Serotonin receptor 5-HT7 modulates inflammatory-associated functions of macrophages | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Serotonin receptor 5-HT7 modulates inflammatory-associated functions of macrophages Frauke S Bahr, Franziska Müller, Martina Kasten, Nils Benen, Christine S Falk, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4582151/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 21 Jan, 2025 Read the published version in Cellular and Molecular Life Sciences → Version 1 posted 5 You are reading this latest preprint version Abstract The hormone and neurotransmitter serotonin regulates numerous physiological functions within the central nervous system and in the periphery upon binding to specific receptors. In the periphery, the serotonin receptor 7 (5-HT7R) is expressed on different immune cells including monocytes and macrophages. To investigate the impact of 5-HT7R-mediated signaling on macrophage properties, we used human THP-1 cells and differentiated them into pro-inflammatory M1- and anti-inflammatory M2-like macrophages. Pharmacological 5-HT7R activation with the specific agonist LP-211 especially modulates morphology of M1-like macrophages by increasing the number of rounded cells. Furthermore, 5-HT7R stimulation results in significantly reduced phagocytic and migratory ability of M1-like macrophages. Noteworthy, LP-211 treatment leads to changes in secretory properties of all macrophages types with the highest effects obtained for M0- and M2c-like macrophages. These results indicate that 5-HT7R activation selectively impairs basic functions of pro-inflammatory macrophages and might thus be a new access point for the modulation of macrophage responses in the future treatment of inflammatory diseases. Macrophages THP-1 cells serotonin 5-HT7 receptor phagocytosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Serotonin (5-HT) is a neurotransmitter of the central nervous system known to modulate mood, pain, body homeostasis, and circadian rhythm [ 1 , 2 ]. However, nearly 95% of the body’s 5-HT is produced and released by enterochromaffin cells in the gut, where it acts locally or it can enter into the blood circulation. In the periphery, 5-HT acts as a hormone to modulate various physiological processes via activation of serotonin receptors belonging to seven major families, including the serotonin receptor 7 (5-HT7R) [ 3 – 6 ]. The 5-HT7R belongs to the family of G protein-coupled receptors and can activate two different heterotrimeric G proteins. The canonical signaling involves activation of the Gs-protein and adenylyl cyclase, leading to increased synthesis of cyclic adenosine monophosphate (cAMP) in the cell [ 7 – 9 ]. In addition, 5-HT7R can activate the G12-protein resulting in activation of small GTPase cell division control protein 42 homolog (Cdc42) leading to modulation of cytoskeleton [ 10 , 11 ]. The 5-HT7R was shown to be an important regulator of the immune system. [ 2 , 12 ]. Among others, 5HT7R-mediated signaling was identified to be crucial for T lymphocyte activation [13]. Our own data and results from other groups demonstrated that 5-HT7R expressed on dendritic cells regulates their maturation and morphology and could modulate cytokine and chemokine secretion [ 14 – 16 ]. Moreover, human lipopolysaccharide (LPS)-primed monocytes display changes in their secretion profile upon 5HT7R stimulation [17]. It has also been demonstrated that 5-HT7R- and 5-HT2BR-mediated signaling influence in vitro monocyte-to-macrophage differentiation [18]. In addition, macrophages can alter their gene expression profile via 5-HT7R - protein kinase A (PKA) signaling pathway [19]. However, the detailed role of 5-HT7R-mediated signaling in the regulation of the basic macrophage functions has not yet been investigated. Macrophages display a high degree of phenotypic and functional heterogeneity. In vitro , two main macrophage subtypes are conventionally discriminated: Classically activated macrophages, which display a pro-inflammatory phenotype (M1-like), and alternatively activated macrophages of various subtypes with anti-inflammatory properties (M2-like) [ 20 – 22 ]. The identification of each subtype can be achieved through the determination of surface marker expression. For instance, M1-like macrophages typically express high levels of CD80 and human leukocyte antigen–DR isotype (HLA-DR), whereas M2a-like macrophages can be identified by their expression of CD206 and M2c-like macrophages by CD163[ 23 ]. One important feature of both types of macrophages is phagocytosis of pathogens and necrotic tissue to clear the area of inflammation. Another important characteristic of macrophages is the initiation of inflammatory responses via secretion of cytokines and chemokines. Depending on their phenotype, distinct pro- or anti-inflammatory environments can thereby be achieved, which attracts various immune cells. Human THP-1 cells are a broadly used and well-characterized cell culture model for investigation of macrophage functions in vitro . This monocytic, non-adherent cell line was isolated from a 1-year old male with acute monocytic leukemia [ 24 , 25 ]. Treatment of THP-1 cells with phorbol-12-myristat-13-acetat (PMA) or macrophage colony-stimulating factor (M-CSF) leads to cell adherence and initiates differentiation of monocytes to macrophages [ 24 , 26 – 30 ]. The latter can be further differentiated into macrophage subtypes with pro- or anti-inflammatory properties, M1- and M2-like macrophages, respectively. Although such traditional classification (i.e., M1, M2a, M2c), which is based on induction of in vitro polarization, does not accurately describe the full phenotypic heterogeneity of in vivo macrophages, for ease of reading, we will use this classification throughout this work [ 24 ]. In this study, we verified expression of 5-HT7R on different subtypes of THP-1-derived macrophages and investigated the functional role of this receptor on macrophage properties. Among others, we analyzed whether the activation of the 5-HT7R by the selective agonist LP-211 modulates cell morphology, migration, phagocytosis, and secretory properties. 2. Material and methods THP-1 cell culture THP-1 cells were purchased from ATCC (TIB-202) and cultured in RPMI medium (ThermoFisher, 51800-019) supplemented with 10% FBS superior stabil (Bio&Sell, S 0615) and 1% Penicillin (100 U mL − 1 )/Streptomycin (100 µg mL − 1 ; Gibco, 15070-063). The differentiation protocol was modified from Surdziel et al. .[ 29 ] In brief, THP-1 monocytes were split (day 1) and respective cell numbers were seeded according to the cell culture dish (0.5x10 6 cells mL − 1 ). For differentiation to macrophages, phorbol-12-myristat-13-acetat (PMA; Sigma, P8139-1MG, 20 ng mL − 1 ) solved in dimethyl sulfoxide (DMSO, Sigma Aldrich, 276855-100ML, 100%) was added and renewed after 24 h. On day three, the medium was exchanged and macrophage polarization was initiated. M0 macrophages received plain medium; to obtain M1-like macrophages - interferon gamma (IFN-γ; Peprotech, AF-300-02, 20 ng mL − 1 ) and lipopolysaccharide (LPS; Sigma, L8274, 100 ng mL − 1 ) were added, for M2a-like macrophages the medium was supplemented with interleukin-4 (IL-4; Peprotech, AF-200-04, 20 ng mL − 1 ) and for M2c-like macrophages with IL-10 (Peprotech, AF-200-10, 50 ng mL − 1 ). On day 5, the THP-1 derived macrophages were used for experiments. Flow cytometry THP-1-derived macrophages were washed with prewarmed PBS, incubated with 0.25% Trypsin-EDTA (1X), phenol red (Invitrogen, 25200-56) for 10 min at 37°C and detached by gentle pipetting. Cells were pelleted (400 g, 5 min, 4°C) and suspended in 1 mL autoMACS Rinsing Solution (Miltenyi Biotec, 130-091-222). All stainings were performed with 1x10 7 cells and centrifugation steps were performed at 400 g for 5 min at 4°C. Blocking was done with donkey serum (1:100, Jackson Immunoresearch, 017-000-121) or Human TruStain FcX (1:100, Biolegend, 422301) for 5 min, followed by centrifugation and incubation with antibody mix (PE/Cyanine7-anti-human CD11b (Biolegend, 301321), PerCP/Cyanine5.5-anti-human MERTK (Biolegend, 367621), APC-anti-human HLA-DR (Biolegend, 307610), PE-anti-human CD86 (B7-2; eBioscience, 12-0869-41); BV421-anti-human CD163 (BD, 562643), PE/Dazzle 594-anti-human CD105 (Biolegend, 323223), Alexa Fluor 700-anti-human CD14 (Biolegend, 367113), PE-anti-human CD200R (Biolegend, 329306), FITC-anti-human CD64 (Invitrogen, 11-0649-42) for 20 min at 4°C, washing, centrifugation and resuspension in autoMACS Rinsing Solution. Stained cells were measured at Sony Spectral cell analyzer SA3800 using FCS Express 6 software for data analysis. Western blot Cells were differentiated as described above and lysed on day 5 of differentiation. Adherent cells (M0, M1, M2a, and M2c) were once washed with cold PBS before adding RIPA lysis buffer and supplemented with protease inhibitors CLAP and PMSF. Cells were detached using a cell scraper and lysates were transferred into reaction tubes. Undifferentiated THP-1 cells in suspension were centrifuged at 700 rpm for 7 min and washed once with PBS. The cell pellet was resuspended in lysis buffer. All lysates were centrifuged at 15 000 g at 4°C for 15 min and the supernatant was used for further experiments. Protein concentrations were determined using Pierce BCA Protein Assay Kit (Thermo scientific, 23225) according to the manufactures protocol. Supernatants were mixed with 6x Nick loading buffer with β-mercaptoethanol (Carl Roth, 4227.1, 5%) and loaded on an SDS-gel (12%) run at 140 V. After separation, the proteins were transferred onto nitrocellulose membranes (Cytiva, 10600003) and blocked for 1 h at room temperature with milk powder (5%) in TBS-T. Membranes were incubated overnight with following primary antibodies: 5-HT7R (1:1000, Abcam, 128892), Gαs (1:500, Abcam, ab101736), Gα12 (1:250, Santa Cruz, sc-515545), Cdc42 (1:500, 610929, BD Biosciences, in SignalBoost™Immunoreaction Enhancer Kit, Merck Millipore, 407207), GAPDH (1:5000, Millipore, MAB374) in milk (5%), if not differently specified. Membranes were washed three times with TBS-T and incubated with corresponding secondary antibodies (all 1:10000 in milk (5%), goat anti-rabbit IgG (H + L) HRP (Thermo Fisher Scientific, 31460), rabbit anti-mouse IgG Fc HRP (Thermo Fisher Scientific, 31455), rabbit anti-goat IgG (H + L) HRP (Thermo Fisher Scientific, 31402)) for 1 h. The western blots were developed using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, 3457734096), SuperSignal West Pico Plus Chemiluminescent Substrate (Thermo Fisher Scientific, 34577), or Immobilon ECL Ultra Western HRP Substrate (Merck, WBULS0100) respectively at Fusion SL Vilber Lourmat (PeqLab). For quantification of the band signals, a custom-written Matlab script was used and normalization was done by the sum of replicates method. Quantitative Real-time polymerase chain reaction (qRT-PCR) RNA from THP-1-derived macrophages was isolated using RNeasy Mini Plus Kit (Qiagen, 74134) and transcribed with either SuperScript® III First-Strand Synthesis System (Invitrogen, 18080-051) or LunaScript™ RT SuperMix Kit (E3010L, NEB). For detection of differentiation marker expression an AriaMx Realtime-PCR System (Agilent Technologies, Software Agilent Aria 1.5) with Maxima SYBR Green qPCR Master Mix (2x) (ThermoScientific, K0253) was used. The respective sequences of the utilized primers are listed in Table 1 . Table 1 Primer sequences. Gene Forward Reverse 18S AGAACGAAAGTCGGAGGTTCG GGACATCTAAGGGCATCACAG CCL22 TTACGTCCGTTACCGTCTGC CCACGGTCATCAGAGTAGGC CD163 TTTGTCAACTTGAGTCCCTTCAG TCCCGCTACACTTGTTTTCAC CD206 GCCAAATGACGAATTGTGGA CACGAAGCCATTTGGTAAACG CD80 TTGGATTGTCATCAGCCCTGC ATTTTCTCCTTTTGCCAGTAG IL-1β AAACCTCTTCGAGGCACAAG GTTTAGGGCCATCAGCTTCA Expression levels of 5-HT7R signaling pathway components were determined on a StepOne Plus System (Applied Biosystems) with either TaqMan Universal PCR Master Mix (Applied Biosystems, 4324018) or Luna® Universal Probe qPCR Master Mix (M3004L, NEB). The following Taqman Gene Expression Assays (Thermofisher), primers and probes were used: 5-HT7R (Hs00909028_g1), Gα12 (Hs00170899_m1), Cdc42 (forward: AGAAAAGTGGGTGCCTGAGAT, reverse: AATTTGAGTCCCAACAAGCAA, probe: GTCACCACTGRCCAAAGACTCCTT), Gαs (Hs00255603_m1), and β-actin (Hs99999903_m1). Relative mRNA expression levels were calculated using the 2 −∆∆C T method. Immunocytochemistry and Microscopy Bright field Differentiated THP-1 cells were imaged in a 48-well plate using bright field at Zeiss Axio Oberver.Z1/7, with Zen 3.2 Blue software (Carl Zeiss, Jena). Immunofluorescence staining and imaging THP-1-derived macrophages were grown on glass cover slips and fixed using paraformaldehyde (PFA, Carl Roth, 0335.3, 4%) for 10 min at RT, permeabilized with acetone for 3 min at -20°C, washed with PBS and unspecific binding sites were blocked with albumin fraction V (Carl Roth, T844.4, %) in PBS for 1 h at room temperature. Afterwards, cells were incubated with anti-5HT7 Receptor/HTR7 (extracellular)-FITC antibody (1:400 in PBS, ASR-037-F, Alomone Labs) or 5HT7 Receptor/HTR7 (extracellular) Blocking Peptide (1:10 ratio to the antibody according to the manufacturers recommendations; BLP-SR037, Alomone Labs) for 1 h at room temperature. Nuclei were stained using DAPI (1:5000, Sigma Aldrich, D9542) for 5 min at RT. Cover slips were mounted with Fluoromount-G (Biozol, SBA-0100-01,) and sealed with clear nail polish after 24 h. Imaging was performed at Zeiss LSM780 confocal microscope using Zen black (2012 SP5) software (Carl Zeiss, Jena). Five regions per cover slip were selected and analyzed. Morphological analysis THP-1 cells were differentiated as described above and stimulated using LP-211 (Sigma Aldrich, SML1561-5MG, 10 µ m) solved in DMSO or DMSO for control at day 3, respectively. Cell surface was stained using Cell Mask Plasma Membrane Stain (1:100, Life Technologies, C37608) in tyrode buffer according to manufacturer’s protocol. In short, on day 5 after seeding cells were washed with prewarmed PBS and incubated for 10 min at 37°C with the staining solution. Cells were subsequently washed with PBS and imaged in tyrode buffer at Zeiss LSM780 confocal microscope (Carl Zeiss, Jena). Images of single cells with the main morphology (M0 – round, M1 – stretched, M2a – enlarged, M2c – enlarged) were separated using the MotiQ ImageJ/Fiji plugin [ 31 , 32 ]. Quantification of shape and protrusions was performed in ImageJ/Fiji by manually drawing segmented lines and using the inbuild “measure” tool for measuring length and numbers. All values < 1 µm were excluded from analysis. Scratch Assay For the scratch assay, 2x10 5 cells per 48 well were seeded and differentiated as described above. On day 5, medium was renewed and cells were stimulated using LP-211 (10 µ m , in DMSO) or DMSO (10 %), respectively. The confluent cell layer was scratched in a vertical line using a p200 pipet tip. Recovery of wounded area was documented using Zeiss Axio Oberver.Z1/7, with Zen 3.2 Blue software (Carl Zeiss, Jena). For quantification of the recovered area, Fiji Wound healing size tool was modified [ 33 ]. Experiments with recovered areas less than the mean recovered area of M2c-like macrophages under control stimulation were excluded from analysis. Phagocytosis Assay A phagocytosis assay was performed as described in Sieve et al. . [ 34 ] In short, THP-1 cells were differentiated and stimulated with LP-211 (10 µ m ) in DMSO or DMSO (100%) for control on day 3 after seeding. Cells were stimulated again after 24 h and subsequently incubated with 1x10 6 particles of Zymosan A ( S. cerevisiae BioParticles™-Texas Red™ conjugate, ThermoFischer, Z2843). On day 5 after seeding, cells were incubated with Hoechst 33342 (1:2000 in culture medium, Invitrogen, H3570) for 15 min at 37°C and washed twice with prewarmed PBS. Fluorescence intensities were measured at Cytation5 image reader (BioTek) and quantified with Gene5 Image Prime 3.11 software (BioTek). Relative phagocytosis rate was calculated automatically by the software. Multiplex assays of THP-1-derived macrophages On day 5 after seeding and differentiation, THP-1-derived macrophages were changed into plain medium and treated with DMSO or LP-211 (10 µ m solved in DMSO) respectively. After 24 h, on day 6, the stimulation was renewed. On day 7, supernatant was collected, centrifuged at 1000 g for 15 min at 4°C and stored at -80°C until measurement. Supernatants were analyzed using Bio-Plex Pro Human Inflammation Panel 1, 27-Plex (BioRad, M500KCAF0Y) with the Bio-Plex 200 system (Bio-Rad). For normalization, cells were lysed as described above for Western Blot and Pierce BCA Protein Assay Kit (ThermoFisher scientific, 23225) was used to determine protein concentrations. Measured chemokine and cytokine concentrations were normalized to corresponding protein concentration of the sample. Analysis was performed on values within the standard range of each analysis. Analytes with one value were excluded from the analysis. Principle component analysis was performed using GraphPad Prism version 11. Analytes with values below the lowest value of the standard were include with the half minimal concentration of each standard [ 35 ]. Statistical analysis The presented data are shown as mean ± standard deviation (SD). Statistical analysis was performed using GraphPad Prism version 11. All data were subjected to outlier analysis and normal distribution tests. Applied statistical tests are indicated in the respective figure legends. 3. Results 3.1. Differentiation of THP-1 monocytes in different subtypes First, we optimized the protocol for differentiation of THP-1 cells to defined subtypes of macrophages ( Fig. 1 A ) . To this end, THP-1 monocytes were treated with PMA, which results in cell adherence and generation of precursor M0-like macrophages. To polarize specific macrophage subtypes, cells were treated with LPS and interferon gamma (IFN-γ) to induce M1-like macrophages. Treatment of M0-like macrophages with interleukin 4 (IL-4) or IL-10 leads to either M2a- or M2c-like macrophages, respectively [ 29 ]. All generated macrophage subtypes displayed a distinct morphology [ 36 ]: the majority of M0 cells were small and round; M1-like stretched and enlarged; M2a- and M2c-like enlarged (Fig. 1 B). To confirm successful differentiation, we verified expression of mRNA encoding particular macrophage markers (Fig. 1 C). Pro-inflammatory M1-like macrophages showed significantly increased expression of IL-1β as well as CD80. Differentiation into M2a-like macrophages was confirmed by increased expression of CCL22 and CD206, whereas M2c-like macrophages demonstrated higher expression of CD163. In addition, M2c-like macrophages also expressed CD206, which is a broad M2 macrophage marker. To further verify proper macrophage polarization, we analyzed expression of defined cell surface markers using flow cytometry analysis (Fig. 1 D and Fig. S 1 ). All subtypes of macrophages displayed a shift in median fluoresce intensity (MFI) for pan-macrophage marker CD11b (Fig. 1 D). Furthermore, M1-like macrophages showed enhanced levels of the HLA-DR. In contrast, the percentage of CD86 + cells were significantly increased in M2a-like macrophages, while M2c-like macrophages demonstrated significantly elevated levels of proto-oncogene tyrosine-protein kinase MER (MERTK) on the cell surface compared to M2a-like macrophages. Taken together, this combined analysis confirms that our optimized differentiation protocol leads to generation of robust subsets of macrophages. 3.2. Expression of 5-HT7R in different macrophage subtypes It has been suggested that variable expression of defined 5-HT receptors can be responsible for different effects of serotonin on immune cells [ 12 , 14 ]. Therefore, we next analyzed the expression of the 5-HT7R as well as its down-stream effectors in different subsets of THP-1-derived macrophages. Results of quantitative real-time PCR (qRT-PCR) revealed a tendency for increased amount of mRNA encoding 5-HT7R and Gα12 protein in M1-like macrophages compared to monocytes and M2-like macrophages, while Gαs mRNA levels were similar in all groups (Fig. 2 A). Of note, expression of mRNA encoding the small GTPase Cdc42 was reduced upon differentiation from THP-1 monocytes to macrophages showing significantly lower levels in M2c-like macrophages (Fig. 2 A). Because the level of mRNA transcripts does not necessarily correlate with the protein expression level, we next analyzed protein expression of 5-HT7R and its signaling components by western blot. In line with transcript levels, expression of 5-HT7R was visible in all cell types (Fig. 2 B). Of note, expression of 5-HT7R and the Gα12 subunit was significantly increased in M1-like macrophages compared to M2-like macrophages and to monocytes and M2-like macrophages, respectively. Immunocytochemical analysis further confirmed expression of 5-HT7R within the intracellular compartments as well as at the plasma membrane in all THP-1-derived macrophages (Fig. 2 C). In these experiments, antibody specify was confirmed using a specific blocking peptide (Fig. 2 C, right panel). Thus, these combined data demonstrate that THP-1-derived macrophages represent a suitable model to study the functional implication of 5-HT7R-mediated signaling in regulation of macrophage functions. 3.3. Stimulation of 5-HT7R modulates the morphological profile of THP-1-derived macrophages Cell morphology represents an essential feature for various macrophage functions including migration, phagocytosis, and cell-cell interactions. Therefore, we characterized basal cell morphology after macrophage differentiation using plasma membrane staining followed by live cell imaging ( Fig. 3 AB) . The majority of M0-like macrophages were rounded (6 %) with only 27% displaying an enlarged morphology. In contrast, the latter was a dominant cell form for both M1- and M2-like macrophages (57% for M1-like, 76% for M2a-like and 58% for M2c-like; Fig. 3 B). One particular feature of M1-like macrophages, in comparison to the other investigated monocytic cell types, was a substantially increased amount of elongated and enlarged cells (32%; Fig. 3 B). Pharmacological activation of the 5-HT7R by the selective agonist LP-211 (48 h) results in a considerable decrease in number of elongated and enlarged cells in M1-like macrophages to 8% and 38%, respectively, while the fraction of rounded cells increased from 11–54% (Fig. 3 C-D). Similar tendencies were also obtained in M2c-like macrophages, in which the percentage of rounded cells in relation to enlarged and elongated cells increased from 27–56% (Fig. 3 C-D). In contrast, M0- and M2a-like macrophages show only minor morphological changes in response to 5-HT7R activation. Of note, LP-211 treatment did not influence the number or mean length of protrusions of any macrophage subtypes (Fig. 3 E and F ). However, detailed morphological analysis ( Fig. S 2 ) revealed that M0-like macrophages possess a reduced number of plasma membrane protrusions compared to other macrophage subsets, while the mean length of protrusions does not differ between all macrophage subtypes and after pharmacological treatment (Fig. 3 E). It is important to mention that morphological changes obtained after 5-HT7R stimulation were not mediated by the agonist-mediated shift in the differentiation profiles, since mRNA expression levels of differentiation markers in all macrophage subtypes did not change after LP-211 treatment ( Fig. S 3 ). 3.4. 5-HT7R signaling selectively restrains migratory capability of pro-inflammatory acrophages To assess the migratory ability of differentiated macrophage subtypes, we applied a wound healing scratch assay. Under basal conditions, M0- and M2c-like macrophages exhibited the highest recovery rate of the scratched area reaching 59.3% and 52.1% after 24 hours, respectively, followed by M2a-like macrophages (19.8% after 24 hours). In contrast, pro-inflammatory M1-like macrophages demonstrated the lowest migratory ability at all analyzed time points with only 3.3% recovery at the end point ( Fig. 4 A-B ) . Stimulation of 5-HT7R with LP-211 significantly slowed the migratory ability of M1-like macrophages to about 1.3% recovered area after 24 hours (Fig. 4 C-D). In contrast, the migratory properties of M0-like and M2-like macrophages remained unaffected upon pharmacological 5-HT7R activation (recovered area of 54.0%, 11.4%, and 59.3% for M0-like, M2a-like and M2c-like macrophages after 24 hours, respectively; Fig. 4 C-D). Taken together, these results suggest that 5-HT7R-mediated signaling plays an important role in regulation of morphology and motility of pro-inflammatory macrophages. 3.5. Phagocytosis rate of pro-inflammatory macrophages is reduced upon 5-HT7R activation Phagocytosis represents the essential function of macrophages, enabling the clearance of pathogens, cell debris and maintenance of tissue integrity. To quantitatively validate the phagocytosis rate of THP1-deriverd macrophages, we exposed the cells to fluorescently labelled Zymosan A particles (derived from Saccharomyces cerevisiae ) followed by real-time visualization of phagocytic events using fluorescence microscopy. As shown in Fig. 5 A-B and Fig. S 4 , M0-, M2a- and M2c-like macrophages exhibit relatively high phagocytosis rates (M0- 53.4%, M2a- 45.7%, M2c-like 60.3% of cells show engulfed particles after 24 hours), and pharmacological activation of the 5-HT7R by LP-211 for 48 hours has no effect on their phagocytic properties (Fig. 5 C-D). In contrast, the number of M1-like pro-inflammatory macrophages, which were able to phagocytose Zymosan A, was significantly lower already under basal conditions (24.6%; Fig. 5 A-B). Noteworthy, treatment of M1-like macrophages with LP-211 drastically reduced their phagocytosis rate by 4.5-fold, reaching 5.3% (Fig. 5 C-D). This demonstrates that 5-HT7R-mediated signaling exclusively reduces phagocytic activity of pro-inflammatory M1-like macrophages. 3.6. Stimulation of 5-HT7R modulates cytokine and chemokine secretion The process of wound healing is highly dependent on the composition of cytokines and chemokines secreted by present immune cells. To assess the impact of 5-HT7R-mediated signaling on cytokine and chemokine levels, we analyzed the secreted amounts of multiple cytokines and chemokines in the supernatants of THP-1-derived macrophages under basal conditions and after pharmacological 5HT7R activation ( Fig. 6 ) . Under basal conditions, pro-inflammatory M1-like macrophages showed increased amounts of secreted proteins compared to M0 and M2-like macrophages (Fig. 6 A). In particular, secretion of IL-1Ra, IL-8, CCL5, granulocyte-colony-stimulating factor (G-CSF) and TNF-α was substantially higher in comparison to M0-, M2a-, and M2c-like macrophages. These pro-inflammatory cytokines and chemokines are of primary importance for leukocyte recruitment, their differentiation and the initiation of an inflammatory response [ 37 – 39 ]. Interestingly, only M1-like macrophages secreted the interleukins-6 and − 13 within the detection range. The IL-13 possess predominantly anti-inflammatory properties, whereas IL-6 acts pro-inflammatory but has also been shown to facilitate the differentiation of M2-like macrophages[ 40 , 41 ]. Treatment of the different subtypes of macrophages with the 5-HT7R agonist LP-211 results in heterogeneous effects (Fig. 6 B): Secretion of IL-1Ra, IL-8, and G-CSF by pro-inflammatory M1-like macrophages was similar to basal conditions. Noteworthy, LP-211 treatment results in remarkable (up to 8-fold) increase in secretion of IL-8, G-CSF, macrophage inflammatory protein 1-α (MIP-1a), and CCL5 by M0- and M2c-like macrophages in comparison to each control condition. Interestingly, pro-inflammatory M1-like macrophages respond to LP-211 treatment with reduced secretion of most of the analyzed proteins. We also performed a principal component analysis of the secreted proteins in the supernatant of three independent THP-1 macrophage differentiation experiment. To visualize clustering under basal conditions, two components representing 97% of the observed variation in the data set, were displayed. Principal component 1 (PC1) represents 93% whereas PC2 stand for 4% of the variation leading to a separate clustering of pro-inflammatory M1-like and anti-inflammatory M2a-like macrophages. M0 and M2c- like macrophages cluster together under basal conditions (Fig. 6 C). Upon treatment with LP-211, M0-, M1-, and M2c-like macrophages respond with an individual shift in their secretion profiles (Fig. 6 D). 4. Discussion The monocytic cell line THP-1 can be differentiated into macrophage subtypes with specific functions [ 24 ]. Depending on applied differentiation agents and culture protocols, the obtained macrophage properties can substantially differ [ 24 , 27 ]. Here we confirmed previous data that the polarization of THP-1-derived macrophages is reflected by specific mRNA and flow cytometry expression patterns as well as by typical cell morphology. Among others, IL-1β, CD80, and HLA-DR – established markers for pro-inflammatory macrophages - were upregulated in M1-like macrophages [ 27 , 34 , 42 – 44 ]. To distinguish between M2a- and M2c-like macrophages, we compared the expression of CD163, CD86, MERTK, and CD14, which displayed a clear differentiation between the macrophage subtypes. This data suggests that our differentiation protocol is suitable for detailed analysis of macrophage functions. The morphology of macrophages changes upon differentiation status, and is important for exhibition of their function [ 45 ]. Here, M1-like macrophages were mainly stretched and enlarged, whereas M2-like cells exhibited enlarged phenotypes compared to M0-like macrophages. These phenotypes were also observed in human monocyte-derived macrophages (hMDMs) [ 36 , 45 ]. Interestingly, mouse bone marrow derived macrophages (BMDM) possess different morphological phenotypes supporting existence of species-specific differences [ 46 ]. Stimulation of the 5-HT7R by LP-211 changed the morphology profile of cultured macrophages by increasing the population of round cells in M1- as well as M2a-like macrophages. Since specific morphological shapes of macrophages were shown to correlate with their activation status, [ 47 ] LP-211 treatment might therefore modulate the activation status of these cells. Migration is a crucial feature of macrophages allowing them to move towards the site of injury. This complex process involves cell attachment and detachment as well as actin cytoskeleton rearrangement with podosome formation [ 48 ]. Pro-inflammatory macrophages show reduced migration ability compared to anti-inflammatory macrophages. This drawback was described in different macrophage models with diverse chemoattractants [ 45 , 49 ]. For example, it was shown that mouse M1-like macrophages express high levels of integrin α D β 2 (CD11d/CD18), increasing their attachment, which in turn inhibits migration [ 49 – 52 ]. In addition, formation of podosomes as well as differences in actin cytoskeletal reorganization were observed between pro- and anti-inflammatory macrophages [ 36 , 45 ]. In line with these observations, THP-1-derived M1-like macrophages in our study showed the weakest migration ability. More importantly, such weak ability for migration was further reduced upon 5HT7R activation. This effect was accompanied by profound morphological changes – number of round cells was increased upon LP-211 treatment. This was in contrast to previous observation in dendritic cells, where 5-HT7R activation induced elongation of protrusions and enhanced migration, effects evoked by the G12 protein-mediated activation of small GTPases Rac1 and Cdc42 [15]. On the other hand, stimulation of 5-HT7R with LP-211 initiates Gs signaling leading to increased production of cAMP. This, in turn, could negatively modulate cell adhesion and migration via Epac-Rap1-mediated activation of integrins [ 53 – 55 ]. Phagocytosis is a central function of macrophages. The in vitro phagocytic efficacy of macrophages is influenced by the macrophages’ origin (tissue, species, cell line), differentiation agents (GM-/M-CSF, PMA, LPS, IFN-γ, IL-4, Il-13, IL-10) and used bioparticles (yeast, bacteria, coated beads) [ 56 – 58 ]. For example, application of differentiation reagents such as LPS and IFNγ has been shown to differentially affect phagocytosis: treatment with LPS enhanced, while treatment with IFN-γ reduced phagocytic capacity of macrophages[ 59 , 60 ]. It was also shown that M1-like macrophages have increased ability to phagocytose S. aureus bioparticles compared to other THP-1-derived macrophage subtypes [56]. Also Tedesco and co-workers demonstrated that M0- and M1-like macrophages displayed high levels of dextran-FITC phagocytosis, while M2-like macrophages showed reduced engulfment [43]. On the other hand, recent study by Hicksman and co-workers demonstrated that M1-like hMDMs have significantly lower phagocytic capacity for Zymosan A bioparticles than M0- and M2 hMDMs [61]. Also in the present study, THP-1-derived pro-inflammatory M1-like macrophages showed very low phagocytic capacity of Zymosan A particles under basal conditions. More importantly, stimulation of 5-HT7R resulted in significantly reduced phagocytic ability particularly in this macrophage subtype. An essential step during phagocytosis is the remodeling of the actin cytoskeleton, which is concomitant with local changes of cAMP concentrations in close proximity to the cell membrane[ 57 , 62 – 65 ]. Both elevated cAMP and Epac1 levels have been shown to reduce phagocytic capacity [ 66 – 71 ]. Our combined data therefore suggests that 5-HT7R-mediated activation of Gαs-AC-cAMP-Epac1-Rap1 signaling module might be responsible for agonist-evoked reduction of migratory ability and decreased phagocytosis in M1-like macrophages. The M1-like macrophages may be particularly susceptible to LP-211 treatment, as they have higher levels of 5-HT7R. Several studies have shown that 5-HT can modulate monocytes’ and macrophages’ secretory profile. Pretreatment with 5-HT leads to reduced mRNA levels of the cytokines and chemokines CXCL10, CXCL11, IDO, RSAD2, IL-27, IFIT2, and CXCL11 in hMDMs [ 19 ]. Furthermore, 5-HT7R activation upregulates the release of IL-1β, IL-6, IL-12p40 and IL-8/CXCL8 and downregulates LPS-induced TNF-α release in human primary monocytes [ 17 ]. Here, we found that under basal conditions pro-inflammatory M1-like macrophages secreted high levels of cytokines and chemokine compared to M0- and M2-like macrophages, which is in accordance to the results obtained in hMDMs [ 61 , 72 ]. Pharmacological activation of the 5HT7R with LP-211 boosts secretion of chemokines and cytokines particularly from M0- and M2-like macrophage subtypes. In particular M0-like macrophages showed increased secretion of pro-inflammatory cytokines IL-8, MIP-1α, G-CSF, and CCL5 (RANTES). These cytokines are important for neutrophil recruitment and migration of leukocytes, indicating a possible impact on early inflammatory responses [ 73 – 76 ]. In contrast, in M1-like macrophages LP-211 treatment resulted in slightly reduced secretion when compared to control conditions. Taken together, we demonstrated that stimulation of the 5HT7R selectively reduces pro-inflammatory M1-like macrophages’ migratory and phagocytic properties. Furthermore, 5-HT7R activation shifts morphology profiles and alters M0-, M2a-, and M2c-like macrophages’ secretion properties. Thus, 5-HT7R-mediated signaling might be a new access point for the modulation of macrophage responses in the treatment of inflammatory diseases. Abbreviations 5-HT serotonin 5-HT7R serotonin receptor 7 BMDM bone marrow derived macrophages cAMP cyclic adenosine monophosphate Cdc42 cell division control protein 42 homolog DMSO dimethyl sulfoxide G-CSF granulocyte-colony-stimulating factor HLA-DR leukocyte antigen–DR isotype hMDMs human monocyte-derived macrophages IFN-γ interferon gamma IL interleukin LPS lipopolysaccharide M-CSF macrophage colony-stimulating factor MERTK proto-oncogene tyrosine-protein kinase MER MFI median fluoresce intensity MIP-1a macrophage inflammatory protein 1-α PC principal component PFA paraformaldehyde PKA protein kinase A PMA phorbol-12-myristat-13-acetat qRT-PCR quantitative real-time PCR Declarations Acknowledgements We thank Dalia Abdel Galil, Tania Bunke, Martin Leibrock, Kerstin Beushausen and Jana Keil for technical support, Dr. Andre Zeug for assistance in microscopy, and Dr. Margarethe Klein and Dr. Mania Ackermann for supporting flow cytometry analysis. This work is part of the PhD thesis of F. S. B.. Funding This work was funded by Deutsche Forschungsgemeinschaft (DFG, HI 842/12-1 to M.R.-H. and PO732 to E.P.) Competing interests The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Consent for publication The authors hereby consent to publication of the work in Cellular and Molecular Life Sciences. Author Contributions F.E.M., M. R.-H., D.H-K and E.P. created the initial concept, F.S.B., F.E.M., N.B., M.K., and C.S.F. performed experiments, F.S.B, F.E.M. created figures, F.S.B., and F.E.M. wrote the initial draft to which all authors contributed later. All authors reviewed and approved the final version of the manuscript. Data Availability The data that support the findings of this study are available from the corresponding author upon reasonable request. Ethical approval Not applicable. References Barnes NM, Ahern GP, Becamel C et al (2021) International Union of Basic and Clinical Pharmacology. CX. Classification of Receptors for 5-hydroxytryptamine; Pharmacology and Function. Pharmacol Rev 73:310–520. https://doi.org/10.1124/pr.118.015552 Quintero-Villegas A, Valdés-Ferrer SI (2019) Role of 5-HT7 receptors in the immune system in health and disease. Mol Med 26:2. https://doi.org/10.1186/s10020-019-0126-x Rieder M, Gauchel N, Bode C, Duerschmied D (2021) Serotonin: a platelet hormone modulating cardiovascular disease. J Thromb Thrombolysis 52:42–47. https://doi.org/10.1007/s11239-020-02331-0 El-Merahbi R, Löffler M, Mayer A, Sumara G (2015) The roles of peripheral serotonin in metabolic homeostasis. FEBS Lett 589:1728–1734. https://doi.org/10.1016/j.febslet.2015.05.054 Sharp T, Barnes NM (2020) Central 5-HT receptors and their function; present and future. Neuropharmacology 177:108155. https://doi.org/10.1016/j.neuropharm.2020.108155 Bahr FS, Ricke-Hoch M, Ponimaskin E, Müller FE (2024) Serotonin Receptors in Myocardial Infarction: Friend or Foe? ACS Chem Neurosci. https://doi.org/10.1021/acschemneuro.4c00031 Shen Y, Monsma FJ, Metcalf MA et al (1993) Molecular cloning and expression of a 5-hydroxytryptamine7 serotonin receptor subtype. J Biol Chem 268:18200–18204. https://doi.org/10.1016/S0021-9258(17)46830-X Bard JA, Zgombick J, Adham N et al (1993) Cloning of a novel human serotonin receptor (5-HT7) positively linked to adenylate cyclase. J Biol Chem 268:23422–23426. https://doi.org/10.1016/S0021-9258(19)49479-9 Ruat M, Traiffort E, Leurs R et al (1993) Molecular cloning, characterization, and localization of a high-affinity serotonin receptor (5-HT7) activating cAMP formation. Proc Natl Acad Sci U S A 90:8547–8551 Kvachnina E, Liu G, Dityatev A et al (2005) 5-HT7 Receptor Is Coupled to Gα Subunits of Heterotrimeric G12-Protein to Regulate Gene Transcription and Neuronal Morphology. J Neurosci 25:7821–7830. https://doi.org/10.1523/JNEUROSCI.1790-05.2005 Kobe F, Guseva D, Jensen TP et al (2012) 5-HT7R/G12 Signaling Regulates Neuronal Morphology and Function in an Age-Dependent Manner. J Neurosci 32:2915–2930. https://doi.org/10.1523/JNEUROSCI.2765-11.2012 Herr N, Bode C, Duerschmied D (2017) The Effects of Serotonin in Immune Cells. Front Cardiovasc Med 4 León-Ponte M, Ahern GP, O’Connell PJ (2007) Serotonin provides an accessory signal to enhance T-cell activation by signaling through the 5-HT7 receptor. Blood 109:3139–3146. https://doi.org/10.1182/blood-2006-10-052787 Idzko M, Panther E, Stratz C et al (2004) The Serotoninergic Receptors of Human Dendritic Cells: Identification and Coupling to Cytokine Release 1. J Immunol 172:6011–6019. https://doi.org/10.4049/jimmunol.172.10.6011 Holst K, Guseva D, Schindler S et al (2015) The serotonin receptor 5-HT₇R regulates the morphology and migratory properties of dendritic cells. J Cell Sci 128:2866–2880. https://doi.org/10.1242/jcs.167999 Katoh N, Soga F, Nara T et al (2006) Effect of serotonin on the differentiation of human monocytes into dendritic cells. Clin Exp Immunol 146:354–361. https://doi.org/10.1111/j.1365-2249.2006.03197.x Dürk T, Panther E, Müller T et al (2005) 5-Hydroxytryptamine modulates cytokine and chemokine production in LPS-primed human monocytes via stimulation of different 5-HTR subtypes. Int Immunol 17:599–606. https://doi.org/10.1093/intimm/dxh242 de Las Casas-Engel M, Corbí AL (2014) Serotonin modulation of macrophage polarization: inflammation and beyond. Adv Exp Med Biol 824:89–115. https://doi.org/10.1007/978-3-319-07320-0_9 Domínguez-Soto Á, Usategui A, de Casas-Engel M L, et al (2017) Serotonin drives the acquisition of a profibrotic and anti-inflammatory gene profile through the 5-HT7R-PKA signaling axis. Sci Rep 7:14761. https://doi.org/10.1038/s41598-017-15348-y Murray PJ (2017) Macrophage Polarization. Annu Rev Physiol 79:541–566. https://doi.org/10.1146/annurev-physiol-022516-034339 Mosser DM, Edwards JP (2008) Exploring the full spectrum of macrophage activation. Nat Rev Immunol 8:958–969. https://doi.org/10.1038/nri2448 Martinez FO, Gordon S (2014) The M1 and M2 paradigm of macrophage activation: time for reassessment. https://doi.org/10.12703/P6-13 . F1000Prime Rep 6: Strizova Z, Benesova I, Bartolini R et al (2023) M1/M2 macrophages and their overlaps – myth or reality? Clin Sci 137:1067–1093. https://doi.org/10.1042/CS20220531 Chanput W, Mes JJ, Wichers HJ (2014) THP-1 cell line: An in vitro cell model for immune modulation approach. Int Immunopharmacol 23:37–45. https://doi.org/10.1016/j.intimp.2014.08.002 Tsuchiya S, Yamabe M, Yamaguchi Y et al (1980) Establishment and characterization of a human acute monocytic leukemia cell line (THP-1). Int J Cancer 26:171–176. https://doi.org/10.1002/ijc.2910260208 Nascimento CR, Rodrigues Fernandes NA, Gonzalez Maldonado LA, Rossa Junior C (2022) Comparison of monocytic cell lines U937 and THP-1 as macrophage models for in vitro studies. Biochem Biophys Rep 32:101383. https://doi.org/10.1016/j.bbrep.2022.101383 Baxter EW, Graham AE, Re NA et al (2020) Standardized protocols for differentiation of THP-1 cells to macrophages with distinct M(IFNγ + LPS), M(IL-4) and M(IL-10) phenotypes. J Immunol Methods 478:112721. https://doi.org/10.1016/j.jim.2019.112721 Daigneault M, Preston JA, Marriott HM et al (2010) The Identification of Markers of Macrophage Differentiation in PMA-Stimulated THP-1 Cells and Monocyte-Derived Macrophages. PLoS ONE 5:e8668. https://doi.org/10.1371/journal.pone.0008668 Surdziel E, Clay I, Nigsch F et al (2017) Multidimensional pooled shRNA screens in human THP-1 cells identify candidate modulators of macrophage polarization. PLoS ONE 12:e0183679. https://doi.org/10.1371/journal.pone.0183679 Lund ME, To J, O’Brien BA, Donnelly S (2016) The choice of phorbol 12-myristate 13-acetate differentiation protocol influences the response of THP-1 macrophages to a pro-inflammatory stimulus. J Immunol Methods 430:64–70. https://doi.org/10.1016/j.jim.2016.01.012 Rasband WS (1997) ImageJ Hansen JN, Brückner M, Pietrowski MJ et al (2022) MotiQ: an open-source toolbox to quantify the cell motility and morphology of microglia. Mol Biol Cell 33:ar99. https://doi.org/10.1091/mbc.E21-11-0585 Suarez-Arnedo A, Figueroa FT, Clavijo C et al (2020) An image J plugin for the high throughput image analysis of in vitro scratch wound healing assays. PLoS ONE 15:e0232565. https://doi.org/10.1371/journal.pone.0232565 Sieve I, Ricke-Hoch M, Kasten M et al (2018) A positive feedback loop between IL-1β, LPS and NEU1 may promote atherosclerosis by enhancing a pro-inflammatory state in monocytes and macrophages. Vascul Pharmacol 103–105:16–28. https://doi.org/10.1016/j.vph.2018.01.005 Beal SL (2001) Ways to Fit a PK Model with Some Data Below the Quantification Limit. J Pharmacokinet Pharmacodyn 28:481–504. https://doi.org/10.1023/A:1012299115260 Sridharan R, Cavanagh B, Cameron AR et al (2019) Material stiffness influences the polarization state, function and migration mode of macrophages. Acta Biomater 89:47–59. https://doi.org/10.1016/j.actbio.2019.02.048 Marques RE, Guabiraba R, Russo RC, Teixeira MM (2013) Targeting CCL5 in inflammation. Expert Opin Ther Targets 17:1439–1460. https://doi.org/10.1517/14728222.2013.837886 Cambier S, Gouwy M, Proost P (2023) The chemokines CXCL8 and CXCL12: molecular and functional properties, role in disease and efforts towards pharmacological intervention. Cell Mol Immunol 20:217–251. https://doi.org/10.1038/s41423-023-00974-6 Martin KR, Wong HL, Witko-Sarsat V, Wicks IP (2021) G-CSF – A double edge sword in neutrophil mediated immunity. Semin Immunol 54:101516. https://doi.org/10.1016/j.smim.2021.101516 Fernando MR, Reyes JL, Iannuzzi J et al (2014) The Pro-Inflammatory Cytokine, Interleukin-6, Enhances the Polarization of Alternatively Activated Macrophages. PLoS ONE 9:e94188. https://doi.org/10.1371/journal.pone.0094188 Fuster JJ, Walsh K (2014) The Good, the Bad, and the Ugly of interleukin-6 signaling. EMBO J 33:1425–1427. https://doi.org/10.15252/embj.201488856 Genin M, Clement F, Fattaccioli A et al (2015) M1 and M2 macrophages derived from THP-1 cells differentially modulate the response of cancer cells to etoposide. BMC Cancer 15:577. https://doi.org/10.1186/s12885-015-1546-9 Tedesco S, De Majo F, Kim J et al (2018) Convenience versus Biological Significance: Are PMA-Differentiated THP-1 Cells a Reliable Substitute for Blood-Derived Macrophages When Studying in Vitro Polarization? Front Pharmacol 9:71. https://doi.org/10.3389/fphar.2018.00071 Sapudom J, Karaman S, Mohamed WKE et al (2021) 3D in vitro M2 macrophage model to mimic modulation of tissue repair. NPJ Regen Med 6:83. https://doi.org/10.1038/s41536-021-00193-5 Vogel DY, Heijnen PD, Breur M et al (2014) Macrophages migrate in an activation-dependent manner to chemokines involved in neuroinflammation. J Neuroinflammation 11:23. https://doi.org/10.1186/1742-2094-11-23 McWhorter FY, Wang T, Nguyen P et al (2013) Modulation of macrophage phenotype by cell shape. Proceedings of the National Academy of Sciences 110:17253–17258. https://doi.org/10.1073/pnas.1308887110 Anderson JA, Lamichhane S, Mani G (2016) Macrophage responses to 316L stainless steel and cobalt chromium alloys with different surface topographies. J Biomedical Mater Res Part A 104:2658–2672. https://doi.org/10.1002/jbm.a.35808 Rougerie P, Miskolci V, Cox D (2013) Generation of membrane structures during phagocytosis and chemotaxis of macrophages: role and regulation of the actin cytoskeleton. Immunol Rev 256:222–239. https://doi.org/10.1111/imr.12118 Cui K, Ardell CL, Podolnikova NP, Yakubenko VP (2018) Distinct Migratory Properties of M1, M2, and Resident Macrophages Are Regulated by αDβ2 and αMβ2 Integrin-Mediated Adhesion. Front Immunol 9 Yakubenko VP, Yadav SP, Ugarova TP (2006) Integrin αDβ2, an adhesion receptor up-regulated on macrophage foam cells, exhibits multiligand-binding properties. Blood 107:1643–1650. https://doi.org/10.1182/blood-2005-06-2509 Yakubenko VP, Belevych N, Mishchuk D et al (2008) The role of integrin αDβ2 (CD11d/CD18) in monocyte/macrophage migration. Exp Cell Res 314:2569–2578. https://doi.org/10.1016/j.yexcr.2008.05.016 Aziz MH, Cui K, Das M et al (2017) The Upregulation of Integrin αDβ2 (CD11d/CD18) on Inflammatory Macrophages Promotes Macrophage Retention in Vascular Lesions and Development of Atherosclerosis. J Immunol 198:4855–4867. https://doi.org/10.4049/jimmunol.1602175 Lorenowicz MJ, van Gils J, de Boer M et al (2006) Epac1-Rap1 signaling regulates monocyte adhesion and chemotaxis. J Leukoc Biol 80:1542–1552. https://doi.org/10.1189/jlb.0506357 de Rooij J, Zwartkruis FJ, Verheijen MH et al (1998) Epac is a Rap1 guanine-nucleotide-exchange factor directly activated by cyclic AMP. Nature 396:474–477. https://doi.org/10.1038/24884 Kim C, Ye F, Ginsberg MH (2011) Regulation of Integrin Activation. Annu Rev Cell Dev Biol 27:321–345. https://doi.org/10.1146/annurev-cellbio-100109-104104 Shiratori H, Feinweber C, Luckhardt S et al (2017) THP-1 and human peripheral blood mononuclear cell-derived macrophages differ in their capacity to polarize in vitro. Mol Immunol 88:58–68. https://doi.org/10.1016/j.molimm.2017.05.027 Rosales C, Uribe-Querol E (2017) Phagocytosis: A Fundamental Process in Immunity. Biomed Res Int 2017:e9042851. https://doi.org/10.1155/2017/9042851 Uribe-Querol E, Rosales C (2020) Phagocytosis: Our Current Understanding of a Universal Biological Process. Front Immunol 11 Ghate A, Sharma S, Agrawal P, Sahu A (2021) Differential expression of complement receptors CR1/2 and CR4 by murine M1 and M2 macrophages. Mol Immunol 137:75–83. https://doi.org/10.1016/j.molimm.2021.06.003 Wang Z, Zhou S, Sun C et al (2014) Interferon-γ Inhibits Nonopsonized Phagocytosis of Macrophages via an mTORC1-c/EBPβ Pathway. J Innate Immun 7:165–176. https://doi.org/10.1159/000366421 Hickman E, Smyth T, Cobos-Uribe C et al (2023) Expanded characterization of in vitro polarized M0, M1, and M2 human monocyte-derived macrophages: Bioenergetic and secreted mediator profiles. PLoS ONE 18:e0279037. https://doi.org/10.1371/journal.pone.0279037 Birmelin M, Decker K (1984) Synthesis of prostanoids and cyclic nucleotides by phagocytosing rat Kupffer cells. Eur J Biochem 142:219–225. https://doi.org/10.1111/j.1432-1033.1984.tb08274.x Füöp T, Fóris G, Leövey A (1984) Age-related changes in cAMP and cGMP levels during phagocytosis in human polymorphonuclear leukocytes. Mech Ageing Dev 27:233–237. https://doi.org/10.1016/0047-6374(84)90048-4 Ballinger MN, Welliver T, Straight S et al (2010) Transient Increase in Cyclic AMP Localized to Macrophage Phagosomes. PLoS ONE 5:e13962. https://doi.org/10.1371/journal.pone.0013962 Kamanova J, Kofronova O, Masin J et al (2008) Adenylate Cyclase Toxin Subverts Phagocyte Function by RhoA Inhibition and Unproductive Ruffling1. J Immunol 181:5587–5597. https://doi.org/10.4049/jimmunol.181.8.5587 Pryzwansky KB, Kidao S, Merricks EP (1998) Compartmentalization of PDE-4 and cAMP-dependent protein kinase in neutrophils and macrophages during phagocytosis. Cell Biochem Biophys 28:251–275. https://doi.org/10.1007/BF02737813 Kalamidas SA, Kuehnel MP, Peyron P et al (2006) cAMP synthesis and degradation by phagosomes regulate actin assembly and fusion events: consequences for mycobacteria. J Cell Sci 119:3686–3694. https://doi.org/10.1242/jcs.03091 Aronoff DM, Canetti C, Serezani CH et al (2005) Cutting Edge: Macrophage Inhibition by Cyclic AMP (cAMP): Differential Roles of Protein Kinase A and Exchange Protein Directly Activated by cAMP-11. J Immunol 174:595–599. https://doi.org/10.4049/jimmunol.174.2.595 Makranz C, Cohen G, Reichert F et al (2006) cAMP cascade (PKA, Epac, adenylyl cyclase, Gi, and phosphodiesterases) regulates myelin phagocytosis mediated by complement receptor-3 and scavenger receptor-AI/II in microglia and macrophages. Glia 53:441–448. https://doi.org/10.1002/glia.20303 Bryn T, Mahic M, Enserink JM et al (2006) The Cyclic AMP-Epac1-Rap1 Pathway Is Dissociated from Regulation of Effector Functions in Monocytes but Acquires Immunoregulatory Function in Mature Macrophages1. J Immunol 176:7361–7370. https://doi.org/10.4049/jimmunol.176.12.7361 Ydrenius L, Majeed M, Rasmusson BJ et al (2000) Activation of cAMP-dependent protein kinase is necessary for actin rearrangements in human neutrophils during phagocytosis. J Leukoc Biol 67:520–528. https://doi.org/10.1002/jlb.67.4.520 Tarique AA, Logan J, Thomas E et al (2015) Phenotypic, Functional, and Plasticity Features of Classical and Alternatively Activated Human Macrophages. Am J Respir Cell Mol Biol 53:676–688. https://doi.org/10.1165/rcmb.2015-0012OC Matsushima K, Yang D, Oppenheim JJ (2022) Interleukin-8: An evolving chemokine. Cytokine 153:155828. https://doi.org/10.1016/j.cyto.2022.155828 Bhavsar I, Miller CS, Al-Sabbagh M (2015) Macrophage Inflammatory Protein-1 Alpha (MIP-1 alpha)/CCL3: As a Biomarker. Gen Methods Biomark Res their Appl 223–249. https://doi.org/10.1007/978-94-007-7696-8_27 Roberts AW (2005) G-CSF: A key regulator of neutrophil production, but that’s not all! Growth Factors. https://doi.org/10.1080/08977190500055836 Appay V, Rowland-Jones SL (2001) RANTES: a versatile and controversial chemokine. Trends Immunol 22:83–87. https://doi.org/10.1016/S1471-4906(00)01812-3 Supplementary Files CMLSSupportingInformationfinal.docx Cite Share Download PDF Status: Published Journal Publication published 21 Jan, 2025 Read the published version in Cellular and Molecular Life Sciences → Version 1 posted Editorial decision: Major Revision 19 Jul, 2024 Reviewers agreed at journal 27 Jun, 2024 Reviewers invited by journal 27 Jun, 2024 Editor assigned by journal 15 Jun, 2024 First submitted to journal 14 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4582151","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":319981636,"identity":"139b6dbd-c2e6-4c53-9b71-044ef51fcd99","order_by":0,"name":"Frauke S Bahr","email":"","orcid":"","institution":"Medizinische Hochschule Hannover","correspondingAuthor":false,"prefix":"","firstName":"Frauke","middleName":"S","lastName":"Bahr","suffix":""},{"id":319981637,"identity":"cc60ce14-7f08-4a1d-bbac-670140431b61","order_by":1,"name":"Franziska Müller","email":"","orcid":"","institution":"Medizinische Hochschule Hannover","correspondingAuthor":false,"prefix":"","firstName":"Franziska","middleName":"","lastName":"Müller","suffix":""},{"id":319981638,"identity":"1598f7cd-9317-4ac8-9441-2dca5d15546d","order_by":2,"name":"Martina Kasten","email":"","orcid":"","institution":"Medizinische Hochschule Hannover","correspondingAuthor":false,"prefix":"","firstName":"Martina","middleName":"","lastName":"Kasten","suffix":""},{"id":319981639,"identity":"0fdd4159-ac87-44ff-a5f6-b53d071a9451","order_by":3,"name":"Nils Benen","email":"","orcid":"","institution":"Medizinische Hochschule Hannover","correspondingAuthor":false,"prefix":"","firstName":"Nils","middleName":"","lastName":"Benen","suffix":""},{"id":319981640,"identity":"435aaec6-db84-48c4-b6d5-c3a7c2f6b606","order_by":4,"name":"Christine S Falk","email":"","orcid":"","institution":"Medizinische Hochschule Hannover","correspondingAuthor":false,"prefix":"","firstName":"Christine","middleName":"S","lastName":"Falk","suffix":""},{"id":319981641,"identity":"22a89565-2340-4828-946a-049d2e8f1afa","order_by":5,"name":"Denise Hilfiker-Kleiner","email":"","orcid":"","institution":"Philipps-Universitat Marburg ZMB: Philipps-Universitat Marburg","correspondingAuthor":false,"prefix":"","firstName":"Denise","middleName":"","lastName":"Hilfiker-Kleiner","suffix":""},{"id":319981642,"identity":"8cec9401-cfb9-434d-aa97-e14bd26cff89","order_by":6,"name":"Melanie Ricke-Hoch","email":"","orcid":"","institution":"Medizinische Hochschule Hannover","correspondingAuthor":false,"prefix":"","firstName":"Melanie","middleName":"","lastName":"Ricke-Hoch","suffix":""},{"id":319981643,"identity":"ccadb028-9822-4446-8be3-2622f27883c5","order_by":7,"name":"Evgeni Ponimaskin","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABQklEQVRIie2Qv0rDUBSHTwjcLGnnhIi+QkKgIi31VXIJJEvSpUtBSW+X6xI769RXyFQdoxeaJTp3FDp2SRFEpf65idRCrGQVzLccOJyP8zsHoKbmD3JMAGJedQQgZXkHSQSBQL4nxLKix1sFFR0kx9VKUWGjgGJVKMn5ze38NDCbGkGi/NrpNdWl8yBcd3uHUmgsBtDeL98S3lvMm7EW2oulRWPs9JHmX+lCavePwtQ0UnDN8hbF05mH4g7ieYTLkGGq+VPtjYo4mjuOSoBhskt5DzbKB6bq3VQR6DBX3BeuDHcpPhVbuQLZc4yp0sgVxhV7xt/ArHIwOeXKmJlIwRRWxMZU9nMlwVHKmEp01yhvkULz0XsKjMmFnWTWuosnZ0WwExwlo9GKDNoH5S9v4SEE+qOr/y58sa4aqKmpqfmPfAJP93WgcYUmpAAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-4570-5130","institution":"Hannover Medical School: Medizinische Hochschule Hannover","correspondingAuthor":true,"prefix":"","firstName":"Evgeni","middleName":"","lastName":"Ponimaskin","suffix":""}],"badges":[],"createdAt":"2024-06-14 12:45:03","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4582151/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4582151/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00018-024-05570-z","type":"published","date":"2025-01-21T15:57:15+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":60686716,"identity":"a548f85a-7043-4ac1-9ab8-976303a5555a","added_by":"auto","created_at":"2024-07-19 14:02:22","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":633713,"visible":true,"origin":"","legend":"\u003cp\u003eBasal characterization of THP-1-derived macrophage subtypes\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA:\u003c/strong\u003eDifferentiation scheme of THP-1-monocytes into M0-, M1-, M2a-, and M2c-like macrophages. \u003cstrong\u003eB:\u003c/strong\u003e Representative morphology of differentiated macrophages, arrow indicates stretched cells, * highlights enlarged cells. \u003cstrong\u003eC:\u003c/strong\u003e mRNA expression levels of macrophage markers. Statistical significance was evaluated using Kruskal-Wallis with Dunn’s multiple comparison test (N=5 independent differentiations). \u003cstrong\u003eD:\u003c/strong\u003e Quantitative analysis of surface marker expression of CD11b, HLA-DR, CD86, and MERTK for each macrophage subtype using flow cytometry. Fluorescence intensity shifts are displayed with normalized counts; u: unstained control. Fold changes of median fluorescence intensities (MFI) relative to M0-like macrophages were analyzed using ordinary one-way ANOVA with Tukey’s multiple comparisons test (CD11b, HLA-DR, CD86) and Kruskal-Wallis with Dunn’s multiple comparison test (MERTK) (N≥3 independent differentiations).\u003c/p\u003e","description":"","filename":"Picture1.png","url":"https://assets-eu.researchsquare.com/files/rs-4582151/v1/58b2b9d0576557bd445f5fc7.png"},{"id":60686715,"identity":"5daa23ce-ae2e-4e48-9112-e9ef8b7e2279","added_by":"auto","created_at":"2024-07-19 14:02:22","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1140232,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTHP-1-derived macrophages express the 5-HT7R and downstream signaling molecules\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA: \u003c/strong\u003emRNA levels of 5-HT7R and Gαs, Gα12, and Cdc42. Statistical difference was evaluated using Kruskal-Wallis with Dunn’s multiple comparison test (N≥5).\u003cstrong\u003e B: \u003c/strong\u003eProtein expression levels of 5-HT7R and its downstream effectors shown by western blot. Statistical analysis was performed using ordinary one-way ANOVA with Tukey’s multiple comparisons (5-HT7R, Gα12) and Kruskal-Wallis with Dunn’s multiple comparison (Gαs, Cd42) test (N=5).\u003cstrong\u003e C: \u003c/strong\u003eRepresentative images\u003cstrong\u003e \u003c/strong\u003evisualizing 5-HT7R localization. Antibody specificity was confirmed with a corresponding blocking peptide (right panel; scale bars 20 µm).\u003c/p\u003e","description":"","filename":"Picture2.png","url":"https://assets-eu.researchsquare.com/files/rs-4582151/v1/9db23e5456e8bb575372467a.png"},{"id":60687069,"identity":"b7372877-482a-4811-bcf0-b837542b7eb1","added_by":"auto","created_at":"2024-07-19 14:10:21","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":720771,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e5-HT7R activation influences macrophage morphology\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA:\u003c/strong\u003e Characterization of macrophages morphology using plasma membrane staining in living cells. Representative images of cell shape on day 5 of differentiation are shown. Scale bars 50 µm in upper panel and 20 µm in magnification. \u003cstrong\u003eB:\u003c/strong\u003eRelative quantification of cell shape by counting round, stretched and enlarged phenotypes after THP-1 differentiation. \u003cstrong\u003eC:\u003c/strong\u003eRepresentative images of THP-1-derived macrophage morphology following LP-211 treatment (10 µm; 48 h). Scale bars 50 µm in upper panel and 20 µm in magnification (N=3). \u003cstrong\u003eD:\u003c/strong\u003e Quantification of morphology profiles after treatment with LP-211 (10 µm; 48 h).\u003cstrong\u003e E:\u003c/strong\u003e Quantification of protrusion numbers in differentiated macrophages without and after LP-211 (10 µm; 48 h) treatment. Statistical analysis was performed on daily mean values (N=3) using two-way ANOVA with Tukey’s multiple comparisons test.\u003cstrong\u003e F:\u003c/strong\u003eAnalysis of mean length of protrusions under basal conditions and after 5-HT7R stimulation with LP-211 (10 µm; 48 h). Statistical analysis was performed on daily mean values (N=3) using two-way ANOVA with Tukey’s multiple comparisons test.\u003c/p\u003e","description":"","filename":"Picture3.png","url":"https://assets-eu.researchsquare.com/files/rs-4582151/v1/d4b208673a5eb03d64d61b69.png"},{"id":60686711,"identity":"21d1aa42-6963-4bef-bb09-3ef719e977a9","added_by":"auto","created_at":"2024-07-19 14:02:21","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":644029,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMotility of macrophages is influenced by 5-HT7R activity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA:\u003c/strong\u003e Representative images of scratch area at beginning (0\u0026nbsp;h) and 24\u0026nbsp;h after scratch initiation for all macrophage subtypes. Scale bars 200\u0026nbsp;µm. \u003cstrong\u003eB:\u003c/strong\u003e Recovered area of macrophage subtypes relative to scratch area at 0\u0026nbsp;h. Quantification of migratory ability after 24\u0026nbsp;h. Data are presented as mean with standard deviation. Adjusted p values: † M0 vs. M1 \u003cem\u003ep=\u003c/em\u003e 0.0004, \u003csup\u003e+ \u003c/sup\u003eM0 vs. M2a \u003cem\u003ep=\u003c/em\u003e 0.0084, \u003csup\u003e# \u003c/sup\u003eM1 vs. M2c\u003cem\u003e p \u003c/em\u003e= 0.002, and \u0026nbsp;M2a vs. M2c \u003cem\u003ep=\u003c/em\u003e 0.0398 using one-way ANOVA with Tukey’s multiple comparisons test (N=4). \u003cstrong\u003eC:\u003c/strong\u003e Images of scratch area at 0\u0026nbsp;h and 24\u0026nbsp;h after LP-211 treatment (10\u0026nbsp;µm). Scale bars 200\u0026nbsp;µm. \u003cstrong\u003eD:\u003c/strong\u003e Quantification of macrophage migration ability after 24\u0026nbsp;h after LP-211 (10\u0026nbsp;µm) or control treatment. Statistical significance was evaluated using unpaired two-tailed t-test between control and LP-211 conditions of each macrophage subtype (N=4).\u003c/p\u003e","description":"","filename":"Picture4.png","url":"https://assets-eu.researchsquare.com/files/rs-4582151/v1/ac2a8ecda37309a815d132cc.png"},{"id":60687070,"identity":"6ba386d3-af71-4abf-8b2e-875b9c62b4e2","added_by":"auto","created_at":"2024-07-19 14:10:21","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1000257,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhagocytosis rate of M1-like macrophages is reduced upon 5-HT7R activation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA:\u003c/strong\u003eRepresentative images of nucleus stained DAPI (upper row) and Texas red-coupled Zymosan A particles (lower row) in control-treated macrophages. Scale bars 200 µm.\u003cstrong\u003e B:\u003c/strong\u003e Fraction of phagocytic macrophages showing engulfment of Texas red-coupled Zymosan A particles. Statistical differences are evaluated using ordinary one-way ANOVA with Tukey’s multiple comparison test (N=8; each point displays the mean of 3 replicate wells).\u003cstrong\u003e C:\u003c/strong\u003e Representative images of macrophages treated with LP-211 (10 µm) showing DAPI and Texas red-coupled Zymosan A particle fluorescence after phagocytosis assay. Scale bars 200 µm.\u003cstrong\u003e D:\u003c/strong\u003e Quantification of phagocytosis rate of macrophage subtypes with control or LP-211 treatment (10 µm; 48 h). Statistical significance was determined using unpaired two-tailed t-test (N=8; each point displays the mean of 3 replicate wells).\u003c/p\u003e","description":"","filename":"Picture5.png","url":"https://assets-eu.researchsquare.com/files/rs-4582151/v1/16c12e7a2e57499e21857834.png"},{"id":74858569,"identity":"b95f17bc-4684-4910-b9d2-e8a481e3dbef","added_by":"auto","created_at":"2025-01-27 16:11:39","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5420526,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4582151/v1/30548a4a-4cf3-4233-93f2-5081a87c45e7.pdf"},{"id":60686713,"identity":"db1134de-3744-43ea-b7b3-0784268a2d85","added_by":"auto","created_at":"2024-07-19 14:02:21","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":3327021,"visible":true,"origin":"","legend":"","description":"","filename":"CMLSSupportingInformationfinal.docx","url":"https://assets-eu.researchsquare.com/files/rs-4582151/v1/5abd32633758e6da04b71b75.docx"}],"financialInterests":"","formattedTitle":"Serotonin receptor 5-HT7 modulates inflammatory-associated functions of macrophages","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eSerotonin (5-HT) is a neurotransmitter of the central nervous system known to modulate mood, pain, body homeostasis, and circadian rhythm [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. However, nearly 95% of the body\u0026rsquo;s 5-HT is produced and released by enterochromaffin cells in the gut, where it acts locally or it can enter into the blood circulation. In the periphery, 5-HT acts as a hormone to modulate various physiological processes via activation of serotonin receptors belonging to seven major families, including the serotonin receptor 7 (5-HT7R) [\u003cspan additionalcitationids=\"CR4 CR5\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The 5-HT7R belongs to the family of G protein-coupled receptors and can activate two different heterotrimeric G proteins. The canonical signaling involves activation of the Gs-protein and adenylyl cyclase, leading to increased synthesis of cyclic adenosine monophosphate (cAMP) in the cell [\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In addition, 5-HT7R can activate the G12-protein resulting in activation of small GTPase cell division control protein 42 homolog (Cdc42) leading to modulation of cytoskeleton [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe 5-HT7R was shown to be an important regulator of the immune system. [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Among others, 5HT7R-mediated signaling was identified to be crucial for T lymphocyte activation [13]. Our own data and results from other groups demonstrated that 5-HT7R expressed on dendritic cells regulates their maturation and morphology and could modulate cytokine and chemokine secretion [\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Moreover, human lipopolysaccharide (LPS)-primed monocytes display changes in their secretion profile upon 5HT7R stimulation [17]. It has also been demonstrated that 5-HT7R- and 5-HT2BR-mediated signaling influence \u003cem\u003ein vitro\u003c/em\u003e monocyte-to-macrophage differentiation [18]. In addition, macrophages can alter their gene expression profile via 5-HT7R - protein kinase A (PKA) signaling pathway [19]. However, the detailed role of 5-HT7R-mediated signaling in the regulation of the basic macrophage functions has not yet been investigated.\u003c/p\u003e \u003cp\u003eMacrophages display a high degree of phenotypic and functional heterogeneity. \u003cem\u003eIn vitro\u003c/em\u003e, two main macrophage subtypes are conventionally discriminated: Classically activated macrophages, which display a pro-inflammatory phenotype (M1-like), and alternatively activated macrophages of various subtypes with anti-inflammatory properties (M2-like) [\u003cspan additionalcitationids=\"CR21\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The identification of each subtype can be achieved through the determination of surface marker expression. For instance, M1-like macrophages typically express high levels of CD80 and human leukocyte antigen\u0026ndash;DR isotype (HLA-DR), whereas M2a-like macrophages can be identified by their expression of CD206 and M2c-like macrophages by CD163[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. One important feature of both types of macrophages is phagocytosis of pathogens and necrotic tissue to clear the area of inflammation. Another important characteristic of macrophages is the initiation of inflammatory responses via secretion of cytokines and chemokines. Depending on their phenotype, distinct pro- or anti-inflammatory environments can thereby be achieved, which attracts various immune cells.\u003c/p\u003e \u003cp\u003eHuman THP-1 cells are a broadly used and well-characterized cell culture model for investigation of macrophage functions \u003cem\u003ein vitro\u003c/em\u003e. This monocytic, non-adherent cell line was isolated from a 1-year old male with acute monocytic leukemia [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Treatment of THP-1 cells with phorbol-12-myristat-13-acetat (PMA) or macrophage colony-stimulating factor (M-CSF) leads to cell adherence and initiates differentiation of monocytes to macrophages [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan additionalcitationids=\"CR27 CR28 CR29\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The latter can be further differentiated into macrophage subtypes with pro- or anti-inflammatory properties, M1- and M2-like macrophages, respectively. Although such traditional classification (i.e., M1, M2a, M2c), which is based on induction of \u003cem\u003ein vitro\u003c/em\u003e polarization, does not accurately describe the full phenotypic heterogeneity of \u003cem\u003ein vivo\u003c/em\u003e macrophages, for ease of reading, we will use this classification throughout this work [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, we verified expression of 5-HT7R on different subtypes of THP-1-derived macrophages and investigated the functional role of this receptor on macrophage properties. Among others, we analyzed whether the activation of the 5-HT7R by the selective agonist LP-211 modulates cell morphology, migration, phagocytosis, and secretory properties.\u003c/p\u003e"},{"header":"2. Material and methods","content":"\u003cp\u003e \u003cb\u003eTHP-1 cell culture\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTHP-1 cells were purchased from ATCC (TIB-202) and cultured in RPMI medium (ThermoFisher, 51800-019) supplemented with 10% FBS superior stabil (Bio\u0026amp;Sell, S 0615) and 1% Penicillin (100 U mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)/Streptomycin (100 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e; Gibco, 15070-063). The differentiation protocol was modified from Surdziel \u003cem\u003eet al.\u003c/em\u003e.[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] In brief, THP-1 monocytes were split (day 1) and respective cell numbers were seeded according to the cell culture dish (0.5x10\u003csup\u003e6\u003c/sup\u003e cells mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e). For differentiation to macrophages, phorbol-12-myristat-13-acetat (PMA; Sigma, P8139-1MG, 20 ng mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) solved in dimethyl sulfoxide (DMSO, Sigma Aldrich, 276855-100ML, 100%) was added and renewed after 24 h. On day three, the medium was exchanged and macrophage polarization was initiated. M0 macrophages received plain medium; to obtain M1-like macrophages - interferon gamma (IFN-γ; Peprotech, AF-300-02, 20 ng mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) and lipopolysaccharide (LPS; Sigma, L8274, 100 ng mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) were added, for M2a-like macrophages the medium was supplemented with interleukin-4 (IL-4; Peprotech, AF-200-04, 20 ng mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) and for M2c-like macrophages with IL-10 (Peprotech, AF-200-10, 50 ng mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e). On day 5, the THP-1 derived macrophages were used for experiments.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFlow cytometry\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTHP-1-derived macrophages were washed with prewarmed PBS, incubated with 0.25% Trypsin-EDTA (1X), phenol red (Invitrogen, 25200-56) for 10 min at 37\u0026deg;C and detached by gentle pipetting. Cells were pelleted (400 g, 5 min, 4\u0026deg;C) and suspended in 1 mL autoMACS Rinsing Solution (Miltenyi Biotec, 130-091-222). All stainings were performed with 1x10\u003csup\u003e7\u003c/sup\u003e cells and centrifugation steps were performed at 400 g for 5 min at 4\u0026deg;C. Blocking was done with donkey serum (1:100, Jackson Immunoresearch, 017-000-121) or Human TruStain FcX (1:100, Biolegend, 422301) for 5 min, followed by centrifugation and incubation with antibody mix (PE/Cyanine7-anti-human CD11b (Biolegend, 301321), PerCP/Cyanine5.5-anti-human MERTK (Biolegend, 367621), APC-anti-human HLA-DR (Biolegend, 307610), PE-anti-human CD86 (B7-2; eBioscience, 12-0869-41); BV421-anti-human CD163 (BD, 562643), PE/Dazzle 594-anti-human CD105 (Biolegend, 323223), Alexa Fluor 700-anti-human CD14 (Biolegend, 367113), PE-anti-human CD200R (Biolegend, 329306), FITC-anti-human CD64 (Invitrogen, 11-0649-42) for 20 min at 4\u0026deg;C, washing, centrifugation and resuspension in autoMACS Rinsing Solution. Stained cells were measured at Sony Spectral cell analyzer SA3800 using FCS Express 6 software for data analysis.\u003c/p\u003e \u003cp\u003e \u003cb\u003eWestern blot\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCells were differentiated as described above and lysed on day 5 of differentiation. Adherent cells (M0, M1, M2a, and M2c) were once washed with cold PBS before adding RIPA lysis buffer and supplemented with protease inhibitors CLAP and PMSF. Cells were detached using a cell scraper and lysates were transferred into reaction tubes. Undifferentiated THP-1 cells in suspension were centrifuged at 700 rpm for 7 min and washed once with PBS. The cell pellet was resuspended in lysis buffer. All lysates were centrifuged at 15 000 g at 4\u0026deg;C for 15 min and the supernatant was used for further experiments. Protein concentrations were determined using Pierce BCA Protein Assay Kit (Thermo scientific, 23225) according to the manufactures protocol. Supernatants were mixed with 6x Nick loading buffer with β-mercaptoethanol (Carl Roth, 4227.1, 5%) and loaded on an SDS-gel (12%) run at 140 V. After separation, the proteins were transferred onto nitrocellulose membranes (Cytiva, 10600003) and blocked for 1 h at room temperature with milk powder (5%) in TBS-T. Membranes were incubated overnight with following primary antibodies: 5-HT7R (1:1000, Abcam, 128892), Gαs (1:500, Abcam, ab101736), Gα12 (1:250, Santa Cruz, sc-515545), Cdc42 (1:500, 610929, BD Biosciences, in SignalBoost\u0026trade;Immunoreaction Enhancer Kit, Merck Millipore, 407207), GAPDH (1:5000, Millipore, MAB374) in milk (5%), if not differently specified. Membranes were washed three times with TBS-T and incubated with corresponding secondary antibodies (all 1:10000 in milk (5%), goat anti-rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) HRP (Thermo Fisher Scientific, 31460), rabbit anti-mouse IgG Fc HRP (Thermo Fisher Scientific, 31455), rabbit anti-goat IgG (H\u0026thinsp;+\u0026thinsp;L) HRP (Thermo Fisher Scientific, 31402)) for 1 h. The western blots were developed using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, 3457734096), SuperSignal West Pico Plus Chemiluminescent Substrate (Thermo Fisher Scientific, 34577), or Immobilon ECL Ultra Western HRP Substrate (Merck, WBULS0100) respectively at Fusion SL Vilber Lourmat (PeqLab). For quantification of the band signals, a custom-written Matlab script was used and normalization was done by the sum of replicates method.\u003c/p\u003e \u003cp\u003e \u003cb\u003eQuantitative Real-time polymerase chain reaction (qRT-PCR)\u003c/b\u003e \u003c/p\u003e \u003cp\u003eRNA from THP-1-derived macrophages was isolated using RNeasy Mini Plus Kit (Qiagen, 74134) and transcribed with either SuperScript\u0026reg; III First-Strand Synthesis System (Invitrogen, 18080-051) or LunaScript\u0026trade; RT SuperMix Kit (E3010L, NEB). For detection of differentiation marker expression an AriaMx Realtime-PCR System (Agilent Technologies, Software Agilent Aria 1.5) with Maxima SYBR Green qPCR Master Mix (2x) (ThermoScientific, K0253) was used. The respective sequences of the utilized primers are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e18S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGAACGAAAGTCGGAGGTTCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGACATCTAAGGGCATCACAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCL22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTACGTCCGTTACCGTCTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCACGGTCATCAGAGTAGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD163\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTGTCAACTTGAGTCCCTTCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCCGCTACACTTGTTTTCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD206\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCAAATGACGAATTGTGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACGAAGCCATTTGGTAAACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGGATTGTCATCAGCCCTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATTTTCTCCTTTTGCCAGTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAACCTCTTCGAGGCACAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTTTAGGGCCATCAGCTTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eExpression levels of 5-HT7R signaling pathway components were determined on a StepOne Plus System (Applied Biosystems) with either TaqMan Universal PCR Master Mix (Applied Biosystems, 4324018) or Luna\u0026reg; Universal Probe qPCR Master Mix (M3004L, NEB). The following Taqman Gene Expression Assays (Thermofisher), primers and probes were used: 5-HT7R (Hs00909028_g1), Gα12 (Hs00170899_m1), Cdc42 (forward: AGAAAAGTGGGTGCCTGAGAT, reverse: AATTTGAGTCCCAACAAGCAA, probe: GTCACCACTGRCCAAAGACTCCTT), Gαs (Hs00255603_m1), and β-actin (Hs99999903_m1). Relative mRNA expression levels were calculated using the 2\u003csup\u003e\u0026minus;∆∆C\u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eT\u003c/span\u003e\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003e \u003cb\u003eImmunocytochemistry and Microscopy\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eBright field\u003c/span\u003e \u003c/p\u003e \u003cp\u003eDifferentiated THP-1 cells were imaged in a 48-well plate using bright field at Zeiss Axio Oberver.Z1/7, with Zen 3.2 Blue software (Carl Zeiss, Jena).\u003c/p\u003e \u003cp\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eImmunofluorescence staining and imaging\u003c/span\u003e \u003c/p\u003e \u003cp\u003eTHP-1-derived macrophages were grown on glass cover slips and fixed using paraformaldehyde (PFA, Carl Roth, 0335.3, 4%) for 10 min at RT, permeabilized with acetone for 3 min at -20\u0026deg;C, washed with PBS and unspecific binding sites were blocked with albumin fraction V (Carl Roth, T844.4, %) in PBS for 1 h at room temperature. Afterwards, cells were incubated with anti-5HT7 Receptor/HTR7 (extracellular)-FITC antibody (1:400 in PBS, ASR-037-F, Alomone Labs) or 5HT7 Receptor/HTR7 (extracellular) Blocking Peptide (1:10 ratio to the antibody according to the manufacturers recommendations; BLP-SR037, Alomone Labs) for 1 h at room temperature. Nuclei were stained using DAPI (1:5000, Sigma Aldrich, D9542) for 5 min at RT. Cover slips were mounted with Fluoromount-G (Biozol, SBA-0100-01,) and sealed with clear nail polish after 24 h. Imaging was performed at Zeiss LSM780 confocal microscope using Zen black (2012 SP5) software (Carl Zeiss, Jena). Five regions per cover slip were selected and analyzed.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eMorphological analysis\u003c/span\u003e \u003c/p\u003e \u003cp\u003eTHP-1 cells were differentiated as described above and stimulated using LP-211 (Sigma Aldrich, SML1561-5MG, 10 \u0026micro;\u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003em)\u003c/span\u003e solved in DMSO or DMSO for control at day 3, respectively. Cell surface was stained using Cell Mask Plasma Membrane Stain (1:100, Life Technologies, C37608) in tyrode buffer according to manufacturer\u0026rsquo;s protocol. In short, on day 5 after seeding cells were washed with prewarmed PBS and incubated for 10 min at 37\u0026deg;C with the staining solution. Cells were subsequently washed with PBS and imaged in tyrode buffer at Zeiss LSM780 confocal microscope (Carl Zeiss, Jena). Images of single cells with the main morphology (M0 \u0026ndash; round, M1 \u0026ndash; stretched, M2a \u0026ndash; enlarged, M2c \u0026ndash; enlarged) were separated using the MotiQ ImageJ/Fiji plugin [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Quantification of shape and protrusions was performed in ImageJ/Fiji by manually drawing segmented lines and using the inbuild \u0026ldquo;measure\u0026rdquo; tool for measuring length and numbers. All values\u0026thinsp;\u0026lt;\u0026thinsp;1 \u0026micro;m were excluded from analysis.\u003c/p\u003e \u003cp\u003e \u003cb\u003eScratch Assay\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFor the scratch assay, 2x10\u003csup\u003e5\u003c/sup\u003e cells per 48 well were seeded and differentiated as described above. On day 5, medium was renewed and cells were stimulated using LP-211 (10 \u0026micro;\u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003em\u003c/span\u003e, in DMSO) or DMSO (10 %), respectively. The confluent cell layer was scratched in a vertical line using a p200 pipet tip. Recovery of wounded area was documented using Zeiss Axio Oberver.Z1/7, with Zen 3.2 Blue software (Carl Zeiss, Jena). For quantification of the recovered area, Fiji Wound healing size tool was modified [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Experiments with recovered areas less than the mean recovered area of M2c-like macrophages under control stimulation were excluded from analysis.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePhagocytosis Assay\u003c/b\u003e \u003c/p\u003e \u003cp\u003eA phagocytosis assay was performed as described in Sieve \u003cem\u003eet al.\u003c/em\u003e. [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] In short, THP-1 cells were differentiated and stimulated with LP-211 (10 \u0026micro;\u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003em\u003c/span\u003e) in DMSO or DMSO (100%) for control on day 3 after seeding. Cells were stimulated again after 24 h and subsequently incubated with 1x10\u003csup\u003e6\u003c/sup\u003e particles of Zymosan A (\u003cem\u003eS. cerevisiae\u003c/em\u003e BioParticles\u0026trade;-Texas Red\u0026trade; conjugate, ThermoFischer, Z2843). On day 5 after seeding, cells were incubated with Hoechst 33342 (1:2000 in culture medium, Invitrogen, H3570) for 15 min at 37\u0026deg;C and washed twice with prewarmed PBS. Fluorescence intensities were measured at Cytation5 image reader (BioTek) and quantified with Gene5 Image Prime 3.11 software (BioTek). Relative phagocytosis rate was calculated automatically by the software.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMultiplex assays of THP-1-derived macrophages\u003c/b\u003e \u003c/p\u003e \u003cp\u003eOn day 5 after seeding and differentiation, THP-1-derived macrophages were changed into plain medium and treated with DMSO or LP-211 (10 \u0026micro;\u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003em\u003c/span\u003e solved in DMSO) respectively. After 24 h, on day 6, the stimulation was renewed. On day 7, supernatant was collected, centrifuged at 1000 g for 15 min at 4\u0026deg;C and stored at -80\u0026deg;C until measurement. Supernatants were analyzed using Bio-Plex Pro Human Inflammation Panel 1, 27-Plex (BioRad, M500KCAF0Y) with the Bio-Plex 200 system (Bio-Rad). For normalization, cells were lysed as described above for Western Blot and Pierce BCA Protein Assay Kit (ThermoFisher scientific, 23225) was used to determine protein concentrations. Measured chemokine and cytokine concentrations were normalized to corresponding protein concentration of the sample. Analysis was performed on values within the standard range of each analysis. Analytes with one value were excluded from the analysis. Principle component analysis was performed using GraphPad Prism version 11. Analytes with values below the lowest value of the standard were include with the half minimal concentration of each standard [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cb\u003eStatistical analysis\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe presented data are shown as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Statistical analysis was performed using GraphPad Prism version 11. All data were subjected to outlier analysis and normal distribution tests. Applied statistical tests are indicated in the respective figure legends.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003e3.1. Differentiation of THP-1 monocytes in different subtypes\u003c/h2\u003e\n \u003cp\u003eFirst, we optimized the protocol for differentiation of THP-1 cells to defined subtypes of macrophages \u003cstrong\u003e(\u003c/strong\u003eFig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA\u003cstrong\u003e)\u003c/strong\u003e. To this end, THP-1 monocytes were treated with PMA, which results in cell adherence and generation of precursor M0-like macrophages. To polarize specific macrophage subtypes, cells were treated with LPS and interferon gamma (IFN-\u0026gamma;) to induce M1-like macrophages. Treatment of M0-like macrophages with interleukin 4 (IL-4) or IL-10 leads to either M2a- or M2c-like macrophages, respectively [\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e]. All generated macrophage subtypes displayed a distinct morphology [\u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e]: the majority of M0 cells were small and round; M1-like stretched and enlarged; M2a- and M2c-like enlarged (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB). To confirm successful differentiation, we verified expression of mRNA encoding particular macrophage markers (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC). Pro-inflammatory M1-like macrophages showed significantly increased expression of IL-1\u0026beta; as well as CD80. Differentiation into M2a-like macrophages was confirmed by increased expression of CCL22 and CD206, whereas M2c-like macrophages demonstrated higher expression of CD163. In addition, M2c-like macrophages also expressed CD206, which is a broad M2 macrophage marker.\u003c/p\u003e\n \u003cp\u003eTo further verify proper macrophage polarization, we analyzed expression of defined cell surface markers using flow cytometry analysis (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eD and \u003cstrong\u003eFig. S 1\u003c/strong\u003e). All subtypes of macrophages displayed a shift in median fluoresce intensity (MFI) for pan-macrophage marker CD11b (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eD). Furthermore, M1-like macrophages showed enhanced levels of the HLA-DR. In contrast, the percentage of CD86\u003csup\u003e+\u003c/sup\u003e cells were significantly increased in M2a-like macrophages, while M2c-like macrophages demonstrated significantly elevated levels of proto-oncogene tyrosine-protein kinase MER (MERTK) on the cell surface compared to M2a-like macrophages. Taken together, this combined analysis confirms that our optimized differentiation protocol leads to generation of robust subsets of macrophages.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003e3.2. Expression of 5-HT7R in different macrophage subtypes\u003c/h2\u003e\n \u003cp\u003eIt has been suggested that variable expression of defined 5-HT receptors can be responsible for different effects of serotonin on immune cells [\u003cspan class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e]. Therefore, we next analyzed the expression of the 5-HT7R as well as its down-stream effectors in different subsets of THP-1-derived macrophages. Results of quantitative real-time PCR (qRT-PCR) revealed a tendency for increased amount of mRNA encoding 5-HT7R and G\u0026alpha;12 protein in M1-like macrophages compared to monocytes and M2-like macrophages, while G\u0026alpha;s mRNA levels were similar in all groups (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA). Of note, expression of mRNA encoding the small GTPase Cdc42 was reduced upon differentiation from THP-1 monocytes to macrophages showing significantly lower levels in M2c-like macrophages (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA). Because the level of mRNA transcripts does not necessarily correlate with the protein expression level, we next analyzed protein expression of 5-HT7R and its signaling components by western blot. In line with transcript levels, expression of 5-HT7R was visible in all cell types (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB). Of note, expression of 5-HT7R and the G\u0026alpha;12 subunit was significantly increased in M1-like macrophages compared to M2-like macrophages and to monocytes and M2-like macrophages, respectively. Immunocytochemical analysis further confirmed expression of 5-HT7R within the intracellular compartments as well as at the plasma membrane in all THP-1-derived macrophages (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC). In these experiments, antibody specify was confirmed using a specific blocking peptide (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC, right panel). Thus, these combined data demonstrate that THP-1-derived macrophages represent a suitable model to study the functional implication of 5-HT7R-mediated signaling in regulation of macrophage functions.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003e3.3. Stimulation of 5-HT7R modulates the morphological profile of THP-1-derived macrophages\u003c/h2\u003e\n \u003cp\u003eCell morphology represents an essential feature for various macrophage functions including migration, phagocytosis, and cell-cell interactions. Therefore, we characterized basal cell morphology after macrophage differentiation using plasma membrane staining followed by live cell imaging \u003cstrong\u003e(\u003c/strong\u003eFig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e \u003cstrong\u003eAB)\u003c/strong\u003e. The majority of M0-like macrophages were rounded (6 %) with only 27% displaying an enlarged morphology. In contrast, the latter was a dominant cell form for both M1- and M2-like macrophages (57% for M1-like, 76% for M2a-like and 58% for M2c-like; Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB). One particular feature of M1-like macrophages, in comparison to the other investigated monocytic cell types, was a substantially increased amount of elongated and enlarged cells (32%; Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e\n \u003cp\u003ePharmacological activation of the 5-HT7R by the selective agonist LP-211 (48 h) results in a considerable decrease in number of elongated and enlarged cells in M1-like macrophages to 8% and 38%, respectively, while the fraction of rounded cells increased from 11\u0026ndash;54% (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC-D). Similar tendencies were also obtained in M2c-like macrophages, in which the percentage of rounded cells in relation to enlarged and elongated cells increased from 27\u0026ndash;56% (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC-D). In contrast, M0- and M2a-like macrophages show only minor morphological changes in response to 5-HT7R activation. Of note, LP-211 treatment did not influence the number or mean length of protrusions of any macrophage subtypes (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eE \u003cstrong\u003eand F\u003c/strong\u003e). However, detailed morphological analysis (\u003cstrong\u003eFig. S 2\u003c/strong\u003e) revealed that M0-like macrophages possess a reduced number of plasma membrane protrusions compared to other macrophage subsets, while the mean length of protrusions does not differ between all macrophage subtypes and after pharmacological treatment (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eE).\u003c/p\u003e\n \u003cp\u003eIt is important to mention that morphological changes obtained after 5-HT7R stimulation were not mediated by the agonist-mediated shift in the differentiation profiles, since mRNA expression levels of differentiation markers in all macrophage subtypes did not change after LP-211 treatment (\u003cstrong\u003eFig. S 3\u003c/strong\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003e3.4. 5-HT7R signaling selectively restrains migratory capability of pro-inflammatory acrophages\u003c/h2\u003e\n \u003cp\u003eTo assess the migratory ability of differentiated macrophage subtypes, we applied a wound healing scratch assay. Under basal conditions, M0- and M2c-like macrophages exhibited the highest recovery rate of the scratched area reaching 59.3% and 52.1% after 24 hours, respectively, followed by M2a-like macrophages (19.8% after 24 hours). In contrast, pro-inflammatory M1-like macrophages demonstrated the lowest migratory ability at all analyzed time points with only 3.3% recovery at the end point \u003cstrong\u003e(\u003c/strong\u003eFig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA-B\u003cstrong\u003e)\u003c/strong\u003e. Stimulation of 5-HT7R with LP-211 significantly slowed the migratory ability of M1-like macrophages to about 1.3% recovered area after 24 hours (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC-D). In contrast, the migratory properties of M0-like and M2-like macrophages remained unaffected upon pharmacological 5-HT7R activation (recovered area of 54.0%, 11.4%, and 59.3% for M0-like, M2a-like and M2c-like macrophages after 24 hours, respectively; Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC-D). Taken together, these results suggest that 5-HT7R-mediated signaling plays an important role in regulation of morphology and motility of pro-inflammatory macrophages.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003e3.5. Phagocytosis rate of pro-inflammatory macrophages is reduced upon 5-HT7R activation\u003c/h2\u003e\n \u003cp\u003ePhagocytosis represents the essential function of macrophages, enabling the clearance of pathogens, cell debris and maintenance of tissue integrity. To quantitatively validate the phagocytosis rate of THP1-deriverd macrophages, we exposed the cells to fluorescently labelled Zymosan A particles (derived from \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e) followed by real-time visualization of phagocytic events using fluorescence microscopy. As shown in Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA-B \u003cstrong\u003eand Fig. S 4\u003c/strong\u003e, M0-, M2a- and M2c-like macrophages exhibit relatively high phagocytosis rates (M0- 53.4%, M2a- 45.7%, M2c-like 60.3% of cells show engulfed particles after 24 hours), and pharmacological activation of the 5-HT7R by LP-211 for 48 hours has no effect on their phagocytic properties (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eC-D). In contrast, the number of M1-like pro-inflammatory macrophages, which were able to phagocytose Zymosan A, was significantly lower already under basal conditions (24.6%; Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA-B). Noteworthy, treatment of M1-like macrophages with LP-211 drastically reduced their phagocytosis rate by 4.5-fold, reaching 5.3% (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eC-D). This demonstrates that 5-HT7R-mediated signaling exclusively reduces phagocytic activity of pro-inflammatory M1-like macrophages.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n \u003ch2\u003e3.6. Stimulation of 5-HT7R modulates cytokine and chemokine secretion\u003c/h2\u003e\n \u003cp\u003eThe process of wound healing is highly dependent on the composition of cytokines and chemokines secreted by present immune cells. To assess the impact of 5-HT7R-mediated signaling on cytokine and chemokine levels, we analyzed the secreted amounts of multiple cytokines and chemokines in the supernatants of THP-1-derived macrophages under basal conditions and after pharmacological 5HT7R activation \u003cstrong\u003e(\u003c/strong\u003eFig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e\u003cstrong\u003e)\u003c/strong\u003e. Under basal conditions, pro-inflammatory M1-like macrophages showed increased amounts of secreted proteins compared to M0 and M2-like macrophages (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA). In particular, secretion of IL-1Ra, IL-8, CCL5, granulocyte-colony-stimulating factor (G-CSF) and TNF-\u0026alpha; was substantially higher in comparison to M0-, M2a-, and M2c-like macrophages. These pro-inflammatory cytokines and chemokines are of primary importance for leukocyte recruitment, their differentiation and the initiation of an inflammatory response [\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e39\u003c/span\u003e]. Interestingly, only M1-like macrophages secreted the interleukins-6 and \u0026minus;\u0026thinsp;13 within the detection range. The IL-13 possess predominantly anti-inflammatory properties, whereas IL-6 acts pro-inflammatory but has also been shown to facilitate the differentiation of M2-like macrophages[\u003cspan class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e\n \u003cp\u003eTreatment of the different subtypes of macrophages with the 5-HT7R agonist LP-211 results in heterogeneous effects (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eB): Secretion of IL-1Ra, IL-8, and G-CSF by pro-inflammatory M1-like macrophages was similar to basal conditions. Noteworthy, LP-211 treatment results in remarkable (up to 8-fold) increase in secretion of IL-8, G-CSF, macrophage inflammatory protein 1-\u0026alpha; (MIP-1a), and CCL5 by M0- and M2c-like macrophages in comparison to each control condition. Interestingly, pro-inflammatory M1-like macrophages respond to LP-211 treatment with reduced secretion of most of the analyzed proteins.\u003c/p\u003e\n \u003cp\u003eWe also performed a principal component analysis of the secreted proteins in the supernatant of three independent THP-1 macrophage differentiation experiment. To visualize clustering under basal conditions, two components representing 97% of the observed variation in the data set, were displayed. Principal component 1 (PC1) represents 93% whereas PC2 stand for 4% of the variation leading to a separate clustering of pro-inflammatory M1-like and anti-inflammatory M2a-like macrophages. M0 and M2c- like macrophages cluster together under basal conditions (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eC). Upon treatment with LP-211, M0-, M1-, and M2c-like macrophages respond with an individual shift in their secretion profiles (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eD).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe monocytic cell line THP-1 can be differentiated into macrophage subtypes with specific functions [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Depending on applied differentiation agents and culture protocols, the obtained macrophage properties can substantially differ [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Here we confirmed previous data that the polarization of THP-1-derived macrophages is reflected by specific mRNA and flow cytometry expression patterns as well as by typical cell morphology. Among others, IL-1β, CD80, and HLA-DR \u0026ndash; established markers for pro-inflammatory macrophages - were upregulated in M1-like macrophages [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan additionalcitationids=\"CR43\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. To distinguish between M2a- and M2c-like macrophages, we compared the expression of CD163, CD86, MERTK, and CD14, which displayed a clear differentiation between the macrophage subtypes. This data suggests that our differentiation protocol is suitable for detailed analysis of macrophage functions.\u003c/p\u003e \u003cp\u003eThe morphology of macrophages changes upon differentiation status, and is important for exhibition of their function [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Here, M1-like macrophages were mainly stretched and enlarged, whereas M2-like cells exhibited enlarged phenotypes compared to M0-like macrophages. These phenotypes were also observed in human monocyte-derived macrophages (hMDMs) [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Interestingly, mouse bone marrow derived macrophages (BMDM) possess different morphological phenotypes supporting existence of species-specific differences [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Stimulation of the 5-HT7R by LP-211 changed the morphology profile of cultured macrophages by increasing the population of round cells in M1- as well as M2a-like macrophages. Since specific morphological shapes of macrophages were shown to correlate with their activation status, [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] LP-211 treatment might therefore modulate the activation status of these cells.\u003c/p\u003e \u003cp\u003eMigration is a crucial feature of macrophages allowing them to move towards the site of injury. This complex process involves cell attachment and detachment as well as actin cytoskeleton rearrangement with podosome formation [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Pro-inflammatory macrophages show reduced migration ability compared to anti-inflammatory macrophages. This drawback was described in different macrophage models with diverse chemoattractants [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. For example, it was shown that mouse M1-like macrophages express high levels of integrin α\u003csub\u003eD\u003c/sub\u003eβ\u003csub\u003e2\u003c/sub\u003e (CD11d/CD18), increasing their attachment, which in turn inhibits migration [\u003cspan additionalcitationids=\"CR50 CR51\" citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. In addition, formation of podosomes as well as differences in actin cytoskeletal reorganization were observed between pro- and anti-inflammatory macrophages [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. In line with these observations, THP-1-derived M1-like macrophages in our study showed the weakest migration ability. More importantly, such weak ability for migration was further reduced upon 5HT7R activation. This effect was accompanied by profound morphological changes \u0026ndash; number of round cells was increased upon LP-211 treatment. This was in contrast to previous observation in dendritic cells, where 5-HT7R activation induced elongation of protrusions and enhanced migration, effects evoked by the G12 protein-mediated activation of small GTPases Rac1 and Cdc42 [15]. On the other hand, stimulation of 5-HT7R with LP-211 initiates Gs signaling leading to increased production of cAMP. This, in turn, could negatively modulate cell adhesion and migration via Epac-Rap1-mediated activation of integrins [\u003cspan additionalcitationids=\"CR54\" citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e].\u003c/p\u003e \u003cp\u003ePhagocytosis is a central function of macrophages. The \u003cem\u003ein vitro\u003c/em\u003e phagocytic efficacy of macrophages is influenced by the macrophages\u0026rsquo; origin (tissue, species, cell line), differentiation agents (GM-/M-CSF, PMA, LPS, IFN-γ, IL-4, Il-13, IL-10) and used bioparticles (yeast, bacteria, coated beads) [\u003cspan additionalcitationids=\"CR57\" citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. For example, application of differentiation reagents such as LPS and IFNγ has been shown to differentially affect phagocytosis: treatment with LPS enhanced, while treatment with IFN-γ reduced phagocytic capacity of macrophages[\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. It was also shown that M1-like macrophages have increased ability to phagocytose \u003cem\u003eS. aureus\u003c/em\u003e bioparticles compared to other THP-1-derived macrophage subtypes [56]. Also Tedesco and co-workers demonstrated that M0- and M1-like macrophages displayed high levels of dextran-FITC phagocytosis, while M2-like macrophages showed reduced engulfment [43]. On the other hand, recent study by Hicksman and co-workers demonstrated that M1-like hMDMs have significantly lower phagocytic capacity for Zymosan A bioparticles than M0- and M2 hMDMs [61]. Also in the present study, THP-1-derived pro-inflammatory M1-like macrophages showed very low phagocytic capacity of Zymosan A particles under basal conditions. More importantly, stimulation of 5-HT7R resulted in significantly reduced phagocytic ability particularly in this macrophage subtype. An essential step during phagocytosis is the remodeling of the actin cytoskeleton, which is concomitant with local changes of cAMP concentrations in close proximity to the cell membrane[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan additionalcitationids=\"CR63 CR64\" citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. Both elevated cAMP and Epac1 levels have been shown to reduce phagocytic capacity [\u003cspan additionalcitationids=\"CR67 CR68 CR69 CR70\" citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e]. Our combined data therefore suggests that 5-HT7R-mediated activation of Gαs-AC-cAMP-Epac1-Rap1 signaling module might be responsible for agonist-evoked reduction of migratory ability and decreased phagocytosis in M1-like macrophages. The M1-like macrophages may be particularly susceptible to LP-211 treatment, as they have higher levels of 5-HT7R.\u003c/p\u003e \u003cp\u003eSeveral studies have shown that 5-HT can modulate monocytes\u0026rsquo; and macrophages\u0026rsquo; secretory profile. Pretreatment with 5-HT leads to reduced mRNA levels of the cytokines and chemokines CXCL10, CXCL11, IDO, RSAD2, IL-27, IFIT2, and CXCL11 in hMDMs [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Furthermore, 5-HT7R activation upregulates the release of IL-1β, IL-6, IL-12p40 and IL-8/CXCL8 and downregulates LPS-induced TNF-α release in human primary monocytes [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Here, we found that under basal conditions pro-inflammatory M1-like macrophages secreted high levels of cytokines and chemokine compared to M0- and M2-like macrophages, which is in accordance to the results obtained in hMDMs [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e, \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]. Pharmacological activation of the 5HT7R with LP-211 boosts secretion of chemokines and cytokines particularly from M0- and M2-like macrophage subtypes. In particular M0-like macrophages showed increased secretion of pro-inflammatory cytokines IL-8, MIP-1α, G-CSF, and CCL5 (RANTES). These cytokines are important for neutrophil recruitment and migration of leukocytes, indicating a possible impact on early inflammatory responses [\u003cspan additionalcitationids=\"CR74 CR75\" citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e]. In contrast, in M1-like macrophages LP-211 treatment resulted in slightly reduced secretion when compared to control conditions.\u003c/p\u003e \u003cp\u003eTaken together, we demonstrated that stimulation of the 5HT7R selectively reduces pro-inflammatory M1-like macrophages\u0026rsquo; migratory and phagocytic properties. Furthermore, 5-HT7R activation shifts morphology profiles and alters M0-, M2a-, and M2c-like macrophages\u0026rsquo; secretion properties. Thus, 5-HT7R-mediated signaling might be a new access point for the modulation of macrophage responses in the treatment of inflammatory diseases.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003e5-HT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eserotonin\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003e5-HT7R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eserotonin receptor 7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eBMDM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003ebone marrow derived macrophages\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003ecAMP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003ecyclic adenosine monophosphate\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eCdc42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003ecell division control protein 42 homolog\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eDMSO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003edimethyl sulfoxide\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eG-CSF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003egranulocyte-colony-stimulating factor\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eHLA-DR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eleukocyte antigen\u0026ndash;DR isotype\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003ehMDMs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003ehuman monocyte-derived macrophages\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eIFN-\u0026gamma;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003einterferon gamma\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eIL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003einterleukin\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eLPS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003elipopolysaccharide\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eM-CSF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003emacrophage colony-stimulating factor\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eMERTK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eproto-oncogene tyrosine-protein kinase MER\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eMFI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003emedian fluoresce intensity\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eMIP-1a\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003emacrophage inflammatory protein 1-\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003ePC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eprincipal component\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003ePFA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eparaformaldehyde\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003ePKA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eprotein kinase A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003ePMA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003ephorbol-12-myristat-13-acetat\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003eqRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"NaN%\" valign=\"top\"\u003e\n \u003cp\u003equantitative real-time PCR\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Dalia Abdel Galil, Tania Bunke, Martin Leibrock, Kerstin Beushausen and Jana Keil for technical support, Dr. Andre Zeug for assistance in microscopy, and Dr. Margarethe Klein and Dr. Mania Ackermann for supporting flow cytometry analysis. This work is part of the PhD thesis of F. S. B..\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was funded by Deutsche Forschungsgemeinschaft (DFG, HI 842/12-1 to M.R.-H. and PO732 to E.P.)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors hereby consent to publication of the work in Cellular and Molecular Life Sciences.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eF.E.M., M. R.-H., D.H-K and E.P. created the initial concept, F.S.B., F.E.M., N.B., M.K., and C.S.F. performed experiments, F.S.B, F.E.M. created figures, F.S.B., and F.E.M. wrote the initial draft to which all authors contributed later. All authors reviewed and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable. \u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBarnes NM, Ahern GP, Becamel C et al (2021) International Union of Basic and Clinical Pharmacology. CX. Classification of Receptors for 5-hydroxytryptamine; Pharmacology and Function. Pharmacol Rev 73:310\u0026ndash;520. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1124/pr.118.015552\u003c/span\u003e\u003cspan address=\"10.1124/pr.118.015552\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQuintero-Villegas A, Vald\u0026eacute;s-Ferrer SI (2019) Role of 5-HT7 receptors in the immune system in health and disease. Mol Med 26:2. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s10020-019-0126-x\u003c/span\u003e\u003cspan address=\"10.1186/s10020-019-0126-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRieder M, Gauchel N, Bode C, Duerschmied D (2021) Serotonin: a platelet hormone modulating cardiovascular disease. J Thromb Thrombolysis 52:42\u0026ndash;47. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11239-020-02331-0\u003c/span\u003e\u003cspan address=\"10.1007/s11239-020-02331-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl-Merahbi R, L\u0026ouml;ffler M, Mayer A, Sumara G (2015) The roles of peripheral serotonin in metabolic homeostasis. FEBS Lett 589:1728\u0026ndash;1734. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.febslet.2015.05.054\u003c/span\u003e\u003cspan address=\"10.1016/j.febslet.2015.05.054\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharp T, Barnes NM (2020) Central 5-HT receptors and their function; present and future. Neuropharmacology 177:108155. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neuropharm.2020.108155\u003c/span\u003e\u003cspan address=\"10.1016/j.neuropharm.2020.108155\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBahr FS, Ricke-Hoch M, Ponimaskin E, M\u0026uuml;ller FE (2024) Serotonin Receptors in Myocardial Infarction: Friend or Foe? ACS Chem Neurosci. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acschemneuro.4c00031\u003c/span\u003e\u003cspan address=\"10.1021/acschemneuro.4c00031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen Y, Monsma FJ, Metcalf MA et al (1993) Molecular cloning and expression of a 5-hydroxytryptamine7 serotonin receptor subtype. J Biol Chem 268:18200\u0026ndash;18204. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0021-9258(17)46830-X\u003c/span\u003e\u003cspan address=\"10.1016/S0021-9258(17)46830-X\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBard JA, Zgombick J, Adham N et al (1993) Cloning of a novel human serotonin receptor (5-HT7) positively linked to adenylate cyclase. J Biol Chem 268:23422\u0026ndash;23426. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0021-9258(19)49479-9\u003c/span\u003e\u003cspan address=\"10.1016/S0021-9258(19)49479-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRuat M, Traiffort E, Leurs R et al (1993) Molecular cloning, characterization, and localization of a high-affinity serotonin receptor (5-HT7) activating cAMP formation. Proc Natl Acad Sci U S A 90:8547\u0026ndash;8551\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKvachnina E, Liu G, Dityatev A et al (2005) 5-HT7 Receptor Is Coupled to Gα Subunits of Heterotrimeric G12-Protein to Regulate Gene Transcription and Neuronal Morphology. J Neurosci 25:7821\u0026ndash;7830. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1523/JNEUROSCI.1790-05.2005\u003c/span\u003e\u003cspan address=\"10.1523/JNEUROSCI.1790-05.2005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKobe F, Guseva D, Jensen TP et al (2012) 5-HT7R/G12 Signaling Regulates Neuronal Morphology and Function in an Age-Dependent Manner. J Neurosci 32:2915\u0026ndash;2930. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1523/JNEUROSCI.2765-11.2012\u003c/span\u003e\u003cspan address=\"10.1523/JNEUROSCI.2765-11.2012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHerr N, Bode C, Duerschmied D (2017) The Effects of Serotonin in Immune Cells. Front Cardiovasc Med 4\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLe\u0026oacute;n-Ponte M, Ahern GP, O\u0026rsquo;Connell PJ (2007) Serotonin provides an accessory signal to enhance T-cell activation by signaling through the 5-HT7 receptor. Blood 109:3139\u0026ndash;3146. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1182/blood-2006-10-052787\u003c/span\u003e\u003cspan address=\"10.1182/blood-2006-10-052787\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIdzko M, Panther E, Stratz C et al (2004) The Serotoninergic Receptors of Human Dendritic Cells: Identification and Coupling to Cytokine Release 1. J Immunol 172:6011\u0026ndash;6019. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4049/jimmunol.172.10.6011\u003c/span\u003e\u003cspan address=\"10.4049/jimmunol.172.10.6011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHolst K, Guseva D, Schindler S et al (2015) The serotonin receptor 5-HT₇R regulates the morphology and migratory properties of dendritic cells. J Cell Sci 128:2866\u0026ndash;2880. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/jcs.167999\u003c/span\u003e\u003cspan address=\"10.1242/jcs.167999\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKatoh N, Soga F, Nara T et al (2006) Effect of serotonin on the differentiation of human monocytes into dendritic cells. Clin Exp Immunol 146:354\u0026ndash;361. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1365-2249.2006.03197.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-2249.2006.03197.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD\u0026uuml;rk T, Panther E, M\u0026uuml;ller T et al (2005) 5-Hydroxytryptamine modulates cytokine and chemokine production in LPS-primed human monocytes via stimulation of different 5-HTR subtypes. Int Immunol 17:599\u0026ndash;606. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/intimm/dxh242\u003c/span\u003e\u003cspan address=\"10.1093/intimm/dxh242\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Las Casas-Engel M, Corb\u0026iacute; AL (2014) Serotonin modulation of macrophage polarization: inflammation and beyond. Adv Exp Med Biol 824:89\u0026ndash;115. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-319-07320-0_9\u003c/span\u003e\u003cspan address=\"10.1007/978-3-319-07320-0_9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDom\u0026iacute;nguez-Soto \u0026Aacute;, Usategui A, de Casas-Engel M L, et al (2017) Serotonin drives the acquisition of a profibrotic and anti-inflammatory gene profile through the 5-HT7R-PKA signaling axis. Sci Rep 7:14761. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-017-15348-y\u003c/span\u003e\u003cspan address=\"10.1038/s41598-017-15348-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurray PJ (2017) Macrophage Polarization. Annu Rev Physiol 79:541\u0026ndash;566. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev-physiol-022516-034339\u003c/span\u003e\u003cspan address=\"10.1146/annurev-physiol-022516-034339\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMosser DM, Edwards JP (2008) Exploring the full spectrum of macrophage activation. Nat Rev Immunol 8:958\u0026ndash;969. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nri2448\u003c/span\u003e\u003cspan address=\"10.1038/nri2448\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartinez FO, Gordon S (2014) The M1 and M2 paradigm of macrophage activation: time for reassessment. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.12703/P6-13\u003c/span\u003e\u003cspan address=\"10.12703/P6-13\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. F1000Prime Rep 6:\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStrizova Z, Benesova I, Bartolini R et al (2023) M1/M2 macrophages and their overlaps \u0026ndash; myth or reality? Clin Sci 137:1067\u0026ndash;1093. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1042/CS20220531\u003c/span\u003e\u003cspan address=\"10.1042/CS20220531\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChanput W, Mes JJ, Wichers HJ (2014) THP-1 cell line: An in vitro cell model for immune modulation approach. Int Immunopharmacol 23:37\u0026ndash;45. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.intimp.2014.08.002\u003c/span\u003e\u003cspan address=\"10.1016/j.intimp.2014.08.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsuchiya S, Yamabe M, Yamaguchi Y et al (1980) Establishment and characterization of a human acute monocytic leukemia cell line (THP-1). Int J Cancer 26:171\u0026ndash;176. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/ijc.2910260208\u003c/span\u003e\u003cspan address=\"10.1002/ijc.2910260208\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNascimento CR, Rodrigues Fernandes NA, Gonzalez Maldonado LA, Rossa Junior C (2022) Comparison of monocytic cell lines U937 and THP-1 as macrophage models for in vitro studies. Biochem Biophys Rep 32:101383. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrep.2022.101383\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrep.2022.101383\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaxter EW, Graham AE, Re NA et al (2020) Standardized protocols for differentiation of THP-1 cells to macrophages with distinct M(IFNγ\u0026thinsp;+\u0026thinsp;LPS), M(IL-4) and M(IL-10) phenotypes. J Immunol Methods 478:112721. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jim.2019.112721\u003c/span\u003e\u003cspan address=\"10.1016/j.jim.2019.112721\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDaigneault M, Preston JA, Marriott HM et al (2010) The Identification of Markers of Macrophage Differentiation in PMA-Stimulated THP-1 Cells and Monocyte-Derived Macrophages. PLoS ONE 5:e8668. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0008668\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0008668\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSurdziel E, Clay I, Nigsch F et al (2017) Multidimensional pooled shRNA screens in human THP-1 cells identify candidate modulators of macrophage polarization. PLoS ONE 12:e0183679. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0183679\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0183679\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLund ME, To J, O\u0026rsquo;Brien BA, Donnelly S (2016) The choice of phorbol 12-myristate 13-acetate differentiation protocol influences the response of THP-1 macrophages to a pro-inflammatory stimulus. J Immunol Methods 430:64\u0026ndash;70. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jim.2016.01.012\u003c/span\u003e\u003cspan address=\"10.1016/j.jim.2016.01.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRasband WS (1997) ImageJ\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHansen JN, Br\u0026uuml;ckner M, Pietrowski MJ et al (2022) MotiQ: an open-source toolbox to quantify the cell motility and morphology of microglia. Mol Biol Cell 33:ar99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1091/mbc.E21-11-0585\u003c/span\u003e\u003cspan address=\"10.1091/mbc.E21-11-0585\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuarez-Arnedo A, Figueroa FT, Clavijo C et al (2020) An image J plugin for the high throughput image analysis of in vitro scratch wound healing assays. PLoS ONE 15:e0232565. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0232565\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0232565\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSieve I, Ricke-Hoch M, Kasten M et al (2018) A positive feedback loop between IL-1β, LPS and NEU1 may promote atherosclerosis by enhancing a pro-inflammatory state in monocytes and macrophages. Vascul Pharmacol 103\u0026ndash;105:16\u0026ndash;28. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.vph.2018.01.005\u003c/span\u003e\u003cspan address=\"10.1016/j.vph.2018.01.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeal SL (2001) Ways to Fit a PK Model with Some Data Below the Quantification Limit. J Pharmacokinet Pharmacodyn 28:481\u0026ndash;504. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1023/A:1012299115260\u003c/span\u003e\u003cspan address=\"10.1023/A:1012299115260\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSridharan R, Cavanagh B, Cameron AR et al (2019) Material stiffness influences the polarization state, function and migration mode of macrophages. Acta Biomater 89:47\u0026ndash;59. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.actbio.2019.02.048\u003c/span\u003e\u003cspan address=\"10.1016/j.actbio.2019.02.048\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarques RE, Guabiraba R, Russo RC, Teixeira MM (2013) Targeting CCL5 in inflammation. Expert Opin Ther Targets 17:1439\u0026ndash;1460. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1517/14728222.2013.837886\u003c/span\u003e\u003cspan address=\"10.1517/14728222.2013.837886\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCambier S, Gouwy M, Proost P (2023) The chemokines CXCL8 and CXCL12: molecular and functional properties, role in disease and efforts towards pharmacological intervention. Cell Mol Immunol 20:217\u0026ndash;251. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41423-023-00974-6\u003c/span\u003e\u003cspan address=\"10.1038/s41423-023-00974-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartin KR, Wong HL, Witko-Sarsat V, Wicks IP (2021) G-CSF \u0026ndash; A double edge sword in neutrophil mediated immunity. Semin Immunol 54:101516. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.smim.2021.101516\u003c/span\u003e\u003cspan address=\"10.1016/j.smim.2021.101516\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFernando MR, Reyes JL, Iannuzzi J et al (2014) The Pro-Inflammatory Cytokine, Interleukin-6, Enhances the Polarization of Alternatively Activated Macrophages. PLoS ONE 9:e94188. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0094188\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0094188\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFuster JJ, Walsh K (2014) The Good, the Bad, and the Ugly of interleukin-6 signaling. EMBO J 33:1425\u0026ndash;1427. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.15252/embj.201488856\u003c/span\u003e\u003cspan address=\"10.15252/embj.201488856\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGenin M, Clement F, Fattaccioli A et al (2015) M1 and M2 macrophages derived from THP-1 cells differentially modulate the response of cancer cells to etoposide. BMC Cancer 15:577. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12885-015-1546-9\u003c/span\u003e\u003cspan address=\"10.1186/s12885-015-1546-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTedesco S, De Majo F, Kim J et al (2018) Convenience versus Biological Significance: Are PMA-Differentiated THP-1 Cells a Reliable Substitute for Blood-Derived Macrophages When Studying in Vitro Polarization? Front Pharmacol 9:71. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphar.2018.00071\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2018.00071\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSapudom J, Karaman S, Mohamed WKE et al (2021) 3D in vitro M2 macrophage model to mimic modulation of tissue repair. NPJ Regen Med 6:83. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41536-021-00193-5\u003c/span\u003e\u003cspan address=\"10.1038/s41536-021-00193-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVogel DY, Heijnen PD, Breur M et al (2014) Macrophages migrate in an activation-dependent manner to chemokines involved in neuroinflammation. J Neuroinflammation 11:23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1742-2094-11-23\u003c/span\u003e\u003cspan address=\"10.1186/1742-2094-11-23\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcWhorter FY, Wang T, Nguyen P et al (2013) Modulation of macrophage phenotype by cell shape. Proceedings of the National Academy of Sciences 110:17253\u0026ndash;17258. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.1308887110\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1308887110\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnderson JA, Lamichhane S, Mani G (2016) Macrophage responses to 316L stainless steel and cobalt chromium alloys with different surface topographies. J Biomedical Mater Res Part A 104:2658\u0026ndash;2672. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jbm.a.35808\u003c/span\u003e\u003cspan address=\"10.1002/jbm.a.35808\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRougerie P, Miskolci V, Cox D (2013) Generation of membrane structures during phagocytosis and chemotaxis of macrophages: role and regulation of the actin cytoskeleton. Immunol Rev 256:222\u0026ndash;239. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/imr.12118\u003c/span\u003e\u003cspan address=\"10.1111/imr.12118\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui K, Ardell CL, Podolnikova NP, Yakubenko VP (2018) Distinct Migratory Properties of M1, M2, and Resident Macrophages Are Regulated by αDβ2 and αMβ2 Integrin-Mediated Adhesion. Front Immunol 9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYakubenko VP, Yadav SP, Ugarova TP (2006) Integrin αDβ2, an adhesion receptor up-regulated on macrophage foam cells, exhibits multiligand-binding properties. Blood 107:1643\u0026ndash;1650. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1182/blood-2005-06-2509\u003c/span\u003e\u003cspan address=\"10.1182/blood-2005-06-2509\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYakubenko VP, Belevych N, Mishchuk D et al (2008) The role of integrin αDβ2 (CD11d/CD18) in monocyte/macrophage migration. Exp Cell Res 314:2569\u0026ndash;2578. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.yexcr.2008.05.016\u003c/span\u003e\u003cspan address=\"10.1016/j.yexcr.2008.05.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAziz MH, Cui K, Das M et al (2017) The Upregulation of Integrin αDβ2 (CD11d/CD18) on Inflammatory Macrophages Promotes Macrophage Retention in Vascular Lesions and Development of Atherosclerosis. J Immunol 198:4855\u0026ndash;4867. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4049/jimmunol.1602175\u003c/span\u003e\u003cspan address=\"10.4049/jimmunol.1602175\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLorenowicz MJ, van Gils J, de Boer M et al (2006) Epac1-Rap1 signaling regulates monocyte adhesion and chemotaxis. J Leukoc Biol 80:1542\u0026ndash;1552. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1189/jlb.0506357\u003c/span\u003e\u003cspan address=\"10.1189/jlb.0506357\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Rooij J, Zwartkruis FJ, Verheijen MH et al (1998) Epac is a Rap1 guanine-nucleotide-exchange factor directly activated by cyclic AMP. Nature 396:474\u0026ndash;477. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/24884\u003c/span\u003e\u003cspan address=\"10.1038/24884\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim C, Ye F, Ginsberg MH (2011) Regulation of Integrin Activation. Annu Rev Cell Dev Biol 27:321\u0026ndash;345. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev-cellbio-100109-104104\u003c/span\u003e\u003cspan address=\"10.1146/annurev-cellbio-100109-104104\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShiratori H, Feinweber C, Luckhardt S et al (2017) THP-1 and human peripheral blood mononuclear cell-derived macrophages differ in their capacity to polarize in vitro. Mol Immunol 88:58\u0026ndash;68. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.molimm.2017.05.027\u003c/span\u003e\u003cspan address=\"10.1016/j.molimm.2017.05.027\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosales C, Uribe-Querol E (2017) Phagocytosis: A Fundamental Process in Immunity. Biomed Res Int 2017:e9042851. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2017/9042851\u003c/span\u003e\u003cspan address=\"10.1155/2017/9042851\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUribe-Querol E, Rosales C (2020) Phagocytosis: Our Current Understanding of a Universal Biological Process. Front Immunol 11\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhate A, Sharma S, Agrawal P, Sahu A (2021) Differential expression of complement receptors CR1/2 and CR4 by murine M1 and M2 macrophages. Mol Immunol 137:75\u0026ndash;83. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.molimm.2021.06.003\u003c/span\u003e\u003cspan address=\"10.1016/j.molimm.2021.06.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z, Zhou S, Sun C et al (2014) Interferon-γ Inhibits Nonopsonized Phagocytosis of Macrophages via an mTORC1-c/EBPβ Pathway. J Innate Immun 7:165\u0026ndash;176. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1159/000366421\u003c/span\u003e\u003cspan address=\"10.1159/000366421\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHickman E, Smyth T, Cobos-Uribe C et al (2023) Expanded characterization of in vitro polarized M0, M1, and M2 human monocyte-derived macrophages: Bioenergetic and secreted mediator profiles. PLoS ONE 18:e0279037. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0279037\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0279037\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBirmelin M, Decker K (1984) Synthesis of prostanoids and cyclic nucleotides by phagocytosing rat Kupffer cells. Eur J Biochem 142:219\u0026ndash;225. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1432-1033.1984.tb08274.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1432-1033.1984.tb08274.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eF\u0026uuml;\u0026ouml;p T, F\u0026oacute;ris G, Le\u0026ouml;vey A (1984) Age-related changes in cAMP and cGMP levels during phagocytosis in human polymorphonuclear leukocytes. Mech Ageing Dev 27:233\u0026ndash;237. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0047-6374(84)90048-4\u003c/span\u003e\u003cspan address=\"10.1016/0047-6374(84)90048-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBallinger MN, Welliver T, Straight S et al (2010) Transient Increase in Cyclic AMP Localized to Macrophage Phagosomes. PLoS ONE 5:e13962. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0013962\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0013962\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamanova J, Kofronova O, Masin J et al (2008) Adenylate Cyclase Toxin Subverts Phagocyte Function by RhoA Inhibition and Unproductive Ruffling1. J Immunol 181:5587\u0026ndash;5597. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4049/jimmunol.181.8.5587\u003c/span\u003e\u003cspan address=\"10.4049/jimmunol.181.8.5587\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePryzwansky KB, Kidao S, Merricks EP (1998) Compartmentalization of PDE-4 and cAMP-dependent protein kinase in neutrophils and macrophages during phagocytosis. Cell Biochem Biophys 28:251\u0026ndash;275. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/BF02737813\u003c/span\u003e\u003cspan address=\"10.1007/BF02737813\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKalamidas SA, Kuehnel MP, Peyron P et al (2006) cAMP synthesis and degradation by phagosomes regulate actin assembly and fusion events: consequences for mycobacteria. J Cell Sci 119:3686\u0026ndash;3694. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/jcs.03091\u003c/span\u003e\u003cspan address=\"10.1242/jcs.03091\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAronoff DM, Canetti C, Serezani CH et al (2005) Cutting Edge: Macrophage Inhibition by Cyclic AMP (cAMP): Differential Roles of Protein Kinase A and Exchange Protein Directly Activated by cAMP-11. J Immunol 174:595\u0026ndash;599. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4049/jimmunol.174.2.595\u003c/span\u003e\u003cspan address=\"10.4049/jimmunol.174.2.595\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMakranz C, Cohen G, Reichert F et al (2006) cAMP cascade (PKA, Epac, adenylyl cyclase, Gi, and phosphodiesterases) regulates myelin phagocytosis mediated by complement receptor-3 and scavenger receptor-AI/II in microglia and macrophages. Glia 53:441\u0026ndash;448. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/glia.20303\u003c/span\u003e\u003cspan address=\"10.1002/glia.20303\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBryn T, Mahic M, Enserink JM et al (2006) The Cyclic AMP-Epac1-Rap1 Pathway Is Dissociated from Regulation of Effector Functions in Monocytes but Acquires Immunoregulatory Function in Mature Macrophages1. J Immunol 176:7361\u0026ndash;7370. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4049/jimmunol.176.12.7361\u003c/span\u003e\u003cspan address=\"10.4049/jimmunol.176.12.7361\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYdrenius L, Majeed M, Rasmusson BJ et al (2000) Activation of cAMP-dependent protein kinase is necessary for actin rearrangements in human neutrophils during phagocytosis. J Leukoc Biol 67:520\u0026ndash;528. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jlb.67.4.520\u003c/span\u003e\u003cspan address=\"10.1002/jlb.67.4.520\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTarique AA, Logan J, Thomas E et al (2015) Phenotypic, Functional, and Plasticity Features of Classical and Alternatively Activated Human Macrophages. Am J Respir Cell Mol Biol 53:676\u0026ndash;688. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1165/rcmb.2015-0012OC\u003c/span\u003e\u003cspan address=\"10.1165/rcmb.2015-0012OC\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsushima K, Yang D, Oppenheim JJ (2022) Interleukin-8: An evolving chemokine. Cytokine 153:155828. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cyto.2022.155828\u003c/span\u003e\u003cspan address=\"10.1016/j.cyto.2022.155828\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhavsar I, Miller CS, Al-Sabbagh M (2015) Macrophage Inflammatory Protein-1 Alpha (MIP-1 alpha)/CCL3: As a Biomarker. Gen Methods Biomark Res their Appl 223\u0026ndash;249. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-94-007-7696-8_27\u003c/span\u003e\u003cspan address=\"10.1007/978-94-007-7696-8_27\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoberts AW (2005) G-CSF: A key regulator of neutrophil production, but that\u0026rsquo;s not all! Growth Factors. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/08977190500055836\u003c/span\u003e\u003cspan address=\"10.1080/08977190500055836\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAppay V, Rowland-Jones SL (2001) RANTES: a versatile and controversial chemokine. Trends Immunol 22:83\u0026ndash;87. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S1471-4906(00)01812-3\u003c/span\u003e\u003cspan address=\"10.1016/S1471-4906(00)01812-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"cellular-and-molecular-life-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"life","sideBox":"Learn more about [Cellular and Molecular Life Sciences](https://link.springer.com/journal/18)","snPcode":"18","submissionUrl":"https://www.editorialmanager.com/life/default2.aspx","title":"Cellular and Molecular Life Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Open","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Macrophages, THP-1 cells, serotonin, 5-HT7 receptor, phagocytosis","lastPublishedDoi":"10.21203/rs.3.rs-4582151/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4582151/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe hormone and neurotransmitter serotonin regulates numerous physiological functions within the central nervous system and in the periphery upon binding to specific receptors. In the periphery, the serotonin receptor 7 (5-HT7R) is expressed on different immune cells including monocytes and macrophages. To investigate the impact of 5-HT7R-mediated signaling on macrophage properties, we used human THP-1 cells and differentiated them into pro-inflammatory M1- and anti-inflammatory M2-like macrophages. Pharmacological 5-HT7R activation with the specific agonist LP-211 especially modulates morphology of M1-like macrophages by increasing the number of rounded cells. Furthermore, 5-HT7R stimulation results in significantly reduced phagocytic and migratory ability of M1-like macrophages. Noteworthy, LP-211 treatment leads to changes in secretory properties of all macrophages types with the highest effects obtained for M0- and M2c-like macrophages. These results indicate that 5-HT7R activation selectively impairs basic functions of pro-inflammatory macrophages and might thus be a new access point for the modulation of macrophage responses in the future treatment of inflammatory diseases.\u003c/p\u003e","manuscriptTitle":"Serotonin receptor 5-HT7 modulates inflammatory-associated functions of macrophages","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-19 14:02:16","doi":"10.21203/rs.3.rs-4582151/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major Revision","date":"2024-07-19T15:41:38+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2024-06-28T00:52:42+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-06-28T00:19:08+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-15T07:44:50+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cellular and Molecular Life Sciences","date":"2024-06-14T08:44:43+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"cellular-and-molecular-life-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"life","sideBox":"Learn more about [Cellular and Molecular Life Sciences](https://link.springer.com/journal/18)","snPcode":"18","submissionUrl":"https://www.editorialmanager.com/life/default2.aspx","title":"Cellular and Molecular Life Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Open","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"23c9172e-1430-4d94-931d-75d157692442","owner":[],"postedDate":"July 19th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-01-27T16:05:38+00:00","versionOfRecord":{"articleIdentity":"rs-4582151","link":"https://doi.org/10.1007/s00018-024-05570-z","journal":{"identity":"cellular-and-molecular-life-sciences","isVorOnly":false,"title":"Cellular and Molecular Life Sciences"},"publishedOn":"2025-01-21 15:57:15","publishedOnDateReadable":"January 21st, 2025"},"versionCreatedAt":"2024-07-19 14:02:16","video":"","vorDoi":"10.1007/s00018-024-05570-z","vorDoiUrl":"https://doi.org/10.1007/s00018-024-05570-z","workflowStages":[]},"version":"v1","identity":"rs-4582151","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4582151","identity":"rs-4582151","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.