria are the main taxon in the early infant gut [ 8 ] so the high proportion of Bifidobacterium seen in the larval gut following feeding with faecal slurry is promising. However, 16S rRNA amplification doesn’t discriminate between living and dead bacteria, so it is unclear whether they were viable. Furthermore, given the more aerobic environment in the larvae gut (i.e. higher oxygen levels), this may not represent an optimal niche for longer-term colonisation of anaerobic Bifidobacterium species and strains. The high proportion of Enterococcus in the faecal-slurry-fed larvae is unsurprising given it is dominant in the native G. mellonella microbiome [ 13 , 16 ]. Our recent work indicates that a newly identified novel G. mellonella -resident Enterococcus species ( E. innesii ), is also closely related to strains that have been isolated from human patients [ 9 ]. However, the composition of the faecal-slurry-fed microbiome is not stable; whether or not the infant gut bacteria are viable in the gut, they do not seem to be able to permanently colonise the gut. The composition eventually converges to a similar profile as the other antibiotic-treated larvae (Fig. 3), which may link to the differences in gut physiology between humans and insects. The peritrophic membrane prevents bacteria having proximity to the epithelial cells and therefore excludes the human commensals from the mucosal niches they would inhabit in a mammalian gut. The conditions in the lepidopteran gut also differ from the conditions in the mammalian gut in other ways, such as oxygen levels and pH, which is much more alkaline than any part of the human gut [ 17 ]. Although there is plenty of fibre in the diet, the lack of access to other sources of nutrition, such as mucus or human milk oligosaccharides from breast milk, may also be limiting growth of the infant-gut bacteria. Mortality of the larvae fed faecal slurry was low, however, they did not survive pupation, as with all larvae that were antibiotic-treated. This may be due to the absence of bacteria providing colonisation resistance [ 16 ]. Taken together our results demonstrate a viable protocol for introducing non-native (human infant) bacteria into G. mellonella larvae. Limitations We found that, although some species (e.g. enterococci) may, at least temporarily, thrive in the insect gut, others (e.g. bifidobacteria) may not. Further work is needed to fully explore the potential of using G. mellonella larvae as a substitute for mice in the investigation of the human infant gut microbiome. Abbreviations FS: Faecal slurry HMO: human milk oligosaccharide PCR: polymerase chain reaction UEA: University of East Anglia Declarations Ethical approvals and consent to participate: Human subjects were not directly involved in this study therefore no consent was required as no identifiable human subjects were used. Anonymised infant stool samples were collected from the Norfolk and Norwich University Hospital NNUH as approved by the Faculty of Medical and Health Sciences Ethics Committee at the University of East Anglia (UEA), and following protocols laid out by the UEA Biorepository (License no: 11208). Galleria mellonella larvae were used in accordance with Institute guidelines. We confirm that all methods were carried out in accordance with relevant guidelines and regulations and all experimental protocols were approved by the Quadram Institute and John Innes Centre. Consent for publication: Not applicable. Availability of data and materials: All data/materials can be obtained by contacting the senior author ( [email protected] ). Funding : We acknowledge funding from NC3Rs (NC/R001782/1) and a Biotechnology and Biosciences Research Council (UK) Institute Strategic Programme Grant (BB/P012523/1). Conflicts of interest: The authors have no conflicts of interest, either financial or non-financial. Acknowledgements We thank the parents from the original clinical study for consenting and providing samples from their infants, and the clinical team involved, particularly Prof Paul Clarke and Katherine McColl at Norfolk and Norwich University Hospital. We thank Tom Johnson and Peter Sutherland for providing wild G. mellonella larvae. Author Contributions AM and LJH conceived the study; HHCG and ML carried out the work; manuscript written by HHCG and AM with input from LJH. References Kwadha CA, Ong'amo GO, Ndegwa PN, Raina SK, Fombong AT. The Biology and Control of the Greater Wax Moth, Galleria mellonella. Insects. 2017;8(2). Ignasiak K, Maxwell A. Oxytetracycline reduces the diversity of tetracycline-resistance genes in the Galleria mellonella gut microbiome. Bmc Microbiol. 2018;18. Fallon J, Kelly J, Kavanagh K. Galleria mellonella as a model for fungal pathogenicity testing. Methods Mol Biol. 2012;845:469-85. Tsai CJ, Loh JM, Proft T. Galleria mellonella infection models for the study of bacterial diseases and for antimicrobial drug testing. Virulence. 2016;7(3):214-29. Jorjão AL, Oliveira LD, Scorzoni L, Figueiredo-Godoi LMA, Cristina A. Prata M, Jorge AOC, et al. From moths to caterpillars: Ideal conditions for Galleria mellonella rearing for in vivo microbiological studies. Virulence. 2018;9(1):383-9. Ellis JD, Graham JR, Mortensen A. Standard methods for wax moth research. J Apicult Res. 2013;52(1). Champion O, Titball R, Bates S. Standardization of G. mellonella larvae to provide reliable and reproducible results in the study of fungal pathogens. Journal of Fungi. 2018;4(3):108. Stewart CJ, Ajami NJ, O'Brien JL, Hutchinson DS, Smith DP, Wong MC, et al. Temporal development of the gut microbiome in early childhood from the TEDDY study. Nature. 2018;562(7728):583-8. Gooch HCC, Kiu R, Rudder S, Baker DJ, Hall LJ, Maxwell A. Enterococcus innesii sp. nov., isolated from the wax moth Galleria mellonella. International journal of systematic and evolutionary microbiology. 2021;71(12). Illumina. 16s metagenomic sequencing library preparation. Illumina: San Diego, CA, USA. 2013. Alcon-Giner C, Dalby MJ, Caim S, Ketskemety J, Shaw A, Sim K, et al. Microbiota Supplementation with Bifidobacterium and Lactobacillus Modifies the Preterm Infant Gut Microbiota and Metabolome: An Observational Study. Cell Rep Med. 2020;1(5):100077. Champion OL, Titball RW, Bates S. Standardization of G. mellonella Larvae to Provide Reliable and Reproducible Results in the Study of Fungal Pathogens. J Fungi (Basel). 2018;4(3). Allonsius CN, Van Beeck W, De Boeck I, Wittouck S, Lebeer S. The microbiome of the invertebrate model host Galleria mellonella is dominated by Enterococcus. Anim Microbiome. 2019;1(1):7. Paniagua Voirol LR, Valsamakis G, Yu M, Johnston PR, Hilker M. How the 'kitome' influences the characterization of bacterial communities in lepidopteran samples with low bacterial biomass. J Appl Microbiol. 2021;130(6):1780-93. Kim D, Song L, Breitwieser FP, Salzberg SL. Centrifuge: rapid and sensitive classification of metagenomic sequences. Genome Res. 2016;26(12):1721-9. Johnston PR, Rolff J. Host and Symbiont Jointly Control Gut Microbiota during Complete Metamorphosis. PLoS Pathog. 2015;11(11):e1005246. Harrison JF. Insect acid-base physiology. Annu Rev Entomol. 2001;46:221-50. Additional Declarations No competing interests reported. Supplementary Files Goochetal.2023Supplfinal.docx Cite Share Download PDF Status: Published Journal Publication published 29 Apr, 2024 Read the published version in BMC Research Notes → Version 1 posted Editorial decision: Revision requested 23 Jan, 2024 Reviews received at journal 21 Jan, 2024 Reviewers agreed at journal 13 Jan, 2024 Reviewers invited by journal 05 Jan, 2024 Editor invited by journal 04 Jan, 2024 Submission checks completed at journal 03 Jan, 2024 Editor assigned by journal 03 Jan, 2024 First submitted to journal 20 Dec, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3782451","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Short Report","associatedPublications":[],"authors":[{"id":265182565,"identity":"a570e744-c170-4781-9dc4-6ed1525e3e33","order_by":0,"name":"Harriet Gooch","email":"","orcid":"","institution":"John Innes Centre","correspondingAuthor":false,"prefix":"","firstName":"Harriet","middleName":"","lastName":"Gooch","suffix":""},{"id":265182566,"identity":"01407df0-9831-4841-9588-74d4276e49ea","order_by":1,"name":"Marjorie Labedan","email":"","orcid":"","institution":"John Innes Centre","correspondingAuthor":false,"prefix":"","firstName":"Marjorie","middleName":"","lastName":"Labedan","suffix":""},{"id":265182567,"identity":"432bbe68-ced3-424a-a6b0-7ef8387177f9","order_by":2,"name":"Lindsay Hall","email":"","orcid":"","institution":"Quadram Institute","correspondingAuthor":false,"prefix":"","firstName":"Lindsay","middleName":"","lastName":"Hall","suffix":""},{"id":265182568,"identity":"50d31da8-d9fa-4dec-9cf5-cb08afe77d3c","order_by":3,"name":"Anthony Maxwell","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6klEQVRIiWNgGAWjYHAD5sYDH3gkoJwDuNXxIJiMDQdnkKzlMIKHR4s9e+8xCcYcu8QNxxsbDtvIWMgzsB9+wMxzBo8tPOfSJBi3JRsbnDnYcDiHR8KwgSfNgJnnBh4tEjlmQC3McmY3EsFaEhgYchiYeT4Q1FLPY3b/YcNhC5AW/jdEaTkMtAXofQaQFgmQLfgcduaMsUXituPG9mcSGw72AP3SJvHM4OAcPN5nb+8xvPFxW3XizPbDBx/87KmT5+dPfvjgzTHcWoCABeRlCGDsYWBgY8AbK2DAjOTVHwTUjoJRMApGwYgEAPs1TLSrSOoIAAAAAElFTkSuQmCC","orcid":"","institution":"John Innes Centre","correspondingAuthor":true,"prefix":"","firstName":"Anthony","middleName":"","lastName":"Maxwell","suffix":""}],"badges":[],"createdAt":"2023-12-20 15:14:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3782451/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3782451/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13104-024-06785-w","type":"published","date":"2024-04-30T01:15:12+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":49241812,"identity":"0ed9ae56-0ec0-4d7c-8346-c7cefd6911f7","added_by":"auto","created_at":"2024-01-05 18:27:26","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":55856,"visible":true,"origin":"","legend":"\u003cp\u003eComposition of the gut microbial communities of \u003cem\u003eG. mellonella\u003c/em\u003e larvae from different sources, by 16S amplicon sequencing. Larvae were flash-frozen, guts dissected and pooled 3 to a sample; DNA was purified and sequenced using 16S rRNA amplicon sequencing (V3-V4). Reads were classified using Centrifuge v0.15 [15]. Abundances \u0026lt;0.5% not shown.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3782451/v1/a0d60f2a0bfd620b0f555ce2.jpg"},{"id":49241810,"identity":"0f12d546-bee6-4b98-9f6d-6235725097b9","added_by":"auto","created_at":"2024-01-05 18:27:26","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":57786,"visible":true,"origin":"","legend":"\u003cp\u003eGut composition by genus following faecal slurry feeding. Antibiotic-treated larvae were fed faecal slurry (FS) for 2 days before they were flash frozen and homogenised. DNA was purified and subjected to 16S rRNA amplicon sequencing (V3-V4). Taxa were assigned using Centrifuge (v0.15).\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3782451/v1/f90de47d9c4e7785e2ef8da8.jpg"},{"id":49241811,"identity":"5eb2308a-ded5-4be6-9cd9-24391dac1e7c","added_by":"auto","created_at":"2024-01-05 18:27:26","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":88898,"visible":true,"origin":"","legend":"\u003cp\u003eGut composition by genus following faecal slurry feeding. Antibiotic-treated larvae were fed faecal slurry (FS) or sterile food (C) for up to 8 days, frozen and analysed as in Fig. 2.\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3782451/v1/bf9df3fd7b9e63e00f74c22e.jpg"},{"id":55698469,"identity":"16170af3-56b3-40e7-a052-ce7af40a6ca2","added_by":"auto","created_at":"2024-05-02 02:35:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":409777,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3782451/v1/e3d99019-5316-44f1-922b-9e995f42c884.pdf"},{"id":49241814,"identity":"0305d3d2-00d9-4d63-bc79-a9eb9f9456de","added_by":"auto","created_at":"2024-01-05 18:27:27","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":7916558,"visible":true,"origin":"","legend":"","description":"","filename":"Goochetal.2023Supplfinal.docx","url":"https://assets-eu.researchsquare.com/files/rs-3782451/v1/b2c052b9a776fcc1792ef732.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Transplanting human infant gut microbiome species into Galleria mellonella","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe greater wax moth, \u003cem\u003eGalleria mellonella\u003c/em\u003e, is a member of the order Lepidoptera and is mostly known as a pest of beehives [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. As \u003cem\u003eG. mellonella\u003c/em\u003e can grow for several generations on artificial food [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], are easily inoculated with bacteria, can grow at 37\u0026deg;C, and have few ethical issues, it has gained in popularity as a model host, in particular to study microbial interactions such as pathogenesis [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Previously, most studies have used larvae supplied from pet food shops, which may have been grown with antibiotics and hormones, but recently there have been attempts to standardise \u003cem\u003eG. mellonella\u003c/em\u003e as a model [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], including TruLarv\u0026trade;[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe bacterial population in the \u003cem\u003eG. mellonella\u003c/em\u003e gut is low in both diversity and abundance. Most studies report the gut microbiome to be primarily composed of \u003cem\u003eEnterococcus\u003c/em\u003e. The relationship \u003cem\u003eG. mellonella\u003c/em\u003e has with its commensal enterococci may make it a useful model to study \u003cem\u003eEnterococcus\u003c/em\u003e commensal bacteria from humans.\u003c/p\u003e \u003cp\u003eHere we aimed to expand the use of \u003cem\u003eG. mellonella\u003c/em\u003e beyond infection studies and assess its potential as a surrogate for studying the gut microbiome of human infants. Given the microbial community in human early life is relatively low diversity and is often dominated by beneficial genera such as \u003cem\u003eBifidobacterium\u003c/em\u003e [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], we sought to determine if \u003cem\u003eG. mellonella\u003c/em\u003e could prove a useful model for understanding dynamics in these burgeoning ecosystems, which could also be used to test the utility of different probiotic formulations.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e \u003cem\u003eInsect rearing: Galleria mellonella\u003c/em\u003e larvae were obtained from a colony originally sourced from Livefood UK Ltd and maintained at the John Innes Centre Entomology Facility (Norwich, UK). Where specified, larvae were from BioSystems Technology (TruLarv\u0026trade;), and also from a local Norfolk beekeeper. Larval diet consisted of: 20 g brown sugar (Sainsbury\u0026rsquo;s dark soft brown sugar), 40 mL glycerol (Sigma), 20 g milk powder (Dried Skimmed Milk Powder, Marvel), 20 g wholemeal flour (Strong Stoneground 100% Wholemeal Flour, Sainsbury\u0026rsquo;s), 10 g yeast extract (Merck) 10 g wheat germ (Neal\u0026rsquo;s Yard Wholefoods Natural Wheatgerm), 40 g bran (Neal\u0026rsquo;s Yard Wholefoods Natural Wheat Bran). Unless specified, larvae were incubated at 30\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eDissection and DNA isolation\u003c/strong\u003e \u003cp\u003eLarvae were transferred to empty 90 mm round Petri dishes for 2 h of starvation; dissection was carried out under sterile conditions [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Larvae were transferred individually to small centrifuge tubes and killed by flash-freezing in liquid nitrogen, then the head was removed and a cut was made down the ventral side. Gut contents were removed with forceps and placed in a sterile 2 mL tube, three guts to a tube. Both gut and whole larval samples were homogenised using an MP Biomedicals FastPrep-24\u0026trade; homogeniser with 2 mL Lysing Matrix D tubes, for 40 seconds (speed 6.0). DNA was purified with the FastDNA\u0026reg; SPIN Kit for Soil according to instructions but with two extra homogenisation cycles followed by 15-min centrifugation.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eCharacterisation of the native G. mellonella gut microbiome\u003c/em\u003e: Library preparation for 16S rRNA amplicon sequencing of whole \u003cem\u003eGalleria\u003c/em\u003e guts was carried out according to Illumina [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. V3-V4 amplicon sequencing was carried out by Novogene using the Novoseq 6000 PE150 platform. Taxa were assigned using Centrifuge (v0.15). Primers: 341F: CCTAYGGGRBGCASCAG; 806R: GGACTACNNGGGTATCTAAT.\u003c/p\u003e \u003cp\u003e \u003cem\u003eClearing the native G. mellonella gut microbiome\u003c/em\u003e: Larvae were fed on food containing 15 mg streptomycin (Sigma) and 15 mg oxytetracycline (Sigma) per 100 g of food for 0, 1, 5 or 10 days. Larvae were dissected, guts removed, homogenised and plated. Full-length 16S rRNA amplification through PCR was carried out on gut homogenates and products run on 1% agarose gels and stained with ethidium bromide. In subsequent experiments, larvae were fed as above for 10 days, then incubated for two days without food. Primers: 8F: AGAGTTTGATCATGGCTCAG; 1492R: TACGGTTACCTTGTTACGACT\u003c/p\u003e \u003cp\u003e \u003cem\u003eFaecal slurry stock\u003c/em\u003e: Faecal collection from the Norfolk and Norwich University Hospital NNUH was approved by the Faculty of Medical and Health Sciences Ethics Committee at the University of East Anglia (UEA), and followed protocols laid out by the UEA Biorepository (License no: 11208) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. A faecal slurry stock was made using 30 unique 1 g samples from different infants. Under sterile, anaerobic conditions the samples were combined into a single 50 mL Falcon tube, and 20 mL of sterile PBS (Formedium) was added. The slurry was then vortexed until homogenous. 1 mL aliquots were flash-frozen in liquid nitrogen, and stored in cryo-vials at -80\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003cem\u003eGut colonisation\u003c/em\u003e: A 1 g aliquot of human infant faecal slurry was mixed into 10 g of sterile food in each of 3 Petri dishes. 12 larvae were placed on food then incubated at 37\u0026deg;C. On day 0, guts were dissected from 9 antibiotic-treated larvae, followed by 9 larvae each from the control and faecal slurry groups on days 1, 2, 4 and 8. Guts were pooled, 3 per sample, and homogenised using glass beads in an Omni Bead Ruptor (Speed 4 for 2x 60 s, 30 s dwell time). Samples were diluted 1000x in PBS, spread on BHI plates and incubated for 24 h at 37\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003cem\u003eMortality assessment\u003c/em\u003e: Mortality was assessed by stimulating larvae and monitoring for movement. Health was assessed using the health index [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cem\u003eNative gut microbiome of G. mellonella:\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003eInitially we investigated the native microbiome of our experimental colonies: in-house, TruLarv\u0026trade; (a commercial source of research-grade larvae), and a wild colony. Each sample contained purified DNA from three pooled \u003cem\u003eG. mellonella\u003c/em\u003e gut contents. 16S rRNA genus level taxonomic profiles (Fig. 1) for the larvae from our colony and the Trularv\u0026trade; larvae were very similar and were dominated by \u003cem\u003eEnterococcus.\u0026nbsp;\u003c/em\u003eas usually reported [13]. During the course of this analysis a new bacterial species, \u003cem\u003eE. innesii\u003c/em\u003e, was isolated and is reported elsewhere [9]. The composition of the gut microbiome of the wild larvae appeared very different; it was dominated by \u003cem\u003eCutibacterium\u0026nbsp;\u003c/em\u003eand also contained \u003cem\u003eRalstonia\u0026nbsp;\u003c/em\u003eand \u003cem\u003eStaphylococcus\u003c/em\u003e. These bacteria are common members of the \u0026lsquo;kitome\u0026rsquo; [14] and may have arisen due to contamination. Very few bacteria could be isolated from the wild larvae, so the bacterial abundance in the guts may have been very low. These larvae were melanised before sampling so may have had high immune activity, which may disrupt the gut microbiome.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eClearing the G. mellonella gut of bacteria\u003c/em\u003e: We developed a protocol to clear the \u003cem\u003eGalleria\u0026nbsp;\u003c/em\u003egut of its native bacteria by feeding with oxytetracycline and streptomycin. Guts were dissected out, homogenised, and DNA purified. Prior to DNA purification, the homogenate was plated at 1/100 dilution on BHI plates. No colonies grew from the 5- or 10-day gut samples. Fig. S1 shows PCR products of 16S rRNA amplification of the purified DNA. A band can be seen for the 1-day and 5-day samples but not the 10-day, showing that a 10-day antibiotic treatment is preferable.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eLimited colonisation of the Galleria gut can be achieved with faecal slurry:\u0026nbsp;\u003c/em\u003eLarvae were placed on food containing faecal slurry and incubated for 1, 2, 4 and 8 days, alongside a control fed only sterile food. No colonies were apparent for larvae fed sterile food and many identical-looking colonies were observed for larvae fed faecal slurry. Using 16S PCR we identified these isolates as \u003cem\u003eE. faecalis.\u0026nbsp;\u003c/em\u003eDue to the poor resolution of 16S rRNA amplicon sequencing for differentiating at the species level, it is possible that this is a resurgence of the host \u003cem\u003eEnterococcus,\u0026nbsp;\u003c/em\u003ebut we consider this unlikely due to the absence of cultures on the control plates.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eFaecal slurry colonisation persists over several days:\u0026nbsp;\u003c/em\u003eLarvae fed faecal slurry have a higher proportion of \u003cem\u003eBifidobacterium\u0026nbsp;\u003c/em\u003ethan both the larvae sampled before the experiment and the larvae not fed faecal slurry (Fig. 2).\u003cem\u003e\u0026nbsp;\u003c/em\u003eThe resulting bacterial composition over longer times can be seen in Fig. 3.\u0026nbsp;The faecal-slurry-fed larvae had a higher abundance of \u003cem\u003eBifidobacterium\u003c/em\u003e, which is very abundant in the infant gut microbiome, and is similar to what was observed in the clinical study from where these samples were sourced [8]. However, both faecal-slurry-fed larvae and control larvae converge to similar profiles after 8 days. In most of the groups, the most dominant genus remains \u003cem\u003eEnterococcus,\u0026nbsp;\u003c/em\u003eperhaps reflecting its dominance in the native \u003cem\u003eGalleria\u0026nbsp;\u003c/em\u003egut.\u0026nbsp;\u003c/p\u003e"},{"header":"Conclusions/Discussion","content":"\u003cp\u003eWe aimed to investigate the possibility of colonising \u003cem\u003eG. mellonella\u003c/em\u003e larvae with bacteria from human infant gut. This required a number of steps. Investigation of the native gut microbiome of \u003cem\u003eG. mellonella\u003c/em\u003e larvae showed that cultured larvae from two different sources contained similar bacterial species, but bacteria from larvae from a \u0026lsquo;wild\u0026rsquo; source were potentially quite different, emphasising the importance of using well-characterised sources of larvae. Prior to the attempted colonisation with non-native species, it was necessary to clear the larvae of their resident gut microbiome. We have established a protocol for the treatment of \u003cem\u003eG. mellonella\u003c/em\u003e to efficiently clear the microbiome using only oxytetracycline and streptomycin. Following this treatment, a break of 2\u0026ndash;3 days days must be given to ensure the absence of antibiotic when attempting to colonise larvae.\u003c/p\u003e \u003cp\u003eOverall it is unclear how successful colonisation of the \u003cem\u003eG. mellonella\u003c/em\u003e gut with infant gut bacteria was. Bifidobacteria are the main taxon in the early infant gut [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] so the high proportion of \u003cem\u003eBifidobacterium\u003c/em\u003e seen in the larval gut following feeding with faecal slurry is promising. However, 16S rRNA amplification doesn\u0026rsquo;t discriminate between living and dead bacteria, so it is unclear whether they were viable. Furthermore, given the more aerobic environment in the larvae gut (i.e. higher oxygen levels), this may not represent an optimal niche for longer-term colonisation of anaerobic \u003cem\u003eBifidobacterium\u003c/em\u003e species and strains.\u003c/p\u003e \u003cp\u003eThe high proportion of \u003cem\u003eEnterococcus\u003c/em\u003e in the faecal-slurry-fed larvae is unsurprising given it is dominant in the native \u003cem\u003eG. mellonella\u003c/em\u003e microbiome [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Our recent work indicates that a newly identified novel \u003cem\u003eG. mellonella\u003c/em\u003e-resident \u003cem\u003eEnterococcus\u003c/em\u003e species (\u003cem\u003eE. innesii\u003c/em\u003e), is also closely related to strains that have been isolated from human patients [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. However, the composition of the faecal-slurry-fed microbiome is not stable; whether or not the infant gut bacteria are viable in the gut, they do not seem to be able to permanently colonise the gut. The composition eventually converges to a similar profile as the other antibiotic-treated larvae (Fig.\u0026nbsp;3), which may link to the differences in gut physiology between humans and insects. The peritrophic membrane prevents bacteria having proximity to the epithelial cells and therefore excludes the human commensals from the mucosal niches they would inhabit in a mammalian gut. The conditions in the lepidopteran gut also differ from the conditions in the mammalian gut in other ways, such as oxygen levels and pH, which is much more alkaline than any part of the human gut [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Although there is plenty of fibre in the diet, the lack of access to other sources of nutrition, such as mucus or human milk oligosaccharides from breast milk, may also be limiting growth of the infant-gut bacteria. Mortality of the larvae fed faecal slurry was low, however, they did not survive pupation, as with all larvae that were antibiotic-treated. This may be due to the absence of bacteria providing colonisation resistance [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Taken together our results demonstrate a viable protocol for introducing non-native (human infant) bacteria into \u003cem\u003eG. mellonella\u003c/em\u003e larvae.\u003c/p\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eLimitations\u003c/h2\u003e \u003cp\u003eWe found that, although some species (e.g. enterococci) may, at least temporarily, thrive in the insect gut, others (e.g. bifidobacteria) may not. Further work is needed to fully explore the potential of using \u003cem\u003eG. mellonella\u003c/em\u003e larvae as a substitute for mice in the investigation of the human infant gut microbiome.\u003c/p\u003e \u003c/div\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eFS: Faecal slurry\u003c/p\u003e\n\u003cp\u003eHMO: human milk oligosaccharide\u003c/p\u003e\n\u003cp\u003ePCR: polymerase chain reaction\u003c/p\u003e\n\u003cp\u003eUEA: University of East Anglia\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cem\u003eEthical approvals and consent to participate:\u003c/em\u003e Human subjects were not directly involved in this study therefore no consent was required as no identifiable human subjects were used. \u0026nbsp;Anonymised infant stool samples were collected from the Norfolk and Norwich University Hospital NNUH as approved by the Faculty of Medical and Health Sciences Ethics Committee at the University of East Anglia (UEA), and following protocols laid out by the UEA Biorepository (License no: 11208). \u003cem\u003eGalleria mellonella\u003c/em\u003e larvae were used in accordance with Institute guidelines. \u0026nbsp;We confirm that all methods were carried out in accordance with relevant guidelines and regulations and all experimental protocols were approved by the Quadram Institute and John Innes Centre.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eConsent for publication:\u003c/em\u003e Not applicable.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAvailability of data and materials:\u003c/em\u003e All data/materials can be obtained by contacting the senior author (
[email protected]).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eFunding\u003c/em\u003e: We acknowledge funding from NC3Rs (NC/R001782/1) and a Biotechnology and Biosciences Research Council (UK) Institute Strategic Programme Grant (BB/P012523/1).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eConflicts of interest:\u003c/em\u003e The authors have no conflicts of interest, either financial or non-financial.\u003c/p\u003e\n\u003ch4\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/h4\u003e\n\u003cp\u003eWe thank the parents from the original clinical study for consenting and providing samples from their infants, and the clinical team involved, particularly Prof Paul Clarke and Katherine McColl at Norfolk and Norwich University Hospital. We thank Tom Johnson and Peter Sutherland for providing wild \u003cem\u003eG.\u003c/em\u003e \u003cem\u003emellonella larvae.\u003c/em\u003e\u0026nbsp;\u003c/p\u003e\n\u003ch4\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/h4\u003e\n\u003cp\u003eAM and LJH conceived the study; HHCG and ML carried out the work; manuscript written by HHCG and AM with input from LJH.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKwadha CA, Ong\u0026apos;amo GO, Ndegwa PN, Raina SK, Fombong AT. The Biology and Control of the Greater Wax Moth, Galleria mellonella. Insects. 2017;8(2).\u003c/li\u003e\n\u003cli\u003eIgnasiak K, Maxwell A. Oxytetracycline reduces the diversity of tetracycline-resistance genes in the Galleria mellonella gut microbiome. Bmc Microbiol. 2018;18.\u003c/li\u003e\n\u003cli\u003eFallon J, Kelly J, Kavanagh K. Galleria mellonella as a model for fungal pathogenicity testing. Methods Mol Biol. 2012;845:469-85.\u003c/li\u003e\n\u003cli\u003eTsai CJ, Loh JM, Proft T. Galleria mellonella infection models for the study of bacterial diseases and for antimicrobial drug testing. Virulence. 2016;7(3):214-29.\u003c/li\u003e\n\u003cli\u003eJorj\u0026atilde;o AL, Oliveira LD, Scorzoni L, Figueiredo-Godoi LMA, Cristina A. Prata M, Jorge AOC, et al. From moths to caterpillars: Ideal conditions for Galleria mellonella rearing for in vivo microbiological studies. Virulence. 2018;9(1):383-9.\u003c/li\u003e\n\u003cli\u003eEllis JD, Graham JR, Mortensen A. Standard methods for wax moth research. J Apicult Res. 2013;52(1).\u003c/li\u003e\n\u003cli\u003eChampion O, Titball R, Bates S. Standardization of G. mellonella larvae to provide reliable and reproducible results in the study of fungal pathogens. Journal of Fungi. 2018;4(3):108.\u003c/li\u003e\n\u003cli\u003eStewart CJ, Ajami NJ, O\u0026apos;Brien JL, Hutchinson DS, Smith DP, Wong MC, et al. Temporal development of the gut microbiome in early childhood from the TEDDY study. Nature. 2018;562(7728):583-8.\u003c/li\u003e\n\u003cli\u003eGooch HCC, Kiu R, Rudder S, Baker DJ, Hall LJ, Maxwell A. Enterococcus innesii sp. nov., isolated from the wax moth Galleria mellonella. International journal of systematic and evolutionary microbiology. 2021;71(12).\u003c/li\u003e\n\u003cli\u003eIllumina. 16s metagenomic sequencing library preparation. Illumina: San Diego, CA, USA. 2013.\u003c/li\u003e\n\u003cli\u003eAlcon-Giner C, Dalby MJ, Caim S, Ketskemety J, Shaw A, Sim K, et al. Microbiota Supplementation with Bifidobacterium and Lactobacillus Modifies the Preterm Infant Gut Microbiota and Metabolome: An Observational Study. Cell Rep Med. 2020;1(5):100077.\u003c/li\u003e\n\u003cli\u003eChampion OL, Titball RW, Bates S. Standardization of G. mellonella Larvae to Provide Reliable and Reproducible Results in the Study of Fungal Pathogens. J Fungi (Basel). 2018;4(3).\u003c/li\u003e\n\u003cli\u003eAllonsius CN, Van Beeck W, De Boeck I, Wittouck S, Lebeer S. The microbiome of the invertebrate model host Galleria mellonella is dominated by Enterococcus. Anim Microbiome. 2019;1(1):7.\u003c/li\u003e\n\u003cli\u003ePaniagua Voirol LR, Valsamakis G, Yu M, Johnston PR, Hilker M. How the \u0026apos;kitome\u0026apos; influences the characterization of bacterial communities in lepidopteran samples with low bacterial biomass. J Appl Microbiol. 2021;130(6):1780-93.\u003c/li\u003e\n\u003cli\u003eKim D, Song L, Breitwieser FP, Salzberg SL. Centrifuge: rapid and sensitive classification of metagenomic sequences. Genome Res. 2016;26(12):1721-9.\u003c/li\u003e\n\u003cli\u003eJohnston PR, Rolff J. Host and Symbiont Jointly Control Gut Microbiota during Complete Metamorphosis. PLoS Pathog. 2015;11(11):e1005246.\u003c/li\u003e\n\u003cli\u003eHarrison JF. Insect acid-base physiology. Annu Rev Entomol. 2001;46:221-50.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-research-notes","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"resn","sideBox":"Learn more about [BMC Research Notes](http://bmcresnotes.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/resn/default.aspx","title":"BMC Research Notes","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Galleria, microbiome, Enterococcus, Bifidobacterium","lastPublishedDoi":"10.21203/rs.3.rs-3782451/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3782451/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eObjective\u003c/strong\u003eStudy of the human infant gut microbiome requires the use of surrogate mammalian species such as mice. We sought to investigate the usefulness of the greater wax moth larva, \u003cem\u003eGalleria mellonella\u003c/em\u003e, as an alternative.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e We have analysed the native gut microbiome of Galleria and developed methods for clearing the native microbiome and introducing species from human infant faecal samples. We find that some species, e.g. enterococci, are more successful at recolonisation, but that others, e.g. \u003cem\u003eBifidobacterium\u003c/em\u003e, are less so. The work paves the way for using \u003cem\u003eGalleria \u003c/em\u003erather than mice in this and similar work.\u003c/p\u003e","manuscriptTitle":"Transplanting human infant gut microbiome species into Galleria mellonella","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-05 18:27:21","doi":"10.21203/rs.3.rs-3782451/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-01-23T10:24:05+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-01-21T18:58:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"8ecdfb15-b0ad-477c-864b-72ef5dd6ba79","date":"2024-01-13T16:25:57+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-01-05T10:24:25+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-01-04T10:42:19+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-01-03T16:29:20+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-03T16:29:20+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Research Notes","date":"2023-12-20T15:02:16+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-research-notes","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"resn","sideBox":"Learn more about [BMC Research Notes](http://bmcresnotes.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/resn/default.aspx","title":"BMC Research Notes","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ccbdaaaa-7900-4e68-9286-cd044ea33cce","owner":[],"postedDate":"January 5th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-05-02T01:15:12+00:00","versionOfRecord":{"articleIdentity":"rs-3782451","link":"https://doi.org/10.1186/s13104-024-06785-w","journal":{"identity":"bmc-research-notes","isVorOnly":false,"title":"BMC Research Notes"},"publishedOn":"2024-04-30 01:15:12","publishedOnDateReadable":"April 30th, 2024"},"versionCreatedAt":"2024-01-05 18:27:21","video":"","vorDoi":"10.1186/s13104-024-06785-w","vorDoiUrl":"https://doi.org/10.1186/s13104-024-06785-w","workflowStages":[]},"version":"v1","identity":"rs-3782451","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3782451","identity":"rs-3782451","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.