Esophageal cancer derived exosomes imbalance circulating Tfh/Tfr via EXO-PDL1 to promote immunosuppression

Esophageal cancer derived exosomes imbalance circulating Tfh/Tfr via EXO-PDL1 to promote immunosuppression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Esophageal cancer derived exosomes imbalance circulating Tfh/Tfr via EXO-PDL1 to promote immunosuppression Zijie Li, Yuehua Zhang, He Hao, Lu Chen, Tingting Lv, Xiaokuan Zhang, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3089394/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background : Esophageal cancer (EC) is a deadly malignancy. Exosomal programmed death ligand 1 (EXO-PDL1) induces immune escape to promote tumor progression. Furthermore, the imbalance between circulating follicular helper T cells (Tfh) and circulating follicular regulatory T cells (Tfr) is related to the progression of many malignant tumors. However, the role of the EC derived EXO-PDL1 in circulating Tfh/Tfr is unknown. Methods : Circulating Tfh and circulating Tfr cells were determined using flow cytometry. Exosomes were isolated using differential centrifugation and PDL1 expression on exosomes was tested using ELISA. Exosomes were cultured in vitro for Tfh and Tfr cells expansion assays. Naïve CD4 + T cells were isolated, stimulated, and cultured in vitro with exosomes to evaluate the frequencies, phenotypes, and functions of Tfh and Tfr cells.. Results : For EC patients, the proportion of circulating Tfh cells was lower than that in HD whereas the proportion of circulating Tfr cells was higher. EC patients showed a significantly lower circulating Tfh/Tfr and a higher level of EXO-PDL1 than HD, and a negative correlation was noted between EXO-PDL1 and circulating Tfh/Tfr. EXO-PDL1 inhibited the expansion of Tfh cells and enhanced the percentage of CTLA4 + Tfh cells. Additionally, the levels of IL-21 and IFN-γ decreased, whereas IL-10 level was increased. EXO-PDL1 promoted the expansion and suppressive functions of circulating Tfr cells, the increased percentages of CTLA4 + Tfr cells and ICOS + Tfr cells were accompanied with higher levels of IL-10, IFN-γ, and IL-21. Conclusions : Our results suggest a novel mechanism of EXO-PDL1 mediated immunosuppression in EC. Thus, inhibiting EXO-PDL1 to restore circulating Tfh/Tfr balance may provide new therapeutic approaches in EC treatment. esophageal cancer follicular regulatory T cells follicular helper T cells EXO-PDL1 immunosuppression Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction EC is a common but deadly malignancy even when treated with immune checkpoint inhibitors. Cancer derived exosomes modulate the immune systems by triggering the immunosuppressive response [ 1 ], which in turn favors tumor progression [ 2 ]. These exosomes regulate the functions of immune cells by expressing immunosuppressive or pro-apoptotic molecules on their surface, including programmed death ligand 1 (PDL1) and CTLA4 [ 3 ]. Furthermore, exosomes derived from tumors reflect the characteristics of their parent cells and promote tumor progression by presenting PDL1. Exosomal-PDL1 (EXO-PDL1) mediates programmed death receptor 1 (PD1) crosslinking and immunosuppression as it has a similar extracellular membrane topology as its cell surface counterpart [ 4 ]. Exosomes suppress T cells in a PDL1 dependent fashion. For instance, removal of tumor exosomes from TRAMP-C2 cells recapitulated the effects of deleting PDL1 [ 5 ], suggesting that exosomes are a significant source of extra-tumoral PDL1 and may contribute to PD1 antibody treatment resistance [ 6 , 7 ]. Indeed, exosomes may be more potent immunosuppressants than other forms of extracellular PDL1 [ 4 ] and PDL1 levels on circulating exosomes appear to be a more reliable prognostic marker than PDL1 expression in tumor biopsies. Thus, monitoring circulating EXO-PDL1 maybe useful to predict the tumor response to treatment and clinical outcome [ 8 ]. In addition, the role of EXO-PDL1 in the formation of systemic immunosuppression may be more important than previously assumed [ 9 ]. Circulating Tfh and Tfr cells share many characteristics. Specifically, they co-express PD1, chemokine receptor 5 (CXCR5) as well as produce IL-21, IL-10, and IFN-γ. Tfh and Tfr cells are believed to be involved in the pathogenesis of many kinds of cancers. Tfr cells play a suppressive role during the generation of CD38 + CD27 high plasma blasts [ 10 ], leading to the immunosuppression. Tfh cells represent a distinct lineage of helper CD4 + T cells; they express CXCR5 and migrate into B cell follicles. Inducible T cell co-stimulator (ICOS), a cell surface co-stimulatory molecule, is highly expressed on Tfh cells and crucial for the interaction of Tfh cells with B cells [ 11 , 12 ]. Tfh cells play an important role in tumor immune protection [ 13 ]. A subset of FoxP3 + regulatory T cells that suppress different types of immune responses are known as Tfr cells [ 14 , 15 ]. They act as a regulatory counterpart for Tfh cells [ 16 ]. Tfr cells regulate germinal center responses and prevent antibody-mediated autoimmunity, promoting the formation of an immunosuppressive microenvironment [ 15 , 17 ]. Peter T. Sage have declared that circulating Tfh and circulating Tfr cells were homed to germinal centers and persisted for long periods of time in vivo, they produced more cytokines than did effector LN Tfh and Tfr cells[ 18 ]. Given opposing functions of Tfh and Tfr cells, a balance of their actions is critical for immune homeostasis [ 13 ][ 19 ]. Therefore, circulating Tfh/Tfr can be used as a tumor progression marker. However, whether EC is characterized by imbalanced circulating Tfh/Tfr remains unknown. Cancer release exosomes and stimulate the expansion of regulatory T cells [ 2 ], which causes immunosuppression in the tumor microenvironment by impairing the function of antitumorigenic T cells [ 20 ]. Regulatory T cells are precursors of Tfr cells; however, it is unclear whether EC-derived exosomes regulate Tfr cells to promote immunosuppression in EC. Furthermore, the relationship between EXO-PDL1 and circulating Tfh/Tfr ratio in EC has not been clarified. Therefore, this study was designed to assess the effect of EC derived exosomes on circulating Tfh/Tfr balance. Furthermore, we aimed to evaluate whether these exosomes act via PDL1 to cause immunosuppression and promote the development of EC. Materials and methods Patient samples and cell lines Fresh blood samples were obtained from 45 naïve EC patients and 33 HD visiting the Fourth Hospital of Hebei Medical University from August 2021 to April 2022. Clinical features of patients are listed in Table S1 . None of the patients had received anti-cancer therapy before surgical resection. Patients with concurrent HIV, other cancers or autoimmune diseases were excluded. Among the included patients, the plasma samples of 26 EC patients and 17 HD were used to detect EXO-PDL1. Clinical stages were classified according to the guidelines of the International Union against Cancer and patient characteristics are listed in Table S1 . Informed consent was obtained from each patient, the protocol was approved by the Fourth Hospital of Hebei Medical University. Human EC cell, Eca109 cells, used in this study was obtained from ATCC. Lentivirus infection ShRNA was introduced by shRNA carrying lentivirus under CMV promoter/enhancer (Gene Pharma, Shanghai, China). The vector carried GFP encoding gene for visualization and puromycin resistance gene for selection. Cells were grown in six-well plates for 24 h till they reached approximately 50% confluence. Cells were washed with PBS, and viral transfection solution was added along with 3 ml Polybrene. Cells were incubated at 37°C under 5% CO 2 for 24 h before normal medium was replenished. Transfection efficiency was estimated by observing green fluorescence under a fluorescence microscope at 48 h post transfection. Puromycin was added at 48 h post transfection to maintain stably transfected cells. ShRNA sequences were as follows: shRNA1: CTGACATTCATCTTCCGTTTA, shRNA2: CGAATTACTGTGAAAGTCAAT. Exosome isolation Exosomes were isolated using differential centrifugation of conditioned media collected from human plasma or the supernatant of Eca109-PDL1 ko and Eca109-PDL1 nc cells. Cell cultures were treated with exosome-depleted media prepared by ultracentrifugation of fetal bovine serum for 3 hours at 200,000 g . All culture medium contained polymyxin B (20µg/ml; Sigma-Aldrich) to eliminate endotoxin contamination. The cells were grown in their respective conditioned media till they reached 70 to 80% confluence. Briefly, cells were cultured for 72 hours, the culture medium was centrifuged at 300 g for 10 min to remove dead cells and debris followed by centrifugation at 2,000 g for 10 min, and finally, the supernatant was centrifuges at 10000 g for 60 min twice to pellet the exosomes. The exosome pellet was washed in a large volume of PBS to eliminate contaminating proteins and centrifuged one last time at 100000 g . The exosomal pellets were re-suspended in PBS and the total exosomal protein concentrations were determined using the BCA Protein Assay kit (Thermo Fisher Scientific, Santa Clara, CA). Exosome analysis Transmission electron microscope (HITACHI H-7650, Tokyo, Japan) was used to analyze samples of exosomes processed using a standard protocol. Protein estimation and particle number of exosomes were determined using the protein micro-BCA assay kit (Invitrogen, Santa Clara, CA) and NTA (Particle Metrix Zetaview, Meerbusch, Germany), respectively. The expression of CD63, CD9, Tsg101, Calnexin and PDL1 on exosomes were evaluated by performing western blot analysis. Peripheral blood mononuclear cell (PBMC) isolation PBMCs were isolated from fresh blood samples within 1h to insure that the living cells are more than 90% using a lymphocyte separation medium (Cedarlane Corporation, Ontario, Canada). Briefly, 10 ml fresh blood was mixed with 10 ml PBS and the mixture was carefully added to 10 ml lymphocyte separation medium. The mixed solution was centrifuged at 400 g for 25 minutes at 20–25℃, the buffy coat was removed and washed 3 times with PBS to obtain PBMCs. Naïve CD4 + T cells were purified using a Naïve CD4 + T Cell Isolation Kit (BioLegend, New York, America) and cell purity was > 90% (Fig. S1 ). Cell stimulation and culture All cells were cultured in a humidified incubator at a temperature of 37ºC in an atmosphere of 5% CO 2 . Briefly, 96-well plates were coated with anti-CD3 (1 µg/ml, 100 µl) and anti-CD28 antibodies (0.5 µg/ml, 100 µl) overnight at 4°C. Then, the antibody solution was removed, and the plate was washed twice with PBS to remove unbound antibodies. Next, naïve CD4 + T cells were plated (2×10^5 cells/well) in abovementioned CD3 antibody-coated wells. Forty-eight hours later, isolated exosomes (10 µg/ml) or exosomes that were preincubated with 20 µg/ml anti-PDL1 or anti-IgG for 1 h at 37°C were added to cell cultures. Then, the CD4 + T cells were cultured for another 3 days before being harvested and analyzed using flow cytometry. Phenotypic and intracellular cytokine analyses of CD4 + T cells, with or without stimulation, were carried out. The reagents used in this experiment are listed in Table S2 and Table S3. Flow cytometry Here, we identify CD3 + CD4 + CD45RA − CXCR5 + PD1 + FoxP3 −/+ T cells as ‘Tfh’ ‘Tfr’. Cells were stained with specific antibodies for 30 minutes; antibodies used in this experiment are listed in Table S2 and Table S3. For intracellular staining, cells were fixed and permeabilized for 30 minutes at 4°C using a Transcription Factor Buffer Set (BD Biosciences, New York, America) and then washed with Perm/Wash Buffer. For intracytoplasmic staining, cells were stimulated for 5 hours with phorbol 12-myristate 13-acetate (50 ng/ml), ionomycin (1 µg/ml), and brefeldin A (2.5 µg/ml). Isotype-matched control antibodies were used as the background control. Flow cytometric analysis was performed using BD FACS Aria and analyzed using FlowJo software version 10. Enzyme-linked Immunosorbent Assay (ELISA) The level of PDL1 expression on exosomes isolated from plasma of EC patients and HD was determined using human ELISA kits (Abcam, Cambridge, UK) according to the manufacturer’s instructions. Statistical analysis The results are expressed as the mean ± SE. The statistical significance of differences between groups was analyzed using the log-rank test or Student’s t -test. Correlations between two parameters were assessed using Pearson’s correlation analysis. All data were analyzed using two-tailed tests, and results with P < 0.05 were considered statistically significant. Results EC patients with progressive clinical characteristics have imbalanced circulating Tfh/Tfr First, we used flow cytometry to analyze the proportions of circulating Tfh and Tfr cells in fresh peripheral blood samples of 45 naïve EC patients and 33 HD (Fig. 1 A-B). The proportion of circulating Tfh cells was significantly lower in EC patients (P < 0.001, Fig. 1 C), whereas the proportion of circulating Tfr cells was significantly enhanced (P < 0.001, Fig. 1 D). Furthermore, circulating Tfh/Tfr was significantly lower in the EC patients than that in the HD group (P < 0.001, Fig. 1 E). To determine the clinical relevance of our findings, we checked the correlation between the circulating Tfh/Tfr and the tumor TNM stage, tumor location, and tumor differentiation status. Notably, a significant negative correlation was observed between circulating Tfh/Tfr with the tumor size and lymph node infiltration. EC patients with higher TNM stage had a higher circulating Tfh/Tfr (Fig. 1 F-I). EC patients with poor tumor differentiation had a higher circulating Tfh/Tfr than those with well or moderate differentiated tumor (Fig. 1 K). Furthermore, no correlation was observed between the circulating Tfh/Tfr and tumor location (Fig. 1 J). Based on these results, the increased frequency of circulating Tfr cells was attributed to the extent of immunosuppressive microenvironment in EC. Thus, impaired circulating Tfh/Tfr balance may negatively impact antitumor immunity in EC patients. Correlation of EXO-PDL1 with circulating Tfh/Tfr and progressive clinical characteristics in EC patients The mechanism contributing to impaired circulating Tfh/Tfr remains to be elucidated. In EC, tumor cell derived exosomes may induce Tfr cell expansion and induce the expression of immunosuppressive marker PDL1 to trigger inhibitory signal [ 21 ]. Therefore, exploring the role of EXO-PDL1 is crucial to understand its role as the inhibitor of immune responses as well as its potential as a biomarker. In this study, we isolated exosomes from the plasma of 26 EC patients and 17 HD, and detected EXO-PDL1. EXO-PDL1 is negatively correlated with Tfh (R=-0.47, P < 0.05) while positively correlated with Tfr (R = 0.8, P < 0.05)(Fig.S2). As shown in Fig. 2 A, EC patients showed a clear negative correlation between EXO-PDL1 and circulating Tfh/Tfr (R=-0.74, P < 0.05). Furthermore, these patients exhibited higher EXO-PDL1 level than HD did (P < 0.001) (Fig. 2 B). Additionally, EC patients with higher TNM stage had higher EXO-PDL1 levels (Fig. 2 C-E). Based on these findings, we hypothesized that the observed decrease in circulating Tfh/Tfr in EC patients might be attributed to EXO-PDL1 expressed on tumor derived exosomes. Isolation and characterization of EC cell derived exosomes To determine whether EXO-PDL1 can induce circulating Tfh/Tfr imbalance, we knocked out PDL1 in Eca109 cells and acquired PDL1 deficient cell clones that secreted exosomes without PDL1. Exosomes obtained from the culture supernatant of Eca109-PDL1 ko and Eca109-PDL1 nc cells showed vesicle like morphology with a lipid bilayer (Fig. 3 A). Nano Sight nanoparticle tracking analysis showed that the extracellular vesicles were approximately 100 nm in diameter (Fig. 3 B). EXO-PDL1 ko and EXO-PDL1 nc were positive for the multivesicular body-related proteins CD63, CD9, and Tsg101, but not for Calnexin. As expected, only EXO-PDL1 nc were positive for PDL1 (Fig. 3 C). EC derived exosomes impairs circulating Tfh/Tfr via EXO-PDL1 Exosomes were isolated from Eca109-PDL1 ko and Eca109-PDL1 nc cell supernatants; naïve CD4 + T cells were separated from PBMCs of HD and cultured for use in subsequent assays (Fig. 4 A). Naïve CD4 + T cells were seeded in the 96 wells (2×10^5 cells/well) followed by anti-CD3 and anti-CD28 antibody stimulation for 48 hours. Next, EXO-PDL1 ko and EXO-PDL1 nc (10 µg/ml) were preincubated with or without anti-PDL1 or anti-IgG (20 µg/ml) for 1 h and cocultured with naïve CD4 + T cells for another 3 days (Fig. 4 B). Higher proportion of Tfr cells (P < 0.05) and lower proportion of Tfh cells (P < 0.05) were observed in EXO-PDL1 nc group than in EXO-PDL1 ko group (Fig. 4 C-D, E-F), resulting in a lower circulating Tfh/Tfr (P < 0.01); consistently, EXO-PDL1 ko group showed the opposite trend (Fig. 4 G). However, there is no difference between EXO-PDL1 nc group than in EXO-PDL1 ko group. Moreover, EXO-PDL1 neutralization using anti-PDL1 reversed the circulating Tfh/Tfr induced by EXO-PDL1 nc as EXO-PDL1 nc + anti-PDL1 group had similar result with that observed in the EXO-PDL1 ko group. Tumor derived exosomes showed a strong potential to induce Tfr cell expansion via EXO-PDL1, leading to immunosuppression. These results suggest that anti-PDL1 drugs could reverse circulating Tfh/Tfr imbalance in EC to achieve ICI efficiency in clinical settings. EC derived exosomes changes the frequencies, phenotypes, functions of circulating Tfh and circulating Tfr cells via EXO-PDL1 Our results so far raised the possibility that EC derived EXO-PDL1 can disrupt circulating Tfh/Tfr by increasing the proportion of Tfr cells via PD1-PDL1 interaction. Additionally, blocking PD1-PDL1 interaction reversed this effect. After EXO-PDL1 was incubated with naïve CD4 + T cells for 3 days, we analyzed the expression levels of CTLA4 and ICOS on circulating CD4 + CXCR5 + FoxP3 − Tfh cells and circulating CD4 + CXCR5 + FoxP3 + Tfr cells. In addition, levels of IL-10, IL-21 and IFN-γ secreted from circulating Tfh and circulating Tfr cells were detected (Fig. 5 A-B). After the incubation with EXO-PDL1 nc , the proportion of CD3 + CD4 + CXCR5 + FoxP3 + CTLA4 + Tfr cells (P < 0.01) (Fig. 5 C) and the CD4 + CXCR5 + FoxP3 + ICOS + Tfr cells increased (P < 0.001, Fig. 5 D), whereas incubation with EXO-PDL1 upregulated the expression of CTLA4 on Tfh cells (P < 0.001) (Fig. 5 H-I). Concurrently, after incubation with EXO-PDL1 nc , Tfr cells expressed a higher level of IL-10 (P < 0.001) (Fig. 5 E-G), whereas circulating Tfh cells secreted lower levels of IL-21 (P < 0.01) and IFN-γ (P < 0.05) and a higher level of IL-10 (Fig. 5 J-L) than those incubated with EXO-PDL1 ko . Next, to elucidate whether those trends were induced by PD1-PDL1 interaction, we incubated exosomes with anti-PDL1 antibody, which significantly reversed the results. Collectively, these findings indicate that EXO-PDL1 may change the phenotypes of circulating Tfh cells and circulating Tfr cells, induce suppressive functions. EXO-PDL1 can, therefore, play a key role in immunosuppression by involving PD1-PDL1 and skewing circulating Tfh/Tfr in EC patients. Discussion In this study, we investigated the role of EC derived exosomes in regulating the balance of circulating Tfh/Tfr. Our data showed that the proportion of circulating Tfr cells, characterized by high expression of FoxP3, was higher in EC patients than HD, whereas that of circulating Tfh cells, characterized by low expression of FoxP3, was lower than HD. In addition, EC patients had a significantly lower circulating Tfh/Tfr than HD. Furthermore, circulating Tfh/Tfr significantly correlated with tumor TNM stage and tumor differentiation status, which suggests that circulating Tfh/Tfr imbalance may be one of the mechanisms to induce EC carcinogenesis and may be used as a tumor prediction marker for EC. Our results are consistent with findings from studies, which reported that Tfh/Tfr imbalance is related to the progression of malignant tumors, such as non-small cell lung cancer [ 22 ], breast cancer [ 23 ], hepatocellular carcinoma [ 24 ], colorectal cancer [ 25 ], and pancreatic cancer [ 26 ]. As circulating Tfh and Tfr cells play opposing roles in maintaining germinal center responses, their balanced activities are critical for immune homeostasis [ 19 ]. Tumor derived exosomal PDL1 contributes to establishing the immune memory of the tumor [ 5 ]. Furthermore, immunosuppressive signaling mediated by EXO-PDL1 reportedly plays a crucial role in inhibiting antitumor immunity [ 27 ]. Accordingly, EXO-PDL1 predicts poor survival, reflects immune status in gastric cancer patients and correlates with clinical stage of breast cancer, head and neck cancer, and melanoma [ 28 – 31 ]. Similar results were reported for MC38 colon cancer, melanoma, and TRAMP-C2 prostate cancer mouse models [ 4 , 6 , 9 ]. In our study, exosomes extracted from the plasma of EC patients revealed increased EXO-PDL1 expression compared with those extracted from HD. Furthermore, a significant correlation was noted between EXO-PDL1 and tumor TNM stage and differentiation status. Interestingly, increased EXO-PDL1 expression level reportedly negatively correlates with circulating Tfh/Tfr in EC patients. Based on these findings, we infer that EXO-PDL1 may induce the expansion of circulating Tfr cells. EC derived EXO-PDL1 be one of the mechanisms underlying circulating Tfh/Tfr imbalance. In vitro coculture of PDL1 + exosomes with T cells suppresses T cell activation [ 9 ], and EXO-PDL1 also suppresses tumor immunity [ 4 ]. Here, we confirmed that following anti-CD3/CD28 stimulation, EXO-PDL1 nc but not EXO-PDL1 ko , induced the expansion of circulating Tfr cells, thereby disturbed circulating Tfh/Tfr. It is possible that the greater suppressive capacity of circulating Tfr cells, together with the decreased circulating Tfh/Tfh inhibits circulating Tfh cell function [ 32 ]. Eca109-PDL1 ko cell-derived exosomes did not induce the expansion of Tfr cells, whereas Eca109-PDL1 nc cell-derived exosomes did. To the best of our knowledge, this is the first study to show the role of tumor-derived EXO-PDL1 in Tfh/Tfr balance in EC tumorigenesis. CTLA4 inhibits T cell proliferation, suppresses the transcription of IL-2 encoding gene, as well as initiates inhibitory signal transduction. Sage et al demonstrated that CTLA4 loss on Tfh cells resulted in stronger B cell responses, whereas CTLA4 loss on Tfr cells resulted in defective suppression of antigen-specific antibody responses [ 33 , 34 ]. Our results showed that EXO-PDL1 increased CTLA4 expression not only on Tfr cells, but also on Tfh cells, which means that antigen-specific antibody responses and B cell responses were significantly suppressed, which may be one of the reasons accounting for the EC immunosuppressive microenvironment. Furthermore, ICOS supply essential costimulatory signals for Tfr and Tfh cells in circulation as well as in the lymph nodes and is required for Tfr cell differentiation [ 32 ]. Here, EXO-PDL1 nc but not EXO-PDL1 ko incubated with activated naïve CD4 + T cells led to the higher ICOS expression on Tfr cells. Moreover, ICOS ligand on the B cell surface also binds to ICOS on Tfr cell surface, which may lead to the dysfunctional B cells. IL-10 of Tfr cells could inhibit the ability of Tfh cells to proliferate and secrete cytokines, thereby regulating the immune response of B cells, including antibody class switching and affinity maturation. IL-21 derived from Tfh cells can also inhibit the expansion of Tfr cells in the germinal center. We compared the cytokine IL-21, IL-10 and IFN-γ expression profiles between CD4 + CXCR5 + FoxP3 − Tfh cells and CD4 + CXCR5 + FoxP3 + Tfr cells. Stimulated by TCR, EXO-PDL1 nc promotes the expansion of CTLA4 + Tfr significantly accompanied with higher level of IL-10, while reduces Tfh significantly along with lower level of IL-21 and IFN-γ. These changes in cytokine levels accelerated the imbalance of Tfh/Tfr, defected humoral immunity and had other immunosuppressive effects. PD1 controls the generation and function of suppressive Tfr cells [ 32 ]. Our data showed that when EXO-PDL1 was neutralized by anti-PDL1 antibody, the proportion of circulating Tfr cells decreased and circulating Tfh/Tfr imbalance reversed. Thus, anti-PDL1 treatment can abolish exosomal immunosuppression mediated by PDL1, thereby activating antitumor immunity and attenuating the immune suppression [ 35 ]. Tumor-derived exosome bound PDL1 results in anergic T cells in different types of cancer, such as glioblastoma, melanoma, gastric and lung cancer [ 8 , 29 , 34 ]. Our results are consistent with those findings showing that EXO-PDL1 can function as a systemic immunosuppressant [ 36 , 37 ]. Overall, our study highlights a novel pathway whereby EC cells release exosomes with the potential to promote the accumulation of Tfr cells. Sage et al highlighted the lack of methods for selectively modulating Tfr cells in clinical settings [ 32 ], our findings suggest the possibility that tumor-secreted exosomes may also serve as a therapeutic target while EXO-PDL1 could modulate circulating Tfh/Tfr in clinical settings. Certain limitations were noted in our research. First, some studies have demonstrated that EXO-PDL1 is associated with PFS and OS [ 3 ]. In our study, we did not obtain data related to PFS or OS. Second, the relative proportions of circulating Tfh and circulating Tfr cells change over time and precede antibody production and function [ 32 ], further studies are required to investigate and validate these aspects. Conclusion This is the first study to investigate the relationship between circulating Tfh/Tfr, EXO-PDL1, and clinical characteristics for EC patients. EXO-PDL1 and circulating Tfh/Tfr served as independent prognostic biomarkers. Furthermore, we define a new role for EXO-PDL1 in regulating EC immune responses via modulating differentiation and functions of circulating Tfh and circulating Tfr cells in the blood, which could be reversed by treatment with anti-PDL1 antibody. EXO-PDL1 maybe one of the effectors by which anti-PDL1 drugs achieve their clinical benefits. Deepening our understanding of how EXO-PDL1 influences the overall immune profile of EC patients is critical to achieve successful patient outcomes. Abbreviations EC: esophageal cancer; HD: healthy donors; Tfr: follicular regulatory T cell; Tfh: follicular helper T cell; PDL1: Programmed death ligand 1; PD1: Programmed death receptor 1; PBMC: Peripheral blood mononuclear cells; Exo/exo: Exosome; qPCR: Quantitative PCR; CXCR5: the chemokine receptor 5; TNM: tumor size (T)、lymph node infiltration (N)、metastasis (M); ATCC: American Type Culture Collection. Declarations Ethics approval and consent to participate This study involves human participants. Participants gave informed consent to participate in the study before taking part. This study was approved by the Fourth Hospital of Hebei Medical University Ethics Committee (2020ky241). Consent for publication Not applicable. Availability of data and material Data are available upon reasonable request. Competing interests The authors declare no competing interests. Funding This work was supported by the Basic Research Cooperation Project of Beijing, Tianjin, Hebei from the Natural Science Foundation of Hebei (H2020206649), Tianjin (20JCZXJC00070) and Beijing (J200018). Authors' contributions Zhiyu Wang and Zijie Li conducted conceptualization of the study, experimental design. Zijie Li performed major Imageflow experiments and mass cytometry experiments and analysis., He Hao and Yuehua Zhang interpreted and analyzed data. Lu Chen, Xiaokuan Zhang and Tingting Lv assisted with experiments. Yuying Qi provided advice with experiments. Zijie Li wrote, reviewed and edited the manuscript. Zhiyu Wang is responsible for the overall content as guarantor. Acknowledgements We sincerely thank all the people who have provided helpful support. References Morrissey, S.M., et al., Tumor-derived exosomes drive immunosuppressive macrophages in a pre-metastatic niche through glycolytic dominant metabolic reprogramming. Cell Metab, 2021. 33 (10): p. 2040-2058 e10. Lindau, D., et al., The immunosuppressive tumour network: myeloid-derived suppressor cells, regulatory T cells and natural killer T cells. Immunology, 2013. 138 (2): p. 105-115. Raimondo, S., et al., Extracellular Vesicles and Tumor-Immune Escape: Biological Functions and Clinical Perspectives. Int J Mol Sci, 2020. 21 (7): p. 2286. Daassi, D., K.M. Mahoney, and G.J. Freeman, The importance of exosomal PDL1 in tumour immune evasion. Nat Rev Immunol, 2020. 20 (4): p. 209-215. Poggio, M., et al., Suppression of Exosomal PD-L1 Induces Systemic Anti-tumor Immunity and Memory. Cell, 2019. 177 (2): p. 414-427. Kahlert, C. and R. Kalluri, Exosomes in tumor microenvironment influence cancer progression and metastasis. J Mol Med (Berl), 2013. 91 (4): p. 431-437. Liu, J., et al., The biology, function, and applications of exosomes in cancer. Acta Pharm Sin B, 2021. 11 (9): p. 2783-2797. Cordonnier, M., et al., Tracking the evolution of circulating exosomal-PD-L1 to monitor melanoma patients. J Extracell Vesicles, 2020. 9 (1): p. 1710899. Morrissey, S.M. and J. Yan, Exosomal PD-L1: Roles in Tumor Progression and Immunotherapy. Trends Cancer, 2020. 6 (7): p. 550-558. He, H., et al., ILdrives conversion of T follicular helper cells to T follicular regulatory cells through transcriptional regulation in systemic lupus erythematosus. 2020. Ma, X., et al., Expansion of T follicular helper-T helper 1 like cells through epigenetic regulation by signal transducer and activator of transcription factors. Ann Rheum Dis, 2018. 77 (9): p. 1354-1361. King, C., Tfh cells set the stage for tumor control. Immunity, 2021. 54 (12): p. 2690-2692. Ye, Y., M. Wang, and H. Huang, Follicular regulatory T cell biology and its role in immune-mediated diseases. J Leukoc Biol, 2021. 110 (2): p. 239-255. Wing, J.B., A. Tanaka, and S. Sakaguchi, Human FOXP3(+) Regulatory T Cell Heterogeneity and Function in Autoimmunity and Cancer. Immunity, 2019. 50 (2): p. 302-316. Chung, Y., et al., Follicular regulatory T cells expressing Foxp3 and Bcl-6 suppress germinal center reactions. Nat Med, 2011. 17 (8): p. 983-988. Gonzalez-Figueroa, P., et al., Follicular regulatory T cells produce neuritin to regulate B cells. Cell, 2021. 184 (7): p. 1775-1789. Sage, P.T. and A.H. Sharpe, T follicular regulatory cells in the regulation of B cell responses. Trends Immunol, 2015. 36 (7): p. 410-418. Sage, P.T., et al., Circulating T follicular regulatory and helper cells have memory-like properties. J Clin Invest, 2014. 124 (12): p. 5191-5204. Liu, C., et al., Increased Circulating Follicular Treg Cells Are Associated With Lower Levels of Autoantibodies in Patients With Rheumatoid Arthritis in Stable Remission. Arthritis Rheumatol, 2018. 70 (5): p. 711-721. Wieckowski, E.U., et al., Tumor-derived microvesicles promote regulatory T cell expansion and induce apoptosis in tumor-reactive activated CD8+ T lymphocytes. J Immunol, 2009. 183 (6): p. 3720-3730. Xie, F., et al., The role of exosomal PD-L1 in tumor progression and immunotherapy. Mol Cancer, 2019. 18 (1): p. 146-156. Shi, W., et al., PD-1 regulates CXCR5(+) CD4 T cell-mediated proinflammatory functions in non-small cell lung cancer patients. Int Immunopharmacol, 2020. 82 : p. 106295. Faghih, Z., et al., Immune profiles of CD4+ lymphocyte subsets in breast cancer tumor draining lymph nodes. Immunol Lett, 2014. 158 (1-2): p. 57-65. Wang, B., et al., Tfr-Tfh index: A new predicator for recurrence of hepatocellular carcinoma patients with HBV infection after curative resection. Clin Chim Acta, 2020. 511 : p. 282-290. Shi, W., et al., Follicular helper T cells promote the effector functions of CD8(+) T cells via the provision of IL-21, which is downregulated due to PD-1/PD-L1-mediated suppression in colorectal cancer. Exp Cell Res, 2018. 372 (1): p. 35-42. Lux, A., et al., c-Met and PD-L1 on Circulating Exosomes as Diagnostic and Prognostic Markers for Pancreatic Cancer. Int J Mol Sci, 2019. 20 (13): p. 3305. Wang, L., et al., HCV-associated exosomes promote myeloid-derived suppressor cell expansion via inhibiting miR-124 to regulate T follicular cell differentiation and function. Cell Discov, 2018. 4 : p. 51. Del Re, M., et al., PD-L1 mRNA expression in plasma-derived exosomes is associated with response to anti-PD-1 antibodies in melanoma and NSCLC. Br J Cancer, 2018. 118 (6): p. 820-824. Cao, J., et al., Exosomes in head and neck cancer: Roles, mechanisms and applications. Cancer Letters, 2020. 494 : p. 7-16. Fan, Y., et al., Exosomal PD-L1 Retains Immunosuppressive Activity and is Associated with Gastric Cancer Prognosis. Ann Surg Oncol, 2019. 26 (11): p. 3745-3755. Yang, Y., et al., Exosomal PD-L1 harbors active defense function to suppress T cell killing of breast cancer cells and promote tumor growth. Cell Research, 2018. 28 (8): p. 862-864. Sage, P.T., et al., The receptor PD-1 controls follicular regulatory T cells in the lymph nodes and blood. Nat Immunol, 2013. 14 (2): p. 152-161. Sage, P.T. and A.H.J.I.R. Sharpe, T follicular regulatory cells. 2016. 271 (1): p. 246-259. Sage, P.T., et al., The coinhibitory receptor CTLA-4 controls B cell responses by modulating T follicular helper, T follicular regulatory, and T regulatory cells. Immunity, 2014. 41 (6): p. 1026-1039. Theodoraki, M.N., et al., Clinical Significance of PD-L1+ Exosomes in Plasma of Head and Neck Cancer Patients. 2017. 24 (4): p. 896-905. Xing, C., et al., The roles of exosomal immune checkpoint proteins in tumors. Mil Med Res, 2021. 8 (1): p. 56-66. Kugeratski, F.G. and R. Kalluri, Exosomes as mediators of immune regulation and immunotherapy in cancer. FEBS J, 2021. 288 (1): p. 10-35. Additional Declarations No competing interests reported. Supplementary Files Supplementalmaterial.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3089394","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":211774179,"identity":"89700cf8-67ed-4b93-81c8-feaa2a1778e7","order_by":0,"name":"Zijie Li","email":"","orcid":"","institution":"Hebei Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zijie","middleName":"","lastName":"Li","suffix":""},{"id":211774180,"identity":"d18a1bbe-9f8d-4979-ba26-82e3af10ee51","order_by":1,"name":"Yuehua Zhang","email":"","orcid":"","institution":"The Fourth Hospital of Hebei Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yuehua","middleName":"","lastName":"Zhang","suffix":""},{"id":211774182,"identity":"24e0d84f-fe43-4b39-8f5d-f7a8cf526a73","order_by":2,"name":"He Hao","email":"","orcid":"","institution":"Henan Cancer Hospital Affiliated Cancer Hospital of Zhengzhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"He","middleName":"","lastName":"Hao","suffix":""},{"id":211774184,"identity":"07175aab-4bf8-44b8-9d68-dd410d27afa3","order_by":3,"name":"Lu Chen","email":"","orcid":"","institution":"The Fourth Hospital of Hebei Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Lu","middleName":"","lastName":"Chen","suffix":""},{"id":211774186,"identity":"34a941a6-25c6-48a8-805f-2e0afef719c2","order_by":4,"name":"Tingting Lv","email":"","orcid":"","institution":"Hebei Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tingting","middleName":"","lastName":"Lv","suffix":""},{"id":211774189,"identity":"52075104-8dfb-4bec-bfdc-6bd0a786462a","order_by":5,"name":"Xiaokuan Zhang","email":"","orcid":"","institution":"Hebei Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaokuan","middleName":"","lastName":"Zhang","suffix":""},{"id":211774190,"identity":"14e5308a-5848-4b68-a901-3a1c51549968","order_by":6,"name":"Yuying Qi","email":"","orcid":"","institution":"Hebei Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yuying","middleName":"","lastName":"Qi","suffix":""},{"id":211774192,"identity":"66d72f0a-fc19-423c-94b7-0b380919f51c","order_by":7,"name":"Zhiyu Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+klEQVRIiWNgGAWjYDCCAxAqgY2BgfExjCtBrBZmY9K0ADGbNFFa+G6fMfxc8Ksuj08ix6y6oOJOtMEB5oO3eRjs8nBpkTyXYyw9s4+tmA2o5faMM89yNxxgS7bmYUguxqXF4AzvBmneHp7ENpAW3rbDQC08ZtI8DAcSG3Br2fybt0cCrKWY9x9IC/83Qlq2SfP8MABrYeZtANvChleL5Bn+b9a8DQmJbTzPiqV5jj3LnXmYzdhyjkEyTi18Z9iSb/P8qUuc35688TNPzZ3cvuPND2+8qbDDqQUMGNuAhEAClMcMdjA+9SDwB4j5DxBSNQpGwSgYBSMVAAAEeVr4kZylAwAAAABJRU5ErkJggg==","orcid":"","institution":"Hebei Medical University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Zhiyu","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2023-06-21 00:59:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3089394/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3089394/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":39188856,"identity":"14e0ca9a-3fb0-4739-922c-1239fe33b436","added_by":"auto","created_at":"2023-06-27 19:30:57","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":238639,"visible":true,"origin":"","legend":"\u003cp\u003eImbalanced circulating Tfh/Tfr in EC patients with progressive clinical characteristics. PBMCs isolated from the fresh peripheral blood of 45 naïve EC patients and 33 HD are analyzed using flow cytometry without incubation. A, Representative flow cytometric staining of peripheral blood Tfh (CD3\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003eCD45RA\u003csup\u003e−\u003c/sup\u003eCXCR5\u003csup\u003e+\u003c/sup\u003ePD1\u003csup\u003e+\u003c/sup\u003eFoxP3\u003csup\u003e−\u003c/sup\u003e) and Tfr (CD3\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003eCD45RA\u003csup\u003e−\u003c/sup\u003eCXCR5\u003csup\u003e+\u003c/sup\u003ePD1\u003csup\u003e+\u003c/sup\u003eFoxP3\u003csup\u003e+\u003c/sup\u003e) cells. B, Gating strategy of Tfh and Tfr and histograms of PD1 and FoxP3 expressed by fluorescent minus one (FMO) method in EC and HD subsets. C-E, Proportions of circulating Tfh and circulating Tfr cells (C, D) and the circulating Tfh/Tfr (E) between EC and HD. F-K, The correlation of circulating Tfh/Tfr with tumor TNM stage, location, and differentiation status. Data was presented as mean ± S.D.; Statistical significance: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-3089394/v1/ff3fa30e8fa8ffd2a4659a57.png"},{"id":39188445,"identity":"ff1739a7-7663-49e6-b714-3936c5e0d612","added_by":"auto","created_at":"2023-06-27 19:22:57","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":175985,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelation between EXO-PDL1 and circulating Tfh/Tfr in EC patients. A, Correlation of plasma EXO-PDL1 levels with circulating Tfh/Tfr in EC patients (n=26). B, Relative plasma EXO-PDL1 level in 17 HD and 26 EC patients evaluated using ELISA kit. C-F, Correlation of EXO-PDL1 with the TNM stage (C), tumor T(D), tumor N (E) and tumor differentiation (F). Data was presented as mean ± S.D.; Statistical significance: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-3089394/v1/913d7681faa614146693daf1.png"},{"id":39188447,"identity":"9e3b16fa-0678-4433-a02f-9d5294994ca6","added_by":"auto","created_at":"2023-06-27 19:22:57","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":295107,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization of exosomes derived from Eca109-PDL1\u003csup\u003eko \u003c/sup\u003eand Eca109-PDL1\u003csup\u003enc\u003c/sup\u003e cells. A, Exosome morphology determined using transmission electron microscopy. Scale, 200 nm. B, Size distribution of the exosomes is determined using NTA assay. C, Surface proteins on the Eca109-PDL1\u003csup\u003eko \u003c/sup\u003eand Eca109-PDL1\u003csup\u003enc\u003c/sup\u003e cells-derived exosomes are detected using western blot analysis.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3089394/v1/3f576c7c233dcd38c4331faf.jpeg"},{"id":39188449,"identity":"bf929333-894f-493a-80ad-741610a47736","added_by":"auto","created_at":"2023-06-27 19:22:57","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":275641,"visible":true,"origin":"","legend":"\u003cp\u003eEXO-PDL1 derived from Eca-109 cells disturbed circulating Tfh/Tfr. Briefly, naïve CD4\u003csup\u003e+\u003c/sup\u003eT cells from HD were stimulated with 1 μg/ml anti-CD3 and 0.5 μg/ml anti-CD28 antibodies for 48 h. Then, 10 μg/ml EXO-PDL1\u003csup\u003eko \u003c/sup\u003eor EXO-PDL1\u003csup\u003enc\u003c/sup\u003e exosomes were preincubated with 20 μg/ml anti-PDL1 or anti-IgG for 1 h and cocultured with cells for another 3 days. A, Schematic illustration of human naïve CD4\u003csup\u003e+\u003c/sup\u003eT cell proliferation in response to EC derived exosomes. B, Representative flow cytometry plots showing distribution of circulating Tfh and circulating Tfr cells. C-D, The histograms of Tfr (C) and Tfh cells (D) after incubation with EXO-PDL1\u003csup\u003eko \u003c/sup\u003eor EXO-PDL1\u003csup\u003enc\u003c/sup\u003e exosomes. E-G, Representative histograms showing the proportions of Tfr cells (E) and Tfh cells (F) and circulating Tfh/Tfr (G). Data was presented as mean ± S.D.; Statistical significance: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-3089394/v1/98da745d259eb98f089223f8.png"},{"id":39188448,"identity":"450a072e-af61-4466-a7b0-8f09a7994cad","added_by":"auto","created_at":"2023-06-27 19:22:57","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":313367,"visible":true,"origin":"","legend":"\u003cp\u003eEXO-PDL1 changes the frequencies, phenotypes, functions of circulating Tfh cells and circulating Tfr cells. Naïve CD4\u003csup\u003e+\u003c/sup\u003eT cells from HD were stimulated with 1 μg/ml anti-CD3 and 0.5 μg/ml anti-CD28 antibodies for 48 h. Then, 10 μg/ml EXO-PDL1\u003csup\u003eko \u003c/sup\u003eor EXO-PDL1\u003csup\u003enc\u003c/sup\u003e exosomes were preincubated with anti-PDL1 or anti-IgG for (20 μg/ml) 1 h and cocultured with CD4\u003csup\u003e+\u003c/sup\u003eT cells for another 3 days. A-B, Representative flow cytometry plots show expression levels of CTLA4, ICOS, IL-21, IL-10, and IFN-γ in CD4\u003csup\u003e+\u003c/sup\u003eCXCR5\u003csup\u003e+\u003c/sup\u003eFoxP3\u003csup\u003e-\u003c/sup\u003eTfh cells (A) and CD4\u003csup\u003e+\u003c/sup\u003eCXCR5\u003csup\u003e+\u003c/sup\u003eFoxP3\u003csup\u003e+\u003c/sup\u003e Tfr cells (B). C-L, Bar graphs showing expression levels of CTLA4, ICOS, IL-21, IL-10, and IFN-γ (C-G) in Tfr cells and Tfh cells (H-L). Data was presented as mean ± S.D.; Statistical significance: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-3089394/v1/e3859de070ab2313e0c25183.png"},{"id":39188863,"identity":"98058537-7bd5-4a44-b744-525f96b13089","added_by":"auto","created_at":"2023-06-27 19:31:03","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1552828,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3089394/v1/32425c33-0c9d-4a63-b25c-3df68f4923ff.pdf"},{"id":39188450,"identity":"25d10b11-81ad-4065-8080-bd427823df5c","added_by":"auto","created_at":"2023-06-27 19:22:57","extension":"docx","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":296101,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementalmaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-3089394/v1/8493c001012b8f9894f4b3ea.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eEsophageal cancer derived exosomes imbalance circulating Tfh/Tfr via EXO-PDL1 to promote immunosuppression\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEC is a common but deadly malignancy even when treated with immune checkpoint inhibitors. Cancer derived exosomes modulate the immune systems by triggering the immunosuppressive response [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], which in turn favors tumor progression [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. These exosomes regulate the functions of immune cells by expressing immunosuppressive or pro-apoptotic molecules on their surface, including programmed death ligand 1 (PDL1) and CTLA4 [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Furthermore, exosomes derived from tumors reflect the characteristics of their parent cells and promote tumor progression by presenting PDL1. Exosomal-PDL1 (EXO-PDL1) mediates programmed death receptor 1 (PD1) crosslinking and immunosuppression as it has a similar extracellular membrane topology as its cell surface counterpart [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Exosomes suppress T cells in a PDL1 dependent fashion. For instance, removal of tumor exosomes from TRAMP-C2 cells recapitulated the effects of deleting PDL1 [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], suggesting that exosomes are a significant source of extra-tumoral PDL1 and may contribute to PD1 antibody treatment resistance [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Indeed, exosomes may be more potent immunosuppressants than other forms of extracellular PDL1 [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] and PDL1 levels on circulating exosomes appear to be a more reliable prognostic marker than PDL1 expression in tumor biopsies. Thus, monitoring circulating EXO-PDL1 maybe useful to predict the tumor response to treatment and clinical outcome [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. In addition, the role of EXO-PDL1 in the formation of systemic immunosuppression may be more important than previously assumed [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCirculating Tfh and Tfr cells share many characteristics. Specifically, they co-express PD1, chemokine receptor 5 (CXCR5) as well as produce IL-21, IL-10, and IFN-γ. Tfh and Tfr cells are believed to be involved in the pathogenesis of many kinds of cancers. Tfr cells play a suppressive role during the generation of CD38\u003csup\u003e+\u003c/sup\u003eCD27\u003csup\u003ehigh\u003c/sup\u003e plasma blasts [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], leading to the immunosuppression. Tfh cells represent a distinct lineage of helper CD4\u003csup\u003e+\u003c/sup\u003e T cells; they express CXCR5 and migrate into B cell follicles. Inducible T cell co-stimulator (ICOS), a cell surface co-stimulatory molecule, is highly expressed on Tfh cells and crucial for the interaction of Tfh cells with B cells [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Tfh cells play an important role in tumor immune protection [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. A subset of FoxP3\u003csup\u003e+\u003c/sup\u003e regulatory T cells that suppress different types of immune responses are known as Tfr cells [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. They act as a regulatory counterpart for Tfh cells [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Tfr cells regulate germinal center responses and prevent antibody-mediated autoimmunity, promoting the formation of an immunosuppressive microenvironment [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Peter T. Sage have declared that circulating Tfh and circulating Tfr cells were homed to germinal centers and persisted for long periods of time in vivo, they produced more cytokines than did effector LN Tfh and Tfr cells[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Given opposing functions of Tfh and Tfr cells, a balance of their actions is critical for immune homeostasis [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e][\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Therefore, circulating Tfh/Tfr can be used as a tumor progression marker. However, whether EC is characterized by imbalanced circulating Tfh/Tfr remains unknown.\u003c/p\u003e \u003cp\u003eCancer release exosomes and stimulate the expansion of regulatory T cells [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], which causes immunosuppression in the tumor microenvironment by impairing the function of antitumorigenic T cells [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Regulatory T cells are precursors of Tfr cells; however, it is unclear whether EC-derived exosomes regulate Tfr cells to promote immunosuppression in EC. Furthermore, the relationship between EXO-PDL1 and circulating Tfh/Tfr ratio in EC has not been clarified. Therefore, this study was designed to assess the effect of EC derived exosomes on circulating Tfh/Tfr balance. Furthermore, we aimed to evaluate whether these exosomes act via PDL1 to cause immunosuppression and promote the development of EC.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePatient samples and cell lines\u003c/h2\u003e \u003cp\u003eFresh blood samples were obtained from 45 na\u0026iuml;ve EC patients and 33 HD visiting the Fourth Hospital of Hebei Medical University from August 2021 to April 2022. Clinical features of patients are listed in Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e. None of the patients had received anti-cancer therapy before surgical resection. Patients with concurrent HIV, other cancers or autoimmune diseases were excluded. Among the included patients, the plasma samples of 26 EC patients and 17 HD were used to detect EXO-PDL1. Clinical stages were classified according to the guidelines of the International Union against Cancer and patient characteristics are listed in Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e. Informed consent was obtained from each patient, the protocol was approved by the Fourth Hospital of Hebei Medical University. Human EC cell, Eca109 cells, used in this study was obtained from ATCC.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eLentivirus infection\u003c/h2\u003e \u003cp\u003eShRNA was introduced by shRNA carrying lentivirus under CMV promoter/enhancer (Gene Pharma, Shanghai, China). The vector carried GFP encoding gene for visualization and puromycin resistance gene for selection. Cells were grown in six-well plates for 24 h till they reached approximately 50% confluence. Cells were washed with PBS, and viral transfection solution was added along with 3 ml Polybrene. Cells were incubated at 37\u0026deg;C under 5% CO\u003csub\u003e2\u003c/sub\u003e for 24 h before normal medium was replenished. Transfection efficiency was estimated by observing green fluorescence under a fluorescence microscope at 48 h post transfection. Puromycin was added at 48 h post transfection to maintain stably transfected cells. ShRNA sequences were as follows: shRNA1: CTGACATTCATCTTCCGTTTA, shRNA2: CGAATTACTGTGAAAGTCAAT.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eExosome isolation\u003c/h2\u003e \u003cp\u003eExosomes were isolated using differential centrifugation of conditioned media collected from human plasma or the supernatant of Eca109-PDL1\u003csup\u003eko\u003c/sup\u003e and Eca109-PDL1\u003csup\u003enc\u003c/sup\u003e cells. Cell cultures were treated with exosome-depleted media prepared by ultracentrifugation of fetal bovine serum for 3 hours at 200,000 \u003cem\u003eg\u003c/em\u003e. All culture medium contained polymyxin B (20\u0026micro;g/ml; Sigma-Aldrich) to eliminate endotoxin contamination. The cells were grown in their respective conditioned media till they reached 70 to 80% confluence. Briefly, cells were cultured for 72 hours, the culture medium was centrifuged at 300 \u003cem\u003eg\u003c/em\u003e for 10 min to remove dead cells and debris followed by centrifugation at 2,000 \u003cem\u003eg\u003c/em\u003e for 10 min, and finally, the supernatant was centrifuges at 10000 \u003cem\u003eg\u003c/em\u003e for 60 min twice to pellet the exosomes. The exosome pellet was washed in a large volume of PBS to eliminate contaminating proteins and centrifuged one last time at 100000 \u003cem\u003eg\u003c/em\u003e. The exosomal pellets were re-suspended in PBS and the total exosomal protein concentrations were determined using the BCA Protein Assay kit (Thermo Fisher Scientific, Santa Clara, CA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eExosome analysis\u003c/h2\u003e \u003cp\u003eTransmission electron microscope (HITACHI H-7650, Tokyo, Japan) was used to analyze samples of exosomes processed using a standard protocol. Protein estimation and particle number of exosomes were determined using the protein micro-BCA assay kit (Invitrogen, Santa Clara, CA) and NTA (Particle Metrix Zetaview, Meerbusch, Germany), respectively. The expression of CD63, CD9, Tsg101, Calnexin and PDL1 on exosomes were evaluated by performing western blot analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003ePeripheral blood mononuclear cell (PBMC) isolation\u003c/h2\u003e \u003cp\u003ePBMCs were isolated from fresh blood samples within 1h to insure that the living cells are more than 90% using a lymphocyte separation medium (Cedarlane Corporation, Ontario, Canada). Briefly, 10 ml fresh blood was mixed with 10 ml PBS and the mixture was carefully added to 10 ml lymphocyte separation medium. The mixed solution was centrifuged at 400 \u003cem\u003eg\u003c/em\u003e for 25 minutes at 20\u0026ndash;25℃, the buffy coat was removed and washed 3 times with PBS to obtain PBMCs. Na\u0026iuml;ve CD4\u003csup\u003e+\u003c/sup\u003e T cells were purified using a Na\u0026iuml;ve CD4\u003csup\u003e+\u003c/sup\u003e T Cell Isolation Kit (BioLegend, New York, America) and cell purity was \u0026gt;\u0026thinsp;90% (Fig.\u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell stimulation and culture\u003c/h2\u003e \u003cp\u003eAll cells were cultured in a humidified incubator at a temperature of 37\u0026ordm;C in an atmosphere of 5% CO\u003csub\u003e2\u003c/sub\u003e. Briefly, 96-well plates were coated with anti-CD3 (1 \u0026micro;g/ml, 100 \u0026micro;l) and anti-CD28 antibodies (0.5 \u0026micro;g/ml, 100 \u0026micro;l) overnight at 4\u0026deg;C. Then, the antibody solution was removed, and the plate was washed twice with PBS to remove unbound antibodies. Next, na\u0026iuml;ve CD4\u003csup\u003e+\u003c/sup\u003eT cells were plated (2\u0026times;10^5 cells/well) in abovementioned CD3 antibody-coated wells. Forty-eight hours later, isolated exosomes (10 \u0026micro;g/ml) or exosomes that were preincubated with 20 \u0026micro;g/ml anti-PDL1 or anti-IgG for 1 h at 37\u0026deg;C were added to cell cultures. Then, the CD4\u003csup\u003e+\u003c/sup\u003eT cells were cultured for another 3 days before being harvested and analyzed using flow cytometry. Phenotypic and intracellular cytokine analyses of CD4\u003csup\u003e+\u003c/sup\u003eT cells, with or without stimulation, were carried out. The reagents used in this experiment are listed in Table S2 and Table S3.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry\u003c/h2\u003e \u003cp\u003eHere, we identify CD3\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003eCD45RA\u003csup\u003e\u0026minus;\u003c/sup\u003eCXCR5\u003csup\u003e+\u003c/sup\u003ePD1\u003csup\u003e+\u003c/sup\u003eFoxP3\u003csup\u003e\u0026minus;/+\u003c/sup\u003eT cells as \u0026lsquo;Tfh\u0026rsquo; \u0026lsquo;Tfr\u0026rsquo;. Cells were stained with specific antibodies for 30 minutes; antibodies used in this experiment are listed in Table S2 and Table S3. For intracellular staining, cells were fixed and permeabilized for 30 minutes at 4\u0026deg;C using a Transcription Factor Buffer Set (BD Biosciences, New York, America) and then washed with Perm/Wash Buffer. For intracytoplasmic staining, cells were stimulated for 5 hours with phorbol 12-myristate 13-acetate (50 ng/ml), ionomycin (1 \u0026micro;g/ml), and brefeldin A (2.5 \u0026micro;g/ml). Isotype-matched control antibodies were used as the background control. Flow cytometric analysis was performed using BD FACS Aria and analyzed using FlowJo software version 10.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme-linked Immunosorbent Assay (ELISA)\u003c/h2\u003e \u003cp\u003eThe level of PDL1 expression on exosomes isolated from plasma of EC patients and HD was determined using human ELISA kits (Abcam, Cambridge, UK) according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe results are expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE. The statistical significance of differences between groups was analyzed using the log-rank test or Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test. Correlations between two parameters were assessed using Pearson\u0026rsquo;s correlation analysis. All data were analyzed using two-tailed tests, and results with P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eEC patients with progressive clinical characteristics have imbalanced circulating Tfh/Tfr\u003c/h2\u003e \u003cp\u003eFirst, we used flow cytometry to analyze the proportions of circulating Tfh and Tfr cells in fresh peripheral blood samples of 45 na\u0026iuml;ve EC patients and 33 HD (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-B). The proportion of circulating Tfh cells was significantly lower in EC patients (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC), whereas the proportion of circulating Tfr cells was significantly enhanced (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Furthermore, circulating Tfh/Tfr was significantly lower in the EC patients than that in the HD group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003eTo determine the clinical relevance of our findings, we checked the correlation between the circulating Tfh/Tfr and the tumor TNM stage, tumor location, and tumor differentiation status. Notably, a significant negative correlation was observed between circulating Tfh/Tfr with the tumor size and lymph node infiltration. EC patients with higher TNM stage had a higher circulating Tfh/Tfr (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF-I). EC patients with poor tumor differentiation had a higher circulating Tfh/Tfr than those with well or moderate differentiated tumor (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eK). Furthermore, no correlation was observed between the circulating Tfh/Tfr and tumor location (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ). Based on these results, the increased frequency of circulating Tfr cells was attributed to the extent of immunosuppressive microenvironment in EC. Thus, impaired circulating Tfh/Tfr balance may negatively impact antitumor immunity in EC patients.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCorrelation of EXO-PDL1 with circulating Tfh/Tfr and progressive clinical characteristics in EC patients\u003c/h2\u003e \u003cp\u003eThe mechanism contributing to impaired circulating Tfh/Tfr remains to be elucidated. In EC, tumor cell derived exosomes may induce Tfr cell expansion and induce the expression of immunosuppressive marker PDL1 to trigger inhibitory signal [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Therefore, exploring the role of EXO-PDL1 is crucial to understand its role as the inhibitor of immune responses as well as its potential as a biomarker. In this study, we isolated exosomes from the plasma of 26 EC patients and 17 HD, and detected EXO-PDL1. EXO-PDL1 is negatively correlated with Tfh (R=-0.47, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) while positively correlated with Tfr (R\u0026thinsp;=\u0026thinsp;0.8, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)(Fig.S2). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, EC patients showed a clear negative correlation between EXO-PDL1 and circulating Tfh/Tfr (R=-0.74, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Furthermore, these patients exhibited higher EXO-PDL1 level than HD did (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Additionally, EC patients with higher TNM stage had higher EXO-PDL1 levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-E). Based on these findings, we hypothesized that the observed decrease in circulating Tfh/Tfr in EC patients might be attributed to EXO-PDL1 expressed on tumor derived exosomes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eIsolation and characterization of EC cell derived exosomes\u003c/h2\u003e \u003cp\u003eTo determine whether EXO-PDL1 can induce circulating Tfh/Tfr imbalance, we knocked out PDL1 in Eca109 cells and acquired PDL1 deficient cell clones that secreted exosomes without PDL1. Exosomes obtained from the culture supernatant of Eca109-PDL1\u003csup\u003eko\u003c/sup\u003e and Eca109-PDL1\u003csup\u003enc\u003c/sup\u003e cells showed vesicle like morphology with a lipid bilayer (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Nano Sight nanoparticle tracking analysis showed that the extracellular vesicles were approximately 100 nm in diameter (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). EXO-PDL1\u003csup\u003eko\u003c/sup\u003e and EXO-PDL1\u003csup\u003enc\u003c/sup\u003e were positive for the multivesicular body-related proteins CD63, CD9, and Tsg101, but not for Calnexin. As expected, only EXO-PDL1\u003csup\u003enc\u003c/sup\u003e were positive for PDL1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eEC derived exosomes impairs circulating Tfh/Tfr via EXO-PDL1\u003c/h2\u003e \u003cp\u003eExosomes were isolated from Eca109-PDL1\u003csup\u003eko\u003c/sup\u003e and Eca109-PDL1\u003csup\u003enc\u003c/sup\u003e cell supernatants; na\u0026iuml;ve CD4\u003csup\u003e+\u003c/sup\u003eT cells were separated from PBMCs of HD and cultured for use in subsequent assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Na\u0026iuml;ve CD4\u003csup\u003e+\u003c/sup\u003eT cells were seeded in the 96 wells (2\u0026times;10^5 cells/well) followed by anti-CD3 and anti-CD28 antibody stimulation for 48 hours. Next, EXO-PDL1\u003csup\u003eko\u003c/sup\u003e and EXO-PDL1\u003csup\u003enc\u003c/sup\u003e (10 \u0026micro;g/ml) were preincubated with or without anti-PDL1 or anti-IgG (20 \u0026micro;g/ml) for 1 h and cocultured with na\u0026iuml;ve CD4\u003csup\u003e+\u003c/sup\u003e T cells for another 3 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Higher proportion of Tfr cells (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and lower proportion of Tfh cells (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) were observed in EXO-PDL1\u003csup\u003enc\u003c/sup\u003e group than in EXO-PDL1\u003csup\u003eko\u003c/sup\u003e group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC-D, E-F), resulting in a lower circulating Tfh/Tfr (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01); consistently, EXO-PDL1\u003csup\u003eko\u003c/sup\u003e group showed the opposite trend (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). However, there is no difference between EXO-PDL1\u003csup\u003enc\u003c/sup\u003e group than in EXO-PDL1\u003csup\u003eko\u003c/sup\u003e group. Moreover, EXO-PDL1 neutralization using anti-PDL1 reversed the circulating Tfh/Tfr induced by EXO-PDL1\u003csup\u003enc\u003c/sup\u003e as EXO-PDL1\u003csup\u003enc\u003c/sup\u003e\u0026thinsp;+\u0026thinsp;anti-PDL1 group had similar result with that observed in the EXO-PDL1\u003csup\u003eko\u003c/sup\u003e group. Tumor derived exosomes showed a strong potential to induce Tfr cell expansion via EXO-PDL1, leading to immunosuppression. These results suggest that anti-PDL1 drugs could reverse circulating Tfh/Tfr imbalance in EC to achieve ICI efficiency in clinical settings.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEC derived exosomes changes the frequencies, phenotypes, functions of circulating Tfh and circulating Tfr cells via EXO-PDL1\u003c/b\u003e \u003c/p\u003e \u003cp\u003eOur results so far raised the possibility that EC derived EXO-PDL1 can disrupt circulating Tfh/Tfr by increasing the proportion of Tfr cells via PD1-PDL1 interaction. Additionally, blocking PD1-PDL1 interaction reversed this effect. After EXO-PDL1 was incubated with na\u0026iuml;ve CD4\u003csup\u003e+\u003c/sup\u003eT cells for 3 days, we analyzed the expression levels of CTLA4 and ICOS on circulating CD4\u003csup\u003e+\u003c/sup\u003eCXCR5\u003csup\u003e+\u003c/sup\u003eFoxP3\u003csup\u003e\u0026minus;\u003c/sup\u003eTfh cells and circulating CD4\u003csup\u003e+\u003c/sup\u003eCXCR5\u003csup\u003e+\u003c/sup\u003eFoxP3\u003csup\u003e+\u003c/sup\u003eTfr cells. In addition, levels of IL-10, IL-21 and IFN-γ secreted from circulating Tfh and circulating Tfr cells were detected (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-B). After the incubation with EXO-PDL1\u003csup\u003enc\u003c/sup\u003e, the proportion of CD3\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003eCXCR5\u003csup\u003e+\u003c/sup\u003eFoxP3\u003csup\u003e+\u003c/sup\u003eCTLA4\u003csup\u003e+\u003c/sup\u003eTfr cells (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC) and the CD4\u003csup\u003e+\u003c/sup\u003eCXCR5\u003csup\u003e+\u003c/sup\u003eFoxP3\u003csup\u003e+\u003c/sup\u003eICOS\u003csup\u003e+\u003c/sup\u003eTfr cells increased (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD), whereas incubation with EXO-PDL1 upregulated the expression of CTLA4 on Tfh cells (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH-I). Concurrently, after incubation with EXO-PDL1\u003csup\u003enc\u003c/sup\u003e, Tfr cells expressed a higher level of IL-10 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE-G), whereas circulating Tfh cells secreted lower levels of IL-21 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and IFN-γ (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and a higher level of IL-10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ-L) than those incubated with EXO-PDL1\u003csup\u003eko\u003c/sup\u003e. Next, to elucidate whether those trends were induced by PD1-PDL1 interaction, we incubated exosomes with anti-PDL1 antibody, which significantly reversed the results.\u003c/p\u003e \u003cp\u003eCollectively, these findings indicate that EXO-PDL1 may change the phenotypes of circulating Tfh cells and circulating Tfr cells, induce suppressive functions. EXO-PDL1 can, therefore, play a key role in immunosuppression by involving PD1-PDL1 and skewing circulating Tfh/Tfr in EC patients.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we investigated the role of EC derived exosomes in regulating the balance of circulating Tfh/Tfr. Our data showed that the proportion of circulating Tfr cells, characterized by high expression of FoxP3, was higher in EC patients than HD, whereas that of circulating Tfh cells, characterized by low expression of FoxP3, was lower than HD. In addition, EC patients had a significantly lower circulating Tfh/Tfr than HD. Furthermore, circulating Tfh/Tfr significantly correlated with tumor TNM stage and tumor differentiation status, which suggests that circulating Tfh/Tfr imbalance may be one of the mechanisms to induce EC carcinogenesis and may be used as a tumor prediction marker for EC. Our results are consistent with findings from studies, which reported that Tfh/Tfr imbalance is related to the progression of malignant tumors, such as non-small cell lung cancer [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], breast cancer [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], hepatocellular carcinoma [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], colorectal cancer [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], and pancreatic cancer [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. As circulating Tfh and Tfr cells play opposing roles in maintaining germinal center responses, their balanced activities are critical for immune homeostasis [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTumor derived exosomal PDL1 contributes to establishing the immune memory of the tumor [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Furthermore, immunosuppressive signaling mediated by EXO-PDL1 reportedly plays a crucial role in inhibiting antitumor immunity [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Accordingly, EXO-PDL1 predicts poor survival, reflects immune status in gastric cancer patients and correlates with clinical stage of breast cancer, head and neck cancer, and melanoma [\u003cspan additionalcitationids=\"CR29 CR30\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Similar results were reported for MC38 colon cancer, melanoma, and TRAMP-C2 prostate cancer mouse models [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In our study, exosomes extracted from the plasma of EC patients revealed increased EXO-PDL1 expression compared with those extracted from HD. Furthermore, a significant correlation was noted between EXO-PDL1 and tumor TNM stage and differentiation status. Interestingly, increased EXO-PDL1 expression level reportedly negatively correlates with circulating Tfh/Tfr in EC patients.\u003c/p\u003e \u003cp\u003eBased on these findings, we infer that EXO-PDL1 may induce the expansion of circulating Tfr cells. EC derived EXO-PDL1 be one of the mechanisms underlying circulating Tfh/Tfr imbalance.\u003c/p\u003e \u003cp\u003eIn vitro coculture of PDL1\u003csup\u003e+\u003c/sup\u003e exosomes with T cells suppresses T cell activation [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], and EXO-PDL1 also suppresses tumor immunity [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Here, we confirmed that following anti-CD3/CD28 stimulation, EXO-PDL1\u003csup\u003enc\u003c/sup\u003e but not EXO-PDL1\u003csup\u003eko\u003c/sup\u003e, induced the expansion of circulating Tfr cells, thereby disturbed circulating Tfh/Tfr. It is possible that the greater suppressive capacity of circulating Tfr cells, together with the decreased circulating Tfh/Tfh inhibits circulating Tfh cell function [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Eca109-PDL1\u003csup\u003eko\u003c/sup\u003e cell-derived exosomes did not induce the expansion of Tfr cells, whereas Eca109-PDL1\u003csup\u003enc\u003c/sup\u003e cell-derived exosomes did. To the best of our knowledge, this is the first study to show the role of tumor-derived EXO-PDL1 in Tfh/Tfr balance in EC tumorigenesis.\u003c/p\u003e \u003cp\u003eCTLA4 inhibits T cell proliferation, suppresses the transcription of IL-2 encoding gene, as well as initiates inhibitory signal transduction. Sage et al demonstrated that CTLA4 loss on Tfh cells resulted in stronger B cell responses, whereas CTLA4 loss on Tfr cells resulted in defective suppression of antigen-specific antibody responses [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Our results showed that EXO-PDL1 increased CTLA4 expression not only on Tfr cells, but also on Tfh cells, which means that antigen-specific antibody responses and B cell responses were significantly suppressed, which may be one of the reasons accounting for the EC immunosuppressive microenvironment. Furthermore, ICOS supply essential costimulatory signals for Tfr and Tfh cells in circulation as well as in the lymph nodes and is required for Tfr cell differentiation [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Here, EXO-PDL1\u003csup\u003enc\u003c/sup\u003e but not EXO-PDL1\u003csup\u003eko\u003c/sup\u003e incubated with activated na\u0026iuml;ve CD4\u003csup\u003e+\u003c/sup\u003eT cells led to the higher ICOS expression on Tfr cells. Moreover, ICOS ligand on the B cell surface also binds to ICOS on Tfr cell surface, which may lead to the dysfunctional B cells.\u003c/p\u003e \u003cp\u003eIL-10 of Tfr cells could inhibit the ability of Tfh cells to proliferate and secrete cytokines, thereby regulating the immune response of B cells, including antibody class switching and affinity maturation. IL-21 derived from Tfh cells can also inhibit the expansion of Tfr cells in the germinal center. We compared the cytokine IL-21, IL-10 and IFN-γ expression profiles between CD4\u003csup\u003e+\u003c/sup\u003eCXCR5\u003csup\u003e+\u003c/sup\u003eFoxP3\u003csup\u003e\u0026minus;\u003c/sup\u003eTfh cells and CD4\u003csup\u003e+\u003c/sup\u003eCXCR5\u003csup\u003e+\u003c/sup\u003eFoxP3\u003csup\u003e+\u003c/sup\u003eTfr cells. Stimulated by TCR, EXO-PDL1\u003csup\u003enc\u003c/sup\u003e promotes the expansion of CTLA4\u003csup\u003e+\u003c/sup\u003eTfr significantly accompanied with higher level of IL-10, while reduces Tfh significantly along with lower level of IL-21 and IFN-γ. These changes in cytokine levels accelerated the imbalance of Tfh/Tfr, defected humoral immunity and had other immunosuppressive effects.\u003c/p\u003e \u003cp\u003ePD1 controls the generation and function of suppressive Tfr cells [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Our data showed that when EXO-PDL1 was neutralized by anti-PDL1 antibody, the proportion of circulating Tfr cells decreased and circulating Tfh/Tfr imbalance reversed. Thus, anti-PDL1 treatment can abolish exosomal immunosuppression mediated by PDL1, thereby activating antitumor immunity and attenuating the immune suppression [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTumor-derived exosome bound PDL1 results in anergic T cells in different types of cancer, such as glioblastoma, melanoma, gastric and lung cancer [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Our results are consistent with those findings showing that EXO-PDL1 can function as a systemic immunosuppressant [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOverall, our study highlights a novel pathway whereby EC cells release exosomes with the potential to promote the accumulation of Tfr cells. Sage et al highlighted the lack of methods for selectively modulating Tfr cells in clinical settings [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], our findings suggest the possibility that tumor-secreted exosomes may also serve as a therapeutic target while EXO-PDL1 could modulate circulating Tfh/Tfr in clinical settings.\u003c/p\u003e \u003cp\u003eCertain limitations were noted in our research. First, some studies have demonstrated that EXO-PDL1 is associated with PFS and OS [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In our study, we did not obtain data related to PFS or OS. Second, the relative proportions of circulating Tfh and circulating Tfr cells change over time and precede antibody production and function [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], further studies are required to investigate and validate these aspects.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis is the first study to investigate the relationship between circulating Tfh/Tfr, EXO-PDL1, and clinical characteristics for EC patients. EXO-PDL1 and circulating Tfh/Tfr served as independent prognostic biomarkers. Furthermore, we define a new role for EXO-PDL1 in regulating EC immune responses via modulating differentiation and functions of circulating Tfh and circulating Tfr cells in the blood, which could be reversed by treatment with anti-PDL1 antibody. EXO-PDL1 maybe one of the effectors by which anti-PDL1 drugs achieve their clinical benefits. Deepening our understanding of how EXO-PDL1 influences the overall immune profile of EC patients is critical to achieve successful patient outcomes.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eEC: esophageal cancer; HD: healthy donors; Tfr: follicular regulatory T cell; Tfh: follicular helper T cell; PDL1: Programmed death ligand 1; PD1: Programmed death receptor 1; PBMC: Peripheral blood mononuclear cells; Exo/exo: Exosome; qPCR: Quantitative PCR; CXCR5: the chemokine receptor 5; TNM: tumor size (T)、lymph node infiltration (N)、metastasis (M); ATCC: American Type Culture Collection.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e\n\u003cp\u003eThis study involves human participants. Participants gave informed consent to participate in the study before taking part. This study was approved by the Fourth Hospital of Hebei Medical University Ethics Committee (2020ky241).\u003c/p\u003e\n\u003ch2\u003eConsent for publication\u003c/h2\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003ch2\u003eAvailability of data and material\u003c/h2\u003e\n\u003cp\u003eData are available upon reasonable request.\u003c/p\u003e\n\u003ch2\u003eCompeting interests\u003c/h2\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003eThis work was supported by the Basic Research Cooperation Project of Beijing, Tianjin, Hebei from the Natural Science Foundation of Hebei (H2020206649), Tianjin (20JCZXJC00070) and Beijing (J200018).\u003c/p\u003e\n\u003ch2\u003eAuthors\u0026apos; contributions\u003c/h2\u003e\n\u003cp\u003eZhiyu Wang and Zijie Li conducted conceptualization of the study, experimental design. Zijie Li performed major Imageflow experiments and mass cytometry experiments and analysis., He Hao and Yuehua Zhang interpreted and analyzed data. Lu Chen, Xiaokuan Zhang and Tingting Lv assisted with experiments. Yuying Qi provided advice with experiments. Zijie Li wrote, reviewed and edited the manuscript. Zhiyu Wang is responsible for the overall content as guarantor.\u003c/p\u003e\n\u003ch2\u003eAcknowledgements\u003c/h2\u003e\n\u003cp\u003eWe sincerely thank all the people who have provided helpful support.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMorrissey, S.M., et al., \u003cem\u003eTumor-derived exosomes drive immunosuppressive macrophages in a pre-metastatic niche through glycolytic dominant metabolic reprogramming.\u003c/em\u003e Cell Metab, 2021. \u003cstrong\u003e33\u003c/strong\u003e(10): p. 2040-2058 e10.\u003c/li\u003e\n\u003cli\u003eLindau, D., et al., \u003cem\u003eThe immunosuppressive tumour network: myeloid-derived suppressor cells, regulatory T cells and natural killer T cells.\u003c/em\u003e Immunology, 2013. \u003cstrong\u003e138\u003c/strong\u003e(2): p. 105-115.\u003c/li\u003e\n\u003cli\u003eRaimondo, S., et al., \u003cem\u003eExtracellular Vesicles and Tumor-Immune Escape: Biological Functions and Clinical Perspectives.\u003c/em\u003e Int J Mol Sci, 2020. \u003cstrong\u003e21\u003c/strong\u003e(7): p. 2286.\u003c/li\u003e\n\u003cli\u003eDaassi, D., K.M. Mahoney, and G.J. Freeman, \u003cem\u003eThe importance of exosomal PDL1 in tumour immune evasion.\u003c/em\u003e Nat Rev Immunol, 2020. \u003cstrong\u003e20\u003c/strong\u003e(4): p. 209-215.\u003c/li\u003e\n\u003cli\u003ePoggio, M., et al., \u003cem\u003eSuppression of Exosomal PD-L1 Induces Systemic Anti-tumor Immunity and Memory.\u003c/em\u003e Cell, 2019. \u003cstrong\u003e177\u003c/strong\u003e(2): p. 414-427.\u003c/li\u003e\n\u003cli\u003eKahlert, C. and R. Kalluri, \u003cem\u003eExosomes in tumor microenvironment influence cancer progression and metastasis.\u003c/em\u003e J Mol Med (Berl), 2013. \u003cstrong\u003e91\u003c/strong\u003e(4): p. 431-437.\u003c/li\u003e\n\u003cli\u003eLiu, J., et al., \u003cem\u003eThe biology, function, and applications of exosomes in cancer.\u003c/em\u003e Acta Pharm Sin B, 2021. \u003cstrong\u003e11\u003c/strong\u003e(9): p. 2783-2797.\u003c/li\u003e\n\u003cli\u003eCordonnier, M., et al., \u003cem\u003eTracking the evolution of circulating exosomal-PD-L1 to monitor melanoma patients.\u003c/em\u003e J Extracell Vesicles, 2020. \u003cstrong\u003e9\u003c/strong\u003e(1): p. 1710899.\u003c/li\u003e\n\u003cli\u003eMorrissey, S.M. and J. Yan, \u003cem\u003eExosomal PD-L1: Roles in Tumor Progression and Immunotherapy.\u003c/em\u003e Trends Cancer, 2020. \u003cstrong\u003e6\u003c/strong\u003e(7): p. 550-558.\u003c/li\u003e\n\u003cli\u003eHe, H., et al., \u003cem\u003eILdrives conversion of T follicular helper cells to T follicular regulatory cells through transcriptional regulation in systemic lupus erythematosus.\u003c/em\u003e 2020.\u003c/li\u003e\n\u003cli\u003eMa, X., et al., \u003cem\u003eExpansion of T follicular helper-T helper 1 like cells through epigenetic regulation by signal transducer and activator of transcription factors.\u003c/em\u003e Ann Rheum Dis, 2018. \u003cstrong\u003e77\u003c/strong\u003e(9): p. 1354-1361.\u003c/li\u003e\n\u003cli\u003eKing, C., \u003cem\u003eTfh cells set the stage for tumor control.\u003c/em\u003e Immunity, 2021. \u003cstrong\u003e54\u003c/strong\u003e(12): p. 2690-2692.\u003c/li\u003e\n\u003cli\u003eYe, Y., M. Wang, and H. Huang, \u003cem\u003eFollicular regulatory T cell biology and its role in immune-mediated diseases.\u003c/em\u003e J Leukoc Biol, 2021. \u003cstrong\u003e110\u003c/strong\u003e(2): p. 239-255.\u003c/li\u003e\n\u003cli\u003eWing, J.B., A. Tanaka, and S. Sakaguchi, \u003cem\u003eHuman FOXP3(+) Regulatory T Cell Heterogeneity and Function in Autoimmunity and Cancer.\u003c/em\u003e Immunity, 2019. \u003cstrong\u003e50\u003c/strong\u003e(2): p. 302-316.\u003c/li\u003e\n\u003cli\u003eChung, Y., et al., \u003cem\u003eFollicular regulatory T cells expressing Foxp3 and Bcl-6 suppress germinal center reactions.\u003c/em\u003e Nat Med, 2011. \u003cstrong\u003e17\u003c/strong\u003e(8): p. 983-988.\u003c/li\u003e\n\u003cli\u003eGonzalez-Figueroa, P., et al., \u003cem\u003eFollicular regulatory T cells produce neuritin to regulate B cells.\u003c/em\u003e Cell, 2021. \u003cstrong\u003e184\u003c/strong\u003e(7): p. 1775-1789.\u003c/li\u003e\n\u003cli\u003eSage, P.T. and A.H. Sharpe, \u003cem\u003eT follicular regulatory cells in the regulation of B cell responses.\u003c/em\u003e Trends Immunol, 2015. \u003cstrong\u003e36\u003c/strong\u003e(7): p. 410-418.\u003c/li\u003e\n\u003cli\u003eSage, P.T., et al., \u003cem\u003eCirculating T follicular regulatory and helper cells have memory-like properties.\u003c/em\u003e J Clin Invest, 2014. \u003cstrong\u003e124\u003c/strong\u003e(12): p. 5191-5204.\u003c/li\u003e\n\u003cli\u003eLiu, C., et al., \u003cem\u003eIncreased Circulating Follicular Treg Cells Are Associated With Lower Levels of Autoantibodies in Patients With Rheumatoid Arthritis in Stable Remission.\u003c/em\u003e Arthritis Rheumatol, 2018. \u003cstrong\u003e70\u003c/strong\u003e(5): p. 711-721.\u003c/li\u003e\n\u003cli\u003eWieckowski, E.U., et al., \u003cem\u003eTumor-derived microvesicles promote regulatory T cell expansion and induce apoptosis in tumor-reactive activated CD8+ T lymphocytes.\u003c/em\u003e J Immunol, 2009. \u003cstrong\u003e183\u003c/strong\u003e(6): p. 3720-3730.\u003c/li\u003e\n\u003cli\u003eXie, F., et al., \u003cem\u003eThe role of exosomal PD-L1 in tumor progression and immunotherapy.\u003c/em\u003e Mol Cancer, 2019. \u003cstrong\u003e18\u003c/strong\u003e(1): p. 146-156.\u003c/li\u003e\n\u003cli\u003eShi, W., et al., \u003cem\u003ePD-1 regulates CXCR5(+) CD4 T cell-mediated proinflammatory functions in non-small cell lung cancer patients.\u003c/em\u003e Int Immunopharmacol, 2020. \u003cstrong\u003e82\u003c/strong\u003e: p. 106295.\u003c/li\u003e\n\u003cli\u003eFaghih, Z., et al., \u003cem\u003eImmune profiles of CD4+ lymphocyte subsets in breast cancer tumor draining lymph nodes.\u003c/em\u003e Immunol Lett, 2014. \u003cstrong\u003e158\u003c/strong\u003e(1-2): p. 57-65.\u003c/li\u003e\n\u003cli\u003eWang, B., et al., \u003cem\u003eTfr-Tfh index: A new predicator for recurrence of hepatocellular carcinoma patients with HBV infection after curative resection.\u003c/em\u003e Clin Chim Acta, 2020. \u003cstrong\u003e511\u003c/strong\u003e: p. 282-290.\u003c/li\u003e\n\u003cli\u003eShi, W., et al., \u003cem\u003eFollicular helper T cells promote the effector functions of CD8(+) T cells via the provision of IL-21, which is downregulated due to PD-1/PD-L1-mediated suppression in colorectal cancer.\u003c/em\u003e Exp Cell Res, 2018. \u003cstrong\u003e372\u003c/strong\u003e(1): p. 35-42.\u003c/li\u003e\n\u003cli\u003eLux, A., et al., \u003cem\u003ec-Met and PD-L1 on Circulating Exosomes as Diagnostic and Prognostic Markers for Pancreatic Cancer.\u003c/em\u003e Int J Mol Sci, 2019. \u003cstrong\u003e20\u003c/strong\u003e(13): p. 3305.\u003c/li\u003e\n\u003cli\u003eWang, L., et al., \u003cem\u003eHCV-associated exosomes promote myeloid-derived suppressor cell expansion via inhibiting miR-124 to regulate T follicular cell differentiation and function.\u003c/em\u003e Cell Discov, 2018. \u003cstrong\u003e4\u003c/strong\u003e: p. 51.\u003c/li\u003e\n\u003cli\u003eDel Re, M., et al., \u003cem\u003ePD-L1 mRNA expression in plasma-derived exosomes is associated with response to anti-PD-1 antibodies in melanoma and NSCLC.\u003c/em\u003e Br J Cancer, 2018. \u003cstrong\u003e118\u003c/strong\u003e(6): p. 820-824.\u003c/li\u003e\n\u003cli\u003eCao, J., et al., \u003cem\u003eExosomes in head and neck cancer: Roles, mechanisms and applications.\u003c/em\u003e Cancer Letters, 2020. \u003cstrong\u003e494\u003c/strong\u003e: p. 7-16.\u003c/li\u003e\n\u003cli\u003eFan, Y., et al., \u003cem\u003eExosomal PD-L1 Retains Immunosuppressive Activity and is Associated with Gastric Cancer Prognosis.\u003c/em\u003e Ann Surg Oncol, 2019. \u003cstrong\u003e26\u003c/strong\u003e(11): p. 3745-3755.\u003c/li\u003e\n\u003cli\u003eYang, Y., et al., \u003cem\u003eExosomal PD-L1 harbors active defense function to suppress T cell killing of breast cancer cells and promote tumor growth.\u003c/em\u003e Cell Research, 2018. \u003cstrong\u003e28\u003c/strong\u003e(8): p. 862-864.\u003c/li\u003e\n\u003cli\u003eSage, P.T., et al., \u003cem\u003eThe receptor PD-1 controls follicular regulatory T cells in the lymph nodes and blood.\u003c/em\u003e Nat Immunol, 2013. \u003cstrong\u003e14\u003c/strong\u003e(2): p. 152-161.\u003c/li\u003e\n\u003cli\u003eSage, P.T. and A.H.J.I.R. Sharpe, \u003cem\u003eT follicular regulatory cells.\u003c/em\u003e 2016. \u003cstrong\u003e271\u003c/strong\u003e(1): p. 246-259.\u003c/li\u003e\n\u003cli\u003eSage, P.T., et al., \u003cem\u003eThe coinhibitory receptor CTLA-4 controls B cell responses by modulating T follicular helper, T follicular regulatory, and T regulatory cells.\u003c/em\u003e Immunity, 2014. \u003cstrong\u003e41\u003c/strong\u003e(6): p. 1026-1039.\u003c/li\u003e\n\u003cli\u003eTheodoraki, M.N., et al., \u003cem\u003eClinical Significance of PD-L1+ Exosomes in Plasma of Head and Neck Cancer Patients.\u003c/em\u003e 2017. \u003cstrong\u003e24\u003c/strong\u003e(4): p. 896-905.\u003c/li\u003e\n\u003cli\u003eXing, C., et al., \u003cem\u003eThe roles of exosomal immune checkpoint proteins in tumors.\u003c/em\u003e Mil Med Res, 2021. \u003cstrong\u003e8\u003c/strong\u003e(1): p. 56-66.\u003c/li\u003e\n\u003cli\u003eKugeratski, F.G. and R. Kalluri, \u003cem\u003eExosomes as mediators of immune regulation and immunotherapy in cancer.\u003c/em\u003e FEBS J, 2021. \u003cstrong\u003e288\u003c/strong\u003e(1): p. 10-35.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"esophageal cancer, follicular regulatory T cells, follicular helper T cells, EXO-PDL1, immunosuppression","lastPublishedDoi":"10.21203/rs.3.rs-3089394/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3089394/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e: Esophageal cancer (EC) is a deadly malignancy. Exosomal programmed death ligand 1 (EXO-PDL1) induces immune escape to promote tumor progression. Furthermore, the imbalance between circulating follicular helper T cells (Tfh) and circulating follicular regulatory T cells (Tfr) is related to the progression of many malignant tumors. However, the role of the EC derived EXO-PDL1 in circulating Tfh/Tfr is unknown.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e: Circulating Tfh and circulating Tfr cells were determined using flow cytometry. Exosomes were isolated using differential centrifugation and PDL1 expression on exosomes was tested using ELISA. Exosomes were cultured in vitro for Tfh and Tfr cells expansion assays. Naïve CD4\u003csup\u003e+\u003c/sup\u003e T cells were isolated, stimulated, and cultured in vitro with exosomes to evaluate the frequencies, phenotypes, and functions of Tfh and Tfr cells..\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e: For EC patients, the proportion of circulating Tfh cells was lower than that in HD whereas the proportion of circulating Tfr cells was higher. EC patients showed a significantly lower circulating Tfh/Tfr and a higher level of EXO-PDL1 than HD, and a negative correlation was noted between EXO-PDL1 and circulating Tfh/Tfr. EXO-PDL1 inhibited the expansion of Tfh cells and enhanced the percentage of CTLA4\u003csup\u003e+\u003c/sup\u003eTfh cells. Additionally, the levels of IL-21 and IFN-γ decreased, whereas IL-10 level was increased. EXO-PDL1 promoted the expansion and suppressive functions of circulating Tfr cells, the increased percentages of CTLA4\u003csup\u003e+\u003c/sup\u003e Tfr cells and ICOS\u003csup\u003e+\u003c/sup\u003e Tfr cells were accompanied with higher levels of IL-10, IFN-γ, and IL-21.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions\u003c/strong\u003e: Our results suggest a novel mechanism of EXO-PDL1 mediated immunosuppression in EC. Thus, inhibiting EXO-PDL1 to restore circulating Tfh/Tfr balance may provide new therapeutic approaches in EC treatment.\u003c/p\u003e","manuscriptTitle":"Esophageal cancer derived exosomes imbalance circulating Tfh/Tfr via EXO-PDL1 to promote immunosuppression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-06-27 19:22:52","doi":"10.21203/rs.3.rs-3089394/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"92055e53-8038-47bc-97aa-58cac50259f1","owner":[],"postedDate":"June 27th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-06-27T19:22:55+00:00","versionOfRecord":[],"versionCreatedAt":"2023-06-27 19:22:52","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3089394","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3089394","identity":"rs-3089394","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}