Glypican 3 as target therapy to prevent cell migration and proliferation in rhabdomyosarcoma

Glypican 3 as target therapy to prevent cell migration and proliferation in rhabdomyosarcoma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Glypican 3 as target therapy to prevent cell migration and proliferation in rhabdomyosarcoma Maira Bacchiega, Stefania D’Agostino, Antonella Grigoletto, Elena Poli, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5664628/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 01 Jul, 2025 Read the published version in Scientific Reports → Version 1 posted 8 You are reading this latest preprint version Abstract Rhabdomyosarcoma (RMS) is a pediatric soft tissue sarcoma of mesenchymal origin with two main variants, the embryonal, less aggressive, and the alveolar RMS, more metastatic. The role of the extracellular matrix (ECM) in the growth and migration of RMS, as in other cancers, is becoming increasingly important. This work aims to study the RMS after the silencing of the proteoglycan Glypican 3, overexpressed in RMS. Using classical 2D cell culture with RMS cell lines and 3D hyaluronic acid-based hydrogel, the involvement of Glypican 3 in adhesion, proliferation, matrix degradation, and consequent cell motility was demonstrated. Functional assays were performed with the antineoplastic drug doxurubicin and the WNT3a inhibitor, ipafricept. Both in 2D and in 3D model, cell motility and proliferation were significantly impaired after Glypican 3 silencing and inhibition of the proteoglycan releasing the sulfatase enzyme SULF2. When the in vivo cell-ECM interactions were mimicked in the hyaluronic acid-based hydrogel, Doxorubicin and ipraficept were particularly effective against the GPC3-silenced RMS cells. This study lay the fundation for a different therapeutic approach against pediatric RMS that aim to dysregulate the protein microenvironment not only beat the cancer cells. Biological sciences/Cancer/Cancer microenvironment Biological sciences/Biotechnology/Biomaterials Extracellular matrix Glypican 3 Rhabdomyosarcoma HA-hydrogel model Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Cancer cells are considered to be the key drivers of tumor progression, although in recent years the surrounding cell microenvironment has been identified as the milieu that nourishes and promotes the malignant growth 1 , 2 . In addition, tumor microenvironment proteins and chemokines represent a more stable therapeutic target, free from the genomic instability that characterizes cancer cells 3 , 4 . Rhabdomyosarcoma (RMS) is the most common soft tissue sarcoma in children, with an incidence of 4.5 cases per millions of children and adolescents. RMS develops from rhabdo-myoblasts: immature myogenic mesenchymal cells committed to skeletal muscle differentiation 5 – 8 . RMS can be divided into two subtypes: the alveolar subtype (ARMS), which is more aggressive and metastatic, accounting for 25% of cases, and the embryonal subtype (ERMS), which is less aggressive and more localised, accounting for the remaining 75% of cases 7 , 9 , 10 . Nonetheless, approximately 20–25% of RMS cases have metastasis at diagnosis, particularly in the lung and bone marrow where the microenvironment contributes significantly to the growth potential of cancer cells. Recent studied on the extracellular matrix (ECM) support the important role of the cross-talk between transformed cells and their niche, linking ECM composition to pathological conditions. The ECM supports the growth and survival of the malignant cells and contributes to tumor dissemination. The ECM is composed by a proteoglycans (PGs) mesh, the glycocalyx, and basal membrane proteins, including collagen and fibronectin. The PG component of the ECM plays a central role in the complex events of organ development and stemness, influencing processes such as membrane receptor trafficking (during endocytosis), ligand secretion and the distribution of signaling gradients, which also significantly favour tumor development and progression. Among the PG components, Glypican 3 (GPC3) is particularly overexpressed in RMS cells, suggesting that it may be of special importance for RMS biology. GPC3 encodes a cell surface protein that is time- and tissue-restricted. It contributes to the regulation of cell growth and differentiation in a tissue-dependent manner. GPC3 has been detected in both embryonic and fetal normal tissues, as well as in several childhood and adult tumors, both sarcomas and carcinomas 11 , 12 . The ability of GPC3 to bind growth factors involved in tumor development and survival is due to the sulphation of its saccharide residues 13 – 16 . In particular, sulfatase enzyme-2 (SULF-2) promotes tumor growth by releasing soluble growth factors from GPC3 into the extracellular matrix, which in turn triggers the activity of cell surface cognate receptors and downstream intracellular cancer signaling 17 . This has been shown in hepatocellular carcinoma (HCC), where SULF-2 is overexpressed and GPC3 is abundantly desulphated, leading to the release of FGF2 or Wnt3a factors 18 , 19 . Indeed, SULF-2 knockdown reduces HCC cell proliferation and migration, as downregulation of GPC3 expression results in impaired FGF2 and Wnt3a binding, inhibiting oncogenic signaling related, also, to cell proliferation 18 . Consistent with its overexpression in HCC cells, GPC3 has recently been exploited as a novel tumor-associated antigen, capable of inducing both antibody-dependent cellular cytotoxicity and T cell-mediated tumor rejection in xenografts, as well as CD8 + T-cell responses in HCC patients 20 . In the case of RMS, it has been discovered the presence of redundant autocrine and paracrine circuits such as FGF signaling where deregulation of Wnt and Sonic Hedgehog, important factors for cell proliferation, have been involved in disease onset and spreading 21 , 22 , 23 . Based on these premises, the aim of this study was to investigate the role of the peptidoglycan GPC3 in RMS tumor growth, progression and drug response. Classic 2D and a 3D hydrogel-based cell culture models were used to characterize cell behaviour when the microenvironment was targeted with GPC3 silencing and when cells were exposed to the chemotherapeutic drugs doxorubicin 24 , 25 and ipafricept, a Wnt3a inhibitor 26 . Materials and Methods Cell lines The cell lines RH30 and RH4 for the ARMS subtype, and RD and RH36 for the ERMS subtype were provided by the laboratory of Prof Gianni Bisogno, coordinator of the European Paediatric Soft Tissue Sarcoma Study Group (EpSSG). All cell lines were cultured with DMEM High Glucose (Dulbecco’s modified eagle’s medium: D1145-500mL, Sigma-Aldrich, UK), 10% Fetal Bovine Serum (10270-106, Gibco, UK), 1% Pen-Strep (Penicillin and Streptomycin: 15140-122, Gibco, USA), 1% glutamine (25030-081, Gibco, UK), at 37°C and 5% CO 2 . All cell lines have already been characterized by the laboratory through specific markers, such as myogenin 6 . GPC3 silencing The cells were plated in 24 wells, and the silencing mix was added to each well. To the complete medium, a pool of 3 target-specific siRNA against GPC3 10 µM (sc-40640, Santa Cruz Biotechnology, USA), together with Lipofectamine (13778075, Invitrogen, Lithuania) was added. The silencing procedure was followed twice within 24 hours of each other, to achieve very low levels of GPC3 expression. Cells were also treated with scramble-siRNA (sc-37007, Santa Cruz Biotechnology, USA) to prove the absence of toxicity of the treatment. After silencing, cells were treated with the SULF-2 inhibitor OKN-007 (SML2163, Sigma Aldrich, UK). The treatment lasts for 48 hours at a concentration of 50 µM 27 . Doxorubicin (DOXO) (296, 21CEC PX Pharm Ltd, UK) was added at a concentration of 1 µM for 24 hours, while ipafricept at a concentration of 2 µg/ml (HY-P99667, MedChemExpress, USA) for 48 hours 28 , 29 . Cell viability was evaluated with PrestoBlue HS cell viability reagent (P50200, Invitrogen, US) by measuring the fluorescence with Spark Tecan. Wound healing assay Once the gene for GPC3 was silenced, the wound-healing assay was done. In 24 wells the insert of IBIDI (81176, IBIDI, Germany) has been added in the middle. On the left and the right of the insert 30000 cells have been seeded and 24 hours later the insert was taken off. The images were taken with the optical microscope (Olympus optical co. IX71, Japan), at 0 and 24 hours from the insert take off, and data were analyzed with ImageJ, using the Threshold tool. Adhesion test WT and siRNA-treated cells were seeded in a fibronectin-coated plate diluted 1:1000 in PBS (Fibronectin bovine plasma, F1141-1MG, Sigma Aldrich, UK). After incubation for two hours at 37°C, adhered cells were fixed in PFA 4%, labeled with Hoechst (Hoechst 33342, H3570, Life Technologies, USA), and analyzed with the fluorescence microscope. Cell cycle analysis The staining solution consisted of PBS containing Triton X-100 (0.1%; Fluka,), DNAse-free RNAse A (0.2 mg/ml; Sigma-Aldrich, St Louis, MO, USA), and propidium iodide (1 mg/ml; Sigma-Aldrich, USA). After resuspension in cold PBS and ethanol, tubes were stored at -20°C for at least 24 hours. After staining with 300 µl/10 6 cells of staining solution, cells were analyzed. Immunofluorescence Immunofluorescence analysis was performed following an already published protocol 6 . For cell permeabilization, 0.05% Triton-X-100 (1610407, Bio-Rad, USA) was used. Horse Serum (16050-130, Gibco, New Zealand) was added. The primary antibody was diluted in PBS + 1% Bovine Serum Albumin (A7906-100G, Sigma-Aldrich, USA) according to the dilution in Table 1 . For staining, the hydrogel was incubated for 24 hours with the primary antibody and then for hours with the secondary antibody. Hoechst was added to allow for nuclei staining. Fluorescence microscope (DMI600B, Leica, USA) was used. Table 1 Antibody list. Target Host Dilution Incubation Product code Producer GPC3 rabbit 1:50 4°C, overnight PA5-13360 Thermo Scientific, UK Ki67 rabbit 1:100 4°C, overnight 15580 Abcam, UK GPC3 mouse 1:50 4°C, overnight GT2473 GeneTex, USA GPC5 mouse 1:50 4°C, overnight sc-390838 Santa Cruz Biotechnology, USA SULF2 mouse 1:200 37°C, 1 hour GTX38989 GeneTex, USA ITGα9β1 mouse 1:100 4°C, overnight ab27947 Abcam, UK FGF2 rabbit 1:100 37°C, 1 hour ab208687 Abcam, UK Fibronectin mouse 1:100 4°C, overnight MA5-11981 Invitrogen, US ITG rabbit 1.100 4°C, 24 hours Ab92547 Abcam, UK cCaspase 3 rabbit 1:200 4°C, overnight D175 Cell signaling technologies, USA Anti-Rb chicken 1:200 1 hour A21442 Invitrogen, US Anti-mouse goat 1:200 1 hour A11001 Invitrogen, US Anti-Rb chicken 1:200 1 hour A21441 Invitrogen, US Anti-mouse goat 1:200 1 hour A11005 Invitrogen, US Zymography Cells were seeded in serum-free DMEM-HG, 1% Pen/Strep, and 1% L-Gln. The serum-free conditioned medium was harvested after 24 hours for zymography 30 . The resolving gel was made of sterile H 2 O, 1.5 M Tris·HCl pH 8.8 (489973, Carlo Erba Reagents, Italy), 10% sodium dodecyl sulfate (1610301, Bio-Rad, USA), acrylamide/bis 29:1 (1610156, Bio-Rad, USA), 1% gelatin (94804, Bio-Rad, USA), 10% ammonium persulfate (A3678, Sigma-Aldrich, USA), N’-N’-N’-N’ tetramethylethylenediamine (TEMED) (1610801, Bio-Rad, USA). The stacking gel was made of sterile H 2 O, 0.5 M Tris·HCl pH 6.8, 10% sodium dodecyl sulfate, acrylamide/bis 29:1, 10% ammonium persulfate, TEMED. Working running buffer 1× was made of Tris-base, Glycine (1610718, Bio-Rad, USA), sodium dodecyl sulfate, and sterile H 2 O. For sample normalization the BCA Protein Assay Kit (23227, Thermo Fisher, USA) was used. Each sample was resuspended in 5× sample buffer, made of 0.313 M Tris-HCl pH 6,8, 10% sodium dodecyl sulfate, 50% glycerol (G5516, Sigma-Aldrich, USA), 0.05% bromophenol blue (114391, Sigma-Aldrich, USA). Samples were loaded into the gel and run at 110 V and 30 mA/gel, using the marker Amersham ECL Rainbow Marker – full range (GERPN800E, Sigma-Aldrich, USA). The washing buffer was composed of Triton-X-100 (1610407, Bio-Rad, USA) and sterile H 2 O in a ratio of 1:39. The incubation was run for 20 hours at 37°C with the development buffer containing 500 mM Tris pH 7.4, 100 mM CaCl 2 (43381, Carlo Erba Reagents, Italy), 0.2% NaN 3 (478484, Carlo Erba Reagents, Italy), H 2 O sterile. The staining solution used has the following composition: Coomassie bright blue R-250 (1610400, Bio-Rad, USA), acetic acid, ethanol, and sterile H 2 O. The de-staining buffer was made of ethanol, acetic acid, and H 2 O. The quantification was made by the iBright (iBright 1500, Invitrogen, USA). qRT-PCR RNA extraction has been performed using Trizol Reagent (15596018, Life Technologies, USA). Chloroform (438613, Carlo Erba, Italy) was added. Samples of RNA: isopropanol (278475-1L, Sigma-Aldrich, USA) 1:1 were centrifuged at 4°C for 10 minutes, the supernatant of isopropanol was eliminated, and 75% ethanol (32221-2.5L-M, Sigma-Aldrich, USA) was added. The samples were centrifuged for 10 minutes, and the pellets were resuspended in RNA-free water (129115, Nuclease Free-Water, Qiagen, Germany). RNA quantification was done at Nanodrop (Nanodrop 2000 spectrophotometer, Thermo Scientific, Lithuania). For reverse transcription, the high-capacity cDNA reverse transcription kit, 4368814, applied biosystems by Thermo Fisher Scientific, UK, was used. The housekeeping gene used was GAPDH; different genes were analyzed (Table 2 ). Table 2 List of primers used. gene Sequence Accession number Amplicon size (pb) GAPDH Fw. CCTCTGACTTCAACAGCGA Rev. GGTCTTACTCCTTGGAGGC NM_001256799.3 165 GPC3 Fw. CCAAAAGAGAGGAAGGAATGG Rev. CTCAGGAGCTGGTTAATGTGC NM_004484.4 123 GPC5 Fw. TGAAGCATGTTGTTCAGTTGTT Rev. GAAGTTCATATCATCTGGCATCC NM_004466.6 200 SULF2 Fw. ACTCGAAACATGGACCTGGG Rev. CCCACAGTTGTCCCAGTGAT XM_054323703.1 121 COL1α1 Fw. GCTGGAAAAGATGGTCGCAC Rev. TAACCACCACCGCTTACACC NM_000089.4 140 CXCR4 Fw. CTTCAGTTTGTTGGCTGCGG Rev. GAAGTGTATATACTGATCCCCTCCA NM_003467.2 119 ITGα9β1 Fw. TCAGCTTCCATGGCAAACAC Rev. AGCTTCTCTGTGACCTGACC NM_002207.3 145 Wnt3A Fw. CTTTGCAGTGACACGCTCAT Rev. AGACACCATCCCACCAAACT AB060284.1 136 SYBR green (4367659, applied biosystems by Thermo Fisher Scientific, UK) was added to detect the samples. 7500 Fast Real-Time PCR System (Applied Biosystems, USA) was used. The data were represented as a function of the threshold cycle, according to the formula 2 −ΔΔCt . Gelation of hydrogel The cells of different cell lines were embedded into the hydrogel. HA and HA-based hydrogel were synthesized as already described by Saggioro et al. 6 . Briefly, for the synthesis of the polymer, HA 200 kDa (Fidia Farmaceutici, Abano Terme, Italy) was dissolved in anhydrous dimethyl sulfoxide (DMSO) together with methanesulphonic acid (Merk, Darmstadt, Germany). After dissolution, 1,1-carbonyldiimidazole (Merk, Darmstadt, Germany) and, after 1 h, 2-(2-pyridyldithio) ethylamine hydrochloride (SPDC) were added. The mixture was left to react overnight under stirring at 40°C. The obtained HA-SPDC intermediate was recovered through precipitation in ethanol and washed with EtOH/H 2 O solutions at a decreasing percentage of ethanol. After solubilization in 0.5 M NaOH, and neutralization with HCl 0.5 M, the polymer was dialyzed against 0.1 M acetate buffer at pH 5 for 48 h and then against water for 24 h. The solution was lyophilized. Finally, HA-SPDC was reacted with DTT in 50 mM phosphate buffer with 2 mM EDTA at pH 7 for 1 h. The solution was dialyzed against the same buffer for 24 h and then against 1 mM EDTA for 48 h under nitrogen flow. The product was then lyophilized, and the amount of sulfhydryl groups was determined by Ellman’s assay and 1 H-NMR. For hydrogel gelation, HA-SH was resuspended in the culture medium at a final concentration of 1% [w/v] by gentle pipetting. Pellets of 2×10 5 cells were resuspended in culture medium/HA-SH solution and transferred on a glass flat bottom 96 well plate. This solution mixture was finally crosslinked with 10 kDa PEG-dimaleimide (Iris Biotech GMBH, Marktredwitz, Germany) to obtain the hydrogel. The ratio of maleimide and thiol groups was stoichiometrically kept at 1:1. Fibronectin bovine plasma (F1141-1MG, 100 µg/ml, Sigma, USA), collagen I from rat tail (ALX-522-435-0100, 600 µg/ml, Enzo Biochem, USA), and 5% of Matrigel Matrix Basement Membrane (356234, Corning, USA) were added to the gel, to create a more like in vivo model. Then the viability was evaluated with the kit live&dead (L3224, LIVE/DEAD viability/cytotoxicity kit, ThermoFisher scientifics). Scanning Electron Microscopy For scanning electron microscopy (SEM), samples were lyophilized before imaging with a CamScan MX3000 scanning electron microscope. Statistical analysis For each analysis, at least five random pictures were used for data output. All graphs displayed were produced with GraphPad software 10.0. Data were expressed as means ± SD. Four replicates for each experiment and 4 different experiments were performed for each type of analysis. For all experiments (qPCR and tissue analysis), statistical significance was determined using or an equal-variance Student’s t-test or Mann–Whitney U test to compare two groups, or Anova analysis for multiple comparisons with Tukey’s post hoc test. Statistical significance was determined using GraphPad 10.0 software with an equal-variance Mann-Whitney test to compare the two groups. A p-value below 0.05 was considered statistically significant. Results GPC3 silencing impairs RMS cells lines proliferation without affecting GPC5 expression All the RMS cell lines used in this study exhibited elevated expression of the proteoglycan GPC3, which following silencing was significantly reduced (Fig. S1 ). Non-specific GPC3 silencing-related toxicity was not observed under these conditions (Fig. 1 A), as increased staining of cleaved Caspase 3 (cCAS3) was only detected in a few sparse dying cells (Fig. S2D). The expression levels of proteins, (GPC5, SULF2, Ki67) related to GPC3 were assessed by immunofluorescence before and after silencing (Fig. 1 A). As illustrated in Figs. 1 B and 1 C, the expression of GPC3 protein and its family member GPC5 were examined. GPC5 expression was assessed due to the high homology with GPC3, which could substitute for GPC3 after silencing. However, GPC5 exhibited consistent expression in all the cell lines following GPC3 silencing, further increasing in RH4 ARMS cells seemingly compensating for the absence of GPC3 (Fig. 1 C). In contrast, the proliferation marker Ki67 (Fig. 1 B and C) decreased after treatment, supporting the hypothesis that GPC3 is somehow involved in RMS cell proliferation. Finally, the expression of SULF2, the enzyme that activates GPC3, remained unchanged, except in RH30 cells, where overexpression of SULF2 may help to restore GPC3, which is particularly important for the dissemination of ARMS cells. Adhesion and migration are greatly decreased after silencing GPC3 in both ARMS and ERMS Evaluation of GPC3 expression at early time points of silencing revealed the persistent absence of protein in the cell lines, except for RH36 cells (Fig. 2 A). This finding led to investigate the involved biological processes, including adhesion and migration, in which GPC3 plays a role. As depict in Fig. 2 B, the counts of cells per area were examined in the presence and absence of fibronectin, highlighting the intrinsic inability of silenced cells to rapidly adhere to the fibronectin coating. These results confirmed the primary role of GPC3 in cell adhesion, particularly for the ARMS RH30 cell line. Transwell migration and wound-healing assays were performed to quantitatively assess GPC3 expression in cell migration. As expected, all GPC3-silenced RMS cells showed a significant decrease in transwell migration compared to GPC3-expressing cells (Fig. 2 C-E). Remarkably, these observations were also evident in the wound healing assay. While, no clear difference was observed between ARMS and ERMS cell migration, a clear distinction was noted between treated and untreated cells for each cell line (Fig. 2 D and E). Based on these other findings, it can be hypothesized that GPC3 may play a role in regulating the metastatic behaviour of RMS cells. SULF2 inhibition directly influences RMS cell growth In order to avoid the continuous SULF2 activity following GPC3 silencing, we decided to directly inhibit the enzyme itself. We aimed to analyze both GPC3 and SULF2 protein expression in these setting, in addition to the secreted protein delivered by SULF2, FGF2. We confirmed that after the addition of the SULF2 inhibitor, GPC3 availability was greatly reduced in parental cells and completely lost in GPC3-silenced ones, together with a significant downregulation of GPC5 (Fig. 3 ). The paramount role of the SULF2 in the activation of GPC3 was proven. However, in the presence of the enzyme inhibitor factor, a FGF2 overproduction was observed, with the exception of RH4 cells (Fig. 3 B and S2B). With regard to ECM protein secretion, the inhibition of SULF-2 did not affect fibronectin synthesis, but it did cause an marked alteration in cell proliferation and the cell cycle (Fig. 3 C).Vimentin, a protein that is involved in maintaining cell structure, significantly changed in expression after silencing (Fig. S2C). In contrast, the levels of all the proteins described above were reduced when SULF2 enzyme activity was inhibited together with GPC3 silencing (Fig. 3 C right). This effect was also observed for the proteins involved in ECM composition (Col1α1, GPC3, GPC5, SULF2) and cell migration (CXCR4) (Fig. S3). GPC3 gene expression decreased after the treatments, while SULF2 increased, indicating an attempt to synthesise new SULF2 protein with consequent activation of additional GPC3. Conversely, the GPC5 gene was not detected, and the protein was found to be highly present. The CXCR4 gene demonstrated no alterations in response to the combination of DOXO, SULF2-inhibitor and GPC3 siRNA, whereas Col1α1 expression was reduced in cells subjected to triple treatment, suggesting a potential suppression of matrix formation. The expression of the proliferation markers Ki67 and Wnt3a also decreased after GPC3 silencing, as did ITGα9β1 protein, a factor known to be involved cell cycle reactivation (Fig. 3 C and S2A). Tumor migration appeared to be directly linked to the microenvironmental proteins that determine the shape and mechanical properties of the surrounding ECM. Therefore, we focused on understanding the ECM dysregulation properties after GPC3 silencing, SULF2 inhibition, and DOXO addition by assessing the expression of MMPs (gelatinases), enzymes that are involved in microenvironment remodeling. In these conditions, the expression of active MMP2 (67 kDa) was found to decrease in the RH30 cell line following the triple treatment (Fig. 3 D, E), while its expression increased in the RH4 and RD cell lines. In ARMS, MMP9 (82 kDa), which exhibits lower expression levels compared to MMP2, demonstrated an increase in response to treatment (Fig. 3 D and E). In ERMS cells, MMP9, which is present in the untreated control, decreased only after silencing, while with the combination of GPC3 siRNA, SULF2 inhibitor and DOXO it regained expression (Fig. 3 E and S8). These results highlight how ECM remodelling is influenced by the proteoglycan GPC3. Microenvironment dysregulation and drug-targeting tumor cells induce cell death To evaluate the combined effect of microenvironmental impairment subsequent to GPC3 silencing and the administration of anti-cancer proliferation drugs, the expression of Ki67 and cleaved caspase 3 (cCAS3) proteins was assessed. The use of DOXO following silencing was demonstrated to affect the cell viability (Fig. S4). Furthermore, the triple treatment with GPC3 siRNA, SULF2-inhibitor and DOXO, as shown in Fig. 4 A, resulted in a significant impairment in cell proliferation, resulting in up to 15% of cell death (Fig. 4 A and B). When it was given in preference of DOXO, the cells reached a steady state in which proliferation was blocked (Fig. 4 B and C). The metabolic activity of the cells was strongly impaired when ipafricept was added (Fig. 4 D), most likely due to perturbations in the S phase of RMS cells (Fig. S5, RH30). As expected, the combined treatment was more effective in all RMS cells. Migration and proliferation in the 3D hydrogel are significantly different from the 2D cell culture The HA-based hydrogels have previously been shown to be a promising environment that well recapitulates the in vivo conditions of RMS, in particular after the analysis of the extracellular matrix proteins. Indeed, as already shown by our group, fibronectin and collagen play a paramount role in recapitulating the RMS surrounding in our hydrogel 31 . Here, the presence of RMS RH30 and RD cells was detected in the hydrogel by means of SEM. The shape of the cells, whether elongated or round, was found to correlate with the presence or absence of GPC3 (Fig. 5 A and B). Furthermore, the high level of cell viability observed after administration of scramble GPC3 siRNA provided further evidence that transfection per se was not toxic (Fig. 5 B and C; Fig. S6). It is important to note that untreated RMS cells (WT) spread homogeneously on the hydrogel support, whereas GPC3 silenced cells confirmed their impaired motility, at least in part due to the higher percentage of cell death (Fig. 5 E). The addition of SULF2 inhibitor and DOXO further impaired RMS cell migration on the hydrogel, but also affected cell proliferation and viability (Fig. 5 D-F). A more pronounced effect was observed in the presence of ipafricept, both in ARMS (RH30) and ERMS (RD) cells (Fig. 5 D and S7). In the 3D model, the presence of GPC5 did not protect and rescue the GPC3-silenced cells, demonstrating for the first time, that the presence of GPC3 is essential for RMS cell migration and survival (Fig. 6 ). Discussion In the present study, we demonstrated for the first time, that an ECM protein, such as the proteoglycan GPC3, is of paramount importance for the migration and proliferation of RMS cancer cells. Malignant cells do not act alone in cancer progression but require sustained interactions and crosstalk with supporting cells and ECM components that form the tumor microenvironment 1 , 2 , 16 . Soluble molecules of the ECM, present in proximity of tumor cells, bind to membrane receptors and initiate intracellular signaling cascades necessary to sustain proliferation, angiogenesis, initiation of invasion and metastasis 32 . Glypicans are one of the most important matrix components that regulate the availability of biomolecules in the surrounding milieu. Six glypicans (GPC1-6) have been described in mammals, bound to the outer surface of the plasma membrane by glycosyl-phosphatidylinositol anchors. They regulate several developmental signaling pathways, such as Wnt or Hedgehog, by acting as co-receptors and storage sites for many heparin-binding growth factors. Glypican-3 (GPC3) is protein that is expressed in a time- and tissue-restricted manner and also expressed in pathological conditions including cancer. Following GPC3 silencing, cell proliferation, adhesion, and migration are severely impaired following GPC3 silencing, as demonstrated in RH30 alveolar rhabdomyosarcoma cells, representing the most aggressive RMS subtype known to date. It is worth noting that GPC3 is more abundant in ARMS than in ERMS cells, and this correlates with the tendency of ARMS to invade and spread widely. Indeed, all of the aforementioned biological processes were significantly downregulated in GPC3-silenced ARMS cell lines, whereas in ERMS were dependent on the specific cell line. GPC3 silencing in RMS cells was highly specific, as the expression of the family member GPC5 appeared to be unaffected by the knockdown and even increased after treatment. GPC5 shares 63% homology with GPC3 and is also expressed in RMS cells 33 , 34 . However, although GPC5 is expressed during development in the kidney, testis, limbs, and brain, unlike GPC3, it also persists in the brain during adulthood. Therefore, in addition to silencing GPC3, we decided to inhibit the SULF-2 enzyme, which is shared by both GPC3 and GPC5 for their maturation and proper activation. SULF-2 has been demonstrated to promote tumor growth by releasing soluble growth factors from GPCs in the ECM, which in turn induce cell surface cognate receptor activity and downstream intracellular cancer signaling upon ligand binding. To assess the importance of GPC3 in RMS biology and aggressiveness, we used the SULF-2 inhibitor which has been shown to inhibit cell proliferation, viability, and migration in different tumor models, and to promote cell death by increasing apoptotic caspase 3 enzyme activity 14 , 27 . We demonstrated that although SULF-2 was detectable after GPC3 silencing, it became undetectable after activity inhibition in all treated cell lines, negatively affecting GPC5 expression as hypothesized. Cell adhesion is closely correlated with fibronectin production and extracellular deposition, as fibronectin is one of the major components of the ECM that controls tissue development, cancer progression, wound healing, and the development of diseases associated with fibrosis 35 . We have previously shown that RMS cancer cells produce their own ECM proteins in order to sustain their growth, including fibronectin 36 . Here, we observed that after GPC3 silencing and SULF-2 inhibition, the ECM surrounding RMS cells decreased fibronectin deposition. In addition to this, the expression of ITGα9β1, a fibronectin receptor involved in cell cycle regulation at the pre-metastatic niche 37 – 39 , was deregulated by the combinatorial treatment, along with the disruption of cell proliferation and extracellular matrix formation. Microenvironmental remodeling has therefore been studied following administration of DOXO, an anthracycline drug that has been extensively used in the treatment of various cancers, including rhabdomyosarcoma 40 . In vitro studies have demonstrated that anthracyclines inhibit invasion of cancer cells derived from various solid tumors. The anti-invasive effect of anthracyclines involves the downregulation of matrix metalloproteinases (MMPs), the disorganization of the cytoskeleton and the inhibition of focal adhesion kinases (FAK) 41 – 43 . However, under certain circumstances ECM proteins have been observed to modulate the antimigratory and apoptotic effects of chemotherapeutic drugs, thereby explaining the drug resistance and disease progression events that occur in many cases 44 , 45 . Among the proteins involved in ECM remodelling and degradation, MMPs are of particular importance, in both healthy and pathological conditions 46 – 48 . In particular, the expression of MMP2 and MMP9 has been linked to tumor growth, progression, and metastasis, and correlates with cancer aggressiveness and response to therapy 46 . Here, the reduced MMP expression following GPC3 silencing was found to be increased after SULF-2 inhibition and DOXO treatment, an effect that can be explained by the action of DOXO, which activates microRNAs involved in cell migration 47 – 49 . In this study, the efficacy of DOXO in combination with GPC3 silencing and the SULF-2 inhibitor was investigated. The results demonstrated that the combination therapy was effective in reducing cell proliferation while inducing cell death. However, since the metabolic activity of RMS cells was not reduced after the combinatorial treatment, an early inhibitor of RMS cell proliferation, Ipafricept, was used instead of DOXO. Indeed, Ipafricept synergized with GPC3 silencing and the SULF-2 inhibitor, and also reduced metabolic activity. Ipafricept, a recombinant fusion protein that sequesters Wnt ligands, does not act at the DNA level but blocks Wnt-dependent proliferative signaling early at the plasma membrane 29 , 50 , 51 . Finally, a proprietary hyaluronic-based hydrogel tunable with ECM proteins was utilized. This has been demonstrated to sense RMS cells to feel the spatial and mechanical interactions of the in vivo microenvironment 6 . In the hydrogel support, the RMS cells migrated in all directions, interacting with matrix-embedded fibronectin and collagen I proteins 6 , 52 . The 3D distribution of both viable WT and silenced cells was striking. However, the percentage of dead cells in the latter was significantly increased. The percentage of dead cells increased further after drug treatment, particularly with ipafricept, which was much more potent in RD ERMS cells. Notably, GPC5 protein secretion persisted under these conditions, suggesting a potential for further investigation of an inhibitory strategy capable of silencing both GPC3 and GPC5. In conclusion, we here demonstrated that GPC3 (and GPC5) plays a pivotal role in the growth, proliferation and expansion of RMS. To this end two models were developed: the first, a simple 2D model, allowed us to underline the pivotal role of GPC3 and proved to further expand the study in the second, more complex, 3D model. The latest represents the more suitable condition for future drug testing and new silencing strategies with patient-derived cells. Declarations Consent for publication All authors agree to publish the work. Ethics approval and consent to partecipate Not applicable. The present work use commercially available cell lines. Data Availability The materials are already available in the manuscript. Raw data are available under reasonable request to [email protected] . Statement of Competing Interests The authors have no conflict of interest to declare. Funding This work has been supported by Project 21/07 Institute of Pediatric Research Città della Speranza. PI: Michela Pozzobon. Author Contribution M.B., S.DA. performed the experiments, data collection and interpretation, wrote the article; A.G. created the hydrogel and help with experiments; E.P., P.B. data interpretation. G.B. G.P. read and approved the article. M.P. conceived the experiments, analyzed the data, wrote and approved the article. All the authors approved the article. Acknowledgments We thanks Chiara Frasson for her valuable support in cytofluorimetric analysis. References Paolillo, M. & Schinelli, S. Extracellular Matrix Alterations in Metastatic Processes. Int J Mol Sci 20 , (2019). Winkler, J., Abisoye-Ogunniyan, A., Metcalf, K. J. & Werb, Z. Concepts of extracellular matrix remodelling in tumour progression and metastasis. Nat Commun 11 , (2020). Lian, X. et al. Defining the Extracellular Matrix of Rhabdomyosarcoma. Front Oncol 11 , (2021). Wang, J.-J., Lei, K.-F. & Han, F. Tumor microenvironment: recent advances in various cancer treatments. Xiao, Y. & Yu, D. Tumor microenvironment as a therapeutic target in cancer. Pharmacol Ther 221 , 107753 (2021). Saggioro, M. et al. A rhabdomyosarcoma hydrogel model to unveil cell-extracellular matrix interactions. Biomater Sci 10 , 124–137 (2022). Martin-Giacalone, B. A., Weinstein, P. A., Plon, S. E. & Lupo, P. J. Pediatric Rhabdomyosarcoma: Epidemiology and Genetic Susceptibility. J Clin Med 10 , (2021). Rees, H. et al. Rhabdomyosarcoma Standard Clinical Practice document 1 CLINICAL PRACTICE GUIDELINES FOR PATIENTS WITH RHABDOMYOSARCOMA Collaborators from CWS: Widening country Reviewers. Skapek, S. X. et al. Rhabdomyosarcoma. Nat Rev Dis Primers 5 , 1 (2019). Hinson, A. R. P. et al. Human Rhabdomyosarcoma Cell Lines for Rhabdomyosarcoma Research: Utility and Pitfalls. Front Oncol 3 , (2013). Zhu, Z.-W. et al. Enhanced glypican-3 expression diVerentiates the majority of hepatocellular carcinomas from benign hepatic disorders. doi:10.1136/gut.48.4.558. Boily, G., Saikali, Z. & Sinnett, D. Methylation analysis of the glypican 3 gene in embryonal tumours. Br J Cancer 90 , 1606–1611 (2004). Rosen, S. D. & Lemjabbar-Alaoui, H. SULF-2: AN EXTRACELLULAR MODULATOR OF CELL SIGNALING AND A CANCER TARGET CANDIDATE. doi:10.1517/14728222.2010.504718. Hammond, E., Khurana, A., Shridhar, V. & Dredge, K. The role of heparanase and sulfatases in the modification of heparan sulfate proteoglycans within the tumour microenvironment and opportunities for novel cancer therapeutics. Front Oncol 4 JUL , 195 (2014). Lai, J.-P. et al. Sulfatase 2 Up-Regulates Glypican 3, Promotes Fibroblast Growth Factor Signaling, and Decreases Survival in Hepatocellular Carcinoma. (2008) doi:10.1002/hep.22202. Hill, K. E., Lovett, B. M. & Schwarzbauer, J. E. Heparan sulfate is necessary for the early formation of nascent fibronectin and collagen I fibrils at matrix assembly sites. J Biol Chem 298 , 101479 (2022). Lanzi, C., Zaffaroni, N. & Cassinelli, G. Targeting Heparan Sulfate Proteoglycans and their Modifying Enzymes to Enhance Anticancer Chemotherapy Efficacy and Overcome Drug Resistance. Curr Med Chem 24 , (2017). Fico, A., Maina, • F & Dono, • R. Fine-tuning of cell signaling by glypicans. VISIONS & REFLECTIONS doi:10.1007/s00018-007-7471-6. Desai, A., Sandhu, S., Lai, J. P. & Sandhu, D. S. Hepatocellular carcinoma in non-cirrhotic liver: A comprehensive review. World J Hepatol 11 , 1 (2019). Ofuji, K., Saito, K., Yoshikawa, T. & Nakatsura, T. Critical analysis of the potential of targeting GPC3 in hepatocellular carcinoma. J Hepatocell Carcinoma 1–35 (2014) doi:10.2147/JHC.S48517. De Giovanni, C., Landuzzi, L., Nicoletti, G., Lollini, P. L. & Nanni, P. Molecular and cellular biology of rhabdomyosarcoma. http://dx.doi.org/10.2217/fon.09.97 5 , 1449–1475 (2009). Roma, J., Almazán-Moga, A., Sánchez De Toledo, J. & Gallego, S. Notch, Wnt, and Hedgehog Pathways in Rhabdomyosarcoma: From Single Pathways to an Integrated Network. 2012 , (2012). Salvo, D., Raimondi, M., Vella, L., Adesso, S. & Ciarapica, L. Hyper-Activation of Notch3 Amplifies the Proliferative Potential of Rhabdomyosarcoma Cells. PLoS One 9 , 96238 (2014). Rivankar, S. An overview of doxorubicin formulations in cancer therapy. J Cancer Res Ther 10 , 853 (2014). Meredith, A. M. & Dass, C. R. Increasing role of the cancer chemotherapeutic doxorubicin in cellular metabolism. Journal of Pharmacy and Pharmacology 68 , 729–741 (2016). Jimeno, A. et al. Cancer Therapy: Clinical A First-in-Human Phase I Study of the Anticancer Stem Cell Agent Ipafricept (OMP-54F28), a Decoy Receptor for Wnt Ligands, in Patients with Advanced Solid Tumors. doi:10.1158/1078-0432.CCR-17-2157. Zheng, X. et al. The Human Sulfatase 2 Inhibitor 2,4-Disulfonylphenyl-tert-Butylnitrone (OKN-007) has an Antitumor Effect in Hepatocellular Carcinoma Mediated via Suppression of TGFB1/ SMAD2 and Hedgehog/GLI1 Signaling. Genes Chromosomes Cancer 52 , 225–236 (2013). Baxter-Holland, M. & Dass, C. R. Doxorubicin, mesenchymal stem cell toxicity and antitumour activity: implications for clinical use. Journal of Pharmacy and Pharmacology 70 , 320–327 (2018). Ipafricept (OMP-54F28) | Wnt Inhibitor | MedChemExpress. https://www.medchemexpress.com/ipafricept.html. Toth, M. & Fridman, R. Assessment of Gelatinases (MMP-2 and MMP-9) by Gelatin Zymography. Methods Mol Med 57 , 163–174 (2001). Saggioro, M. et al. A rhabdomyosarcoma hydrogel model to unveil cell-extracellular matrix interactions. Biomater Sci 10 , 124–137 (2022). Theocharis, A. D., Skandalis, S. S., Gialeli, C. & Karamanos, N. K. Extracellular matrix structure. Adv Drug Deliv Rev 97 , 4–27 (2016). Li, F., Shi, W., Capurro, M. & Filmus, J. Glypican-5 stimulates rhabdomyosarcoma cell proliferation by activating Hedgehog signaling. Journal of Cell Biology 192 , 691–704 (2011). Williamson, D. et al. Role for Amplification and Expression of Glypican-5 in Rhabdomyosarcoma. Cancer Res 67 , 57–65 (2007). Ghura, H. et al. Inhibition of fibronectin accumulation suppresses TUMOR growth. Neoplasia 23 , 837 (2021). D’Agostino, S. et al. Rhabdomyosarcoma Cells Produce Their Own Extracellular Matrix With Minimal Involvement of Cancer-Associated Fibroblasts: A Preliminary Study. Front Oncol 10 , (2021). Xu, S. et al. Integrin-a9b1 as a Novel Therapeutic Target for Refractory Diseases: Recent Progress and Insights. doi:10.3389/fimmu.2021.638400. Navarro, N. et al. Integrin alpha9 emerges as a key therapeutic target to reduce metastasis in rhabdomyosarcoma and neuroblastoma. Cellular and Molecular Life Sciences 79 , 546 (2022). Masià, A. et al. Notch-mediated induction of N-cadherin and α9-integrin confers higher invasive phenotype on rhabdomyosarcoma cells. Br J Cancer 107 , 1374–1383 (2012). Gianni Bisogno, Meriel Jenney, Christophe Bergeron, Soledad Gallego Melcón, Andrea Ferrari, Odile Oberlin, Modesto Carli, Michael Stevens, Anna Kelsey, Angela De Paoli, Mark N Gaze, Helene Martelli, Christine Devalck, Johannes H Merks, Myriam Ben-Arush, H, G. L. D. S. Addition of dose-intensified doxorubicin to standard chemotherapy for rhabdomyosarcoma (EpSSG RMS 2005): a multicentre, open-label, randomised controlled, phase 3 trial. The Lancet 19 , 1061–1071 (2018). Park, H. J. et al. Inhibitory effect of DA-125, a new anthracyclin analog antitumor agent, on the invasion of human fibrosarcoma cells by down-regulating the matrix metalloproteinases. doi:10.1016/j.bcp.2005.10.007. Harisi, R. et al. Repopulation of osteosarcoma cells after treatment with doxorubicin in the presence of extracellular matrix biopolymers. doi:10.1007/s00280-005-0165-6. Van Nimwegen, M. J., Huigsloot, M., Camier, A., Tijdens, I. B. & Van De Water, B. Focal Adhesion Kinase and Protein Kinase B Cooperate to Suppress Doxorubicin-Induced Apoptosis of Breast Tumor Cells. Mol Pharmacol 70 , 1330–1339 (2006). Said, G. et al. Extracellular matrix proteins modulate antimigratory and apoptotic effects of Doxorubicin. Chemother Res Pract 2012 , 1–10 (2012). Shin, S. H., Choi, Y. J., Lee, H., Kim, H. S. & Seo, S. W. Oxidative stress induced by low-dose doxorubicin promotes the invasiveness of osteosarcoma cell line U2OS in vitro. Tumour Biol 37 , 1591–1598 (2016). Ricci, S., D’Esposito, V., Oriente, F., Formisano, P. & Di Carlo, A. Substrate-zymography: A still worthwhile method for gelatinases analysis in biological samples. Clin Chem Lab Med 54 , 1281–1290 (2016). Beji, S. et al. Doxorubicin upregulates CXCR4 via miR-200c/ZEB1-dependent mechanism in human cardiac mesenchymal progenitor cells. Cell Death Dis 8 , 3020 (2017). Long, L., Xiang, H., Liu, J., Zhang, Z. & Sun, L. ZEB1 mediates doxorubicin (Dox) resistance and mesenchymal characteristics of hepatocarcinoma cells. Exp Mol Pathol 106 , 116–122 (2019). Regenbogen, S. et al. Cytotoxic drugs in combination with the CXCR4 antagonist AMD3100 as a potential treatment option for pediatric rhabdomyosarcoma. Int J Oncol 57 , 289–300 (2020). Le, P., Mcdermott, J. D. & Jimeno, A. Targeting the Wnt pathway in human cancers: therapeutic targeting with a focus on OMP-54F28. (2014) doi:10.1016/j.pharmthera.2014.08.005. Sun, Y., Wang, W. & Zhao, C. Frizzled Receptors in Tumors, Focusing on Signaling, Roles, Modulation Mechanisms, and Targeted Therapies. Oncol Res 28 , 661 (2021). Yoo, K. M., Murphy, S. V. & Skarda, A. A Rapid Crosslinkable Maleimide-Modified Hyaluronic Acid and Gelatin Hydrogel Delivery System for Regenerative Applications. Gels 7 , 1–17 (2021). Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterialBacchiegaetal.pdf Cite Share Download PDF Status: Published Journal Publication published 01 Jul, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Accepted 20 May, 2025 Reviews received at journal 17 May, 2025 Reviewers agreed at journal 17 May, 2025 Reviews received at journal 17 Apr, 2025 Reviewers agreed at journal 16 Apr, 2025 Reviewers invited by journal 16 Apr, 2025 Submission checks completed at journal 07 Apr, 2025 First submitted to journal 24 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5664628","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":443997821,"identity":"621413c4-f626-41e6-a4cf-71ce26bb5e5a","order_by":0,"name":"Maira Bacchiega","email":"","orcid":"","institution":"University of Padova","correspondingAuthor":false,"prefix":"","firstName":"Maira","middleName":"","lastName":"Bacchiega","suffix":""},{"id":443997822,"identity":"279be6b6-93f0-48e2-b008-bdda6206c758","order_by":1,"name":"Stefania D’Agostino","email":"","orcid":"","institution":"University of Padova","correspondingAuthor":false,"prefix":"","firstName":"Stefania","middleName":"","lastName":"D’Agostino","suffix":""},{"id":443997823,"identity":"76915c6b-d407-4668-a952-e2733e9bd353","order_by":2,"name":"Antonella Grigoletto","email":"","orcid":"","institution":"University of Padova","correspondingAuthor":false,"prefix":"","firstName":"Antonella","middleName":"","lastName":"Grigoletto","suffix":""},{"id":443997824,"identity":"7ee9df8e-b0c8-4648-a181-1d844fc2bc8d","order_by":3,"name":"Elena Poli","email":"","orcid":"","institution":"Foundation Institute of Pediatric Research Città della Speranza","correspondingAuthor":false,"prefix":"","firstName":"Elena","middleName":"","lastName":"Poli","suffix":""},{"id":443997825,"identity":"0b2d9853-bf02-4513-983b-d68fd4309c7c","order_by":4,"name":"Paolo Bonvini","email":"","orcid":"","institution":"Foundation Institute of Pediatric Research Città della Speranza","correspondingAuthor":false,"prefix":"","firstName":"Paolo","middleName":"","lastName":"Bonvini","suffix":""},{"id":443997827,"identity":"f4fb88bd-4e6a-4216-b785-88b3f6005b2d","order_by":5,"name":"Gianni Bisogno","email":"","orcid":"","institution":"University of Padova","correspondingAuthor":false,"prefix":"","firstName":"Gianni","middleName":"","lastName":"Bisogno","suffix":""},{"id":443997829,"identity":"ce2db903-360e-4c36-934d-d219054a169f","order_by":6,"name":"Gianfranco Pasut","email":"","orcid":"","institution":"University of Padova","correspondingAuthor":false,"prefix":"","firstName":"Gianfranco","middleName":"","lastName":"Pasut","suffix":""},{"id":443997832,"identity":"f64dd7fa-0e50-4180-8006-2b1c6b1cb6c8","order_by":7,"name":"Michela Pozzobon","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+klEQVRIiWNgGAWjYDACZgY2BoYCKIexgYGBH0gfAAry4NdigKRFsgGqBbcedC0GB6CCuLTotjM/e/DBwI7BnL398YePO2zyjG/kHjxcUMYgY49Di9lhNnPDGQbJDJY9BxIMZ55JKza7kZdweMY53A4zO8zDJs1jwMxgcCPhQDJv2+HEbTdyDA7zthHQ8segHqglseEwSMvmGcRoYTA4DNSSzNgM0rJBgqAWNjPJHoPjPJY9x5gZgX5JnHHmjQHQLxI8PAdwaDl/+JnEj4pqOViIJfa35xh/LiizsWdvwGENFPAYIPOYGRgk8KsHAXQto2AUjIJRMArgAAC401Ud38DuVAAAAABJRU5ErkJggg==","orcid":"","institution":"University of Padova","correspondingAuthor":true,"prefix":"","firstName":"Michela","middleName":"","lastName":"Pozzobon","suffix":""}],"badges":[],"createdAt":"2024-12-17 21:23:07","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5664628/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5664628/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-03466-x","type":"published","date":"2025-07-01T15:56:54+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":80999569,"identity":"d99ec487-eca0-41ec-9812-2037752893e3","added_by":"auto","created_at":"2025-04-21 06:03:04","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":978680,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGPC3 silencing.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A).\u003c/strong\u003e Cartoon illustrating the experimental protocol. Two siRNA treatments were performed after cell seeding. Analysis was performed 72 hours after the second treatment. (\u003cstrong\u003eB)\u003c/strong\u003e. Protein expression levels in wild-type (WT) and siRNA-treated cells. (\u003cstrong\u003eC)\u003c/strong\u003e. Analysis of protein expression. GPC3 expression is reduced by siRNA treatment, with the treatment being highly specific while not affecting GPC5 expression. After silencing, reduced cell proliferation (Ki67 expression) is also observed. SULF2 expression increased possibly to restore the balance of proteoglycan expression. (Mann-Whitney test; *: p\u0026lt;0.05; **: p\u0026lt;0.01; ***: p\u0026lt;0.001). N=4 experiments. In each experiment 4 replicates per each condition.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5664628/v1/b1cd8a28567a786b84aeec3d.jpeg"},{"id":80997953,"identity":"155b7e85-e607-4bf1-8657-12bb587f40ca","added_by":"auto","created_at":"2025-04-21 05:39:04","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":505770,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGPC3 expression over time and adhesion assay and cell migration.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A).\u003c/strong\u003e GPC3 expression at different time points following a second siRNA treatment. The GPC3 expression in siRNA-treated cells was consistently lower compared to wild-type (WT) cells, even after 96 hours of treatment. (\u003cstrong\u003eB).\u003c/strong\u003e Adhesion assay analysis reveal that WT cells exhibit superior adhesion compared to siRNA-treated cells in the presence of a fibronectin (FN) coating. \u003cstrong\u003e(\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e).\u003c/strong\u003eGross appearance of the cells in the migration assay of WT and siRNA treated cells. Scale bar 75mm. Quantification of the migrated cells. Treated cells did not migrate through the transwell like WT cell. \u003cstrong\u003e(\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eD\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e).\u003c/strong\u003e Gross appearance of the cells in the wound healing assay with WT cells\u003cem\u003e and \u003c/em\u003ewith siRNA treated cells. WT cells closed the wound\u003cem\u003e while \u003c/em\u003esiRNA treated cells did not, in particular the ARMS cell line RH30.\u003cem\u003e \u003c/em\u003e\u003cem\u003e\u003cstrong\u003e(E). \u003c/strong\u003e\u003c/em\u003eQuantification of the wound healing assay. (Mann-Whitney test; **: p\u0026lt;0.01; ***: p\u0026lt;0.001). N=4 experiments. In each experiment 4 replicates per each condition.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5664628/v1/c4a729b1b735a56e0ccc64cc.jpeg"},{"id":80999576,"identity":"8dbcb421-bbe7-4423-bef7-47af633e2490","added_by":"auto","created_at":"2025-04-21 06:03:05","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":433717,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSULF2 inhibition directly influences RMS cell growth and extracellular matrix proteins.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A). Cartoon of the experiment. (B). Left. Protein expression in WT cells and siRNA-treated cells, after SULF2-inhibitor treatment. Scale bar 75mm. Right. After the SULF2-inhibitor treatment, the GPC3 expression was lower, and completely absent after siRNA + SULF2 treatments. GPC5 expression was significantly decreased after the addition of SULF2-inhibitor to the silenced cells. (C). Left. Protein expression in WT cells and siRNA-treated cells, after SULF2-inhibitor treatment. Right. FGF2 expression, which is bound to the GPC3 core protein, decreased in parallel with GPC3 expression. FN expression, which is produced by tumor cells, decreased after treatment. Cell proliferation was further diminished after treatment with the SULF2 inhibitor. ITGα9β1 expression decreased, indicating a reduced ability of cells to enter the cell cycle in a new metastatic process/niche. (D).Example of zymography gel of RH30 and RD wild type and siRNA cell line. (E).Quantification of the most abundant MMPs in RMS cells under different conditions (MMP2= pro-MMP2+MMP2; Tukey’s post hoc test; *: p\u0026lt;0.05; ****: p\u0026lt;0.0001). N=4 experiments. In each experiment 4 replicates per each condition. For zymograghy: 4 technical replicates, 2 different experiments for RH4 and RH36, 3 for RH30 and RD (see supplementary).\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5664628/v1/cd40988e99f8840cce2423e0.jpeg"},{"id":80997955,"identity":"9c445607-25e1-408a-9185-002d723263a7","added_by":"auto","created_at":"2025-04-21 05:39:04","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":310976,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of silencing, SULF-2 inhibitor and drugs on cell proliferation, death, and metabolic activity.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A).\u003c/strong\u003e Cartoon of the experiment. After cell seeding, two siRNA treatments were performed to obtain a lower value of GPC3, followed by SULF2 inhibitor treatment and DOXO administration. (\u003cstrong\u003eB)\u003c/strong\u003e. Immunofluorescence. Protein expression in siRNA+SULF2-inhibitor + DOXO treated cells. Scale bar: 75mm. (\u003cstrong\u003eC).\u003c/strong\u003e As can be seen in the graphs, Ki67, and GPC3 decrease in treated cells, while death cells (cleaved Cas3 expression) increase. (\u003cstrong\u003eD).\u003c/strong\u003e Metabolic activity under different conditions showed that the viability decreased in DOXO-treated cells, and further in ipafricept-treated cells. (Tukey’s post hoc test; *: p\u0026lt;0.05; ***: p\u0026lt;0.001, ****: p\u0026lt;0.0001). N=4 experiments. In each experiment 4 replicates per each condition.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5664628/v1/10c51246a3a015b9912db982.jpeg"},{"id":80997957,"identity":"753a6a61-b8a3-477e-9871-fe82fcf86190","added_by":"auto","created_at":"2025-04-21 05:39:04","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":574900,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFirst characterization of cells in hydrogel and their 3D distribution after SULF-2 inhibition and drug addition.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e. SEM of hydrogel with cells. Scale bar: 20 mm and 5 mm. (\u003cstrong\u003eB).\u003c/strong\u003e Live and dead assay of RMS cells in the hydrogel also after scramble treatment (RH30 as example). (\u003cstrong\u003eC).\u003c/strong\u003eRMS cells in hydrogel after scramble and siRNA treatment; roundeness evaluation. Scale bar: 75 mm\u0026nbsp; Scale bar: 200 mm. \u003cstrong\u003e(D).\u003c/strong\u003e Cartoon of the hydrogel seeding procedure with drug and SULF-2 inhibition. \u003cstrong\u003e(E).\u003c/strong\u003e \u003cu\u003eFirst row.\u003c/u\u003e WT cells have better migration, viability, and proliferation than other conditions. \u003cu\u003eSecond row.\u003c/u\u003e The addition of siRNA against GPC3 decreased cell mobility and proliferation, \u003cu\u003eThird and forth row.\u003c/u\u003e While the addition of SULF2-inhibitor and drugs strongly decreased cell proliferation and distribution, indicating a key role of GPC3 in the above mentioned functions. Scale bar: 200 mm\u003cstrong\u003e. (F).\u003c/strong\u003e Histograms of the different cell condition showing cell distribution calculated as the number of cells per volume of 10 mm\u003csup\u003e3\u003c/sup\u003e across the z-axis (z-range). N=4 experiments per each condition.Each condition in quadriplicate.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5664628/v1/6215f95fb35938d5b70d6163.jpeg"},{"id":80997960,"identity":"409e8d9d-fbfd-4256-8315-2bebf246d70e","added_by":"auto","created_at":"2025-04-21 05:39:04","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":345421,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEvaluation of GPC3 and GPC5 expression in GPC3-silenced RH30 (ARMS cells) and RD (ERMS cells) exposed to SULF2 inhibitor and DOXO or SULF2 inhibitor and Ipafricept\u003c/strong\u003e. (\u003cstrong\u003eA).\u003c/strong\u003e RH30 cells in 3 different experimental conditions. GPC3 expression (red signal) decreases in treated cells, while GPC5 (green signal) does not under the same experimental conditions. (\u003cstrong\u003eB).\u003c/strong\u003e RD cells in 3 different experimental conditions. GPC3 expression (red signal) decreases in treated cells, while GPC5 (green signal) does not under the same experimental conditions. N=4 experiments per each condition.Each condition in quadruplicate.\u003c/p\u003e","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5664628/v1/7ade53d5ac6c65157e762609.jpeg"},{"id":86178975,"identity":"77f2b154-f24a-41bb-bc31-7eceea8abea9","added_by":"auto","created_at":"2025-07-07 16:13:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4394187,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5664628/v1/6fc0a413-3fc9-4581-95aa-2e6b6929bf3a.pdf"},{"id":80999571,"identity":"d1e7e178-8e51-429f-9a91-2ebbed1d268d","added_by":"auto","created_at":"2025-04-21 06:03:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":6311695,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterialBacchiegaetal.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5664628/v1/94bc3970f3ff06df1a8c9898.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Glypican 3 as target therapy to prevent cell migration and proliferation in rhabdomyosarcoma","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCancer cells are considered to be the key drivers of tumor progression, although in recent years the surrounding cell microenvironment has been identified as the milieu that nourishes and promotes the malignant growth \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. In addition, tumor microenvironment proteins and chemokines represent a more stable therapeutic target, free from the genomic instability that characterizes cancer cells \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eRhabdomyosarcoma (RMS) is the most common soft tissue sarcoma in children, with an incidence of 4.5 cases per millions of children and adolescents. RMS develops from rhabdo-myoblasts: immature myogenic mesenchymal cells committed to skeletal muscle differentiation \u003csup\u003e\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. RMS can be divided into two subtypes: the alveolar subtype (ARMS), which is more aggressive and metastatic, accounting for 25% of cases, and the embryonal subtype (ERMS), which is less aggressive and more localised, accounting for the remaining 75% of cases \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Nonetheless, approximately 20\u0026ndash;25% of RMS cases have metastasis at diagnosis, particularly in the lung and bone marrow where the microenvironment contributes significantly to the growth potential of cancer cells. Recent studied on the extracellular matrix (ECM) support the important role of the cross-talk between transformed cells and their niche, linking ECM composition to pathological conditions. The ECM supports the growth and survival of the malignant cells and contributes to tumor dissemination. The ECM is composed by a proteoglycans (PGs) mesh, the glycocalyx, and basal membrane proteins, including collagen and fibronectin. The PG component of the ECM plays a central role in the complex events of organ development and stemness, influencing processes such as membrane receptor trafficking (during endocytosis), ligand secretion and the distribution of signaling gradients, which also significantly favour tumor development and progression. Among the PG components, Glypican 3 (GPC3) is particularly overexpressed in RMS cells, suggesting that it may be of special importance for RMS biology. GPC3 encodes a cell surface protein that is time- and tissue-restricted. It contributes to the regulation of cell growth and differentiation in a tissue-dependent manner. GPC3 has been detected in both embryonic and fetal normal tissues, as well as in several childhood and adult tumors, both sarcomas and carcinomas \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. The ability of GPC3 to bind growth factors involved in tumor development and survival is due to the sulphation of its saccharide residues \u003csup\u003e\u003cspan additionalcitationids=\"CR14 CR15\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. In particular, sulfatase enzyme-2 (SULF-2) promotes tumor growth by releasing soluble growth factors from GPC3 into the extracellular matrix, which in turn triggers the activity of cell surface cognate receptors and downstream intracellular cancer signaling \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e .\u003c/p\u003e \u003cp\u003eThis has been shown in hepatocellular carcinoma (HCC), where SULF-2 is overexpressed and GPC3 is abundantly desulphated, leading to the release of FGF2 or Wnt3a factors \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Indeed, SULF-2 knockdown reduces HCC cell proliferation and migration, as downregulation of GPC3 expression results in impaired FGF2 and Wnt3a binding, inhibiting oncogenic signaling related, also, to cell proliferation \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e .\u003c/p\u003e \u003cp\u003eConsistent with its overexpression in HCC cells, GPC3 has recently been exploited as a novel tumor-associated antigen, capable of inducing both antibody-dependent cellular cytotoxicity and T cell-mediated tumor rejection in xenografts, as well as CD8\u0026thinsp;+\u0026thinsp;T-cell responses in HCC patients \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn the case of RMS, it has been discovered the presence of redundant autocrine and paracrine circuits such as FGF signaling where deregulation of Wnt and Sonic Hedgehog, important factors for cell proliferation, have been involved in disease onset and spreading \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eBased on these premises, the aim of this study was to investigate the role of the peptidoglycan GPC3 in RMS tumor growth, progression and drug response. Classic 2D and a 3D hydrogel-based cell culture models were used to characterize cell behaviour when the microenvironment was targeted with GPC3 silencing and when cells were exposed to the chemotherapeutic drugs doxorubicin \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e,\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e and ipafricept, a Wnt3a inhibitor \u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell lines\u003c/h2\u003e \u003cp\u003eThe cell lines RH30 and RH4 for the ARMS subtype, and RD and RH36 for the ERMS subtype were provided by the laboratory of Prof Gianni Bisogno, coordinator of the European Paediatric Soft Tissue Sarcoma Study Group (EpSSG). All cell lines were cultured with DMEM High Glucose (Dulbecco\u0026rsquo;s modified eagle\u0026rsquo;s medium: D1145-500mL, Sigma-Aldrich, UK), 10% Fetal Bovine Serum (10270-106, Gibco, UK), 1% Pen-Strep (Penicillin and Streptomycin: 15140-122, Gibco, USA), 1% glutamine (25030-081, Gibco, UK), at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e. All cell lines have already been characterized by the laboratory through specific markers, such as myogenin \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eGPC3 silencing\u003c/h3\u003e\n\u003cp\u003eThe cells were plated in 24 wells, and the silencing mix was added to each well.\u003c/p\u003e \u003cp\u003eTo the complete medium, a pool of 3 target-specific siRNA against GPC3 10 \u0026micro;M (sc-40640, Santa Cruz Biotechnology, USA), together with Lipofectamine (13778075, Invitrogen, Lithuania) was added. The silencing procedure was followed twice within 24 hours of each other, to achieve very low levels of GPC3 expression. Cells were also treated with scramble-siRNA (sc-37007, Santa Cruz Biotechnology, USA) to prove the absence of toxicity of the treatment. After silencing, cells were treated with the SULF-2 inhibitor OKN-007 (SML2163, Sigma Aldrich, UK). The treatment lasts for 48 hours at a concentration of 50 \u0026micro;M \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eDoxorubicin (DOXO) (296, 21CEC PX Pharm Ltd, UK) was added at a concentration of 1 \u0026micro;M for 24 hours, while ipafricept at a concentration of 2 \u0026micro;g/ml (HY-P99667, MedChemExpress, USA) for 48 hours \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e,\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eCell viability was evaluated with PrestoBlue HS cell viability reagent (P50200, Invitrogen, US) by measuring the fluorescence with Spark Tecan.\u003c/p\u003e\n\u003ch3\u003eWound healing assay\u003c/h3\u003e\n\u003cp\u003eOnce the gene for GPC3 was silenced, the wound-healing assay was done. In 24 wells the insert of IBIDI (81176, IBIDI, Germany) has been added in the middle. On the left and the right of the insert 30000 cells have been seeded and 24 hours later the insert was taken off. The images were taken with the optical microscope (Olympus optical co. IX71, Japan), at 0 and 24 hours from the insert take off, and data were analyzed with ImageJ, using the Threshold tool.\u003c/p\u003e\n\u003ch3\u003eAdhesion test\u003c/h3\u003e\n\u003cp\u003eWT and siRNA-treated cells were seeded in a fibronectin-coated plate diluted 1:1000 in PBS (Fibronectin bovine plasma, F1141-1MG, Sigma Aldrich, UK). After incubation for two hours at 37\u0026deg;C, adhered cells were fixed in PFA 4%, labeled with Hoechst (Hoechst 33342, H3570, Life Technologies, USA), and analyzed with the fluorescence microscope.\u003c/p\u003e\n\u003ch3\u003eCell cycle analysis\u003c/h3\u003e\n\u003cp\u003eThe staining solution consisted of PBS containing Triton X-100 (0.1%; Fluka,), DNAse-free RNAse A (0.2 mg/ml; Sigma-Aldrich, St Louis, MO, USA), and propidium iodide (1 mg/ml; Sigma-Aldrich, USA). After resuspension in cold PBS and ethanol, tubes were stored at -20\u0026deg;C for at least 24 hours. After staining with 300 \u0026micro;l/10\u003csup\u003e6\u003c/sup\u003e cells of staining solution, cells were analyzed.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence\u003c/h2\u003e \u003cp\u003eImmunofluorescence analysis was performed following an already published protocol \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. For cell permeabilization, 0.05% Triton-X-100 (1610407, Bio-Rad, USA) was used. Horse Serum (16050-130, Gibco, New Zealand) was added. The primary antibody was diluted in PBS\u0026thinsp;+\u0026thinsp;1% Bovine Serum Albumin (A7906-100G, Sigma-Aldrich, USA) according to the dilution in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. For staining, the hydrogel was incubated for 24 hours with the primary antibody and then for hours with the secondary antibody. Hoechst was added to allow for nuclei staining. Fluorescence microscope (DMI600B, Leica, USA) was used.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAntibody list.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHost\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDilution\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIncubation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eProduct code\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eProducer\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGPC3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003erabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u0026deg;C, overnight\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePA5-13360\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eThermo Scientific, UK\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKi67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003erabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u0026deg;C, overnight\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15580\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAbcam, UK\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGPC3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u0026deg;C, overnight\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGT2473\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGeneTex, USA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGPC5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u0026deg;C, overnight\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003esc-390838\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSanta Cruz Biotechnology, USA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSULF2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e37\u0026deg;C, 1 hour\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGTX38989\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGeneTex, USA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eITGα9β1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u0026deg;C, overnight\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eab27947\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAbcam, UK\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFGF2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003erabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e37\u0026deg;C, 1 hour\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eab208687\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAbcam, UK\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFibronectin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003emouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u0026deg;C, overnight\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMA5-11981\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eInvitrogen, US\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eITG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003erabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u0026deg;C, 24 hours\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAb92547\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAbcam, UK\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ecCaspase 3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003erabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u0026deg;C, overnight\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eD175\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCell signaling technologies, USA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnti-Rb\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003echicken\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 hour\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eA21442\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eInvitrogen, US\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnti-mouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003egoat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 hour\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eA11001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eInvitrogen, US\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnti-Rb\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003echicken\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 hour\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eA21441\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eInvitrogen, US\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnti-mouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003egoat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 hour\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eA11005\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eInvitrogen, US\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eZymography\u003c/h3\u003e\n\u003cp\u003eCells were seeded in serum-free DMEM-HG, 1% Pen/Strep, and 1% L-Gln. The serum-free conditioned medium was harvested after 24 hours for zymography \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe resolving gel was made of sterile H\u003csub\u003e2\u003c/sub\u003eO, 1.5 M Tris\u0026middot;HCl pH 8.8 (489973, Carlo Erba Reagents, Italy), 10% sodium dodecyl sulfate (1610301, Bio-Rad, USA), acrylamide/bis 29:1 (1610156, Bio-Rad, USA), 1% gelatin (94804, Bio-Rad, USA), 10% ammonium persulfate (A3678, Sigma-Aldrich, USA), N\u0026rsquo;-N\u0026rsquo;-N\u0026rsquo;-N\u0026rsquo; tetramethylethylenediamine (TEMED) (1610801, Bio-Rad, USA).\u003c/p\u003e \u003cp\u003eThe stacking gel was made of sterile H\u003csub\u003e2\u003c/sub\u003eO, 0.5 M Tris\u0026middot;HCl pH 6.8, 10% sodium dodecyl sulfate, acrylamide/bis 29:1, 10% ammonium persulfate, TEMED.\u003c/p\u003e \u003cp\u003eWorking running buffer 1\u0026times; was made of Tris-base, Glycine (1610718, Bio-Rad, USA), sodium dodecyl sulfate, and sterile H\u003csub\u003e2\u003c/sub\u003eO. For sample normalization the BCA Protein Assay Kit (23227, Thermo Fisher, USA) was used. Each sample was resuspended in 5\u0026times; sample buffer, made of 0.313 M Tris-HCl pH 6,8, 10% sodium dodecyl sulfate, 50% glycerol (G5516, Sigma-Aldrich, USA), 0.05% bromophenol blue (114391, Sigma-Aldrich, USA). Samples were loaded into the gel and run at 110 V and 30 mA/gel, using the marker Amersham ECL Rainbow Marker \u0026ndash; full range (GERPN800E, Sigma-Aldrich, USA). The washing buffer was composed of Triton-X-100 (1610407, Bio-Rad, USA) and sterile H\u003csub\u003e2\u003c/sub\u003eO in a ratio of 1:39. The incubation was run for 20 hours at 37\u0026deg;C with the development buffer containing 500 mM Tris pH 7.4, 100 mM CaCl\u003csub\u003e2\u003c/sub\u003e (43381, Carlo Erba Reagents, Italy), 0.2% NaN\u003csub\u003e3\u003c/sub\u003e (478484, Carlo Erba Reagents, Italy), H\u003csub\u003e2\u003c/sub\u003eO sterile. The staining solution used has the following composition: Coomassie bright blue R-250 (1610400, Bio-Rad, USA), acetic acid, ethanol, and sterile H\u003csub\u003e2\u003c/sub\u003eO. The de-staining buffer was made of ethanol, acetic acid, and H\u003csub\u003e2\u003c/sub\u003eO. The quantification was made by the iBright (iBright 1500, Invitrogen, USA).\u003c/p\u003e\n\u003ch3\u003eqRT-PCR\u003c/h3\u003e\n\u003cp\u003eRNA extraction has been performed using Trizol Reagent (15596018, Life Technologies, USA). Chloroform (438613, Carlo Erba, Italy) was added. Samples of RNA: isopropanol (278475-1L, Sigma-Aldrich, USA) 1:1 were centrifuged at 4\u0026deg;C for 10 minutes, the supernatant of isopropanol was eliminated, and 75% ethanol (32221-2.5L-M, Sigma-Aldrich, USA) was added. The samples were centrifuged for 10 minutes, and the pellets were resuspended in RNA-free water (129115, Nuclease Free-Water, Qiagen, Germany). RNA quantification was done at Nanodrop (Nanodrop 2000 spectrophotometer, Thermo Scientific, Lithuania). For reverse transcription, the high-capacity cDNA reverse transcription kit, 4368814, applied biosystems by Thermo Fisher Scientific, UK, was used.\u003c/p\u003e \u003cp\u003eThe housekeeping gene used was GAPDH; different genes were analyzed (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of primers used.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003egene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAccession number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAmplicon size (pb)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFw. CCTCTGACTTCAACAGCGA\u003c/p\u003e \u003cp\u003eRev. GGTCTTACTCCTTGGAGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_001256799.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e165\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGPC3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFw. CCAAAAGAGAGGAAGGAATGG\u003c/p\u003e \u003cp\u003eRev. CTCAGGAGCTGGTTAATGTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_004484.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e123\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGPC5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFw. TGAAGCATGTTGTTCAGTTGTT\u003c/p\u003e \u003cp\u003eRev. GAAGTTCATATCATCTGGCATCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_004466.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSULF2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFw. ACTCGAAACATGGACCTGGG\u003c/p\u003e \u003cp\u003eRev. CCCACAGTTGTCCCAGTGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_054323703.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e121\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCOL1α1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFw. GCTGGAAAAGATGGTCGCAC\u003c/p\u003e \u003cp\u003eRev. TAACCACCACCGCTTACACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_000089.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e140\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCXCR4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFw. CTTCAGTTTGTTGGCTGCGG\u003c/p\u003e \u003cp\u003eRev. GAAGTGTATATACTGATCCCCTCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_003467.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e119\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eITGα9β1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFw. TCAGCTTCCATGGCAAACAC\u003c/p\u003e \u003cp\u003eRev. AGCTTCTCTGTGACCTGACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_002207.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e145\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWnt3A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFw. CTTTGCAGTGACACGCTCAT\u003c/p\u003e \u003cp\u003eRev. AGACACCATCCCACCAAACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAB060284.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e136\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eSYBR green (4367659, applied biosystems by Thermo Fisher Scientific, UK) was added to detect the samples. 7500 Fast Real-Time PCR System (Applied Biosystems, USA) was used. The data were represented as a function of the threshold cycle, according to the formula 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eGelation of hydrogel\u003c/h2\u003e \u003cp\u003eThe cells of different cell lines were embedded into the hydrogel.\u003c/p\u003e \u003cp\u003eHA and HA-based hydrogel were synthesized as already described by Saggioro et al. \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Briefly, for the synthesis of the polymer, HA 200 kDa (Fidia Farmaceutici, Abano Terme, Italy) was dissolved in anhydrous dimethyl sulfoxide (DMSO) together with methanesulphonic acid (Merk, Darmstadt, Germany). After dissolution, 1,1-carbonyldiimidazole (Merk, Darmstadt, Germany) and, after 1 h, 2-(2-pyridyldithio) ethylamine hydrochloride (SPDC) were added. The mixture was left to react overnight under stirring at 40\u0026deg;C. The obtained HA-SPDC intermediate was recovered through precipitation in ethanol and washed with EtOH/H\u003csub\u003e2\u003c/sub\u003eO solutions at a decreasing percentage of ethanol. After solubilization in 0.5 M NaOH, and neutralization with HCl 0.5 M, the polymer was dialyzed against 0.1 M acetate buffer at pH 5 for 48 h and then against water for 24 h. The solution was lyophilized. Finally, HA-SPDC was reacted with DTT in 50 mM phosphate buffer with 2 mM EDTA at pH 7 for 1 h. The solution was dialyzed against the same buffer for 24 h and then against 1 mM EDTA for 48 h under nitrogen flow. The product was then lyophilized, and the amount of sulfhydryl groups was determined by Ellman\u0026rsquo;s assay and \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003eH-NMR.\u003c/p\u003e \u003cp\u003eFor hydrogel gelation, HA-SH was resuspended in the culture medium at a final concentration of 1% [w/v] by gentle pipetting. Pellets of 2\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells were resuspended in culture medium/HA-SH solution and transferred on a glass flat bottom 96 well plate. This solution mixture was finally crosslinked with 10 kDa PEG-dimaleimide (Iris Biotech GMBH, Marktredwitz, Germany) to obtain the hydrogel. The ratio of maleimide and thiol groups was stoichiometrically kept at 1:1. Fibronectin bovine plasma (F1141-1MG, 100 \u0026micro;g/ml, Sigma, USA), collagen I from rat tail (ALX-522-435-0100, 600 \u0026micro;g/ml, Enzo Biochem, USA), and 5% of Matrigel Matrix Basement Membrane (356234, Corning, USA) were added to the gel, to create a more like in vivo model.\u003c/p\u003e \u003cp\u003eThen the viability was evaluated with the kit live\u0026amp;dead (L3224, LIVE/DEAD viability/cytotoxicity kit, ThermoFisher scientifics).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eScanning Electron Microscopy\u003c/h2\u003e \u003cp\u003eFor scanning electron microscopy (SEM), samples were lyophilized before imaging with a CamScan MX3000 scanning electron microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eFor each analysis, at least five random pictures were used for data output. All graphs displayed were produced with GraphPad software 10.0.\u003c/p\u003e \u003cp\u003eData were expressed as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Four replicates for each experiment and 4 different experiments were performed for each type of analysis. For all experiments (qPCR and tissue analysis), statistical significance was determined using or an equal-variance Student\u0026rsquo;s t-test or Mann\u0026ndash;Whitney U test to compare two groups, or Anova analysis for multiple comparisons with Tukey\u0026rsquo;s post hoc test. Statistical significance was determined using GraphPad 10.0 software with an equal-variance Mann-Whitney test to compare the two groups. A p-value below 0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eGPC3 silencing impairs RMS cells lines proliferation without affecting GPC5 expression\u003c/h2\u003e \u003cp\u003eAll the RMS cell lines used in this study exhibited elevated expression of the proteoglycan GPC3, which following silencing was significantly reduced (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Non-specific GPC3 silencing-related toxicity was not observed under these conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA), as increased staining of cleaved Caspase 3 (cCAS3) was only detected in a few sparse dying cells (Fig. S2D). The expression levels of proteins, (GPC5, SULF2, Ki67) related to GPC3 were assessed by immunofluorescence before and after silencing (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eAs illustrated in Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, the expression of GPC3 protein and its family member GPC5 were examined. GPC5 expression was assessed due to the high homology with GPC3, which could substitute for GPC3 after silencing. However, GPC5 exhibited consistent expression in all the cell lines following GPC3 silencing, further increasing in RH4 ARMS cells seemingly compensating for the absence of GPC3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). In contrast, the proliferation marker Ki67 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB and C) decreased after treatment, supporting the hypothesis that GPC3 is somehow involved in RMS cell proliferation.\u003c/p\u003e \u003cp\u003eFinally, the expression of SULF2, the enzyme that activates GPC3, remained unchanged, except in RH30 cells, where overexpression of SULF2 may help to restore GPC3, which is particularly important for the dissemination of ARMS cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eAdhesion and migration are greatly decreased after silencing GPC3 in both ARMS and ERMS\u003c/h2\u003e \u003cp\u003eEvaluation of GPC3 expression at early time points of silencing revealed the persistent absence of protein in the cell lines, except for RH36 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). This finding led to investigate the involved biological processes, including adhesion and migration, in which GPC3 plays a role. As depict in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, the counts of cells per area were examined in the presence and absence of fibronectin, highlighting the intrinsic inability of silenced cells to rapidly adhere to the fibronectin coating. These results confirmed the primary role of GPC3 in cell adhesion, particularly for the ARMS RH30 cell line.\u003c/p\u003e \u003cp\u003eTranswell migration and wound-healing assays were performed to quantitatively assess GPC3 expression in cell migration. As expected, all GPC3-silenced RMS cells showed a significant decrease in transwell migration compared to GPC3-expressing cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-E). Remarkably, these observations were also evident in the wound healing assay. While, no clear difference was observed between ARMS and ERMS cell migration, a clear distinction was noted between treated and untreated cells for each cell line (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD and E). Based on these other findings, it can be hypothesized that GPC3 may play a role in regulating the metastatic behaviour of RMS cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eSULF2 inhibition directly influences RMS cell growth\u003c/h2\u003e \u003cp\u003eIn order to avoid the continuous SULF2 activity following GPC3 silencing, we decided to directly inhibit the enzyme itself. We aimed to analyze both GPC3 and SULF2 protein expression in these setting, in addition to the secreted protein delivered by SULF2, FGF2. We confirmed that after the addition of the SULF2 inhibitor, GPC3 availability was greatly reduced in parental cells and completely lost in GPC3-silenced ones, together with a significant downregulation of GPC5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The paramount role of the SULF2 in the activation of GPC3 was proven. However, in the presence of the enzyme inhibitor factor, a FGF2 overproduction was observed, with the exception of RH4 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB and S2B). With regard to ECM protein secretion, the inhibition of SULF-2 did not affect fibronectin synthesis, but it did cause an marked alteration in cell proliferation and the cell cycle (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).Vimentin, a protein that is involved in maintaining cell structure, significantly changed in expression after silencing (Fig. S2C). In contrast, the levels of all the proteins described above were reduced when SULF2 enzyme activity was inhibited together with GPC3 silencing (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC right). This effect was also observed for the proteins involved in ECM composition (Col1α1, GPC3, GPC5, SULF2) and cell migration (CXCR4) (Fig. S3). GPC3 gene expression decreased after the treatments, while SULF2 increased, indicating an attempt to synthesise new SULF2 protein with consequent activation of additional GPC3. Conversely, the GPC5 gene was not detected, and the protein was found to be highly present. The CXCR4 gene demonstrated no alterations in response to the combination of DOXO, SULF2-inhibitor and GPC3 siRNA, whereas Col1α1 expression was reduced in cells subjected to triple treatment, suggesting a potential suppression of matrix formation. The expression of the proliferation markers Ki67 and Wnt3a also decreased after GPC3 silencing, as did ITGα9β1 protein, a factor known to be involved cell cycle reactivation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and S2A). Tumor migration appeared to be directly linked to the microenvironmental proteins that determine the shape and mechanical properties of the surrounding ECM. Therefore, we focused on understanding the ECM dysregulation properties after GPC3 silencing, SULF2 inhibition, and DOXO addition by assessing the expression of MMPs (gelatinases), enzymes that are involved in microenvironment remodeling. In these conditions, the expression of active MMP2 (67 kDa) was found to decrease in the RH30 cell line following the triple treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD, E), while its expression increased in the RH4 and RD cell lines. In ARMS, MMP9 (82 kDa), which exhibits lower expression levels compared to MMP2, demonstrated an increase in response to treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD and E). In ERMS cells, MMP9, which is present in the untreated control, decreased only after silencing, while with the combination of GPC3 siRNA, SULF2 inhibitor and DOXO it regained expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE and S8). These results highlight how ECM remodelling is influenced by the proteoglycan GPC3.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eMicroenvironment dysregulation and drug-targeting tumor cells induce cell death\u003c/h2\u003e \u003cp\u003eTo evaluate the combined effect of microenvironmental impairment subsequent to GPC3 silencing and the administration of anti-cancer proliferation drugs, the expression of Ki67 and cleaved caspase 3 (cCAS3) proteins was assessed. The use of DOXO following silencing was demonstrated to affect the cell viability (Fig. S4). Furthermore, the triple treatment with GPC3 siRNA, SULF2-inhibitor and DOXO, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, resulted in a significant impairment in cell proliferation, resulting in up to 15% of cell death (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and B). When it was given in preference of DOXO, the cells reached a steady state in which proliferation was blocked (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB and C). The metabolic activity of the cells was strongly impaired when ipafricept was added (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD), most likely due to perturbations in the S phase of RMS cells (Fig. S5, RH30). As expected, the combined treatment was more effective in all RMS cells.\u003c/p\u003e\u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eMigration and proliferation in the 3D hydrogel are significantly different from the 2D cell culture\u003c/h2\u003e \u003cp\u003eThe HA-based hydrogels have previously been shown to be a promising environment that well recapitulates the in vivo conditions of RMS, in particular after the analysis of the extracellular matrix proteins. Indeed, as already shown by our group, fibronectin and collagen play a paramount role in recapitulating the RMS surrounding in our hydrogel \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eHere, the presence of RMS RH30 and RD cells was detected in the hydrogel by means of SEM. The shape of the cells, whether elongated or round, was found to correlate with the presence or absence of GPC3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and B). Furthermore, the high level of cell viability observed after administration of scramble GPC3 siRNA provided further evidence that transfection per se was not toxic (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB and C; Fig. S6).\u003c/p\u003e \u003cp\u003eIt is important to note that untreated RMS cells (WT) spread homogeneously on the hydrogel support, whereas GPC3 silenced cells confirmed their impaired motility, at least in part due to the higher percentage of cell death (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003eThe addition of SULF2 inhibitor and DOXO further impaired RMS cell migration on the hydrogel, but also affected cell proliferation and viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD-F). A more pronounced effect was observed in the presence of ipafricept, both in ARMS (RH30) and ERMS (RD) cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD and S7).\u003c/p\u003e \u003cp\u003eIn the 3D model, the presence of GPC5 did not protect and rescue the GPC3-silenced cells, demonstrating for the first time, that the presence of GPC3 is essential for RMS cell migration and survival (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the present study, we demonstrated for the first time, that an ECM protein, such as the proteoglycan GPC3, is of paramount importance for the migration and proliferation of RMS cancer cells.\u003c/p\u003e \u003cp\u003eMalignant cells do not act alone in cancer progression but require sustained interactions and crosstalk with supporting cells and ECM components that form the tumor microenvironment\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Soluble molecules of the ECM, present in proximity of tumor cells, bind to membrane receptors and initiate intracellular signaling cascades necessary to sustain proliferation, angiogenesis, initiation of invasion and metastasis \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. Glypicans are one of the most important matrix components that regulate the availability of biomolecules in the surrounding milieu.\u003c/p\u003e \u003cp\u003eSix glypicans (GPC1-6) have been described in mammals, bound to the outer surface of the plasma membrane by glycosyl-phosphatidylinositol anchors. They regulate several developmental signaling pathways, such as Wnt or Hedgehog, by acting as co-receptors and storage sites for many heparin-binding growth factors.\u003c/p\u003e \u003cp\u003eGlypican-3 (GPC3) is protein that is expressed in a time- and tissue-restricted manner and also expressed in pathological conditions including cancer. Following GPC3 silencing, cell proliferation, adhesion, and migration are severely impaired following GPC3 silencing, as demonstrated in RH30 alveolar rhabdomyosarcoma cells, representing the most aggressive RMS subtype known to date. It is worth noting that GPC3 is more abundant in ARMS than in ERMS cells, and this correlates with the tendency of ARMS to invade and spread widely. Indeed, all of the aforementioned biological processes were significantly downregulated in GPC3-silenced ARMS cell lines, whereas in ERMS were dependent on the specific cell line.\u003c/p\u003e \u003cp\u003eGPC3 silencing in RMS cells was highly specific, as the expression of the family member GPC5 appeared to be unaffected by the knockdown and even increased after treatment. GPC5 shares 63% homology with GPC3 and is also expressed in RMS cells \u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e,\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. However, although GPC5 is expressed during development in the kidney, testis, limbs, and brain, unlike GPC3, it also persists in the brain during adulthood. Therefore, in addition to silencing GPC3, we decided to inhibit the SULF-2 enzyme, which is shared by both GPC3 and GPC5 for their maturation and proper activation. SULF-2 has been demonstrated to promote tumor growth by releasing soluble growth factors from GPCs in the ECM, which in turn induce cell surface cognate receptor activity and downstream intracellular cancer signaling upon ligand binding. To assess the importance of GPC3 in RMS biology and aggressiveness, we used the SULF-2 inhibitor which has been shown to inhibit cell proliferation, viability, and migration in different tumor models, and to promote cell death by increasing apoptotic caspase 3 enzyme activity \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. We demonstrated that although SULF-2 was detectable after GPC3 silencing, it became undetectable after activity inhibition in all treated cell lines, negatively affecting GPC5 expression as hypothesized.\u003c/p\u003e \u003cp\u003eCell adhesion is closely correlated with fibronectin production and extracellular deposition, as fibronectin is one of the major components of the ECM that controls tissue development, cancer progression, wound healing, and the development of diseases associated with fibrosis \u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. We have previously shown that RMS cancer cells produce their own ECM proteins in order to sustain their growth, including fibronectin \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Here, we observed that after GPC3 silencing and SULF-2 inhibition, the ECM surrounding RMS cells decreased fibronectin deposition. In addition to this, the expression of ITGα9β1, a fibronectin receptor involved in cell cycle regulation at the pre-metastatic niche \u003csup\u003e\u003cspan additionalcitationids=\"CR38\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e, was deregulated by the combinatorial treatment, along with the disruption of cell proliferation and extracellular matrix formation.\u003c/p\u003e \u003cp\u003eMicroenvironmental remodeling has therefore been studied following administration of DOXO, an anthracycline drug that has been extensively used in the treatment of various cancers, including rhabdomyosarcoma \u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. In vitro studies have demonstrated that anthracyclines inhibit invasion of cancer cells derived from various solid tumors. The anti-invasive effect of anthracyclines involves the downregulation of matrix metalloproteinases (MMPs), the disorganization of the cytoskeleton and the inhibition of focal adhesion kinases (FAK) \u003csup\u003e\u003cspan additionalcitationids=\"CR42\" citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. However, under certain circumstances ECM proteins have been observed to modulate the antimigratory and apoptotic effects of chemotherapeutic drugs, thereby explaining the drug resistance and disease progression events that occur in many cases \u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e,\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. Among the proteins involved in ECM remodelling and degradation, MMPs are of particular importance, in both healthy and pathological conditions \u003csup\u003e\u003cspan additionalcitationids=\"CR47\" citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. In particular, the expression of MMP2 and MMP9 has been linked to tumor growth, progression, and metastasis, and correlates with cancer aggressiveness and response to therapy \u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. Here, the reduced MMP expression following GPC3 silencing was found to be increased after SULF-2 inhibition and DOXO treatment, an effect that can be explained by the action of DOXO, which activates microRNAs involved in cell migration \u003csup\u003e\u003cspan additionalcitationids=\"CR48\" citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. In this study, the efficacy of DOXO in combination with GPC3 silencing and the SULF-2 inhibitor was investigated. The results demonstrated that the combination therapy was effective in reducing cell proliferation while inducing cell death. However, since the metabolic activity of RMS cells was not reduced after the combinatorial treatment, an early inhibitor of RMS cell proliferation, Ipafricept, was used instead of DOXO. Indeed, Ipafricept synergized with GPC3 silencing and the SULF-2 inhibitor, and also reduced metabolic activity. Ipafricept, a recombinant fusion protein that sequesters Wnt ligands, does not act at the DNA level but blocks Wnt-dependent proliferative signaling early at the plasma membrane \u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e,\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e,\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e. Finally, a proprietary hyaluronic-based hydrogel tunable with ECM proteins was utilized. This has been demonstrated to sense RMS cells to feel the spatial and mechanical interactions of the in vivo microenvironment \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. In the hydrogel support, the RMS cells migrated in all directions, interacting with matrix-embedded fibronectin and collagen I proteins \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. The 3D distribution of both viable WT and silenced cells was striking. However, the percentage of dead cells in the latter was significantly increased. The percentage of dead cells increased further after drug treatment, particularly with ipafricept, which was much more potent in RD ERMS cells.\u003c/p\u003e \u003cp\u003eNotably, GPC5 protein secretion persisted under these conditions, suggesting a potential for further investigation of an inhibitory strategy capable of silencing both GPC3 and GPC5.\u003c/p\u003e \u003cp\u003eIn conclusion, we here demonstrated that GPC3 (and GPC5) plays a pivotal role in the growth, proliferation and expansion of RMS. To this end two models were developed: the first, a simple 2D model, allowed us to underline the pivotal role of GPC3 and proved to further expand the study in the second, more complex, 3D model. The latest represents the more suitable condition for future drug testing and new silencing strategies with patient-derived cells.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors agree to publish the work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to partecipate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable. The present work use commercially available cell lines.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe materials are already available in the manuscript. Raw data are available under reasonable request to [email protected].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatement of Competing Interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflict of interest to declare.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work has been supported by Project 21/07 Institute of Pediatric Research Citt\u0026agrave; della Speranza. PI: Michela Pozzobon.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM.B., S.DA. performed the experiments, data collection and interpretation, wrote the article; A.G. created the hydrogel and help with experiments; E.P., P.B. data interpretation. G.B. G.P. read and approved the article. M.P. conceived the experiments, analyzed the data, wrote and approved the article. All the authors approved the article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thanks Chiara Frasson for her valuable support in cytofluorimetric analysis.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003ePaolillo, M. \u0026amp; Schinelli, S. Extracellular Matrix Alterations in Metastatic Processes. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, (2019).\u003c/li\u003e\n\u003cli\u003eWinkler, J., Abisoye-Ogunniyan, A., Metcalf, K. J. \u0026amp; Werb, Z. Concepts of extracellular matrix remodelling in tumour progression and metastasis. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003eLian, X. \u003cem\u003eet al.\u003c/em\u003e Defining the Extracellular Matrix of Rhabdomyosarcoma. \u003cem\u003eFront Oncol\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, (2021).\u003c/li\u003e\n\u003cli\u003eWang, J.-J., Lei, K.-F. \u0026amp; Han, F. Tumor microenvironment: recent advances in various cancer treatments.\u003c/li\u003e\n\u003cli\u003eXiao, Y. \u0026amp; Yu, D. Tumor microenvironment as a therapeutic target in cancer. \u003cem\u003ePharmacol Ther\u003c/em\u003e \u003cstrong\u003e221\u003c/strong\u003e, 107753 (2021).\u003c/li\u003e\n\u003cli\u003eSaggioro, M. \u003cem\u003eet al.\u003c/em\u003e A rhabdomyosarcoma hydrogel model to unveil cell-extracellular matrix interactions. \u003cem\u003eBiomater Sci\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 124\u0026ndash;137 (2022).\u003c/li\u003e\n\u003cli\u003eMartin-Giacalone, B. A., Weinstein, P. A., Plon, S. E. \u0026amp; Lupo, P. J. Pediatric Rhabdomyosarcoma: Epidemiology and Genetic Susceptibility. \u003cem\u003eJ Clin Med\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, (2021).\u003c/li\u003e\n\u003cli\u003eRees, H. \u003cem\u003eet al.\u003c/em\u003e Rhabdomyosarcoma Standard Clinical Practice document 1 CLINICAL PRACTICE GUIDELINES FOR PATIENTS WITH RHABDOMYOSARCOMA Collaborators from CWS: Widening country Reviewers.\u003c/li\u003e\n\u003cli\u003eSkapek, S. X. \u003cem\u003eet al.\u003c/em\u003e Rhabdomyosarcoma. \u003cem\u003eNat Rev Dis Primers\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 1 (2019).\u003c/li\u003e\n\u003cli\u003eHinson, A. R. P. \u003cem\u003eet al.\u003c/em\u003e Human Rhabdomyosarcoma Cell Lines for Rhabdomyosarcoma Research: Utility and Pitfalls. \u003cem\u003eFront Oncol\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, (2013).\u003c/li\u003e\n\u003cli\u003eZhu, Z.-W. \u003cem\u003eet al.\u003c/em\u003e Enhanced glypican-3 expression diVerentiates the majority of hepatocellular carcinomas from benign hepatic disorders. doi:10.1136/gut.48.4.558.\u003c/li\u003e\n\u003cli\u003eBoily, G., Saikali, Z. \u0026amp; Sinnett, D. Methylation analysis of the glypican 3 gene in embryonal tumours. \u003cem\u003eBr J Cancer\u003c/em\u003e \u003cstrong\u003e90\u003c/strong\u003e, 1606\u0026ndash;1611 (2004).\u003c/li\u003e\n\u003cli\u003eRosen, S. D. \u0026amp; Lemjabbar-Alaoui, H. SULF-2: AN EXTRACELLULAR MODULATOR OF CELL SIGNALING AND A CANCER TARGET CANDIDATE. doi:10.1517/14728222.2010.504718.\u003c/li\u003e\n\u003cli\u003eHammond, E., Khurana, A., Shridhar, V. \u0026amp; Dredge, K. The role of heparanase and sulfatases in the modification of heparan sulfate proteoglycans within the tumour microenvironment and opportunities for novel cancer therapeutics. \u003cem\u003eFront Oncol\u003c/em\u003e \u003cstrong\u003e4 JUL\u003c/strong\u003e, 195 (2014).\u003c/li\u003e\n\u003cli\u003eLai, J.-P. \u003cem\u003eet al.\u003c/em\u003e Sulfatase 2 Up-Regulates Glypican 3, Promotes Fibroblast Growth Factor Signaling, and Decreases Survival in Hepatocellular Carcinoma. (2008) doi:10.1002/hep.22202.\u003c/li\u003e\n\u003cli\u003eHill, K. E., Lovett, B. M. \u0026amp; Schwarzbauer, J. E. Heparan sulfate is necessary for the early formation of nascent fibronectin and collagen I fibrils at matrix assembly sites. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e298\u003c/strong\u003e, 101479 (2022).\u003c/li\u003e\n\u003cli\u003eLanzi, C., Zaffaroni, N. \u0026amp; Cassinelli, G. Targeting Heparan Sulfate Proteoglycans and their Modifying Enzymes to Enhance Anticancer Chemotherapy Efficacy and Overcome Drug Resistance. \u003cem\u003eCurr Med Chem\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, (2017).\u003c/li\u003e\n\u003cli\u003eFico, A., Maina, \u0026bull; F \u0026amp; Dono, \u0026bull; R. Fine-tuning of cell signaling by glypicans. \u003cem\u003eVISIONS \u0026amp; REFLECTIONS\u003c/em\u003e doi:10.1007/s00018-007-7471-6.\u003c/li\u003e\n\u003cli\u003eDesai, A., Sandhu, S., Lai, J. P. \u0026amp; Sandhu, D. S. Hepatocellular carcinoma in non-cirrhotic liver: A comprehensive review. \u003cem\u003eWorld J Hepatol\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 1 (2019).\u003c/li\u003e\n\u003cli\u003eOfuji, K., Saito, K., Yoshikawa, T. \u0026amp; Nakatsura, T. Critical analysis of the potential of targeting GPC3 in hepatocellular carcinoma. \u003cem\u003eJ Hepatocell Carcinoma\u003c/em\u003e 1\u0026ndash;35 (2014) doi:10.2147/JHC.S48517.\u003c/li\u003e\n\u003cli\u003eDe Giovanni, C., Landuzzi, L., Nicoletti, G., Lollini, P. L. \u0026amp; Nanni, P. Molecular and cellular biology of rhabdomyosarcoma. \u003cem\u003ehttp://dx.doi.org/10.2217/fon.09.97\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 1449\u0026ndash;1475 (2009).\u003c/li\u003e\n\u003cli\u003eRoma, J., Almaz\u0026aacute;n-Moga, A., S\u0026aacute;nchez De Toledo, J. \u0026amp; Gallego, S. Notch, Wnt, and Hedgehog Pathways in Rhabdomyosarcoma: From Single Pathways to an Integrated Network. \u003cstrong\u003e2012\u003c/strong\u003e, (2012).\u003c/li\u003e\n\u003cli\u003eSalvo, D., Raimondi, M., Vella, L., Adesso, S. \u0026amp; Ciarapica, L. Hyper-Activation of Notch3 Amplifies the Proliferative Potential of Rhabdomyosarcoma Cells. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 96238 (2014).\u003c/li\u003e\n\u003cli\u003eRivankar, S. An overview of doxorubicin formulations in cancer therapy. \u003cem\u003eJ Cancer Res Ther\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 853 (2014).\u003c/li\u003e\n\u003cli\u003eMeredith, A. M. \u0026amp; Dass, C. R. Increasing role of the cancer chemotherapeutic doxorubicin in cellular metabolism. \u003cem\u003eJournal of Pharmacy and Pharmacology\u003c/em\u003e \u003cstrong\u003e68\u003c/strong\u003e, 729\u0026ndash;741 (2016).\u003c/li\u003e\n\u003cli\u003eJimeno, A. \u003cem\u003eet al.\u003c/em\u003e Cancer Therapy: Clinical A First-in-Human Phase I Study of the Anticancer Stem Cell Agent Ipafricept (OMP-54F28), a Decoy Receptor for Wnt Ligands, in Patients with Advanced Solid Tumors. doi:10.1158/1078-0432.CCR-17-2157.\u003c/li\u003e\n\u003cli\u003eZheng, X. \u003cem\u003eet al.\u003c/em\u003e The Human Sulfatase 2 Inhibitor 2,4-Disulfonylphenyl-tert-Butylnitrone (OKN-007) has an Antitumor Effect in Hepatocellular Carcinoma Mediated via Suppression of TGFB1/ SMAD2 and Hedgehog/GLI1 Signaling. \u003cem\u003eGenes Chromosomes Cancer\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e, 225\u0026ndash;236 (2013).\u003c/li\u003e\n\u003cli\u003eBaxter-Holland, M. \u0026amp; Dass, C. R. Doxorubicin, mesenchymal stem cell toxicity and antitumour activity: implications for clinical use. \u003cem\u003eJournal of Pharmacy and Pharmacology\u003c/em\u003e \u003cstrong\u003e70\u003c/strong\u003e, 320\u0026ndash;327 (2018).\u003c/li\u003e\n\u003cli\u003eIpafricept (OMP-54F28) | Wnt Inhibitor | MedChemExpress. https://www.medchemexpress.com/ipafricept.html.\u003c/li\u003e\n\u003cli\u003eToth, M. \u0026amp; Fridman, R. Assessment of Gelatinases (MMP-2 and MMP-9) by Gelatin Zymography. \u003cem\u003eMethods Mol Med\u003c/em\u003e \u003cstrong\u003e57\u003c/strong\u003e, 163\u0026ndash;174 (2001).\u003c/li\u003e\n\u003cli\u003eSaggioro, M. \u003cem\u003eet al.\u003c/em\u003e A rhabdomyosarcoma hydrogel model to unveil cell-extracellular matrix interactions. \u003cem\u003eBiomater Sci\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 124\u0026ndash;137 (2022).\u003c/li\u003e\n\u003cli\u003eTheocharis, A. D., Skandalis, S. S., Gialeli, C. \u0026amp; Karamanos, N. K. Extracellular matrix structure. \u003cem\u003eAdv Drug Deliv Rev\u003c/em\u003e \u003cstrong\u003e97\u003c/strong\u003e, 4\u0026ndash;27 (2016).\u003c/li\u003e\n\u003cli\u003eLi, F., Shi, W., Capurro, M. \u0026amp; Filmus, J. Glypican-5 stimulates rhabdomyosarcoma cell proliferation by activating Hedgehog signaling. \u003cem\u003eJournal of Cell Biology\u003c/em\u003e \u003cstrong\u003e192\u003c/strong\u003e, 691\u0026ndash;704 (2011).\u003c/li\u003e\n\u003cli\u003eWilliamson, D. \u003cem\u003eet al.\u003c/em\u003e Role for Amplification and Expression of Glypican-5 in Rhabdomyosarcoma. \u003cem\u003eCancer Res\u003c/em\u003e \u003cstrong\u003e67\u003c/strong\u003e, 57\u0026ndash;65 (2007).\u003c/li\u003e\n\u003cli\u003eGhura, H. \u003cem\u003eet al.\u003c/em\u003e Inhibition of fibronectin accumulation suppresses TUMOR growth. \u003cem\u003eNeoplasia\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 837 (2021).\u003c/li\u003e\n\u003cli\u003eD\u0026rsquo;Agostino, S. \u003cem\u003eet al.\u003c/em\u003e Rhabdomyosarcoma Cells Produce Their Own Extracellular Matrix With Minimal Involvement of Cancer-Associated Fibroblasts: A Preliminary Study. \u003cem\u003eFront Oncol\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, (2021).\u003c/li\u003e\n\u003cli\u003eXu, S. \u003cem\u003eet al.\u003c/em\u003e Integrin-a9b1 as a Novel Therapeutic Target for Refractory Diseases: Recent Progress and Insights. doi:10.3389/fimmu.2021.638400.\u003c/li\u003e\n\u003cli\u003eNavarro, N. \u003cem\u003eet al.\u003c/em\u003e Integrin alpha9 emerges as a key therapeutic target to reduce metastasis in rhabdomyosarcoma and neuroblastoma. \u003cem\u003eCellular and Molecular Life Sciences\u003c/em\u003e \u003cstrong\u003e79\u003c/strong\u003e, 546 (2022).\u003c/li\u003e\n\u003cli\u003eMasi\u0026agrave;, A. \u003cem\u003eet al.\u003c/em\u003e Notch-mediated induction of N-cadherin and \u0026amp;alpha;9-integrin confers higher invasive phenotype on rhabdomyosarcoma cells. \u003cem\u003eBr J Cancer\u003c/em\u003e \u003cstrong\u003e107\u003c/strong\u003e, 1374\u0026ndash;1383 (2012).\u003c/li\u003e\n\u003cli\u003eGianni Bisogno, Meriel Jenney, Christophe Bergeron, Soledad Gallego Melc\u0026oacute;n, Andrea Ferrari, Odile Oberlin, Modesto Carli, Michael Stevens, Anna Kelsey, Angela De Paoli, Mark N Gaze, Helene Martelli, Christine Devalck, Johannes H Merks, Myriam Ben-Arush, H, G. L. D. S. Addition of dose-intensified doxorubicin to standard chemotherapy for rhabdomyosarcoma (EpSSG RMS 2005): a multicentre, open-label, randomised controlled, phase 3 trial. \u003cem\u003eThe Lancet\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 1061\u0026ndash;1071 (2018).\u003c/li\u003e\n\u003cli\u003ePark, H. J. \u003cem\u003eet al.\u003c/em\u003e Inhibitory effect of DA-125, a new anthracyclin analog antitumor agent, on the invasion of human fibrosarcoma cells by down-regulating the matrix metalloproteinases. doi:10.1016/j.bcp.2005.10.007.\u003c/li\u003e\n\u003cli\u003eHarisi, R. \u003cem\u003eet al.\u003c/em\u003e Repopulation of osteosarcoma cells after treatment with doxorubicin in the presence of extracellular matrix biopolymers. doi:10.1007/s00280-005-0165-6.\u003c/li\u003e\n\u003cli\u003eVan Nimwegen, M. J., Huigsloot, M., Camier, A., Tijdens, I. B. \u0026amp; Van De Water, B. Focal Adhesion Kinase and Protein Kinase B Cooperate to Suppress Doxorubicin-Induced Apoptosis of Breast Tumor Cells. \u003cem\u003eMol Pharmacol\u003c/em\u003e \u003cstrong\u003e70\u003c/strong\u003e, 1330\u0026ndash;1339 (2006).\u003c/li\u003e\n\u003cli\u003eSaid, G. \u003cem\u003eet al.\u003c/em\u003e Extracellular matrix proteins modulate antimigratory and apoptotic effects of Doxorubicin. \u003cem\u003eChemother Res Pract\u003c/em\u003e \u003cstrong\u003e2012\u003c/strong\u003e, 1\u0026ndash;10 (2012).\u003c/li\u003e\n\u003cli\u003eShin, S. H., Choi, Y. J., Lee, H., Kim, H. S. \u0026amp; Seo, S. W. Oxidative stress induced by low-dose doxorubicin promotes the invasiveness of osteosarcoma cell line U2OS in vitro. \u003cem\u003eTumour Biol\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 1591\u0026ndash;1598 (2016).\u003c/li\u003e\n\u003cli\u003eRicci, S., D\u0026rsquo;Esposito, V., Oriente, F., Formisano, P. \u0026amp; Di Carlo, A. Substrate-zymography: A still worthwhile method for gelatinases analysis in biological samples. \u003cem\u003eClin Chem Lab Med\u003c/em\u003e \u003cstrong\u003e54\u003c/strong\u003e, 1281\u0026ndash;1290 (2016).\u003c/li\u003e\n\u003cli\u003eBeji, S. \u003cem\u003eet al.\u003c/em\u003e Doxorubicin upregulates CXCR4 via miR-200c\u0026amp;sol;ZEB1-dependent mechanism in human cardiac mesenchymal progenitor cells. \u003cem\u003eCell Death Dis\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 3020 (2017).\u003c/li\u003e\n\u003cli\u003eLong, L., Xiang, H., Liu, J., Zhang, Z. \u0026amp; Sun, L. ZEB1 mediates doxorubicin (Dox) resistance and mesenchymal characteristics of hepatocarcinoma cells. \u003cem\u003eExp Mol Pathol\u003c/em\u003e \u003cstrong\u003e106\u003c/strong\u003e, 116\u0026ndash;122 (2019).\u003c/li\u003e\n\u003cli\u003eRegenbogen, S. \u003cem\u003eet al.\u003c/em\u003e Cytotoxic drugs in combination with the CXCR4 antagonist AMD3100 as a potential treatment option for pediatric rhabdomyosarcoma. \u003cem\u003eInt J Oncol\u003c/em\u003e \u003cstrong\u003e57\u003c/strong\u003e, 289\u0026ndash;300 (2020).\u003c/li\u003e\n\u003cli\u003eLe, P., Mcdermott, J. D. \u0026amp; Jimeno, A. Targeting the Wnt pathway in human cancers: therapeutic targeting with a focus on OMP-54F28. (2014) doi:10.1016/j.pharmthera.2014.08.005.\u003c/li\u003e\n\u003cli\u003eSun, Y., Wang, W. \u0026amp; Zhao, C. Frizzled Receptors in Tumors, Focusing on Signaling, Roles, Modulation Mechanisms, and Targeted Therapies. \u003cem\u003eOncol Res\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 661 (2021).\u003c/li\u003e\n\u003cli\u003eYoo, K. M., Murphy, S. V. \u0026amp; Skarda, A. A Rapid Crosslinkable Maleimide-Modified Hyaluronic Acid and Gelatin Hydrogel Delivery System for Regenerative Applications. \u003cem\u003eGels\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 1\u0026ndash;17 (2021).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Extracellular matrix, Glypican 3, Rhabdomyosarcoma, HA-hydrogel model","lastPublishedDoi":"10.21203/rs.3.rs-5664628/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5664628/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eRhabdomyosarcoma (RMS) is a pediatric soft tissue sarcoma of mesenchymal origin with two main variants, the embryonal, less aggressive, and the alveolar RMS, more metastatic. The role of the extracellular matrix (ECM) in the growth and migration of RMS, as in other cancers, is becoming increasingly important. This work aims to study the RMS after the silencing of the proteoglycan Glypican 3, overexpressed in RMS. Using classical 2D cell culture with RMS cell lines and 3D hyaluronic acid-based hydrogel, the involvement of Glypican 3 in adhesion, proliferation, matrix degradation, and consequent cell motility was demonstrated. Functional assays were performed with the antineoplastic drug doxurubicin and the WNT3a inhibitor, ipafricept. Both in 2D and in 3D model, cell motility and proliferation were significantly impaired after Glypican 3 silencing and inhibition of the proteoglycan releasing the sulfatase enzyme SULF2. When the in vivo cell-ECM interactions were mimicked in the hyaluronic acid-based hydrogel, Doxorubicin and ipraficept were particularly effective against the GPC3-silenced RMS cells. This study lay the fundation for a different therapeutic approach against pediatric RMS that aim to dysregulate the protein microenvironment not only beat the cancer cells.\u003c/p\u003e","manuscriptTitle":"Glypican 3 as target therapy to prevent cell migration and proliferation in rhabdomyosarcoma","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-21 05:38:59","doi":"10.21203/rs.3.rs-5664628/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Accepted","date":"2025-05-20T12:05:48+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-17T19:03:42+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"161027316253827175930582669703751084484","date":"2025-05-17T09:16:52+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-04-17T08:02:26+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"64246342299662019798034382722511011436","date":"2025-04-17T00:49:06+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-16T17:57:33+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-04-07T10:34:28+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-03-24T22:45:49+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e56a4672-292e-464a-a242-1e6f271998d9","owner":[],"postedDate":"April 21st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":47272946,"name":"Biological sciences/Cancer/Cancer microenvironment"},{"id":47272947,"name":"Biological sciences/Biotechnology/Biomaterials"}],"tags":[],"updatedAt":"2025-07-07T16:01:53+00:00","versionOfRecord":{"articleIdentity":"rs-5664628","link":"https://doi.org/10.1038/s41598-025-03466-x","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-07-01 15:56:54","publishedOnDateReadable":"July 1st, 2025"},"versionCreatedAt":"2025-04-21 05:38:59","video":"","vorDoi":"10.1038/s41598-025-03466-x","vorDoiUrl":"https://doi.org/10.1038/s41598-025-03466-x","workflowStages":[]},"version":"v1","identity":"rs-5664628","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5664628","identity":"rs-5664628","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}