Curcumin improves spinal cord injury by regulating the Treg/Th17 balance via modulation of the gut microbiota

Curcumin improves spinal cord injury by regulating the Treg/Th17 balance via modulation of the gut microbiota | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Curcumin improves spinal cord injury by regulating the Treg/Th17 balance via modulation of the gut microbiota Chunping Tian, Jiajun Wu, Linfeng Xiao, Qingyan Wang, Jiani Du, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7518068/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Spinal cord injury (SCI) is a severe traumatic disorder of the central nervous system, for which effective therapeutic strategies remain limited. The balance between regulatory T (Treg) cells and T helper 17 (Th17) cells plays a crucial role in immune regulation and the inflammatory response following SCI. As a vital component of the host microecosystem, the gut microbiota is closely associated with immune regulation. Our previous experimental findings demonstrated that curcumin alters the composition and richness of the gut microbiota. However, the relationship between the curcumin-modulated gut microbiota, Treg/Th17 cell balance, and SCI has not been clearly elucidated. This study aims to investigate the role and underlying mechanisms of the gut microbiota, following curcumin intervention, in improving SCI outcomes. Our results show that the gut microbiota modified by curcumin effectively regulates the Treg/Th17 cell balance, promoting the proliferation of Treg cells and suppressing the activation of Th17 cells. It reduces the release of pro-inflammatory cytokines interleukin-17A (IL-17A) and interleukin-6 (IL-6), as well as the expression of the transcription factor retinoic acid-related orphan receptor γt (RORγt), while increasing the secretion of anti-inflammatory cytokines interleukin-10 (IL-10) and transforming growth factor-β1 (TGF-β1), along with the transcription factor forkhead box P3 (FOXP3). These findings suggest that the gut microbiota altered by curcumin alleviates inflammation and promotes spinal cord repair by modulating the Treg/Th17 cell balance. This study provides a novel potential strategy and theoretical foundation for the treatment of SCI. curcumin gut microbiota short-chain fatty acids Treg/Th17 spinal cord injury Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction Spinal cord injury (SCI) is a severe traumatic disorder of the central nervous system, typically caused by external mechanical forces damaging the spinal cord or surrounding structures. It can result in sensory, motor, and autonomic dysfunctions, significantly impairing patients’ quality of life and daily functioning [ 1 , 2 ] , SCI is generally categorized into primary and secondary injury phases. The secondary phase involves processes such as lipid peroxidation, glial cell activation, neuroinflammation, and oxidative stress. Among these, neuroinflammation is considered a key factor contributing to the exacerbation of secondary spinal cord damage [ 3 – 5 ] .Therefore, suppressing neuroinflammation following SCI is crucial for improving therapeutic outcomes. T helper 17 (Th17) cells are a subset of CD4⁺ T cells. Interleukin-6 (IL-6) promotes the proliferation and differentiation of Th17 cells by activating STAT3-mediated transcription of retinoic acid-related orphan receptor γt (RORγt). This leads to increased production of pro-inflammatory cytokines such as interleukin-17A (IL-17A), which drive inflammatory responses and contribute to the pathogenesis of autoimmune diseases [ 6 , 7 ] , In contrast, regulatory T (Treg) cells represent another subset of CD4⁺ T cells. Transforming growth factor-β (TGF-β) induces the transcription of forkhead box P3 (FOXP3), thereby promoting the proliferation and differentiation of Treg cells and the secretion of anti-inflammatory cytokines such as interleukin-10 (IL-10). These cells play an essential role in immune suppression [ 8 , 9 ] . Under physiological conditions, Treg and Th17 cells maintain a dynamic balance that is critical for immune homeostasis [ 10 ] . However, under pathological conditions such as spinal cord injury, this balance is disrupted, with hyperactivation of Th17 cells and a relative deficiency of Treg cell function. This imbalance leads to excessive inflammatory responses and exacerbates SCI [ 11 , 12 ] .Therefore, restoring the Treg/Th17 balance represents a promising therapeutic target for SCI. The gut microbiota, often referred to as a “microbial organ,” has recently been found to be closely linked to both the immune and nervous systems of the host [ 13 , 14 ] . Dysbiosis of the gut microbiota not only disrupts local intestinal immunity but also affects the immune and inflammatory status of the central nervous system via the gut–brain axis [ 15 , 16 ] . Studies have shown that the gut microbiota interacts with the host through its metabolic products and derivatives, including aryl hydrocarbon receptor (AhR) agonists, short-chain fatty acids (SCFAs), and lipopolysaccharides (LPS), all of which play critical roles in modulating central nervous system inflammation [ 17 – 19 ] . SCFAs are among the most important metabolic products of the gut microbiota. In healthy individuals, the gut produces approximately 50–100 mmol of SCFAs per day. These SCFAs serve not only as the preferred energy source for intestinal epithelial cells and key regulators of their proliferation and differentiation, but also exert multiple beneficial effects, including antioxidant, anti-inflammatory, and antitumor activities, as well as regulation of gene expression, host intestinal immunity, and overall gut function [ 19 – 21 ] . Previous studies have reported that SCFAs bind to G protein-coupled receptors (GPCRs) on the cell surface and modulate host immune responses by regulating the Treg/Th17 balance [ 23 , 24 ] 。 Curcumin is a yellow-orange natural polyphenolic compound extracted from the rhizomes of plants in the Zingiberaceae family. It exhibits anti-inflammatory, antioxidant, antitumor, and anti-apoptotic properties [ 25 , 26 ] . Studies have shown that curcumin exerts significant neuroprotective effects in central nervous system disorders such as SCI [ 27 ] 、Alzheimer’s disease [ 28 ] and Parkinson’s disease [ 29 ] . Furthermore, our previous research demonstrated that curcumin not only promotes spinal cord repair but also alters the composition and abundance of the gut microbiota, leading to increased concentrations of SCFAs [ 30 , 31 ] . Based on these findings, we hypothesize that curcumin may regulate SCFA levels via modulation of the gut microbiota, thereby influencing the Treg/Th17 balance and ultimately contributing to SCI recovery. The proposed hypothesis is illustrated in (Fig. 1 ). To test this hypothesis, we performed fecal microbiota transplantation (FMT) and assessed the expression of transcription factors and inflammatory cytokines associated with Treg and Th17 cells in the spinal cord using Real-Time Quantitative PCR (RT-qPCR), Enzyme-Linked Immunosorbent Assay (ELISA), and Western blotting. This study aims to elucidate the specific mechanisms by which curcumin-modulated gut microbiota contributes to spinal cord repair. The findings may provide a theoretical foundation and experimental support for the clinical application of curcumin in treating SCI. 2. Result 2.1 Effects of curcumin-modulated gut microbiota on motor function and tissue morphology in rats with spinal cord injury To investigate the effects of curcumin-modulated gut microbiota on motor function and tissue morphology in rats with SCI, we conducted a FMT experiment. Suspensions of fecal matter from curcumin-treated or conventionally raised donor rats were orally administered to SCI recipient rats. Hindlimb motor recovery was assessed using the Basso–Beattie–Bresnahan (BBB) locomotor rating scale. BBB scores dropped to zero in all SCI groups immediately after injury. Over time, scores gradually increased in the SCI, SCI + FMT, and SCI + FMT(CUR) groups. Notably, the SCI + FMT(CUR) group exhibited significantly higher scores compared to the SCI and SCI + FMT groups. However, all SCI groups had lower scores than the Sham group (Fig. 2 A). Gait analysis revealed a marked loss of fore- and hindlimb coordination after SCI. Compared to the SCI group, rats in the SCI + FMT and SCI + FMT(CUR) groups exhibited longer hindlimb stride length and shorter drag distance. These findings suggest improved gait recovery and motor coordination in these groups (Figs. 2 B–C). Hematoxylin and eosin (HE) staining at 4 weeks post-injury showed smaller lesion areas and fewer cavities in the SCI + FMT(CUR) group compared to the SCI and SCI + FMT groups. (Figs. 2 D). These findings suggest that curcumin-modulated gut microbiota promotes motor function recovery and improves tissue morphology in rats with SCI. 2.2 Effects of curcumin-modulated gut microbiota on Treg and Th17 cells To investigate the effects of curcumin-modulated gut microbiota on Treg and Th17 cells, we collected tissue samples from SCI rats after FMT for analysis. We examined the expression of transcription factors associated with Treg and Th17 cells—FOXP3 and RORγt—as well as inflammatory cytokines including IL-10, TGF-β1, IL-17A, and IL-6 [ 32 ] , at both RNA and protein levels. At the RNA level, expression of FOXP3, IL-10, and TGF-β1 was significantly upregulated in the SCI + FMT(CUR) group compared with the SCI and SCI + FMT groups. In contrast, RORγt, IL-17A, and IL-6 expression was significantly downregulated (Figs. 3 A–F). At the protein level, both ELISA and Western blotting were used to quantify expression. ELISA results showed a significant increase in IL-10 expression in the SCI + FMT(CUR) group compared to the SCI and SCI + FMT groups, accompanied by a marked decrease in IL-17A and IL-6 levels (Figs. 3 G–J). Western blot analysis revealed a significant reduction in RORγt expression in the SCI + FMT(CUR) group compared with the other SCI groups, along with elevated expression of FOXP3 and TGF-β1 (Figs. 4 A–D). These findings suggest that curcumin-modulated gut microbiota promotes the differentiation of Treg cells and suppresses the activation of Th17 cells in rats with SCI, 2.3 Curcumin-modulated gut microbiota promotes spinal cord injury recovery by regulating the Treg/Th17 balance It has been reported that SCFAs regulate immune cell differentiation via GPCRs [ 33 ] .In our previous experiments, curcumin was shown to increase SCFA concentrations [ 30 ] . To further verify whether curcumin promotes SCI recovery by modulating SCFA levels via the gut microbiota and thereby regulating the Treg/Th17 balance, we co-administered a G protein-coupled receptor (GPCR) inhibitor during FMT [ 34 , 35 ] . Western blot and ELISA analyses revealed that the addition of the GPCR inhibitor reversed the expression patterns of Treg- and Th17-associated cytokines and transcription factors. Specifically, protein levels of RORγt, IL-17A, and IL-6 were increased, while FOXP3, TGF-β1, and IL-10 expression was decreased (Figs. 4 E–G). These results suggest that curcumin promotes spinal cord injury recovery by regulating the Treg/Th17 balance through SCFA-mediated signaling pathways. 3. Conclusion and discussion In this study, we systematically investigated the therapeutic effects and underlying mechanisms of curcumin in SCI using in vivo experiments. The results demonstrated that curcumin significantly modulates the gut microbiota in SCI rats, increasing microbial diversity and richness, as well as elevating the levels of SCFAs. FMT experiments further revealed that curcumin restores the Treg/Th17 balance via gut microbiota modulation in SCI rats. This is achieved by promoting the differentiation and proliferation of Treg cells while inhibiting the activation of Th17 cells. Curcumin upregulates the Treg-specific transcription factor FOXP3 and the anti-inflammatory cytokines IL-10 and TGF-β1, while downregulating the Th17-specific transcription factor RORγt and the pro-inflammatory cytokines IL-17A and IL-6, thereby exerting immunoregulatory and anti-inflammatory effects. Although this study confirms that curcumin improves SCI by regulating SCFA levels through the gut microbiota and modulating the Treg/Th17 balance, the precise molecular mechanisms remain to be fully elucidated. SCFAs may act on GPCRs, activating intracellular signaling pathways such as AMPK and mTOR, hereby influencing the differentiation and function of Treg and Th17 cells. In addition, epigenetic regulation may also play an important role in this process. SCFAs can function as histone deacetylase (HDAC) inhibitors, modulating gene expression and affecting the Treg/Th17 cell balance. Future studies should employ more detailed molecular biology approaches to elucidate the interactions among these signaling pathways, as well as the specific roles of epigenetic regulation. Such studies will help to refine the mechanistic understanding of how curcumin modulates the Treg/Th17 balance. Moreover, given the interplay between the gut microbiota, SCFAs, and the immune system, exploring strategies to enhance the therapeutic efficacy of curcumin by modulating the gut microbiota, represents a promising and meaningful direction for future research. 4. Material and methods 4.1 Animals and experimental grouping Specific-pathogen-free (SPF) female Sprague-Dawley (SD) rats, aged 6 weeks and weighing 200–220 g, were obtained from Xi’an Jiaotong University. The rats were housed in a temperature-controlled animal facility (∼25°C) under a 12-hour light/12-hour dark cycle, with ad libitum access to food and water. Animals were acclimated for 2 weeks prior to experimentation. Initially, the rats were randomly divided into two groups using a random number table: a sham group and a curcumin group, with 8 rats in each group. Based on prior experimental experience, rats in the curcumin group received daily oral gavage of curcumin at a dose of 100 mg/kg (Sigma-Aldrich, USA), while the control group received no treatment. Fresh fecal samples were collected on day 14 after gavage for subsequent experiments. Subsequently, the animals were randomly assigned into four groups (n = 5 per group) using a random number table: Sham group, SCI group, SCI + FMT group, and curcumin fecal microbiota transplantation (SCI + FMT (CUR)) group. In the Sham group, only laminectomy was performed to expose the dura mater without inducing SCI. In accordance with the protocol described by Tian et al. [ 36 ] rats in the FMT and FMT (CUR) groups underwent a two-week antibiotic pretreatment to deplete the native gut microbiota prior to SCI surgery. After surgery, these rats received 1 ml of donor fecal supernatant by oral gavage every two days. If any animals died during the experiment and could not complete the procedures, replacements were made, and models were re-established accordingly. All animal procedures were conducted in accordance with the principles of animal welfare and ethics, and the experimental protocol was approved by the Laboratory Animal Ethics Committee of Yan’an University . 4.2 Establishment of spinal cord injury model Prior to surgery, all surgical instruments and medical supplies were sterilized. Medical-grade alcohol, povidone-iodine, normal saline, 2% pentobarbital sodium (Shanghai Shanpu Chemical Co., Ltd., China), and ampicillin sodium (Saiveer Biotech Co., Ltd., China) were prepared in advance. Rats were fasted and deprived of water for 12 hours before surgery. All procedures were performed under sterile conditions. Anesthesia was induced via intraperitoneal injection of pentobarbital sodium at a dose of 15–40 mg/kg. After confirming the anesthetic effect, the rat was placed in a prone position and secured on the surgical platform. The T10 spinous process was located by palpation, and the area centered on this point (3–5 cm radius) was shaved. Following disinfection, a midline skin incision approximately 1.5 cm in length was made. Using tweezers, hemostatic forceps, and ophthalmic scissors, the superficial fascia and the paraspinal muscles and ligaments on both sides of the spinous processes were carefully separated. The position of the T10 vertebra was confirmed based on spinous process orientation: T9 tilts caudally, T10 remains neutral, and T11 tilts cranially. The T10 spinous process was lifted with hemostatic forceps, and the ligament between the T10 and T11 laminae was gradually and gently dissected using ophthalmic scissors. A small rongeur was then used to remove the T10 lamina and expose the underlying dura mater. The rat was transferred to the impactor platform and stabilized. A contusion injury was induced at the T10 spinal level using the HI-0400 spinal cord impactor with an impact force of 200 kilodynes. Successful injury was indicated by visible hemorrhage at the impact site, transient apnea, tail flick reflex, and retraction-like fluttering of the hind limbs and torso. After regaining consciousness, rats displayed flaccid paralysis of both hind limbs. The muscle and skin layers were sutured in sequence, and the wound was disinfected three times. A 5 ml injection of saline was administered to the hind limbs, followed by an intramuscular injection of penicillin sodium (4×10⁵ U) into one of the hind limbs. Rats were placed on a heated pad until fully awake, and then returned to their cages. Manual bladder expression was performed three times daily until spontaneous urination resumed. Rats were maintained under a 12-hour light/12-hour dark cycle at a constant temperature of approximately 25°C. 4.3 Preparation of antibiotic solution Neomycin sulfate (1 g), vancomycin hydrochloride (0.5 g), ampicillin sodium (1 g), and metronidazole (1 g) were accurately weighed and dissolved in 900 mL of double-distilled water (ddH₂O). The solution was then brought to a final volume of 1 L. The prepared antibiotic solution was stored at 4°C until use, as previously described [ 37 ] . 4.4 Fecal microbiota transplantation Fresh fecal samples were collected and immersed in sterile phosphate-buffered saline (PBS) at a ratio of 1 fecal pellet per 1 mL of PBS. The mixture was homogenized and centrifuged at 1000 rpm for 5 minutes at 4°C to remove large particulate matter. The resulting supernatant was then centrifuged at 8000 rpm for 5 minutes at 4°C to collect the bacterial pellet. The final bacterial suspension was mixed with sterile glycerol to a final concentration of 20% and stored at − 80°C until use. Before transplantation, the bacterial suspension was diluted in sterile PBS to an optical density (OD) of 0.5 at 600 nm, corresponding to approximately 10⁸ CFU/mL [ 38 ] . 4.5 Motor function assessment The recovery of hindlimb motor function was evaluated using the Basso–Beattie–Bresnahan (BBB) locomotor rating scale [ 39 ] Rats were allowed to walk freely for 5 minutes in an open field (100 cm in diameter), and hindlimb movements and coordination were closely observed. Behavioral assessments were performed on postoperative days 1, 3, 5, 7, 14, 21, and 28 in the Sham, SCI, SCI + FMT, and SCI + FMT (CUR) groups. All scoring was performed by two independent observers who were trained in the BBB scale but blinded to the experimental design. Each evaluation was repeated three times, and the scores were immediately recorded. The scale ranges from 0 (no observable hindlimb movement) to 21 (normal locomotion). On day 28 post-injury, footprint analysis was performed to assess gait and motor coordination [ 40 ] . Different colored dyes were applied to the forepaws and hindpaws, and rats were allowed to walk in a straight line on white paper. The test was repeated three times and recorded. 4.6 Tissue preparation On day 28 post-injury, rats were anesthetized and perfused transcardially with physiological saline. Spinal cord segments 2 cm rostral and caudal to the injury site were collected and fixed in 4% paraformaldehyde (Wuhan Servicebio Technology Co., Ltd.) for 48 hours. Samples were then dehydrated in a graded ethanol series, embedded in paraffin, and sectioned into 10 µm thick slices. 4.7 Hematoxylin and eosin staining Sections were stained according to the manufacturer’s instructions using an H&E staining kit (Solarbio). The stained slides were dehydrated in graded ethanol, cleared in xylene, and mounted using neutral balsam (Shanghai Specimen and Model Factory, China). 4.8 Real-time quantitative PCR Total RNA was extracted from spinal cord tissue using TRIzol reagent. cDNA was synthesized using reverse transcriptase, and the expression levels of β-actin, IL-17A, IL-6, RORγt, TGF-β1, and FOXP3 were measured by RT-qPCR. The 2 ^−ΔΔCt method was used to analyze changes in gene expression. PCR primers were designed based on rat mRNA sequences obtained from the GenBank database. Primer sequences are listed in (Table 1 ). Table 1 Primer sequences Primer name Sequences(5′to3′) β-actin F- CACTATCGGCAATGAGCGGTTC R-CAGCACTGTGTTGGCATAGAGG FOXP3 F-AGAGAGGCAGAGGACACTCAATG R-GGTTGTGGCGGATGGCATTC IL-10 F-CCCTGGGAGAGAAGCTGAAGAC R-TCACCTGCTCCACTGCCTTG TGF-β1 F-GACCGCAACAACGCAATCTATGAC R-CTGGCACTGCTTCCCGAATGTC RORγt F-ACCACCCTCTTCTCACGGG R-CTTCCATTGCTCCTGCTTTC IL-17A F-CCTGATGCTGTTGCTGCTACTG R-GCGTTTGGACACACTGAACTTTG IL-6 F-CTTCCAGCCAGTTGCCTTCTTG R-TGGTCTGTTGTGGGTGGTACTC 4.9 Enzyme-linked immunosorbent assay Spinal cord tissues were weighed and homogenized in 900 µl of normal saline, then centrifuged at 3000 rpm for 10 minutes to obtain tissue homogenates. The concentrations of cytokines including IL-10 (Wuhan Sanying Biotechnology, Cat# KE20003), IL-17A (XINBOS Biological, Cat# ERC170), and IL-6 (Wuhan Sanying Biotechnology, Cat# KE20024) were measured using ELISA kits according to the manufacturers’ protocols. Absorbance values were measured using a microplate reader, and cytokine concentrations were determined based on standard curves. 4.10 Western blot analysis Total protein was extracted from spinal cord tissue using RIPA lysis buffer (Beyotime Biotechnology). Protein concentrations were determined using a BCA assay kit (Boster Biological Engineering Co., Ltd.). Equal amounts of protein were separated by SDS-PAGE and transferred to PVDF membranes (Merck Millipore). After blocking with 5% skim milk (Yili Group Co., Ltd.) for 2 hours, the membranes were incubated overnight at 4°C with the following primary antibodies: anti-FOXP3 (AF6544), anti-IL-17A (DF6127), and anti-TGF-β1 (AF1027) (all from Jiangsu Abways Biotechnology), and anti-RORγt (M00444; Boster Biological Engineering, Wuhan). After incubation with the appropriate secondary antibodies (anti-mouse A0216 or anti-rabbit 0208), protein bands were visualized using enhanced chemiluminescence reagents (Solarbio Life Sciences). Band intensities were quantified using ImageJ software and normalized to β-actin. 4.11 Data analysis and statistics Statistical analysis and graph generation were performed using GraphPad Prism 8.0. All experiments were repeated at least three times. Data are expressed as mean ± standard deviation (SD). Comparisons between two groups were performed using independent samples t-tests, while comparisons among multiple groups were conducted using one-way analysis of variance (ANOVA), followed by Tukey’s post hoc test for pairwise comparisons. Differences were considered statistically significant at P < 0.05. Declarations Conflict of interest statement The authors declare no conflicts of interest. Funding statement This work was supported by the Graduate Education Innovation Program of Yan’an University (YCX2024102 to Chunping Tian), the Graduate Education Innovation Program of Yan’an University (YCX2024108 to Jiajun Wu), the Graduate Education Innovation Program of Yan’an University (YKY2025010 to Linfeng Xiao) the National Natural Science Foundation of China Funded Project (82560366 to Xiaowei Chang), the General Project of Shaanxi Provincial Department of Science and Technology (2024SF-YBXM-037 to Yanling Yang) and the National Natural Science Foundation of China Funded Project (82560280 to Yanling Yang). Author Contribution C-PT were responsible for performing the experiments and writing the text. J-JW and L-FX were responsible for data collection. Q-YW, J-ND and Q-QH participated in overall supervision. J-LQ, X-WC and Y-LY responsible for designing the project and guiding the article. All authors give final approval of the version to be published and give an agreement to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. References ANJUM A, YAZID M D, FAUZI DAUD M et al (2020) Spinal Cord Injury: Pathophysiology, Multimolecular Interactions, and Underlying Recovery Mechanisms[J/OL]. 21(20):7533. 10.3390/ijms21207533 COWAN H, LAKRA C (2020) Autonomic dysreflexia in spinal cord injury[J/OL]. BMJ (Clinical research ed. 371:m3596. 10.1136/bmj.m3596 HELLENBRAND D J, QUINN C M, PIPER Z J et al (2021) Inflammation after spinal cord injury: a review of the critical timeline of signaling cues and cellular infiltration[J/OL]. J Neuroinflamm 18(1):284. 10.1186/s12974-021-02337-2 JIN L Y, LI J, WANG K F et al (2021) Blood-Spinal Cord Barrier in Spinal Cord Injury: A Review[J/OL]. J Neurotrauma 38(9):1203–1224. 10.1089/neu.2020.7413 GAO P, YI J, CHEN W et al (2023) Pericyte-derived exosomal miR-210 improves mitochondrial function and inhibits lipid peroxidation in vascular endothelial cells after traumatic spinal cord injury by activating JAK1/STAT3 signaling pathway[J/OL]. J Nanobiotechnol 21(1):452. 10.1186/s12951-023-02110-y TANG W, ZHAO K, LI X et al (2024) Bone Marrow Mesenchymal Stem Cell-Derived Exosomes Promote the Recovery of Spinal Cord Injury and Inhibit Ferroptosis by Inactivating IL-17 Pathway[J/OL]. J Mol neuroscience: MN 74(2):33. 10.1007/s12031-024-02209-3 ZHANG S, ZHONG R, TANG S et al (2024) Metabolic regulation of the Th17/Treg balance in inflammatory bowel disease[J/OL]. Pharmacol Res 203:107184. 10.1016/j.phrs.2024.107184 ZHANG H, CAUDLE Y, WHEELER C et al (2018) TGF-β1/Smad2/3/Foxp3 signaling is required for chronic stress-induced immune suppression[J/OL]. J Neuroimmunol 314:30–41. 10.1016/j.jneuroim.2017.11.005 BROCKMANN L, TRAN A, HUANG Y et al (2023) Intestinal microbiota-specific Th17 cells possess regulatory properties and suppress effector T cells via c-MAF and IL-10[J/OL]. Immunity 56(12):2719–2735e7. 10.1016/j.immuni.2023.11.003 CUI H, WANG N, LI H et al (2024) The dynamic shifts of IL-10-producing Th17 and IL-17-producing Treg in health and disease: a crosstalk between ancient Yin-Yang theory and modern immunology[J/OL]. Cell communication signaling: CCS 22(1):99. 10.1186/s12964-024-01505-0 Short-chain fatty (2023) acids ameliorate spinal cord injury recovery by regulating the balance of regulatory T cells and effector IL-17 + γδ T cells[J/OL]. J Zhejiang Univ Sci B 24(4):312–325. 10.1631/jzus.B2200417 WESOLOWSKI M, CAN P, WARZECHA K et al (2023) Long-term changes of Th17 and regulatory T cells in peripheral blood of dogs with spinal cord injury after intervertebral disc herniation[J/OL]. BMC Vet Res 19(1):90. 10.1186/s12917-023-03647-8 LI X, CAO LIUL, Biomedicine et al (2020) Pharmacotherapy = Biomedecine Pharmacotherapie 121:109653. 10.1016/j.biopha.2019.109653 CRYAN JF, O’RIORDAN K J, COWAN C S M et al (2019) The Microbiota-Gut-Brain Axis[J/OL]. Physiol Rev 99(4):1877–2013. 10.1152/physrev.00018.2018 FUNG T C, OLSON C A, HSIAO E Y (2017) Interactions between the microbiota, immune and nervous systems in health and disease[J/OL]. Nat Neurosci 20(2):145–155. 10.1038/nn.4476 ENAMORADO M, KULALERT W, HAN SJ et al (2023) Immunity to the microbiota promotes sensory neuron regeneration[J/OL]. Cell 186(3):607–620e17. 10.1016/j.cell.2022.12.037 LUU M (2019) Short-chain fatty acids: Bacterial messengers modulating the immunometabolism of T cells[J/OL]. Eur J Immunol 49(6):842–848. 10.1002/eji.201848009 ZHAO X, STEIN K R, CHEN V et al (2023) Chemoproteomics reveals microbiota-derived aromatic monoamine agonists for GPRC5A[J/OL]. Nat Chem Biol 19(10):1205–1214. 10.1038/s41589-023-01328-z MORRISON D J, PRESTON T (2016) Formation of short chain fatty acids by the gut microbiota and their impact on human metabolism[J/OL]. Gut Microbes 7(3):189–200. 10.1080/19490976.2015.1134082 KAUR J (2023) A mechanistic overview of spinal cord injury, oxidative DNA damage repair and neuroprotective therapies[J/OL]. Int J Neurosci 133(3):307–321. 10.1080/00207454.2021.1912040 MARTIN-GALLAUSIAUX C, MARINELLI L, BLOTTIÈRE H M et al (2021) SCFA: mechanisms and functional importance in the gut[J/OL]. The Proceedings of the Nutrition Society, 80(1): 37–49. 10.1017/S0029665120006916 ERNY D, DOKALIS N, MEZÖ C et al (2021) Microbiota-derived acetate enables the metabolic fitness of the brain innate immune system during health and disease[J/OL]. Cell Metabol 33(11):2260–2276e7. 10.1016/j.cmet.2021.10.010 SU SH, WU Y F, LIN Q et al (2022) Fecal microbiota transplantation and replenishment of short-chain fatty acids protect against chronic cerebral hypoperfusion-induced colonic dysfunction by regulating gut microbiota, differentiation of Th17 cells, and mitochondrial energy metabolism[J/OL]. J Neuroinflamm 19:313. 10.1186/s12974-022-02675-9 TAN JK, MACKAY C MACIAL (2023) Dietary fiber and SCFAs in the regulation of mucosal immunity[J/OL]. J Allergy Clin Immunol 151(2):361–370. 10.1016/j.jaci.2022.11.007 MAHJOOB M, STOCHAJ U (2021) Curcumin nanoformulations to combat aging-related diseases[J/OL]. Ageing Res Rev 69:101364. 10.1016/j.arr.2021.101364 CHAMANI S, MOOSSAVI M, NAGHIZADEH A et al (2022) Immunomodulatory effects of curcumin in systemic autoimmune diseases[J/OL]. Phytother Res 36(4):1616–1632. 10.1002/ptr.7417 JIANG C, CHEN Z, WANG X et al (2023) Curcumin-activated Olfactory Ensheathing Cells Improve Functional Recovery After Spinal Cord Injury by Modulating Microglia Polarization Through APOE/TREM2/NF-κB Signaling Pathway[J/OL]. J Neuroimmune Pharmacology: Official J Soc NeuroImmune Pharmacol 18(3):476–494. 10.1007/s11481-023-10081-y AZZINI E, PEÑA-CORONA S I, HERNÁNDEZ-PARRA H et al (2024) Neuroprotective and anti-inflammatory effects of curcumin in Alzheimer’s disease: Targeting neuroinflammation strategies[J/OL]. Phytother Res 38(6):3169–3189. 10.1002/ptr.8200 NEBRISI E E (2021) Neuroprotective Activities of Curcumin in Parkinson’s Disease: A Review of the Literature[J/OL]. Int J Mol Sci 22(20):11248. 10.3390/ijms222011248 WANG Q Y,HAO Q,GAO, H et al Effects of Curcumin on Microbial Diversity and Spinal Cord Transcriptomics in Rats after Spinal Cord Injury [J] Microbiology China,2024,51(11):4712–4724. 10.13344/j.microbiol.china.240153 GAO F, SHEN J, ZHAO L et al (2019) Curcumin Alleviates Lipopolysaccharide (LPS)-Activated Neuroinflammation via Modulation of miR-199b-5p/IκB Kinase β (IKKβ)/Nuclear Factor Kappa B (NF-κB) Pathway in Microglia[J/OL]. Med Sci Monitor: Int Med J Experimental Clin Res 25:9801–9810. 10.12659/MSM.918237 CHEN X D, XIE J, WEI Y et al (2023) Immune modulation of Th1/Th2/Treg/Th17/Th9/Th21 cells in rabbits infected with Eimeria stiedai[J/OL]. Front Cell Infect Microbiol 13:1230689. 10.3389/fcimb.2023.1230689 WESTFALL S, CARACCI F, ZHAO D et al (2021) Microbiota metabolites modulate the T helper 17 to regulatory T cell (Th17/Treg) imbalance promoting resilience to stress-induced anxiety- and depressive-like behaviors[J/OL]. Brain, Behavior, and Immunity, 91: 350–368. 10.1016/j.bbi.2020.10.013 LI M, VAN ESCH B C A M, HENRICKS P A J et al (2018) The Anti-inflammatory Effects of Short Chain Fatty Acids on Lipopolysaccharide- or Tumor Necrosis Factor α-Stimulated Endothelial Cells via Activation of GPR41/43 and Inhibition of HDACs[J/OL]. Front Pharmacol 9:533. 10.3389/fphar.2018.00533 AKIBA Y, MARUTA K, NARIMATSU K et al (2017) FFA2 activation combined with ulcerogenic COX inhibition induces duodenal mucosal injury via the 5-HT pathway in rats[J/OL]. Am J Physiol - Gastrointest Liver Physiol 313(2):G117–G128. 10.1152/ajpgi.00041.2017 TIAN D, XU W, PAN W et al (2022) Fecal microbiota transplantation enhances cell therapy in a rat model of hypoganglionosis by SCFA-induced MEK1/2 signaling pathway[J/OL]. EMBO J 42(1):e111139. 10.15252/embj.2022111139 RAKOFF-NAHOUM S, PAGLINO J, ESLAMI-VARZANEH F et al (2004) Recognition of commensal microflora by toll-like receptors is required for intestinal homeostasis[J/OL]. Cell 118(2):229–241. 10.1016/j.cell.2004.07.002 JANG J H, YEOM M J, AHN S, Brain et al (2020) Behav Immun 89:641–655. 10.1016/j.bbi.2020.08.015 MARTINEZ M, BREZUN J M BONNIERL et al (2009) A new rating scale for open-field evaluation of behavioral recovery after cervical spinal cord injury in rats[J/OL]. J Neurotrauma 26(7):1043–1053. 10.1089/neu.2008.0717 QIAN D, XU J, ZHANG X et al (2024) Microenvironment Self-Adaptive Nanomedicine Promotes Spinal Cord Repair by Suppressing Inflammation Cascade and Neural Apoptosis[J/OL]. Adv Mater (Deerfield Beach Fla) 36(50):e2307624. 10.1002/adma.202307624 Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterials.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7518068","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":518116108,"identity":"a9062ff7-1f71-4be6-86e2-578051371e14","order_by":0,"name":"Chunping Tian","email":"","orcid":"","institution":"Yan’an Medical College of Yan’an University","correspondingAuthor":false,"prefix":"","firstName":"Chunping","middleName":"","lastName":"Tian","suffix":""},{"id":518116109,"identity":"0f09fa25-695a-4593-9537-7d7e104481cb","order_by":1,"name":"Jiajun Wu","email":"","orcid":"","institution":"Yan’an Medical College of Yan’an University","correspondingAuthor":false,"prefix":"","firstName":"Jiajun","middleName":"","lastName":"Wu","suffix":""},{"id":518116110,"identity":"9b8ec57f-e5f4-4d51-8de1-6cbb33a19f7b","order_by":2,"name":"Linfeng Xiao","email":"","orcid":"","institution":"Yan’an Medical College of Yan’an University","correspondingAuthor":false,"prefix":"","firstName":"Linfeng","middleName":"","lastName":"Xiao","suffix":""},{"id":518116111,"identity":"31c8b642-e7c9-450f-9aa6-3341aeb02e57","order_by":3,"name":"Qingyan Wang","email":"","orcid":"","institution":"Yan’an Medical College of Yan’an University","correspondingAuthor":false,"prefix":"","firstName":"Qingyan","middleName":"","lastName":"Wang","suffix":""},{"id":518116112,"identity":"23f29572-17ee-4582-aadf-9fc94fb61aab","order_by":4,"name":"Jiani Du","email":"","orcid":"","institution":"Yan’an Medical College of Yan’an University","correspondingAuthor":false,"prefix":"","firstName":"Jiani","middleName":"","lastName":"Du","suffix":""},{"id":518116113,"identity":"0b415f01-38d3-4bf1-aec3-2ea5176bc2de","order_by":5,"name":"Qianqian Hu","email":"","orcid":"","institution":"Yan’an Medical College of Yan’an University","correspondingAuthor":false,"prefix":"","firstName":"Qianqian","middleName":"","lastName":"Hu","suffix":""},{"id":518116115,"identity":"0d53d8f2-482a-436a-ba1e-24f6f5e212c2","order_by":6,"name":"Jingling Qiang","email":"","orcid":"","institution":"Yan'an University Affiliated Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jingling","middleName":"","lastName":"Qiang","suffix":""},{"id":518116116,"identity":"d9ee56a8-7ff9-4b20-a49f-1dfe1b20c4cd","order_by":7,"name":"Xiaowei Chang","email":"","orcid":"","institution":"Yan’an Medical College of Yan’an University","correspondingAuthor":false,"prefix":"","firstName":"Xiaowei","middleName":"","lastName":"Chang","suffix":""},{"id":518116118,"identity":"2f250045-fed1-4b71-be4e-c514a1bba9f3","order_by":8,"name":"Yanling Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABB0lEQVRIiWNgGAWjYBADGTYGBsYHHyps5NjY2w8QpYUHqIXZcMaZNGM+njMJxGkBYjZp3rbDifMkHAzwKjU4fvbwa56aOzx80u2XgbYcTm+TYEhg+FGxDbeWM3lp1jzHnvGwyZwpBPolPbdNuvEAY8+Z27i1HMgxM+ZhO8zDJpGTDLTFOrdN5kACM2MbHi3n3wC1/ANrSQP6hTmdTSLBAL+WGznGj4G+BmpJPwbU4pxAUIvkjTdmjHP7wLaAA9mwDRjIB/H5he98jvGHN98Oy8nPSH8Iikp5+fb2gw9+VODWonCAgU2KB8zkQUTHAZzqgUC+gYH54w8wk/0BPoWjYBSMglEwggEACqldDN4aT6oAAAAASUVORK5CYII=","orcid":"","institution":"Yan’an Medical College of Yan’an University","correspondingAuthor":true,"prefix":"","firstName":"Yanling","middleName":"","lastName":"Yang","suffix":""}],"badges":[],"createdAt":"2025-09-02 13:08:45","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7518068/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7518068/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":92271581,"identity":"ba758baf-ee86-410d-aa7f-c0311e7859c0","added_by":"auto","created_at":"2025-09-26 14:46:09","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1182444,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/4a0fe1cf096e8fc15f684c98.docx"},{"id":92271580,"identity":"09a00a00-7702-4393-bf64-03654eecf76d","added_by":"auto","created_at":"2025-09-26 14:46:08","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9820,"visible":true,"origin":"","legend":"","description":"","filename":"b86333c73ffd456498c953d488f36d39.json","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/1e2060ec22236bb3475ae7ed.json"},{"id":92272584,"identity":"f280bb8b-54bd-4c4b-9fe9-a03872238276","added_by":"auto","created_at":"2025-09-26 14:54:09","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":336243,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/aba726794ac24fc4b0abbcc8.docx"},{"id":92271586,"identity":"77b5c2bd-57ee-4453-b432-00b707d021d3","added_by":"auto","created_at":"2025-09-26 14:46:09","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":97796,"visible":true,"origin":"","legend":"","description":"","filename":"b86333c73ffd456498c953d488f36d391enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/0ca9c397e1b24206661da59c.xml"},{"id":92271590,"identity":"7b0661bf-57cf-48d8-94b9-e0104afb5541","added_by":"auto","created_at":"2025-09-26 14:46:09","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":175545,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/58bf73d6a04930c02b45b86c.png"},{"id":92272589,"identity":"0cb3785e-68a1-4e2b-998a-dab649500d0a","added_by":"auto","created_at":"2025-09-26 14:54:09","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":500433,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/8469676b93b60a4e2b1ce770.png"},{"id":92272586,"identity":"9f2c44ed-6a96-4b04-89db-6a687ccd69d9","added_by":"auto","created_at":"2025-09-26 14:54:09","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":206340,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/a6b6cea7dd76cad658ef509b.png"},{"id":92271594,"identity":"f5615684-3d4e-4339-adca-46d8fcab96e0","added_by":"auto","created_at":"2025-09-26 14:46:09","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":220740,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/52bbe5e1132f651166fc519c.png"},{"id":92272930,"identity":"5d4242be-c69d-4899-b6b4-a916f31944b0","added_by":"auto","created_at":"2025-09-26 15:02:09","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":42306,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/57326d2c066a4bfad4ab15d6.png"},{"id":92273791,"identity":"3f4d5bf4-a13e-4b66-97fe-956c170ed274","added_by":"auto","created_at":"2025-09-26 15:18:14","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":71106,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/74a7a5364adb7fe911cc31a6.png"},{"id":92272588,"identity":"106db1e9-b8cd-4b40-bacd-aa24d52612f1","added_by":"auto","created_at":"2025-09-26 14:54:09","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":60026,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/8e986808958b1b13112fb6c6.png"},{"id":92271596,"identity":"3052da50-a496-4795-9e05-7d82d0c5035d","added_by":"auto","created_at":"2025-09-26 14:46:09","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":57381,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/f7cdaa58ad380ebb115c8d16.png"},{"id":92271599,"identity":"d481c14a-a192-41c8-814f-46718ee00767","added_by":"auto","created_at":"2025-09-26 14:46:09","extension":"xml","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":98076,"visible":true,"origin":"","legend":"","description":"","filename":"b86333c73ffd456498c953d488f36d391structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/2cb919ad2c8ace1e09d08829.xml"},{"id":92271598,"identity":"2b9deb72-6bae-40b1-89f5-e677348d7b5f","added_by":"auto","created_at":"2025-09-26 14:46:09","extension":"html","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":107064,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/ef587b5b54fee7f99651becd.html"},{"id":92272583,"identity":"e5919d3f-6c63-40e2-aae3-cd271703889d","added_by":"auto","created_at":"2025-09-26 14:54:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":175545,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExpression patterns of Treg and Th17 cells in three rat models. \u003c/strong\u003eIn normal rats, CD4⁺ T cells can differentiate into Treg cells by inducing FOXP3 transcription, leading to the secretion of anti-inflammatory cytokines such as IL-10 and TGF-β1. Alternatively, CD4⁺ T cells can differentiate into Th17 cells by inducing RORγt transcription, promoting the secretion of pro-inflammatory cytokines including IL-6 and IL-17A, thereby maintaining a dynamic balance between Treg and Th17 cells. After SCI, Th17 cell function becomes overactivated, Treg cell function is impaired, and the Treg/Th17 balance is disrupted, resulting in increased pro-inflammatory cytokines. FMT following curcumin intervention restores this balance in SCI rats, reducing inflammation and promoting immune homeostasis.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/77bd6282e8927985b48ce5ab.png"},{"id":92272582,"identity":"ff0fc290-64e3-4eca-9628-501faf2208ed","added_by":"auto","created_at":"2025-09-26 14:54:08","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":507041,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTherapeutic effects of curcumin-modulated FMT in a SCI rat model. \u003c/strong\u003e(A) BBB locomotor scores of rats in different groups at multiple time points post-injury. Data are presented as mean ± SD (n = 5). \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, SCI group vs. SCI+FMT(CUR) group; \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, ns: no significant difference, SCI group vs. SCI+FMT group; \u003csup\u003e^\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e^^\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01: SCI+FMT(CUR) group vs. SCI+FMT group.\u003c/p\u003e\n\u003cp\u003e(B) Representative footprint patterns of rats 28 days after SCI. Blue: forepaw prints; Red: hindpaw prints (n = 5). (C) Quantitative analysis of hindpaw print length at 28 days post-injury. Data are expressed as mean ± SD (n = 5). \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001: SCI vs. other groups; \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001: SCI+FMT(CUR) group vs. SCI+FMT group. (D) Representative hematoxylin and eosin (HE) staining of spinal cord sections 28 days after injury (n = 5).\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/9b7ea78b4c6b8be68d663c10.png"},{"id":92271583,"identity":"2fde9704-a1f1-4ddc-9e2f-42d2a66697fa","added_by":"auto","created_at":"2025-09-26 14:46:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":206340,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of curcumin-modulated FMT on Treg and Th17 cell-associated markers in spinal cord tissues.\u003c/strong\u003e (A–C) mRNA expression levels of Treg-related markers FOXP3, IL-10, and TGF-β1 in rat spinal cord tissue. (D–F) mRNA expression levels of Th17-related markers RORγt, IL-17A, and IL-6. (G–H) Protein expression levels of IL-10, IL-17A, and IL-6 in rat spinal cord tissue. All data are presented as mean ± SD (n = 3). \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001: other groups vs. SCI group; \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05,\u003csup\u003e ##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, \u003csup\u003e###\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001: SCI+FMT group vs. SCI+FMT(CUR) group.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/c3ec8a5a97cd8054563b7277.png"},{"id":92271584,"identity":"c9a3f9ba-0706-46e6-83fe-8cb7e802d0dd","added_by":"auto","created_at":"2025-09-26 14:46:09","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":226036,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCurcumin regulates Treg/Th17 cell differentiation via modulation of the gut microbiota.\u003c/strong\u003e (A–F) Protein expression levels and quantitative analysis of TGF-β1, FOXP3, and RORγt in spinal cord tissue. (G) Quantitative analysis of protein levels of IL-17A, IL-6, and IL-10 in spinal cord tissue. All data are presented as mean ± SD (n = 3). \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, \u003csup\u003e###\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/3567cc5c0a2cb4418ef3e3d8.png"},{"id":94652893,"identity":"9463885f-0291-4cfa-9467-f5447ce0752d","added_by":"auto","created_at":"2025-10-29 09:54:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1891555,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/f76a4bdd-533d-4e61-821d-a234041c1b07.pdf"},{"id":92271587,"identity":"8caa9f27-d897-494a-ae79-b4d9c67c330e","added_by":"auto","created_at":"2025-09-26 14:46:09","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":336243,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-7518068/v1/5e8b31aafa942d5a01d3df40.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Curcumin improves spinal cord injury by regulating the Treg/Th17 balance via modulation of the gut microbiota","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eSpinal cord injury (SCI) is a severe traumatic disorder of the central nervous system, typically caused by external mechanical forces damaging the spinal cord or surrounding structures. It can result in sensory, motor, and autonomic dysfunctions, significantly impairing patients\u0026rsquo; quality of life and daily functioning\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e, SCI is generally categorized into primary and secondary injury phases. The secondary phase involves processes such as lipid peroxidation, glial cell activation, neuroinflammation, and oxidative stress. Among these, neuroinflammation is considered a key factor contributing to the exacerbation of secondary spinal cord damage\u003csup\u003e[\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e.Therefore, suppressing neuroinflammation following SCI is crucial for improving therapeutic outcomes.\u003c/p\u003e\u003cp\u003eT helper 17 (Th17) cells are a subset of CD4⁺ T cells. Interleukin-6 (IL-6) promotes the proliferation and differentiation of Th17 cells by activating STAT3-mediated transcription of retinoic acid-related orphan receptor γt (RORγt). This leads to increased production of pro-inflammatory cytokines such as interleukin-17A (IL-17A), which drive inflammatory responses and contribute to the pathogenesis of autoimmune diseases\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e, In contrast, regulatory T (Treg) cells represent another subset of CD4⁺ T cells. Transforming growth factor-β (TGF-β) induces the transcription of forkhead box P3 (FOXP3), thereby promoting the proliferation and differentiation of Treg cells and the secretion of anti-inflammatory cytokines such as interleukin-10 (IL-10). These cells play an essential role in immune suppression \u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. Under physiological conditions, Treg and Th17 cells maintain a dynamic balance that is critical for immune homeostasis\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. However, under pathological conditions such as spinal cord injury, this balance is disrupted, with hyperactivation of Th17 cells and a relative deficiency of Treg cell function. This imbalance leads to excessive inflammatory responses and exacerbates SCI\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e.Therefore, restoring the Treg/Th17 balance represents a promising therapeutic target for SCI.\u003c/p\u003e\u003cp\u003eThe gut microbiota, often referred to as a \u0026ldquo;microbial organ,\u0026rdquo; has recently been found to be closely linked to both the immune and nervous systems of the host\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. Dysbiosis of the gut microbiota not only disrupts local intestinal immunity but also affects the immune and inflammatory status of the central nervous system via the gut\u0026ndash;brain axis\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. Studies have shown that the gut microbiota interacts with the host through its metabolic products and derivatives, including aryl hydrocarbon receptor (AhR) agonists, short-chain fatty acids (SCFAs), and lipopolysaccharides (LPS), all of which play critical roles in modulating central nervous system inflammation\u003csup\u003e[\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. SCFAs are among the most important metabolic products of the gut microbiota. In healthy individuals, the gut produces approximately 50\u0026ndash;100 mmol of SCFAs per day. These SCFAs serve not only as the preferred energy source for intestinal epithelial cells and key regulators of their proliferation and differentiation, but also exert multiple beneficial effects, including antioxidant, anti-inflammatory, and antitumor activities, as well as regulation of gene expression, host intestinal immunity, and overall gut function\u003csup\u003e[\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. Previous studies have reported that SCFAs bind to G protein-coupled receptors (GPCRs) on the cell surface and modulate host immune responses by regulating the Treg/Th17 balance \u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e。\u003c/p\u003e\u003cp\u003eCurcumin is a yellow-orange natural polyphenolic compound extracted from the rhizomes of plants in the Zingiberaceae family. It exhibits anti-inflammatory, antioxidant, antitumor, and anti-apoptotic properties\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. Studies have shown that curcumin exerts significant neuroprotective effects in central nervous system disorders such as SCI\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e、Alzheimer\u0026rsquo;s disease\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003eand Parkinson\u0026rsquo;s disease\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. Furthermore, our previous research demonstrated that curcumin not only promotes spinal cord repair but also alters the composition and abundance of the gut microbiota, leading to increased concentrations of SCFAs\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. Based on these findings, we hypothesize that curcumin may regulate SCFA levels via modulation of the gut microbiota, thereby influencing the Treg/Th17 balance and ultimately contributing to SCI recovery. The proposed hypothesis is illustrated in (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). To test this hypothesis, we performed fecal microbiota transplantation (FMT) and assessed the expression of transcription factors and inflammatory cytokines associated with Treg and Th17 cells in the spinal cord using Real-Time Quantitative PCR (RT-qPCR), Enzyme-Linked Immunosorbent Assay (ELISA), and Western blotting. This study aims to elucidate the specific mechanisms by which curcumin-modulated gut microbiota contributes to spinal cord repair. The findings may provide a theoretical foundation and experimental support for the clinical application of curcumin in treating SCI.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"2. Result","content":"\u003cp\u003e\u003cb\u003e2.1 Effects of curcumin-modulated gut microbiota on motor function and tissue morphology in rats with spinal cord injury\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo investigate the effects of curcumin-modulated gut microbiota on motor function and tissue morphology in rats with SCI, we conducted a FMT experiment. Suspensions of fecal matter from curcumin-treated or conventionally raised donor rats were orally administered to SCI recipient rats. Hindlimb motor recovery was assessed using the Basso\u0026ndash;Beattie\u0026ndash;Bresnahan (BBB) locomotor rating scale. BBB scores dropped to zero in all SCI groups immediately after injury. Over time, scores gradually increased in the SCI, SCI\u0026thinsp;+\u0026thinsp;FMT, and SCI\u0026thinsp;+\u0026thinsp;FMT(CUR) groups. Notably, the SCI\u0026thinsp;+\u0026thinsp;FMT(CUR) group exhibited significantly higher scores compared to the SCI and SCI\u0026thinsp;+\u0026thinsp;FMT groups. However, all SCI groups had lower scores than the Sham group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Gait analysis revealed a marked loss of fore- and hindlimb coordination after SCI. Compared to the SCI group, rats in the SCI\u0026thinsp;+\u0026thinsp;FMT and SCI\u0026thinsp;+\u0026thinsp;FMT(CUR) groups exhibited longer hindlimb stride length and shorter drag distance. These findings suggest improved gait recovery and motor coordination in these groups (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB\u0026ndash;C). Hematoxylin and eosin (HE) staining at 4 weeks post-injury showed smaller lesion areas and fewer cavities in the SCI\u0026thinsp;+\u0026thinsp;FMT(CUR) group compared to the SCI and SCI\u0026thinsp;+\u0026thinsp;FMT groups. (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). These findings suggest that curcumin-modulated gut microbiota promotes motor function recovery and improves tissue morphology in rats with SCI.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Effects of curcumin-modulated gut microbiota on Treg and Th17 cells\u003c/h2\u003e\u003cp\u003eTo investigate the effects of curcumin-modulated gut microbiota on Treg and Th17 cells, we collected tissue samples from SCI rats after FMT for analysis. We examined the expression of transcription factors associated with Treg and Th17 cells\u0026mdash;FOXP3 and RORγt\u0026mdash;as well as inflammatory cytokines including IL-10, TGF-β1, IL-17A, and IL-6\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e, at both RNA and protein levels. At the RNA level, expression of FOXP3, IL-10, and TGF-β1 was significantly upregulated in the SCI\u0026thinsp;+\u0026thinsp;FMT(CUR) group compared with the SCI and SCI\u0026thinsp;+\u0026thinsp;FMT groups. In contrast, RORγt, IL-17A, and IL-6 expression was significantly downregulated (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA\u0026ndash;F). At the protein level, both ELISA and Western blotting were used to quantify expression. ELISA results showed a significant increase in IL-10 expression in the SCI\u0026thinsp;+\u0026thinsp;FMT(CUR) group compared to the SCI and SCI\u0026thinsp;+\u0026thinsp;FMT groups, accompanied by a marked decrease in IL-17A and IL-6 levels (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG\u0026ndash;J). Western blot analysis revealed a significant reduction in RORγt expression in the SCI\u0026thinsp;+\u0026thinsp;FMT(CUR) group compared with the other SCI groups, along with elevated expression of FOXP3 and TGF-β1 (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA\u0026ndash;D). These findings suggest that curcumin-modulated gut microbiota promotes the differentiation of Treg cells and suppresses the activation of Th17 cells in rats with SCI,\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.3 Curcumin-modulated gut microbiota promotes spinal cord injury recovery by regulating the Treg/Th17 balance\u003c/h2\u003e\u003cp\u003eIt has been reported that SCFAs regulate immune cell differentiation via GPCRs\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e.In our previous experiments, curcumin was shown to increase SCFA concentrations\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. To further verify whether curcumin promotes SCI recovery by modulating SCFA levels via the gut microbiota and thereby regulating the Treg/Th17 balance, we co-administered a G protein-coupled receptor (GPCR) inhibitor during FMT\u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. Western blot and ELISA analyses revealed that the addition of the GPCR inhibitor reversed the expression patterns of Treg- and Th17-associated cytokines and transcription factors. Specifically, protein levels of RORγt, IL-17A, and IL-6 were increased, while FOXP3, TGF-β1, and IL-10 expression was decreased (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE\u0026ndash;G). These results suggest that curcumin promotes spinal cord injury recovery by regulating the Treg/Th17 balance through SCFA-mediated signaling pathways.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Conclusion and discussion","content":"\u003cp\u003eIn this study, we systematically investigated the therapeutic effects and underlying mechanisms of curcumin in SCI using in vivo experiments. The results demonstrated that curcumin significantly modulates the gut microbiota in SCI rats, increasing microbial diversity and richness, as well as elevating the levels of SCFAs. FMT experiments further revealed that curcumin restores the Treg/Th17 balance via gut microbiota modulation in SCI rats. This is achieved by promoting the differentiation and proliferation of Treg cells while inhibiting the activation of Th17 cells. Curcumin upregulates the Treg-specific transcription factor FOXP3 and the anti-inflammatory cytokines IL-10 and TGF-β1, while downregulating the Th17-specific transcription factor RORγt and the pro-inflammatory cytokines IL-17A and IL-6, thereby exerting immunoregulatory and anti-inflammatory effects. Although this study confirms that curcumin improves SCI by regulating SCFA levels through the gut microbiota and modulating the Treg/Th17 balance, the precise molecular mechanisms remain to be fully elucidated. SCFAs may act on GPCRs, activating intracellular signaling pathways such as AMPK and mTOR, hereby influencing the differentiation and function of Treg and Th17 cells. In addition, epigenetic regulation may also play an important role in this process. SCFAs can function as histone deacetylase (HDAC) inhibitors, modulating gene expression and affecting the Treg/Th17 cell balance. Future studies should employ more detailed molecular biology approaches to elucidate the interactions among these signaling pathways, as well as the specific roles of epigenetic regulation. Such studies will help to refine the mechanistic understanding of how curcumin modulates the Treg/Th17 balance. Moreover, given the interplay between the gut microbiota, SCFAs, and the immune system, exploring strategies to enhance the therapeutic efficacy of curcumin by modulating the gut microbiota, represents a promising and meaningful direction for future research.\u003c/p\u003e"},{"header":"4. Material and methods","content":"\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e4.1 Animals and experimental grouping\u003c/h2\u003e\u003cp\u003eSpecific-pathogen-free (SPF) female Sprague-Dawley (SD) rats, aged 6 weeks and weighing 200\u0026ndash;220 g, were obtained from Xi\u0026rsquo;an Jiaotong University. The rats were housed in a temperature-controlled animal facility (\u0026sim;25\u0026deg;C) under a 12-hour light/12-hour dark cycle, with ad libitum access to food and water. Animals were acclimated for 2 weeks prior to experimentation. Initially, the rats were randomly divided into two groups using a random number table: a sham group and a curcumin group, with 8 rats in each group. Based on prior experimental experience, rats in the curcumin group received daily oral gavage of curcumin at a dose of 100 mg/kg (Sigma-Aldrich, USA), while the control group received no treatment. Fresh fecal samples were collected on day 14 after gavage for subsequent experiments. Subsequently, the animals were randomly assigned into four groups (n\u0026thinsp;=\u0026thinsp;5 per group) using a random number table: Sham group, SCI group, SCI\u0026thinsp;+\u0026thinsp;FMT group, and curcumin fecal microbiota transplantation (SCI\u0026thinsp;+\u0026thinsp;FMT (CUR)) group. In the Sham group, only laminectomy was performed to expose the dura mater without inducing SCI. In accordance with the protocol described by Tian et al.\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e rats in the FMT and FMT (CUR) groups underwent a two-week antibiotic pretreatment to deplete the native gut microbiota prior to SCI surgery. After surgery, these rats received 1 ml of donor fecal supernatant by oral gavage every two days. If any animals died during the experiment and could not complete the procedures, replacements were made, and models were re-established accordingly. All animal procedures were conducted in accordance with the principles of animal welfare and ethics, and the experimental protocol was approved by the Laboratory Animal Ethics Committee of Yan\u0026rsquo;an University .\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e4.2 Establishment of spinal cord injury model\u003c/h2\u003e\u003cp\u003ePrior to surgery, all surgical instruments and medical supplies were sterilized. Medical-grade alcohol, povidone-iodine, normal saline, 2% pentobarbital sodium (Shanghai Shanpu Chemical Co., Ltd., China), and ampicillin sodium (Saiveer Biotech Co., Ltd., China) were prepared in advance. Rats were fasted and deprived of water for 12 hours before surgery. All procedures were performed under sterile conditions. Anesthesia was induced via intraperitoneal injection of pentobarbital sodium at a dose of 15\u0026ndash;40 mg/kg. After confirming the anesthetic effect, the rat was placed in a prone position and secured on the surgical platform. The T10 spinous process was located by palpation, and the area centered on this point (3\u0026ndash;5 cm radius) was shaved. Following disinfection, a midline skin incision approximately 1.5 cm in length was made. Using tweezers, hemostatic forceps, and ophthalmic scissors, the superficial fascia and the paraspinal muscles and ligaments on both sides of the spinous processes were carefully separated. The position of the T10 vertebra was confirmed based on spinous process orientation: T9 tilts caudally, T10 remains neutral, and T11 tilts cranially. The T10 spinous process was lifted with hemostatic forceps, and the ligament between the T10 and T11 laminae was gradually and gently dissected using ophthalmic scissors. A small rongeur was then used to remove the T10 lamina and expose the underlying dura mater. The rat was transferred to the impactor platform and stabilized. A contusion injury was induced at the T10 spinal level using the HI-0400 spinal cord impactor with an impact force of 200 kilodynes. Successful injury was indicated by visible hemorrhage at the impact site, transient apnea, tail flick reflex, and retraction-like fluttering of the hind limbs and torso. After regaining consciousness, rats displayed flaccid paralysis of both hind limbs. The muscle and skin layers were sutured in sequence, and the wound was disinfected three times. A 5 ml injection of saline was administered to the hind limbs, followed by an intramuscular injection of penicillin sodium (4\u0026times;10⁵ U) into one of the hind limbs. Rats were placed on a heated pad until fully awake, and then returned to their cages. Manual bladder expression was performed three times daily until spontaneous urination resumed. Rats were maintained under a 12-hour light/12-hour dark cycle at a constant temperature of approximately 25\u0026deg;C.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e4.3 Preparation of antibiotic solution\u003c/h2\u003e\u003cp\u003eNeomycin sulfate (1 g), vancomycin hydrochloride (0.5 g), ampicillin sodium (1 g), and metronidazole (1 g) were accurately weighed and dissolved in 900 mL of double-distilled water (ddH₂O). The solution was then brought to a final volume of 1 L. The prepared antibiotic solution was stored at 4\u0026deg;C until use, as previously described\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e4.4 Fecal microbiota transplantation\u003c/h2\u003e\u003cp\u003eFresh fecal samples were collected and immersed in sterile phosphate-buffered saline (PBS) at a ratio of 1 fecal pellet per 1 mL of PBS. The mixture was homogenized and centrifuged at 1000 rpm for 5 minutes at 4\u0026deg;C to remove large particulate matter. The resulting supernatant was then centrifuged at 8000 rpm for 5 minutes at 4\u0026deg;C to collect the bacterial pellet. The final bacterial suspension was mixed with sterile glycerol to a final concentration of 20% and stored at \u0026minus;\u0026thinsp;80\u0026deg;C until use. Before transplantation, the bacterial suspension was diluted in sterile PBS to an optical density (OD) of 0.5 at 600 nm, corresponding to approximately 10⁸ CFU/mL\u003csup\u003e[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e4.5 Motor function assessment\u003c/h2\u003e\u003cp\u003eThe recovery of hindlimb motor function was evaluated using the Basso\u0026ndash;Beattie\u0026ndash;Bresnahan (BBB) locomotor rating scale\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e Rats were allowed to walk freely for 5 minutes in an open field (100 cm in diameter), and hindlimb movements and coordination were closely observed. Behavioral assessments were performed on postoperative days 1, 3, 5, 7, 14, 21, and 28 in the Sham, SCI, SCI\u0026thinsp;+\u0026thinsp;FMT, and SCI\u0026thinsp;+\u0026thinsp;FMT (CUR) groups. All scoring was performed by two independent observers who were trained in the BBB scale but blinded to the experimental design. Each evaluation was repeated three times, and the scores were immediately recorded. The scale ranges from 0 (no observable hindlimb movement) to 21 (normal locomotion). On day 28 post-injury, footprint analysis was performed to assess gait and motor coordination\u003csup\u003e[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e. Different colored dyes were applied to the forepaws and hindpaws, and rats were allowed to walk in a straight line on white paper. The test was repeated three times and recorded.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e4.6 Tissue preparation\u003c/h2\u003e\u003cp\u003eOn day 28 post-injury, rats were anesthetized and perfused transcardially with physiological saline. Spinal cord segments 2 cm rostral and caudal to the injury site were collected and fixed in 4% paraformaldehyde (Wuhan Servicebio Technology Co., Ltd.) for 48 hours. Samples were then dehydrated in a graded ethanol series, embedded in paraffin, and sectioned into 10 \u0026micro;m thick slices.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e4.7 Hematoxylin and eosin staining\u003c/h2\u003e\u003cp\u003eSections were stained according to the manufacturer\u0026rsquo;s instructions using an H\u0026amp;E staining kit (Solarbio). The stained slides were dehydrated in graded ethanol, cleared in xylene, and mounted using neutral balsam (Shanghai Specimen and Model Factory, China).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e4.8 Real-time quantitative PCR\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted from spinal cord tissue using TRIzol reagent. cDNA was synthesized using reverse transcriptase, and the expression levels of β-actin, IL-17A, IL-6, RORγt, TGF-β1, and FOXP3 were measured by RT-qPCR. The 2\u003csup\u003e^\u0026minus;ΔΔCt\u003c/sup\u003e method was used to analyze changes in gene expression. PCR primers were designed based on rat mRNA sequences obtained from the GenBank database. Primer sequences are listed in (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimer name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSequences(5\u0026prime;to3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eβ-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF- CACTATCGGCAATGAGCGGTTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR-CAGCACTGTGTTGGCATAGAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eFOXP3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF-AGAGAGGCAGAGGACACTCAATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR-GGTTGTGGCGGATGGCATTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eIL-10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF-CCCTGGGAGAGAAGCTGAAGAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR-TCACCTGCTCCACTGCCTTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eTGF-β1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF-GACCGCAACAACGCAATCTATGAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR-CTGGCACTGCTTCCCGAATGTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eRORγt\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF-ACCACCCTCTTCTCACGGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR-CTTCCATTGCTCCTGCTTTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eIL-17A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF-CCTGATGCTGTTGCTGCTACTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR-GCGTTTGGACACACTGAACTTTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eIL-6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF-CTTCCAGCCAGTTGCCTTCTTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR-TGGTCTGTTGTGGGTGGTACTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e4.9 Enzyme-linked immunosorbent assay\u003c/h2\u003e\u003cp\u003eSpinal cord tissues were weighed and homogenized in 900 \u0026micro;l of normal saline, then centrifuged at 3000 rpm for 10 minutes to obtain tissue homogenates. The concentrations of cytokines including IL-10 (Wuhan Sanying Biotechnology, Cat# KE20003), IL-17A (XINBOS Biological, Cat# ERC170), and IL-6 (Wuhan Sanying Biotechnology, Cat# KE20024) were measured using ELISA kits according to the manufacturers\u0026rsquo; protocols. Absorbance values were measured using a microplate reader, and cytokine concentrations were determined based on standard curves.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e4.10 Western blot analysis\u003c/h2\u003e\u003cp\u003eTotal protein was extracted from spinal cord tissue using RIPA lysis buffer (Beyotime Biotechnology). Protein concentrations were determined using a BCA assay kit (Boster Biological Engineering Co., Ltd.). Equal amounts of protein were separated by SDS-PAGE and transferred to PVDF membranes (Merck Millipore). After blocking with 5% skim milk (Yili Group Co., Ltd.) for 2 hours, the membranes were incubated overnight at 4\u0026deg;C with the following primary antibodies: anti-FOXP3 (AF6544), anti-IL-17A (DF6127), and anti-TGF-β1 (AF1027) (all from Jiangsu Abways Biotechnology), and anti-RORγt (M00444; Boster Biological Engineering, Wuhan). After incubation with the appropriate secondary antibodies (anti-mouse A0216 or anti-rabbit 0208), protein bands were visualized using enhanced chemiluminescence reagents (Solarbio Life Sciences). Band intensities were quantified using ImageJ software and normalized to β-actin.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e4.11 Data analysis and statistics\u003c/h2\u003e\u003cp\u003eStatistical analysis and graph generation were performed using GraphPad Prism 8.0. All experiments were repeated at least three times. Data are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Comparisons between two groups were performed using independent samples t-tests, while comparisons among multiple groups were conducted using one-way analysis of variance (ANOVA), followed by Tukey\u0026rsquo;s post hoc test for pairwise comparisons. Differences were considered statistically significant at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConflict of interest statement\u003c/h2\u003e\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\u003ch2\u003eFunding statement\u003c/h2\u003e\u003cp\u003eThis work was supported by the Graduate Education Innovation Program of Yan\u0026rsquo;an University (YCX2024102 to Chunping Tian), the Graduate Education Innovation Program of Yan\u0026rsquo;an University (YCX2024108 to Jiajun Wu), the Graduate Education Innovation Program of Yan\u0026rsquo;an University (YKY2025010 to Linfeng Xiao) the National Natural Science Foundation of China Funded Project (82560366 to Xiaowei Chang), the General Project of Shaanxi Provincial Department of Science and Technology (2024SF-YBXM-037 to Yanling Yang) and the National Natural Science Foundation of China Funded Project (82560280 to Yanling Yang).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eC-PT were responsible for performing the experiments and writing the text. J-JW and L-FX were responsible for data collection. Q-YW, J-ND and Q-QH participated in overall supervision. J-LQ, X-WC and Y-LY responsible for designing the project and guiding the article. All authors give final approval of the version to be published and give an agreement to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eANJUM A, YAZID M D, FAUZI DAUD M et al (2020) Spinal Cord Injury: Pathophysiology, Multimolecular Interactions, and Underlying Recovery Mechanisms[J/OL]. 21(20):7533. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms21207533\u003c/span\u003e\u003cspan address=\"10.3390/ijms21207533\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCOWAN H, LAKRA C (2020) Autonomic dysreflexia in spinal cord injury[J/OL]. BMJ (Clinical research ed. 371:m3596. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1136/bmj.m3596\u003c/span\u003e\u003cspan address=\"10.1136/bmj.m3596\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHELLENBRAND D J, QUINN C M, PIPER Z J et al (2021) Inflammation after spinal cord injury: a review of the critical timeline of signaling cues and cellular infiltration[J/OL]. J Neuroinflamm 18(1):284. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12974-021-02337-2\u003c/span\u003e\u003cspan address=\"10.1186/s12974-021-02337-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJIN L Y, LI J, WANG K F et al (2021) Blood-Spinal Cord Barrier in Spinal Cord Injury: A Review[J/OL]. J Neurotrauma 38(9):1203\u0026ndash;1224. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1089/neu.2020.7413\u003c/span\u003e\u003cspan address=\"10.1089/neu.2020.7413\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGAO P, YI J, CHEN W et al (2023) Pericyte-derived exosomal miR-210 improves mitochondrial function and inhibits lipid peroxidation in vascular endothelial cells after traumatic spinal cord injury by activating JAK1/STAT3 signaling pathway[J/OL]. J Nanobiotechnol 21(1):452. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12951-023-02110-y\u003c/span\u003e\u003cspan address=\"10.1186/s12951-023-02110-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTANG W, ZHAO K, LI X et al (2024) Bone Marrow Mesenchymal Stem Cell-Derived Exosomes Promote the Recovery of Spinal Cord Injury and Inhibit Ferroptosis by Inactivating IL-17 Pathway[J/OL]. J Mol neuroscience: MN 74(2):33. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s12031-024-02209-3\u003c/span\u003e\u003cspan address=\"10.1007/s12031-024-02209-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZHANG S, ZHONG R, TANG S et al (2024) Metabolic regulation of the Th17/Treg balance in inflammatory bowel disease[J/OL]. Pharmacol Res 203:107184. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.phrs.2024.107184\u003c/span\u003e\u003cspan address=\"10.1016/j.phrs.2024.107184\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZHANG H, CAUDLE Y, WHEELER C et al (2018) TGF-β1/Smad2/3/Foxp3 signaling is required for chronic stress-induced immune suppression[J/OL]. J Neuroimmunol 314:30\u0026ndash;41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jneuroim.2017.11.005\u003c/span\u003e\u003cspan address=\"10.1016/j.jneuroim.2017.11.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBROCKMANN L, TRAN A, HUANG Y et al (2023) Intestinal microbiota-specific Th17 cells possess regulatory properties and suppress effector T cells via c-MAF and IL-10[J/OL]. Immunity 56(12):2719\u0026ndash;2735e7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.immuni.2023.11.003\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2023.11.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCUI H, WANG N, LI H et al (2024) The dynamic shifts of IL-10-producing Th17 and IL-17-producing Treg in health and disease: a crosstalk between ancient Yin-Yang theory and modern immunology[J/OL]. Cell communication signaling: CCS 22(1):99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12964-024-01505-0\u003c/span\u003e\u003cspan address=\"10.1186/s12964-024-01505-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShort-chain fatty (2023) acids ameliorate spinal cord injury recovery by regulating the balance of regulatory T cells and effector IL-17\u0026thinsp;+\u0026thinsp;γδ T cells[J/OL]. J Zhejiang Univ Sci B 24(4):312\u0026ndash;325. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1631/jzus.B2200417\u003c/span\u003e\u003cspan address=\"10.1631/jzus.B2200417\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWESOLOWSKI M, CAN P, WARZECHA K et al (2023) Long-term changes of Th17 and regulatory T cells in peripheral blood of dogs with spinal cord injury after intervertebral disc herniation[J/OL]. BMC Vet Res 19(1):90. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12917-023-03647-8\u003c/span\u003e\u003cspan address=\"10.1186/s12917-023-03647-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLI X, CAO LIUL, Biomedicine et al (2020) Pharmacotherapy = Biomedecine Pharmacotherapie 121:109653. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biopha.2019.109653\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2019.109653\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCRYAN JF, O\u0026rsquo;RIORDAN K J, COWAN C S M et al (2019) The Microbiota-Gut-Brain Axis[J/OL]. Physiol Rev 99(4):1877\u0026ndash;2013. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1152/physrev.00018.2018\u003c/span\u003e\u003cspan address=\"10.1152/physrev.00018.2018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFUNG T C, OLSON C A, HSIAO E Y (2017) Interactions between the microbiota, immune and nervous systems in health and disease[J/OL]. Nat Neurosci 20(2):145\u0026ndash;155. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nn.4476\u003c/span\u003e\u003cspan address=\"10.1038/nn.4476\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eENAMORADO M, KULALERT W, HAN SJ et al (2023) Immunity to the microbiota promotes sensory neuron regeneration[J/OL]. Cell 186(3):607\u0026ndash;620e17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2022.12.037\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2022.12.037\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLUU M (2019) Short-chain fatty acids: Bacterial messengers modulating the immunometabolism of T cells[J/OL]. Eur J Immunol 49(6):842\u0026ndash;848. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/eji.201848009\u003c/span\u003e\u003cspan address=\"10.1002/eji.201848009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZHAO X, STEIN K R, CHEN V et al (2023) Chemoproteomics reveals microbiota-derived aromatic monoamine agonists for GPRC5A[J/OL]. Nat Chem Biol 19(10):1205\u0026ndash;1214. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41589-023-01328-z\u003c/span\u003e\u003cspan address=\"10.1038/s41589-023-01328-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMORRISON D J, PRESTON T (2016) Formation of short chain fatty acids by the gut microbiota and their impact on human metabolism[J/OL]. Gut Microbes 7(3):189\u0026ndash;200. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/19490976.2015.1134082\u003c/span\u003e\u003cspan address=\"10.1080/19490976.2015.1134082\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKAUR J (2023) A mechanistic overview of spinal cord injury, oxidative DNA damage repair and neuroprotective therapies[J/OL]. Int J Neurosci 133(3):307\u0026ndash;321. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/00207454.2021.1912040\u003c/span\u003e\u003cspan address=\"10.1080/00207454.2021.1912040\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMARTIN-GALLAUSIAUX C, MARINELLI L, BLOTTI\u0026Egrave;RE H M et al (2021) SCFA: mechanisms and functional importance in the gut[J/OL]. The Proceedings of the Nutrition Society, 80(1): 37\u0026ndash;49. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1017/S0029665120006916\u003c/span\u003e\u003cspan address=\"10.1017/S0029665120006916\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eERNY D, DOKALIS N, MEZ\u0026Ouml; C et al (2021) Microbiota-derived acetate enables the metabolic fitness of the brain innate immune system during health and disease[J/OL]. Cell Metabol 33(11):2260\u0026ndash;2276e7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cmet.2021.10.010\u003c/span\u003e\u003cspan address=\"10.1016/j.cmet.2021.10.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSU SH, WU Y F, LIN Q et al (2022) Fecal microbiota transplantation and replenishment of short-chain fatty acids protect against chronic cerebral hypoperfusion-induced colonic dysfunction by regulating gut microbiota, differentiation of Th17 cells, and mitochondrial energy metabolism[J/OL]. J Neuroinflamm 19:313. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12974-022-02675-9\u003c/span\u003e\u003cspan address=\"10.1186/s12974-022-02675-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTAN JK, MACKAY C MACIAL (2023) Dietary fiber and SCFAs in the regulation of mucosal immunity[J/OL]. J Allergy Clin Immunol 151(2):361\u0026ndash;370. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jaci.2022.11.007\u003c/span\u003e\u003cspan address=\"10.1016/j.jaci.2022.11.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMAHJOOB M, STOCHAJ U (2021) Curcumin nanoformulations to combat aging-related diseases[J/OL]. Ageing Res Rev 69:101364. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.arr.2021.101364\u003c/span\u003e\u003cspan address=\"10.1016/j.arr.2021.101364\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCHAMANI S, MOOSSAVI M, NAGHIZADEH A et al (2022) Immunomodulatory effects of curcumin in systemic autoimmune diseases[J/OL]. Phytother Res 36(4):1616\u0026ndash;1632. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ptr.7417\u003c/span\u003e\u003cspan address=\"10.1002/ptr.7417\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJIANG C, CHEN Z, WANG X et al (2023) Curcumin-activated Olfactory Ensheathing Cells Improve Functional Recovery After Spinal Cord Injury by Modulating Microglia Polarization Through APOE/TREM2/NF-κB Signaling Pathway[J/OL]. J Neuroimmune Pharmacology: Official J Soc NeuroImmune Pharmacol 18(3):476\u0026ndash;494. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11481-023-10081-y\u003c/span\u003e\u003cspan address=\"10.1007/s11481-023-10081-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAZZINI E, PE\u0026Ntilde;A-CORONA S I, HERN\u0026Aacute;NDEZ-PARRA H et al (2024) Neuroprotective and anti-inflammatory effects of curcumin in Alzheimer\u0026rsquo;s disease: Targeting neuroinflammation strategies[J/OL]. Phytother Res 38(6):3169\u0026ndash;3189. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ptr.8200\u003c/span\u003e\u003cspan address=\"10.1002/ptr.8200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNEBRISI E E (2021) Neuroprotective Activities of Curcumin in Parkinson\u0026rsquo;s Disease: A Review of the Literature[J/OL]. Int J Mol Sci 22(20):11248. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms222011248\u003c/span\u003e\u003cspan address=\"10.3390/ijms222011248\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWANG Q Y,HAO Q,GAO, H et al Effects of Curcumin on Microbial Diversity and Spinal Cord Transcriptomics in Rats after Spinal Cord Injury [J] Microbiology China,2024,51(11):4712\u0026ndash;4724.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.13344/j.microbiol.china.240153\u003c/span\u003e\u003cspan address=\"10.13344/j.microbiol.china.240153\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGAO F, SHEN J, ZHAO L et al (2019) Curcumin Alleviates Lipopolysaccharide (LPS)-Activated Neuroinflammation via Modulation of miR-199b-5p/IκB Kinase β (IKKβ)/Nuclear Factor Kappa B (NF-κB) Pathway in Microglia[J/OL]. Med Sci Monitor: Int Med J Experimental Clin Res 25:9801\u0026ndash;9810. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.12659/MSM.918237\u003c/span\u003e\u003cspan address=\"10.12659/MSM.918237\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCHEN X D, XIE J, WEI Y et al (2023) Immune modulation of Th1/Th2/Treg/Th17/Th9/Th21 cells in rabbits infected with Eimeria stiedai[J/OL]. Front Cell Infect Microbiol 13:1230689. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcimb.2023.1230689\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2023.1230689\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWESTFALL S, CARACCI F, ZHAO D et al (2021) Microbiota metabolites modulate the T helper 17 to regulatory T cell (Th17/Treg) imbalance promoting resilience to stress-induced anxiety- and depressive-like behaviors[J/OL]. Brain, Behavior, and Immunity, 91: 350\u0026ndash;368. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbi.2020.10.013\u003c/span\u003e\u003cspan address=\"10.1016/j.bbi.2020.10.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLI M, VAN ESCH B C A M, HENRICKS P A J et al (2018) The Anti-inflammatory Effects of Short Chain Fatty Acids on Lipopolysaccharide- or Tumor Necrosis Factor α-Stimulated Endothelial Cells via Activation of GPR41/43 and Inhibition of HDACs[J/OL]. Front Pharmacol 9:533. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fphar.2018.00533\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2018.00533\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAKIBA Y, MARUTA K, NARIMATSU K et al (2017) FFA2 activation combined with ulcerogenic COX inhibition induces duodenal mucosal injury via the 5-HT pathway in rats[J/OL]. Am J Physiol - Gastrointest Liver Physiol 313(2):G117\u0026ndash;G128. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1152/ajpgi.00041.2017\u003c/span\u003e\u003cspan address=\"10.1152/ajpgi.00041.2017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTIAN D, XU W, PAN W et al (2022) Fecal microbiota transplantation enhances cell therapy in a rat model of hypoganglionosis by SCFA-induced MEK1/2 signaling pathway[J/OL]. EMBO J 42(1):e111139. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.15252/embj.2022111139\u003c/span\u003e\u003cspan address=\"10.15252/embj.2022111139\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRAKOFF-NAHOUM S, PAGLINO J, ESLAMI-VARZANEH F et al (2004) Recognition of commensal microflora by toll-like receptors is required for intestinal homeostasis[J/OL]. Cell 118(2):229\u0026ndash;241. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2004.07.002\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2004.07.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJANG J H, YEOM M J, AHN S, Brain et al (2020) Behav Immun 89:641\u0026ndash;655. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbi.2020.08.015\u003c/span\u003e\u003cspan address=\"10.1016/j.bbi.2020.08.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMARTINEZ M, BREZUN J M BONNIERL et al (2009) A new rating scale for open-field evaluation of behavioral recovery after cervical spinal cord injury in rats[J/OL]. J Neurotrauma 26(7):1043\u0026ndash;1053. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1089/neu.2008.0717\u003c/span\u003e\u003cspan address=\"10.1089/neu.2008.0717\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQIAN D, XU J, ZHANG X et al (2024) Microenvironment Self-Adaptive Nanomedicine Promotes Spinal Cord Repair by Suppressing Inflammation Cascade and Neural Apoptosis[J/OL]. Adv Mater (Deerfield Beach Fla) 36(50):e2307624. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/adma.202307624\u003c/span\u003e\u003cspan address=\"10.1002/adma.202307624\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"curcumin, gut microbiota, short-chain fatty acids, Treg/Th17, spinal cord injury","lastPublishedDoi":"10.21203/rs.3.rs-7518068/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7518068/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSpinal cord injury (SCI) is a severe traumatic disorder of the central nervous system, for which effective therapeutic strategies remain limited. The balance between regulatory T (Treg) cells and T helper 17 (Th17) cells plays a crucial role in immune regulation and the inflammatory response following SCI. As a vital component of the host microecosystem, the gut microbiota is closely associated with immune regulation. Our previous experimental findings demonstrated that curcumin alters the composition and richness of the gut microbiota. However, the relationship between the curcumin-modulated gut microbiota, Treg/Th17 cell balance, and SCI has not been clearly elucidated. This study aims to investigate the role and underlying mechanisms of the gut microbiota, following curcumin intervention, in improving SCI outcomes. Our results show that the gut microbiota modified by curcumin effectively regulates the Treg/Th17 cell balance, promoting the proliferation of Treg cells and suppressing the activation of Th17 cells. It reduces the release of pro-inflammatory cytokines interleukin-17A (IL-17A) and interleukin-6 (IL-6), as well as the expression of the transcription factor retinoic acid-related orphan receptor γt (RORγt), while increasing the secretion of anti-inflammatory cytokines interleukin-10 (IL-10) and transforming growth factor-β1 (TGF-β1), along with the transcription factor forkhead box P3 (FOXP3). These findings suggest that the gut microbiota altered by curcumin alleviates inflammation and promotes spinal cord repair by modulating the Treg/Th17 cell balance. This study provides a novel potential strategy and theoretical foundation for the treatment of SCI.\u003c/p\u003e","manuscriptTitle":"Curcumin improves spinal cord injury by regulating the Treg/Th17 balance via modulation of the gut microbiota","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-26 14:46:04","doi":"10.21203/rs.3.rs-7518068/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"43be8fac-400d-46ef-a2e2-584e373c66ba","owner":[],"postedDate":"September 26th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-29T09:53:44+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-26 14:46:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7518068","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7518068","identity":"rs-7518068","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}