Impact of Depression on Long Bone Growth and Bone Mass in Adolescent Rats: Insights into the SOX9 Regulatory Mechanism

preprint OA: closed
Full text JSON View at publisher
Full text 41,490 characters · extracted from preprint-html · click to expand
Impact of Depression on Long Bone Growth and Bone Mass in Adolescent Rats: Insights into the SOX9 Regulatory Mechanism | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 9 July 2025 V1 Latest version Share on Impact of Depression on Long Bone Growth and Bone Mass in Adolescent Rats: Insights into the SOX9 Regulatory Mechanism Authors : Xuejun Zhang 0000-0002-5942-505X , Xiangxu Chen , Ying Chen , Chen Wang , and Yonggui Yuan [email protected] Authors Info & Affiliations https://doi.org/10.22541/au.175203970.01284783/v1 246 views 191 downloads Contents Abstract Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract Background: Depression is highly prevalent among adolescents, and evidence suggests it may affect physical development. However, the specific impact of depression on longitudinal bone growth during adolescence remains poorly understood. Therefore, our study aimed to investigate the effects of depression on bone growth and mass in adolescent rats and to elucidate the underlying molecular mechanisms. Methods: In animal studies, depression was induced in adolescent rats using chronic unpredictable mild stress (CUMS), followed by behavioral assessments including sucrose preference, tail suspension, and forced swim tests. For molecular and structural analyses, serum BDNF levels were measured by ELISA, and bone microarchitecture was examined using micro-computed tomography (µCT). Gene expression profiles were analyzed through RNA sequencing, while the expression of growth plate markers (AGG, RUNX2, and OCN) was detected by immunohistochemistry. Additionally, BDNF and SOX9 expression levels were quantified using qPCR and Western blot. Results: In animal studies, CUMS-induced depression in adolescent rats led to reduced body weight, decreased sucrose preference, and increased immobility in behavioral tests. Notably, CUMS significantly impacted bone development, manifesting as shorter femur and tibia lengths, although with increased bone mass parameters (BV/TV and TBN). RNA sequencing revealed 855 downregulated and 567 upregulated genes in osteoblasts from CUMS rats, particularly affecting bone-related pathways. Key bone development markers showed altered expression: decreased AGG and SOX9, but increased RUNX2 and OCN, accompanied by narrower growth plate width. Furthermore, CUMS reduced BDNF levels in both serum and brain tissue. Conclusions: Depression disrupts long bone growth and alters bone architecture through the BDNF/SOX9 signaling pathway, highlighting potential therapeutic targets to mitigate skeletal consequences of depression. Title: Impact of Depression on Long Bone Growth and Bone Mass in Adolescent Rats: Insights into the SOX9 Regulatory Mechanism Background: Depression is highly prevalent among adolescents, and evidence suggests it may affect physical development. However, the specific impact of depression on longitudinal bone growth during adolescence remains poorly understood. Therefore, our study aimed to investigate the effects of depression on bone growth and mass in adolescent rats and to elucidate the underlying molecular mechanisms. Methods: In animal studies, depression was induced in adolescent rats using chronic unpredictable mild stress (CUMS), followed by behavioral assessments including sucrose preference, tail suspension, and forced swim tests. For molecular and structural analyses, serum BDNF levels were measured by ELISA, and bone microarchitecture was examined using micro-computed tomography (µCT). Gene expression profiles were analyzed through RNA sequencing, while the expression of growth plate markers (AGG, RUNX2, and OCN) was detected by immunohistochemistry. Additionally, BDNF and SOX9 expression levels were quantified using qPCR and Western blot. Results: In animal studies, CUMS-induced depression in adolescent rats led to reduced body weight, decreased sucrose preference, and increased immobility in behavioral tests. Notably, CUMS significantly impacted bone development, manifesting as shorter femur and tibia lengths, although with increased bone mass parameters (BV/TV and TBN). RNA sequencing revealed 855 downregulated and 567 upregulated genes in osteoblasts from CUMS rats, particularly affecting bone-related pathways. Key bone development markers showed altered expression: decreased AGG and SOX9, but increased RUNX2 and OCN, accompanied by narrower growth plate width. Furthermore, CUMS reduced BDNF levels in both serum and brain tissue. Conclusions: Depression disrupts long bone growth and alters bone architecture through the BDNF/SOX9 signaling pathway, highlighting potential therapeutic targets to mitigate skeletal consequences of depression. Keywords: depression; CUMS; adolescence; long-bone growth; brain-bone axis Introduction The high prevalence of depression among adolescents has become a serious public health problem. A meta-analysis showed that the global prevalence of depression among adolescents is 12.9%(Lim et al., 2018). Depression in adolescents affects not only mental health but also profoundly impacts physical growth and development. Specifically, adolescent depression negatively affects individual development, especially the growth and development of long bones(Calarge et al., 2014; Tang, Tang, Ren, & Wong, 2019). Adolescent depression may affect bone growth and development through multiple mechanisms, although the exact mechanisms of action remain unclear. Chronic mild unpredictable stress (CUMS) is one of the most commonly used methods to induce depression in experimental rodents. Compared with methods that use acute aversive stress, chronic paradigms, including CUMS, are more reliable and reproducible in inducing depression. Therefore, CUMS is frequently used to induce depression in rodents and can simulate the clinical features of Major Depressive Disorder (MDD)(Antoniuk, Bijata, Ponimaskin, & Wlodarczyk, 2019), with good predictive validity and consistent results regarding behavioral changes and brain biochemical/structural alterations. Brain-derived neurotrophic factor (BDNF) is an important neurotrophic factor that is expressed and secreted in multiple organs, such as the nervous system, skeletal muscle, cardiovascular system, and immune system. It participates in a variety of physiological and pathological processes and is crucial for maintaining the body’s normal functioning. A reduction in BDNF levels may be associated with the pathogenesis of depression and could also become a potential biomarker for assessing the severity and prognosis of the condition(Pandey et al., 2010; Shimizu et al., 2003). In recent years, an increasing number of studies have revealed that BDNF is also involved in regulating the processes of bone development and remodeling. BDNF can activate the intracellular ERK and AKT signaling pathways through TrkB receptors, upregulate the expression of SOX9 in bone growth plate chondrocytes, and thereby promote chondrocyte proliferation and matrix synthesis, participating in the regulation of bone development(Brunoni, Lopes, & Fregni, 2008; Hutchison, 2012). SOX9 is a key transcription factor that plays a critical role during neonatal and postnatal growth. SOX9 is essential for chondrogenesis, promoting the differentiation of mesenchymal stem cells into chondrocytes and initiating the chondrogenic process(Akiyama, Chaboissier, Martin, Schedl, & de Crombrugghe, 2002). SOX9 continues to be expressed in chondrocytes during the proliferative phase and prehypertrophic phase, promoting chondrocyte proliferation, maintaining their phenotypic characteristics, and preventing premature transition into the hypertrophic phase(Dy et al., 2012). SOX9 expression in chondrocytes helps to prevent the cells from dedifferentiating and transdifferentiating into osteoblasts, thus maintaining chondrocyte stability and the integrity of cartilage tissue(Henry, Liang, Akdemir, & de Crombrugghe, 2012). It is expressed at all levels of the growth plate, especially in the resting zone and proliferative zone. Loss of SOX9 function can cause growth plate chondrocytes to enter the hypertrophic phase prematurely, accelerating growth plate closure and leading to stunted growth(Akiyama et al., 2004). In summary, SOX9 may play a pivotal role in skeletal development by inhibiting premature chondrocyte hypertrophy and osteoblast differentiation, maintaining cellular stability, and ensuring the viability of cartilage tissue. The specific mechanism of BDNF regulating SOX9 expression in skeletal development and disease requires more research to elucidate. However, whether depression can disturb long-bone growth or how depression affect long-bone growth remains unclear. Therefore, we hypothesized that depression suppresses long-bone growth in juvenile rats by stimulating brain-bone axis via BDNF/SOX9 signaling pathway. In this study, we established the CUMS depression young rat model to investigate the roles of brain-bone axis via BDNF/SOX9 signaling pathway in the long-bone growth. Materials and methods Ethics consideration The local ethics committee reviewed, approved, and supervised the animal protocol of this study (NO. 20201207002). Animals Male Sprague Dawley rats (80-140g) were purchased from Charles River. All animals were housed under SPF barrier environment conditions with constant temperature of 22±0.5 °C and humidity of 50%±5%. The room was set as cycles of 12 h light and 12 h dark. Rats were allowed to standard lab chow and drinking water ad libitum. Rats were allowed to adapt the new environment for a week before any interventions. CUMS The CUMS procedure was conducted according to a previous publication (Wang et al., 2020) with minor modifications. First, adolescent rats that were randomly assigned to CUMS were exposed to different stressors. Those random stressors included cage tilting for 24h, cold swim at 0 °C for 3 min, water or food deprivation for 24h, tail nip at 1 cm from the tail tip for 1 min, level shaking for 15 min, heat stress at 45°C for 5min, and inversion of the light/dark cycle for 24 h. Each stressor was applied for a total of six times. These random stressors were induced to rats for a total of 42 days. The stressors were placed on rats with random orders but the same stressors were not conducted on 2 consecutive days, so those animals were unable to predict the next stressor. The total length of CUMS was 6 weeks (Week 1 to Week 7, Figure 2 A). Rats in the control group were left unstressed unless housekeeping procedures including cage changes, and water and food refreshment. Sucrose preference test (SPT) During the measurements, the sucrose preference test (SPT) was utilized to verify and quality loss of interest in rewarding stimuli in animals. Before the test, rats were deprived of food and water for 12 h. Rats were placed in various cages accessing continuously to two bottles for 24 h, one of which was sucrose water (1%) and the other one was tap autoclaved tap water. The positions of the 2 bottles were switched after 6 h to eliminate the possible preference of one side on drinking bottles. The consumption of sucrose solution and drinking water was measured. The sucrose preference (SP) was calculated as: sucrose intake (ml)/[sucrose intake (ml)+water intake (ml)]×100%. Tail Suspension Test (TST) All behavioral tests were performed at the same time of the day (starting at 10 am) at the same location of the animal room. Rats were individually suspended on a 55-cm-high lab rack by adhesive tapes at about 1 cm away from the tail tip. Rats were temporally separated from each other by baffles to prevent potential mutual interference during the suspension time that was set as 5 min long. The cumulative immobility time was documented. Forced Swim Test (FST) The FST was conducted in a transparent glass cylinder that was filled with water (23-25 °C). The dimension of the cylinder was 65 cm in height and 30 cm in diameter. The water level was set as 45 cm from the bottom. Rats were individually placed in the reservoir for 5 min. The time of immobility was documented by analyzing videos recorded during the FST. Rats were considered immobile when they stopped swimming and remained floating passively, but kept heads above the water. After the FST, rats were removed from water gently and dried by a towel. The cage was warmed by a heat blanket. Bone microarchitecture The bone microarchitecture as well as the length of the femur and the tibia were measured using micro-computerized tomography (µCT) (Smith et al., 2014). Parameters, including the trabecular bone volume per unit of the total volume (BV/TV), trabecular number (TBN), trabecular thickness (TBTH), trabecular separation (TBSP), cortical bone thickness (CorTH), were calculated using micro-CT images. We selected right femurs to scan by using micro-CT (Skyscan1176, USA Bruker) with the following parameter settings: source voltage, 50 kV; source current, 450 μA; AI 0.5 mm filter; pixel size 9 μm; rotation step, 0.4 degree. The obtained images were reconstructed with NRecon software (Bruker microCT, Kontich, Belgium) using the following parameter settings: ring artefact correction, 8; smoothing, 2; beam hardening correction, 30%. For the distal metaphysis,a refined volume of interest was generated 200 images under the growth plate of the distal femur. For the shaft, the reference section was the growth plate; we moved forward by 500 images and plotted the VOI between the endosteum and periosteum on 100 images. The constant threshold was set as 80-255. Parameters, including the trabecular bone volume per unit of the total volume (BV/TV), trabecular number (TBN), trabecular thickness (TBTH), trabecular separation (TBSP), cortical bone thickness (CorTH), were analyzed by the program CTAn (Bruker microCT, Kontich, Belgium. RNAseq Bone tissues from the distal femurs were collected from the Control group (n=4) and the CUMS group (n=5). Total RNA was collected using the TRisol method, and the samples were frozen to -80° C for further sequencing. The raw reads from the sequencer were trimmed using the FAXTX Toolkit (v.0.0.13; http://hannonlab.cshl.edu/fastx_toolkit/) to remove those that were than 16 nt. Subsequently, the clean reads were checked for the quality using FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc). Clean reads were aligned to the mRatBN7.2 Rat Genome using HISAT2. Uniquely mapped reads were utilized to calculate the read number and reads per kilo-base of exon per million fragments mapped (FPKM) for every known gene. DEseq2 was utilized to analyze the gene dispersion, which subsequently was reduced. DEseq2 was also used to compare the differential expression of genes between to or more specimens. The difference among individuals was expressed as fold change (FC) and false discovery rate (FDR). The cut-off value of difference was pre-determined as FC ≥2 or ≤ 0.5,or FDR < 0.01. Immunohistochemistry The femur bone was removed from rats after euthanization, and fixed in 4% buffered formalin for 24 h. Subsequently, the bone specimens were decalcified and embedded in paraffin. Sections with a thickness of 4-6 µm were cut. Slides were then incubated with primary antibodies for aggrecan (AGG), RUNX2 and osteocalcin (OCN, all purchased from Proteintech) for immunohistochemistry according to a published paper (Jiang et al., 2020). Safranine O-Fast Green Staining Safranine O-Fast Green Staining is commonly used for the demonstration of cartilage, bone, and other connective tissues. Paraffin sections were incubated in Weigert’s iron hematoxylin solution for 5-10 minutes, 0.1% safranin O solution for 5-10 minutes and 0.2% fast green solution for 30 seconds. Cartilage was stained red by safranine O stains, and bone and connective tissues were stained green by fast greens stains. qRTPCR Total RNA was extracted using TRizol (Invitrogen). Total RNA, after concentration measurements using NanoRop (Thermo Fisher Scientific), was applied to cDNA synthesis using a PrimeScript RT kit (Takara, Shiga, Japan). qPCR was achieved by using SYBR-Green PCR Master Mix (Takara). Primers (5’ to 3’) were the following: Sox9 (CTGAAGGGCTACGACTGGAC and TACTGGTCTGCCAGCTCCCT); OCN (CATGAGGACCCTCTCTXTGC and TGGACATGAAGGCTTTGTCA); Col1a1 (F:GGAGTGTGGTGGCCGCGATG and GCTGTAGGTGGATCGACTGTTGC); Actin (GTAGCCATCCAGGCTGTGTT and CCCTCATAGATGGGCACAGT). Western-blotting Ten micrograms of cellular lysate protein were separated using SDS‒PAGE and transferred to nitrocellulose membranes (Bio-Rad, Hercules, USA). The membranes were incubated with a rabbit monoclonal anti-rat SOX9 antibody, rabbit monoclonal anti-rat OCN antibody, rabbit monoclonal anti-rat BDNF antibody, rabbit monoclonal anti-rat ACTIN antibody and rabbit monoclonal anti-rat GAPDH antibody (all purchased from Proteintech) overnight at 4°C. 2.13 Statistics The data are presented as the means ± SDs. IBM SPSS statistics version 25 software and GraphPad Prism version 8.4.0 software were used to analyse the data. RNAseq’s statistics was conducted using the software package. After evaluation for normality by the Shapiro‒Wilk test, the data were analysed by t test or one-way ANOVA with Fisher’s LSD post hoc test. * P <0.05, ** P <0.01, *** P <0.001 **** P <0.0001 indicate different levels of significance. Results Depression-Like Symptoms by CUMS in Adolescent Rats The experimental protocol began with a one-week adaptation period, followed by 6 weeks of continuous CUMS exposure in the experimental group. CUMS-treated rats exhibited significant depressive-like behaviors, characterized by reduced body weight, decreased sucrose preference, and increased immobility time in both TST and FST(Figure 1). These behavioral changes confirmed the successful establishment of a depression model in adolescent rats through CUMS exposure. 3.2 Impact of CUMS on Long Bone Growth in Adolescent Rats Assessment of bone development revealed that CUMS exposure significantly reduced femur and tibia lengths in adolescent rats (Figure 2A). µCT analysis demonstrated increased bone mass in the CUMS group (Figure 2B). Quantitative analysis of bone parameters (Figure 2C) showed elevated trabecular bone volume per total volume (BV/TV) and trabecular number (TBN), alongside decreased trabecular separation (TBSP) in CUMS-treated rats. Trabecular thickness (TBTH) and cortical bone thickness (CorTH) remained unchanged between groups. These findings indicate that CUMS impairs longitudinal bone growth while paradoxically increasing bone mass during adolescence. 3.3 CUMS affects gene expression related to differentiation, ossification, and proliferation in osteoblasts RNA sequencing analysis of osteoblasts revealed distinct gene expression patterns between Control and CUMS groups (Figure 3A). In CUMS-treated osteoblasts, 855 genes were downregulated and 567 genes were upregulated (Figure 3B), with notable downregulation of Sox9 (Figure 3C). The heatmap demonstrated clear differentiation of gene expression profiles between groups. Gene ontology analysis identified significant alterations in pathways governing osteoblast differentiation, ossification, cell migration, and proliferation (Figures 3D and E), suggesting widespread effects of CUMS on bone-related molecular processes. 3.4 Disruption of Epiphyseal Growth Plate Architecture and Bone Mass by CUMS We subsequently investigated the expression of key markers crucial for epiphyseal growth plate architecture and bone mass. As depicted in Figure 4, AGG, a pivotal factor in growth plate architecture and differentiation (Lauing et al., 2014), exhibited decreased expression levels in the CUMS group. Similarly, SF staining exhibited narrower area of the growth plate in CUMS group. Additionally, RUNX2, known to inhibit osteoblast maturation and mature bone formation (Komori, 2010), showed increased expression in response to CUMS. Furthermore, OCN, which promotes bone mineralization, displayed heightened expression levels in the CUMS group. The growth plate width is narrower in the CUMS group compared to the control group. These findings collectively suggest that CUMS disrupts bone growth and maturation at the molecular level. 3.5 Disruption of Osteoblast Differentiation and Ossification by CUMS via SOX9 Downregulation Given the critical role of SOX9 in bone growth plate development (Endo & Kobayashi, 2013), we examined its expression pattern in our model. qPCR analysis revealed decreased SOX9 expression with concurrent upregulation of OCN and Col1a1 in CUMS-treated rats (Figure 5A). Western blot analysis confirmed the downregulation of SOX9 at protein level (Figure 5B), demonstrating consistent CUMS-induced suppression of SOX9 at both transcriptional and translational levels. 3.7 CUMS on BDNF Expression in Serum and Brain Previous research has highlighted the potential influence of depression on the expression of BDNF in the brain. In this investigation, we sought to assess BDNF expression in both rat serum and brain tissue. The serum concentration of BDNF in the CUMS group exhibited a significant decrease compared to the control group (Figure 5C). Furthermore, analysis of BDNF protein levels in rat brain tissue revealed a reduction in the CUMS group relative to the control group (Figure 5D). Discussion The present study aimed to elucidate the impact of depression on long bone growth in adolescent rats and to explore the potential involvement of the BDNF/SOX9 signaling pathway in mediating these effects. Our findings contribute to a deeper understanding of the complex interplay between depression, neurotrophic factors, and skeletal development. In our study, rats subjected to CUMS exhibited a pronounced decrease in both femur and tibia length compared to the control group. Histological staining of bone architecture markers revealed a narrower growth plate width in CUMS-exposed rats compared to the control group. These results suggested depression inhibited the length growth of long bone. Additionally, we assessed various parameters related to bone structure, and found increased BV/TV and TBN in the CUMS group accompanied by decreased TBSP compared to controls. However, no significant differences were observed in TBTH and CorTH between the control and CUMS groups. These results showed that depression increased bone mass in long bones of adolescent rats, suggesting that depression disturbed long bone growth. Foertsch et al. established a mice model of post-traumatic stress disorder (PTSD) and found that chronic psychosocial stress affected both longitudinal and appositional bone growth in adolescent mice though stimulating endochondral ossification in the growth plate(Foertsch et al., 2017). Many studied presented the relationship between depression and bone loss in adults. Yirmiya et al. established model of depression by chronic mild stress in rodents, and showed decreased trabecular bone volume density, trabecular number, and trabecular connectivity density assessed in femurs and vertebra(Yirmiya et al., 2006). A meta-analysis presented the association of bone mineral density and depression, and revealed that adults with MDD appeared to have lower BMD(Yuan et al., 2021). These results suggested that depression play different roles in bone growth in different stage of life. Our results indicated that CUMS disrupts the normal development and growth of long bones in adolescent rats, potentially impacting overall skeletal health. Despite the recognized link between psychiatric and somatic ailments, the reciprocal relationship between mental and skeletal health remains relatively unexplored. Bone-brain crosstalk is a complex interplay between the skeletal and nervous systems that plays a significant role in maintaining overall health and homeostasis, as well as in the pathophysiology of various diseases such as osteoporosis, depression, and neurodegenerative disorders(Shi et al., 2024). BDNF is a neurotrophin that plays a crucial role in neuronal survival, growth, and plasticity, particularly in the hippocampus and other brain regions involved in mood regulation and cognitive function. Many studies presented a potential link between blood BDNF levels and depression. In our study we found that the levels of serum BDNF was significantly decreased, which was in line with many studies. Félicien K et al. investigated 30 major depressed patients and 30 healthy controls, and they found serum BDNF levels in major depressed patients were significantly decreased(Karege et al., 2002). Reduced BDNF levels were associated with smaller hippocampal volumes, which are commonly observed in individuals with MDD(Frodl et al., 2006). Furthermore, we detected the protein expression in hippocampus, and we found a lower expression in CUMS group. Some studies showed that the gene and protein expression of BDNF was significantly decreased in hippocampus of the depressed subjects compared with normal control subjects(Lee & Kim, 2010) (Rasmusson, Shi, & Duman, 2002; Roceri, Hendriks, Racagni, Ellenbroek, & Riva, 2002). These indicated that BDNF played a role in depression. In recent years, many studies presented that BDNF participated in regulating the process of bone development and remodeling. BDNF promoted chondrocyte proliferation and matrix synthesis by up-regulating the SOX9 expression in chondrocytes of growth plate stimulating bone growth(Hutchison, 2012) (Hutchison, Bassett, & White, 2010). In our study, RNA sequencing showed declined expression of sox9 in CUMS group. In order to investigate the role of SOX9 in bone development of the depression rats, we detected the gene and protein expression of SOX9 in bones of the growth plates. In line with our expected, SOX9 expression was significantly decreased in bones of the depression rats. Haseeb A et al. showed SOX9 inhibited chondrocyte dedifferentiation/osteoblastic redifferentiation in growth plates and articular cartilage by establishing conditional knockout mice and using high-throughput sequencing assays(Haseeb et al., 2021). These suggested that BDNF might affect the expression of SOX9 in chondrocytes of growth plate stimulating chondrocyte dedifferentiation and osteoblastic redifferentiation in depression subjects. These could explain the reason of the shorter length of long bones and more bone mass in long bones of the depression rats compared with the normal control rats. Despite the compelling findings, several limitations of our study warrant consideration. Firstly, the use of animal models may not fully capture the complexity of human depression and its effects on skeletal development. Future studies incorporating human-derived samples or longitudinal clinical investigations are necessary to validate our findings in a clinical context. Additionally, further research is needed to elucidate the specific mechanisms linking BDNF signaling to SOX9 expression in skeletal tissues, providing a more comprehensive understanding of the molecular underpinnings of depression-mediated skeletal pathology. Conclusion In conclusion, our study provides novel insights into the effects of depression on skeletal development and highlights the potential involvement of the BDNF/SOX9 signaling pathway in mediating these effects. By unraveling the intricate interplay between depression, neurotrophic factors, and skeletal biology, our findings offer promising avenues for the development of targeted therapeutic strategies aimed at ameliorating the skeletal consequences of depression and improving overall health outcomes. References Akiyama, H., Chaboissier, M. C., Martin, J. F., Schedl, A., & de Crombrugghe, B. (2002). The transcription factor Sox9 has essential roles in successive steps of the chondrocyte differentiation pathway and is required for expression of Sox5 and Sox6. Genes Dev, 16 (21), 2813-2828. doi:10.1101/gad.1017802Akiyama, H., Lyons, J. P., Mori-Akiyama, Y., Yang, X., Zhang, R., Zhang, Z., . . . de Crombrugghe, B. (2004). Interactions between Sox9 and beta-catenin control chondrocyte differentiation. Genes Dev, 18 (9), 1072-1087. doi:10.1101/gad.1171104Antoniuk, S., Bijata, M., Ponimaskin, E., & Wlodarczyk, J. (2019). Chronic unpredictable mild stress for modeling depression in rodents: Meta-analysis of model reliability. Neurosci Biobehav Rev, 99 , 101-116. doi:10.1016/j.neubiorev.2018.12.002Brunoni, A. R., Lopes, M., & Fregni, F. (2008). A systematic review and meta-analysis of clinical studies on major depression and BDNF levels: implications for the role of neuroplasticity in depression. Int J Neuropsychopharmacol, 11 (8), 1169-1180. doi:10.1017/S1461145708009309Calarge, C. A., Butcher, B. D., Burns, T. L., Coryell, W. H., Schlechte, J. A., & Zemel, B. S. (2014). Major depressive disorder and bone mass in adolescents and young adults. J Bone Miner Res, 29 (10), 2230-2237. doi:10.1002/jbmr.2249Dy, P., Wang, W., Bhattaram, P., Wang, Q., Wang, L., Ballock, R. T., & Lefebvre, V. (2012). Sox9 directs hypertrophic maturation and blocks osteoblast differentiation of growth plate chondrocytes. Dev Cell, 22 (3), 597-609. doi:10.1016/j.devcel.2011.12.024Endo, T., & Kobayashi, T. (2013). Excess TSH causes abnormal skeletal development in young mice with hypothyroidism via suppressive effects on the growth plate. Am J Physiol Endocrinol Metab, 305 (5), E660-666. doi:10.1152/ajpendo.00067.2013Foertsch, S., Haffner-Luntzer, M., Kroner, J., Gross, F., Kaiser, K., Erber, M., . . . Ignatius, A. (2017). Chronic psychosocial stress disturbs long-bone growth in adolescent mice. Dis Model Mech, 10 (12), 1399-1409. doi:10.1242/dmm.030916Frodl, T., Schaub, A., Banac, S., Charypar, M., Jager, M., Kummler, P., . . . Meisenzahl, E. M. (2006). Reduced hippocampal volume correlates with executive dysfunctioning in major depression. J Psychiatry Neurosci, 31 (5), 316-323. Haseeb, A., Kc, R., Angelozzi, M., de Charleroy, C., Rux, D., Tower, R. J., . . . Lefebvre, V. (2021). SOX9 keeps growth plates and articular cartilage healthy by inhibiting chondrocyte dedifferentiation/osteoblastic redifferentiation. Proc Natl Acad Sci U S A, 118 (8). doi:10.1073/pnas.2019152118Henry, S. P., Liang, S., Akdemir, K. C., & de Crombrugghe, B. (2012). The postnatal role of Sox9 in cartilage. J Bone Miner Res, 27 (12), 2511-2525. doi:10.1002/jbmr.1696Hutchison, M. R. (2012). BDNF alters ERK/p38 MAPK activity ratios to promote differentiation in growth plate chondrocytes. Mol Endocrinol, 26 (8), 1406-1416. doi:10.1210/me.2012-1063Hutchison, M. R., Bassett, M. H., & White, P. C. (2010). SCF, BDNF, and Gas6 are regulators of growth plate chondrocyte proliferation and differentiation. Mol Endocrinol, 24 (1), 193-203. doi:10.1210/me.2009-0228Jiang, Y., Qin, H., Wan, H., Yang, J., Yu, Q., Jiang, M., & Yu, B. (2020). Asprin-loaded strontium-containing alpha-calcium sulphate hemihydrate/nano-hydroxyapatite composite promotes regeneration of critical bone defects. J Cell Mol Med, 24 (23), 13690-13702. doi:10.1111/jcmm.15918Karege, F., Perret, G., Bondolfi, G., Schwald, M., Bertschy, G., & Aubry, J. M. (2002). Decreased serum brain-derived neurotrophic factor levels in major depressed patients. Psychiatry Res, 109 (2), 143-148. doi:10.1016/s0165-1781(02)00005-7Komori, T. (2010). Regulation of osteoblast differentiation by Runx2. Adv Exp Med Biol, 658 , 43-49. doi:10.1007/978-1-4419-1050-9_5Lauing, K. L., Cortes, M., Domowicz, M. S., Henry, J. G., Baria, A. T., & Schwartz, N. B. (2014). Aggrecan is required for growth plate cytoarchitecture and differentiation. Dev Biol, 396 (2), 224-236. doi:10.1016/j.ydbio.2014.10.005Lee, B. H., & Kim, Y. K. (2010). The roles of BDNF in the pathophysiology of major depression and in antidepressant treatment. Psychiatry Investig, 7 (4), 231-235. doi:10.4306/pi.2010.7.4.231Lim, G. Y., Tam, W. W., Lu, Y., Ho, C. S., Zhang, M. W., & Ho, R. C. (2018). Prevalence of Depression in the Community from 30 Countries between 1994 and 2014. Sci Rep, 8 (1), 2861. doi:10.1038/s41598-018-21243-xPandey, G. N., Dwivedi, Y., Rizavi, H. S., Ren, X., Zhang, H., & Pavuluri, M. N. (2010). Brain-derived neurotrophic factor gene and protein expression in pediatric and adult depressed subjects. Prog Neuropsychopharmacol Biol Psychiatry, 34 (4), 645-651. doi:10.1016/j.pnpbp.2010.03.003Rasmusson, A. M., Shi, L., & Duman, R. (2002). Downregulation of BDNF mRNA in the hippocampal dentate gyrus after re-exposure to cues previously associated with footshock. Neuropsychopharmacology, 27 (2), 133-142. doi:10.1016/S0893-133X(02)00286-5Roceri, M., Hendriks, W., Racagni, G., Ellenbroek, B. A., & Riva, M. A. (2002). Early maternal deprivation reduces the expression of BDNF and NMDA receptor subunits in rat hippocampus. Mol Psychiatry, 7 (6), 609-616. doi:10.1038/sj.mp.4001036Shi, T., Shen, S., Shi, Y., Wang, Q., Zhang, G., Lin, J., . . . Guo, B. (2024). Osteocyte-derived sclerostin impairs cognitive function during ageing and Alzheimer’s disease progression. Nat Metab . doi:10.1038/s42255-024-00989-xShimizu, E., Hashimoto, K., Okamura, N., Koike, K., Komatsu, N., Kumakiri, C., . . . Iyo, M. (2003). Alterations of serum levels of brain-derived neurotrophic factor (BDNF) in depressed patients with or without antidepressants. Biol Psychiatry, 54 (1), 70-75. doi:10.1016/s0006-3223(03)00181-1Smith, B. J., Bu, S. Y., Wang, Y., Rendina, E., Lim, Y. F., Marlow, D., . . . Lucas, E. A. (2014). A comparative study of the bone metabolic response to dried plum supplementation and PTH treatment in adult, osteopenic ovariectomized rat. Bone, 58 , 151-159. doi:10.1016/j.bone.2013.10.005Tang, X., Tang, S., Ren, Z., & Wong, D. F. K. (2019). Prevalence of depressive symptoms among adolescents in secondary school in mainland China: A systematic review and meta-analysis. J Affect Disord, 245 , 498-507. doi:10.1016/j.jad.2018.11.043Wang, W., Qin, X., Wang, R., Xu, J., Wu, H., Khalid, A., . . . Pan, F. (2020). EZH2 is involved in vulnerability to neuroinflammation and depression-like behaviors induced by chronic stress in different aged mice. J Affect Disord, 272 , 452-464. doi:10.1016/j.jad.2020.03.154Yirmiya, R., Goshen, I., Bajayo, A., Kreisel, T., Feldman, S., Tam, J., . . . Bab, I. (2006). Depression induces bone loss through stimulation of the sympathetic nervous system. Proc Natl Acad Sci U S A, 103 (45), 16876-16881. doi:10.1073/pnas.0604234103Yuan, S., Chen, J., Zeng, L., Zhou, C., Yu, S., & Fang, L. (2021). Association of bone mineral density and depression in different bone sites and ages: A meta-analysis. Food Sci Nutr, 9 (9), 4780-4792. doi:10.1002/fsn3.2379 Acknowledgements We would like to thank the researchers and staff involved in the software and databases used in this study. Conflict of interest statement The authors declare that they have no conflict of interest. Ethical Statement This study was approved by the Animal Experimental Ethics Committee (Approval Number: 20201207002). Figure legends Figure 1. CUMS Induces Depression-Like Symptoms in Rats. A. Experimental Design Schematic B. CUMS induced depression-like symptoms, such as body weight, sucrose intake, Forced Swim Test (FST) and Tail Suspension Test (TST). Statistical significance: ***, P < 0.001; ****, P < 0.0001. Figure 2. Disruption of Long Bone Growth in CUMS Rats. A. Length of Femur and Tibia in CUMS Rats. B. Representative 2D and 3D μCT images of the femurs. C. Histomorphometric quantification of BV/TV, Tb.N, Tb.Th, Tb.Sp and CorTh in femurs. Statistical significance: ** P < 0.01; *** P < 0.001; **** P < 0.0001. Figure 3. Differential Gene Expression between the CUMS and control Groups by RNA sequencing. A. Principal Component Analysis (PCA). Principal component analysis based on FPKM values of all expressed genes. Confidence ellipses represent each group. B. Volcano Plot of Differentially Expressed Genes (DEGs). Volcano plot displaying DEGs identified between the two groups using DEseq2. Criteria: FDR < 0.01 and FC (fold change) ≥ 2 or ≤ 0.5. C. Heatmap of DEGs Expression Profile. Heatmap illustrating the expression profiles of differential genes in the two groups. D-E. Enriched Gene Ontology (GO) Biological Processes. Scatter plots demonstrating the most enriched GO biological processes among up-regulated and down-regulated DEGs. Statistical significance: *** P < 0.001. Figure 4. Histological staining of SF staining and immunohistochemistry staining of AGG, RUNX2 and OCN. Figure 5. Gene and protein expression changes in bone and brain tissues. (A) Gene expression levels of Sox9, Col1a1, and OCN in femur bone tissues. (B) Protein expression levels of Sox9, OCN, and Actin in femurs. CUMS decreases the expression of BNDF at both the serum mRNA level (C) and the protein level (D) in the brain. **P<0.01, **** P < 0.0001. Information & Authors Information Version history V1 Version 1 09 July 2025 Copyright This work is licensed under a Non Exclusive No Reuse License. Keywords adolescence depression Authors Affiliations Xuejun Zhang 0000-0002-5942-505X Southeast University Zhongda Hospital Department of Orthopedics View all articles by this author Xiangxu Chen Southeast University Zhongda Hospital Department of Orthopedics View all articles by this author Ying Chen Southeast University Zhongda Hospital View all articles by this author Chen Wang Southeast University Zhongda Hospital Department of Orthopedics View all articles by this author Yonggui Yuan [email protected] Southeast University Zhongda Hospital View all articles by this author Metrics & Citations Metrics Article Usage 246 views 191 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Xuejun Zhang, Xiangxu Chen, Ying Chen, et al. Impact of Depression on Long Bone Growth and Bone Mass in Adolescent Rats: Insights into the SOX9 Regulatory Mechanism. Authorea . 09 July 2025. DOI: https://doi.org/10.22541/au.175203970.01284783/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.175203970.01284783/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9ffaab439cdc58d3',t:'MTc3OTQ0MDgzMA=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00