Aerobic exercise improves lysosomal function in the brain of high cholesterol diet-fed APP/PS1 mice by modulating 27-hydroxycholesterol via the liver-brain axis

preprint OA: closed
Full text JSON View at publisher
Full text 189,623 characters · extracted from preprint-html · click to expand
Aerobic exercise improves lysosomal function in the brain of high cholesterol diet-fed APP/PS1 mice by modulating 27-hydroxycholesterol via the liver-brain axis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Aerobic exercise improves lysosomal function in the brain of high cholesterol diet-fed APP/PS1 mice by modulating 27-hydroxycholesterol via the liver-brain axis Zeyu Chen, Zelin Hu, Jingran Xiao, Xia Tao, Fanqi Zeng, Siqing Luorong, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6361968/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Typical pathological features of Alzheimer's disease include disturbances in cholesterol metabolism and defects in lysosomal function in the brain. With age and disease progression, patients with Alzheimer's disease have decreased cholesterol synthesis in the brain and abnormal cholesterol accumulation in neurons, accompanied by elevated 27-hydroxycholesterol concentrations. High-cholesterol diets are more common in Alzheimer's disease patients, which may promote the accumulation of 27-hydroxycholesterol and further exacerbate the disturbance of cholesterol metabolism in the brain. This leads to the entry of 27-hydroxycholesterol into the brain through the blood-brain barrier, where it disrupts lysosomal and synaptic function and ultimately exacerbates neuronal damage and Aβ deposition, contributing to cognitive decline. However, the mechanism underlying elevated 27-hydroxycholesterol concentrations and its relationship with lysosomal dysfunction have not been fully elucidated. In this study, we investigated the role of exercise in modulating peripheral and brain 27-hydroxycholesterol concentrations through a 12-week treadmill aerobic exercise intervention in mice. We found that aerobic exercise improved the function of cholesterol-metabolizing enzymes and restored lysosomal function. Exercise regulates 27-hydroxycholesterol levels through the liver-brain axis and reduces damage to neuronal and synaptic functions, providing new ideas for intervention in neurodegenerative diseases such as Alzheimer's disease. Alzheimer's disease cholesterol lysosome 27-hydroxycholesterol Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1. Introduction Disturbed cholesterol metabolism is a typical pathological feature of Alzheimer’s disease (AD) [ 1 ] . Cholesterol is an important component of neuronal cell membranes and plays an important role in maintaining neural plasticity and synaptic transmission in the brain [ 2 ] . Peripheral cholesterol cannot enter the brain via the blood-brain barrier (BBB), so as the nervous system matures, cholesterol in the brain is mainly synthesized endogenously. The ability to synthesize cholesterol in the brain decreases with age and is particularly severe in AD patients [ 3 ] ; cholesterol levels in the hippocampal region are significantly reduced in patients with AD [ 4 ] . Many studies have also shown that cholesterol is deposited in neuronal lysosomes in the brains of patients with AD, which prevents lysosomes from fulfilling their physiological function and leads to neuronal damage and premature apoptosis [ 5 ] . This process is considered a major cause of cognitive impairment in patients with AD. Evidence suggests that lifestyle-related risk factors play key roles in the development of AD [ 6 ] . An important risk factor for AD is a high-cholesterol diet [ 7 ] . Epidemiological studies have shown that higher dietary saturated fat intake increases the risk of AD by 39% [ 8 ] . Feeding rabbits for 7 months with food containing 1% cholesterol caused severe hypercholesterolemia and led to cholesterol accumulation in neurons, promoting the formation of Aβ plaques associated with AD [ 9 ] . This suggests that high cholesterol and high saturated fat diets are not only known risk factors for AD, but also play an important role in contributing to its pathogenesis. Recent studies have shown that the pathology of AD as affected by high-cholesterol diets is associated with 27-hydroxycholesterol (27-OHC) [ 10 ] . Cholesterol is converted to 24-hydroxycholesterol (24-OHC) by the neuron-specific converting enzyme CYP46A1, which is the main pathway through which the brain metabolizes excess cholesterol. 24-OHC can cross the BBB from the brain into peripheral circulation, driven by a concentration gradient [ 11 , 12 ] . Another small portion of cholesterol is converted to 27-OHC by the CYP27A1 enzyme expressed in the brain, and 27-OHC is further catalyzed by CYP7B1 to form 7α-hydroxy-3-oxo-4-cholestanic acid (7-HOCA), which can traverse the BBB, enter the peripheral circulation, and be excreted [ 13 ] . Under non-pathological conditions, brain 27-OHC levels are usually low because of its highly efficient metabolism [ 14 ] . However, high levels of 27-OHC have been observed in the brain and cerebrospinal fluid of patients with both early-onset and sporadic AD [ 15 , 16 ] . High concentrations of 27-OHC in the brain are thought to play important roles in AD pathogenesis [ 17 , 18 ] . For example, high levels of 27-OHC in the brain significantly reduce neuronal spine density and PSD95 synthesis, leading to hippocampal synaptic dysfunction [ 19 ] . Recent studies have shown that an increase in plasma 27-OHC caused by a high-cholesterol diet induces abnormal lysosomal function in Sprague-Dawley (SD) rat neuronal cells, leading to Aβ formation and accumulation [ 20 ] . Abnormal cholesterol metabolism is not only an important part of the pathogenesis of AD but also significantly affects lysosomal function. As a membrane-bound organelle present in all eukaryotic cells, lysosomes have an acidic lumen and are restricted by a single lipid bilayer membrane. They are mainly involved in degradation, repair of plasma membrane damage, secretion, signaling, and energy metabolism [ 21 ] . Under normal physiological conditions, lysosomes can effectively degrade Aβ and mitochondria awaiting degradation in autophagosomes, but in AD, Aβ deposition increases, neurotoxicity increases, and the accumulation of Aβ in lysosomes destabilizes the system, resulting in lysosomal enzyme leakage and reducing the activity of degradative enzymes within lysosomes [ 22 ] . Substrates requiring lysosomal degradation accumulate in large quantities in the lysosome, ultimately leading to cellular dysfunction and cell death [ 23 , 24 ] . Indeed, reduced lysosomal activity and impaired function in patients with AD and in APP/PS1 mice are recognized as typical pathological features of AD [ 25 ] . Song et al. found that increasing the level of Cathepsin D, a lysosomal-associated protein, in the brains of 3× Tg-AD mice reduced Aβ deposition, suggesting that enhancing lysosomal function can improve AD [ 26 ] . Research has shown that cholesterol plays an important role in AD pathology, and its abnormal accumulation not only exacerbates neuronal damage but also further promotes Aβ deposition [ 27 ] . In AD, cholesterol accumulation in lysosomes impairs their function and is accompanied by elevated levels of 27-OHC, and this dual accumulation of cholesterol and 27-OHC leads to structural and functional disorders of lysosomes [ 28 ] . With regard to the cause of the increased 27-OHC concentration, available studies indicate that a possible cause of the increased 27-OHC concentration in the AD brain is a decrease in CYP7B1 protease caused by a decrease in the number of neurons in the brain [ 29 ] . In contrast, CYP27A1 is expressed not only in neurons but also in astrocytes and oligodendrocytes, and increased levels of CYP27A1 protease have been found in the brains of patients with AD, which ultimately leads to an increased proportion of cholesterol metabolized to 27-OHC in the brain [ 30 ] . In fact, most 27-OHC is not produced in the brain, but in the liver, and 27-OHC is the cholesterol metabolite with the highest concentration in the plasma and lowest concentration in the brain [ 17 ] . Elevated 27-OHC concentrations in the brain are attributed to BBB and blood-cerebrospinal fluid barrier dysfunction [ 31 ] . Hypercholesterolemia and a high-fat diet are usually accompanied by an increase in 27-OHC, and excess 27-OHC released from circulation into the brain decreases spatial memory [ 32 , 33 ] . Exercise interventions as non-pharmacological treatments have been shown to play a role in alleviating neurodegenerative diseases by improving metabolism, enhancing neuroplasticity, and modulating inflammation, among other mechanisms. However, the role of 27-OHC in the improvement of AD by exercise is not well understood; therefore, the aim of this study was to investigate the role of aerobic exercise in modulating 27-OHC concentrations through the liver-brain axis. Our results suggest that aerobic exercise modulates 27-OHC levels in the periphery and brain, restores damaged synaptic and lysosomal functions in the brain, reduces apoptosis, and enhances memory capacity. 2. Results 2.1 Aerobic exercise improves learning memory in APP/PS1 mice fed a high-cholesterol diet We assessed the effects of aerobic exercise on learning and memory in mice fed a high-cholesterol diet, using the Morris water maze (MWM) test. As shown in Figure 1A, aerobic exercise shortened the latency of the learning phase in all four groups. At five days, the latency of mice in the ADC group was significantly higher than that in the WTC group, and the avoidance latency of mice in the ADC group was significantly increased on day 5 (p < 0.01) compared with that in the WTC group. As shown in Figure 1B, the mice in the ADC group had fewer platform crossings during the testing phase than those in the WTC group (p < 0.01). As shown in Figure 1C, mice in the ADC-HFD group swam a shorter total distance in the test phase than those in the ADC group (p < 0.05). Figure 1D shows the spatially exploratory swimming trajectories of each group of mice during the test phase. These results suggest that aerobic exercise exerts a beneficial effect on the impaired spatial memory capacity of AD mice fed with a high-cholesterol diet. 2.2 Aerobic exercise attenuates body weight and liver weight in high-cholesterol diet-fed APP/PS1 mice Weight gain is often accompanied by an increased risk of obesity, which has been shown to be strongly associated with AD [34] . Obesity not only causes insulin resistance and metabolic disorders but also exacerbates the pathological process of AD by activating the inflammatory response in the brain [35] . Therefore, weight control and prevention of obesity are important in AD. To investigate the effects of aerobic exercise on the body and liver weights of AD mice fed a high-cholesterol diet, we compared changes in body and liver weights in the four groups of mice before and after the experiments. As shown in Figure 2A, compared with the pre-experimental values, all four groups of mice had gained weight at the end of the experiment, and aerobic exercise significantly reduced the body weight of mice in the ADE-HFD group compared with that of mice in the ADC-HFD group (p<0.01). As shown in Figure 2B, the high-cholesterol diet significantly increased liver weight in the ADC-HFD group compared to the ADC group (p<0.01), while aerobic exercise significantly reduced liver weight in mice in the ADE-HFD group compared to the ADC-HFD group (p<0.001). As shown in Figure 2C, we found that the liver weight ratios of the WTC and ADC groups did not show significant differences. The percentage of liver weight was significantly higher in the ADC-HFD group than in the ADC group (p<0.01), and aerobic exercise significantly reduced the percentage of liver weight in mice in the ADE-HFD group compared to mice in the ADC-HFD group (p<0.05). These results suggest that aerobic exercise can reduce weight gain and liver weight gain in mice fed a high-cholesterol diet, which may reduce the risk of obesity. 2.3 Aerobic exercise reduces serum cholesterol levels in high-cholesterol diet-fed APP/PS1 mice Cholesterol homeostasis is essential for normal cellular and systemic functions. Cholesterol is involved in the maintenance of cell membrane stability, synthesis of steroid hormones, vitamin D, and bile acids, and supports nerve signaling [36] . Recent studies have shown that abnormal cholesterol levels are strongly associated with the onset and progression of AD [37] . High cholesterol levels not only increase the burden on the liver but also intensify the inflammatory response and mitochondrial damage and promote the production of β-amyloid, further exacerbating the pathology of AD [38, 39] . To explore the effects of aerobic exercise on cholesterol metabolism in AD mice, we measured serum cholesterol levels. As shown in Figure 3A, there was no significant difference in serum cholesterol levels between the WTC and ADC groups; serum cholesterol levels were significantly higher in the ADC-HFD group than in the ADC group (p<0.001) and significantly lower in the ADE-HFD group than in the ADC-HFD group (p<0.05). As shown in Figure 3B and C, serum high-density lipoprotein cholesterol (HDL-C) tended to increase in the ADC-HFD group compared to the ADC group, but the difference was not significant. This may be because high-cholesterol diets usually lead to dyslipidemia, and the body may maintain lipid homeostasis by temporarily increasing HDL-C levels through compensatory mechanisms to help remove excess cholesterol. We also used common ratio measures of lipid levels to assess the effects of exercise on lipid metabolism. As shown in Figure 3D and E, the high-cholesterol diet significantly reduced the HDL-C/total cholesterol (TC) ratio (p<0.01) to the low-density lipoprotein cholesterol (LDL-C)/TC ratio (p<0.01) in the ADC-HFD group. These results indicate that a high-cholesterol diet increased serum cholesterol levels in AD mice, whereas aerobic exercise significantly decreased serum cholesterol levels in AD mice fed a high-cholesterol diet. 2.4 Aerobic exercise ameliorates liver tissue injury and hepatic 27-OHC synthesis in high-cholesterol diet-fed APP/PS1 mice As a major organ in cholesterol metabolism, the liver plays a key role in maintaining systemic lipid homeostasis, and some studies have shown that liver dysfunction is strongly associated with cognitive decline in AD [40] . Some risk genes associated with AD, such as ABCA7 and APOE , are highly expressed in the liver, suggesting that the liver may play a role in AD pathogenesis [41] . Inflammation and oxidative stress in the liver have also been implicated in the progression of AD [42] . Especially under high-fat dietary conditions, the liver is prone to fat accumulation and tissue damage, which in turn leads to metabolic disorders that may exacerbate the pathological process of AD and further promote the development of neurodegenerative lesions [43] . Thus, liver dysfunction plays an important role in AD progression. We performed morphological observations on the liver tissues of mice, and hematoxylin and eosin (HE) staining showed that hepatocytes in the WTC group were clearly demarcated and arranged, of uniform size, radiating from the central vein, with intact walls of the central veins of the lobules. There were rounded and well-defined nuclei located in the center of the cells, with abundant cytoplasm, and normal morphology of the hepatocytes, with no steatosis and inflammatory cell infiltration (Figure 4). The structure of the liver lobules of mice in the ADC group was clear, and the arrangement of hepatocytes was more regular and close to normal. Mice in the ADC-HFD group showed obvious liver pathology, with a blurred liver lobule structure, breaks in the wall of the central venous canaliculi of the lobules, disappearance of the nuclei or indistinct margins, many white neutral lipids between the cytoplasm, and the presence of inflammatory cell infiltration (black arrows in Figure 4A). The liver lesions of mice in the ADE-HFD group were significantly improved. The lobular structure and hepatocytes in the liver tissue were more neatly arranged, and the inflammatory infiltration was alleviated. The cytoplasm was well-preserved, the nuclei were prominent and their morphology was normal. The appearance of the liver in the ADE-HFD group was closer to that of the WTC group. This suggests that aerobic exercise ameliorates liver injury in mice fed with a high-cholesterol diet. Previous studies have shown that 27-OHC, a key intermediate in cholesterol metabolism catalyzed by CYP27A1, is not only widespread in peripheral tissues but is also able to enter the brain through the BBB and plays an important role in the onset and development of AD [12] . It has been shown that CYP7A1 expression decreases with age [44] . Therefore, we assayed the hepatic CYP27A1 and CYP7A1 protein levels and serum 27-OHC concentrations in mice. As shown in Figure 4B,C, there was no significant difference between the protein content of CYP27A1 and serum 27-OHC concentration in the livers of mice in the WTC and ADC groups. The hepatic CYP27A1 protein content (p<0.01) as well as serum 27-OHC concentration (p<0.001) were significantly increased in the livers of mice in the ADC-HFD group compared with the ADC group. Compared with mice in the ADC-HFD group, mice in the ADE-HFD group showed a significant decrease in hepatic CYP27A1 protein content (p<0.05), and serum 27-OHC concentration also showed a decreasing trend. As shown in Figure 4D, the hepatic CYP7A1 protein content of mice in the ADC group was significantly lower than that in the WTC group (p<0.05), and the hepatic CYP7A1 protein content of mice in the ADE-HFD group tended to increase but was not significantly different from that in mice in the ADC-HFD group. These results suggest that a high-cholesterol diet significantly increases the CYP27A1 protein content and serum 27-OHC concentration in the livers of AD model mice. 27-OHC, a key product of cholesterol metabolism, can act on the brain through the liver-brain axis, affecting neuronal function and cognition [45] . When cholesterol metabolism is disturbed, elevated 27-OHC concentrations exacerbate neurodegenerative changes in AD [29] . Our results show that aerobic exercise can affect the metabolism of 27-OHC by modulating the expression of CYP27A1 and CYP7A1 in the liver, which may exert a protective effect in AD mice fed a high-cholesterol diet. 2.5 Aerobic exercise ameliorates blood-brain barrier damage and brain 27-OHC turnover in high cholesterol diet-fed APP/PS1 mice The BBB is a highly specialized biological barrier formed the tight junctions, basement membranes, and glia-less cell protrusions of cerebral microvascular endothelial cells. The main function of the BBB is to maintain the stability of the neural environment and the constancy of the internal microenvironment to ensure the normal function and activity of cerebral neurons [46] . AD patients often exhibit BBB damage, and abnormal deposition of Aβ may damage the BBB and exacerbate neurodegenerative processes. When BBB permeability is increased, harmful molecules that are usually blocked, such as inflammatory mediators and toxic substances, are able to enter the brain through the BBB, further exacerbating neuronal damage [47] . Therefore, we tested BBB barrier-associated proteins. As shown in Figure 5A–C, compared with mice in the WTC group, mice in the ADC group had significantly lower levels of Claudin-5 (p<0.01) and Occludin (p<0.05) proteins in the brain, and there was a trend (although not significant) toward lower levels of ZO-1 protein. Compared with mice in the ADC group, the high cholesterol diet significantly reduced Occludin (p<0.05) and ZO-1 (p<0.05) protein levels in the brains of ADC-HFD mice, with a trend toward lower (although not significant) levels in Claudin-5. Aerobic exercise significantly increased the protein content of Claudin-5 (p<0.01) and ZO-1 (p<0.001) in the brains of mice in the ADC-HFD group compared with mice in the ADC-HFD group, and there was a tendency toward an increase in Occludin, which was not significant. This suggests that aerobic exercise has a protective effect on the BBB in AD mice and improves BBB function. In AD, the overproduction of peripheral 27-OHC leads to an influx of 27-OHC into the brain through a compromised BBB, and excess 27-OHC in the brain can lead to cytotoxicity, promoting apoptosis [48] . The liver serves as a major source of 27-OHC production and transports 27-OHC to the brain via the liver-brain axis. Elevated plasma 27-OHC levels are associated with mild cognitive impairment in older adults, further affecting neurological functioning [18] . Therefore, we assayed the effects of exercise on 27-OHC-related metabolic enzyme levels to determine 27-OHC turnover. First, the concentration of 27-OHC in the mouse brain was detected. As shown in Figure 5D, the concentration of 27-OHC in the brains of mice in the ADC group was significantly higher than that in the brains of mice in the ADC-HFD group (p<0.05). The concentration of 27-OHC was significantly higher in the brains of mice in the ADC-HFD group fed a high-cholesterol diet than in mice in the ADC group (p<0.001). Aerobic exercise significantly reduced the concentration of 27-OHC in the brains of mice in the ADE-HFD group compared to mice in the ADC-HFD group (p<0.01). Next, we measured the levels of CYP27A1, which is widely expressed in the brain, as well as CYP7B1, which converts 27-OHC to 7α-hydroxy-3-oxo-4 cholesteric acid (7-OH-4-C), which flows through the BBB to the somatic circulation [13] . As shown in Figure 5E, CYP27A1 protein levels were significantly higher in the brains of mice in the ADC group compared to mice in the WTC group (p<0.01), and there was no significant difference in the CYP27A1 protein content in the brains of the ADC group compared to the ADC-HFD group. Aerobic exercise significantly reduced CYP27A1 protein levels in the brains of mice in the ADE-HFD group compared with ADC-HFD mice (p<0.05). As shown in Figure 5F, the amount of CYP7B1 protein in the brains of ADC mice was significantly reduced compared to mice in the WTC group (p<0.01), while aerobic exercise increased CYP7B1 protein levels in the brains of mice in the ADE-HFD group compared to mice in the ADC-HFD group, but the difference was not significant. These results suggest that aerobic exercise may help alleviate AD by ameliorating BBB damage, decreasing the concentration of 27-OHC, and regulating CYP27A1 protein levels to reduce the negative effects of 27-OHC on the brain. 2.6 Aerobic exercise improves brain lysosomal morphology and related protein expression in APP/PS1 mice Lysosomes are important intracellular organelles responsible for intracellular signaling, energy metabolism, inflammatory pathways, degradation of intracellular waste products, and recycling of damaged cellular components [49] . In AD, lysosomal function is impaired, leading to abnormal accumulation of Aβ and other proteins that exacerbate the AD process [50] . Studies have shown that high cholesterol diets further worsen lysosomal dysfunction and promote the progression of AD [5] . Therefore, we examined lysosomal morphology in the mouse brain and labeled brain sections with anti-cathepsin D (CTSD) antibody to detect lysosomal volume. As shown in Figure 6A, compared with mice in the WTC group, mice in the ADC group had increased lysosomal volumes in the CA1 and CA3 regions of the hippocampus in the brain, and the CA3 region was particularly severe. Compared with mice in the ADC group, mice in the ADC-HFD group had increased lysosomal volumes in the CA1 and CA3 regions of the brain, and the CA3 region was particularly severe. The lysosomal volumes of CA1 and CA3 regions in the brain of mice in the ADE-HFD group were significantly reduced compared with those of mice in the ADC-HFD group. These results suggest that after aerobic exercise intervention, the lysosomal volumes of the CA1 and CA3 regions in the brains of mice in the ADE-HFD group were significantly reduced, indicating that aerobic exercise has an ameliorative effect on lysosomal morphological abnormalities induced by a high-cholesterol diet. Diets high in cholesterol not only affect the volume of lysosomes in the brain but may also alter lysosomal function, thereby exacerbating neuronal damage. Abnormal lysosomal function in AD may lead to the accumulation of intracellular waste products and exacerbate neuronal damage [51] . In rabbits fed a high-cholesterol diet, increased accumulation of cholesterol in lysosomes was accompanied by elevated levels of 27-OHC in the brain. This accumulation led to lysosomal structural and functional disorganization, which in turn reduced the activity of the lysosomal protease CTSD and ultimately triggered lysosomal dysfunction in neurons [52] . CTSD, on the other hand, plays a role in protein hydrolysis in lysosomes, which is especially important in the process of cellular autophagy. CTSD is also involved in the degradation of APP, which plays a protective role in preventing the accumulation of Aβ [53] . Moreover, increasing the concentration of 27-OHC in the plasma of SD rats causes abnormal lysosomal function in neuronal cells [20] . This suggests that elevated peripheral 27-OHC levels cause neuronal damage by altering lysosomal function. The lysosome-associated membrane proteins LAMP1, LAMP2, LIMP2, and ATPase H+ transporting V1 subunit H (Atp6v1h) are lysosomal protective and exert neuroprotective effects by enhancing lysosomal function and alleviating neuronal damage [54] . Therefore, we assessed the effects of aerobic exercise on lysosomal function in the brains of mice with AD fed a high-cholesterol diet by examining the expression of key lysosome-related proteins and mRNAs. Lysosomal function in the mouse brain was assessed by examining the CTSD levels. As shown in Figure 6B, the level of the 42 kDa (single-stranded) mature form of CTSD in the brains of mice in the ADC group showed a decreasing trend compared to mice in the WTC group, whereas the mature form of CTSD was significantly higher in the brains of mice in the ADC-HFD group than in mice in the ADC group (p<0.05). Mice in the ADE-HFD group showed a decreasing trend in the mature form of CTSD in the brain compared to mice in the ADC-HFD group. Re-examination of lysosome-associated protein and mRNA expression in mouse brain, as shown in Figure 6C–F, gene expression of LAMP1 (p<0.05), LIMP2 (p<0.05) and Atp6v1h (p<0.01) was significantly reduced in the brains of mice in the ADC group compared with the WTC group. LAMP2 expression was significantly lower in the brains of mice in the ADC-HFD group compared to mice in the ADC group (p<0.05). Aerobic exercise significantly upregulated gene expression of LAMP1 (P<0.01), LAMP2 (p<0.01), and Atp6v1h (p<0.05) in mice in the ADE-HFD group compared with mice in the ADC-HFD group. These results suggest that aerobic exercise may alleviate lysosomal dysfunction caused by a high-cholesterol diet to a certain extent by improving the morphology of lysosomes in the brain, significantly reducing the increase in lysosomal volume induced by the high-cholesterol diet, and thus improving the expression of lysosomal-associated proteins. 2.7 Aerobic exercise promotes brain synaptic protein expression in APP/PS1 mice In the early stages of AD, cognitive impairment is strongly associated with reduced synaptic density in the cortical and hippocampal regions [55] . Accumulation of Aβ plaques in the AD brain interferes with interneuronal communication at the synapses, leading to neurodegeneration, which in turn impedes long-term potentiation (LTP), an important mechanism for learning and memory formation [56, 57] . It has been shown that toxicity from excess 27-OHC in the body decreases spine density, dendritic arborization, and PSD-95 synthesis [58] . Postsynaptic terminal density plays a crucial role in memory formation and retention, and postsynaptic protein-95 (PSD-95), a key protein underpinning the postsynaptic locus, has been suggested to be a relevant metric in assessing the pathogenesis of AD. It has been shown that PSD-95 protein expression is significantly decreased in AD mice compared to control mice [59] . Synapsin (SYN) is a presynaptic protein involved in the regulation of vesicle storage, mobilization, and release at nerve endings [60] and synergizes with PSD-95 to ensure precise neural signaling [61] . To address these issues, we examined the levels of the synapse-associated proteins PSD-95 and SYN in the mouse brain and analyzed the expression of the synapse-associated genes GAP43, Arc, SNAP25, and MAP2. As shown in Figure 7A and B, PSD-95 (P<0.05) and SYN (p<0.05) protein contents were significantly downregulated in the brains of mice in the ADC group compared with the WTC group. SYN protein content (p<0.01) was significantly downregulated in the brains of mice in the ADC-HFD group compared to ADC mice, whereas the protein content of PSD-95 (p<0.05) and SYN (p<0.05) was significantly increased in the brains of mice in the ADE-HFD group compared with mice in the ADC-HFD group. As shown in Figure 7C–F, Arc (p<0.01) and MAP2 (p<0.01) gene expression was significantly downregulated in the brains of mice in the ADC group compared with mice in the WTC group. Compared with the ADC group, the high-cholesterol diet significantly downregulated the expression level of GAP43 gene in the brains of mice in the ADC-HFD group (p<0.01), and there was a tendency to downregulate the expression of SNAP25 gene, but there was no significant difference. Aerobic exercise significantly upregulated GAP43 (p<0.05), SNAP25 (p<0.01), and MAP2 (p<0.05) gene expression levels in the brains of mice in the ADE-HFD group compared with mice in the ADC-HFD group. These results suggest that aerobic exercise can enhance learning and memory by improving the expression of synaptic proteins and genes and slowing synaptic damage. 2. 8 Aerobic Exercise Improves Brain Neuron Morphology and Increases Density to Reduce Apoptosis in APP/PS1 Mice on a High-Cholesterol Diet Memory and cognitive function decline progressively with age, and the risk of neuronal damage increases in patients with AD. Changes in neuronal cell morphology, such as reduced dendritic spine density and neuronal structural degeneration, are considered important markers of AD disease progression [62] . We therefore examined hippocampal neurons. As shown in Figure 8A, the results of Nissl staining showed that the neurons in the CA1 area of the hippocampus of mice in the WTC group were morphologically and structurally intact, with well-defined nuclei, uniformly distributed, densely arranged, and rich in Nysted bodies. In the CA1 area of the hippocampus of mice in the ADC and ADE-HFD groups, the neuronal structure was unclear with blurred outlines, and the arrangement was scattered and sparse. The number of neurons in the CA1 area of the hippocampus of mice in the ADC-HFD group was reduced, the cytosolic membrane was ruptured, disintegration was unclear, and the nidus appeared to be dissolved, reduced in number, and lightly colored. Overall, neuronal morphological and structural pathological changes in the CA1 region of the hippocampus improved in the ADE-HFD group compared with those in the ADC-HFD group. These results suggest that aerobic exercise ameliorates the pathological changes in neuronal morphology and structure in the hippocampal CA1 region of mice with AD caused by high-cholesterol diets. In addition to observing changes in neuronal morphology, we analyzed the distribution of neuronal density in the CA1 region of the hippocampus. As shown in Figure 8B, the neuronal density ratio in the CA1 region of the brain of mice in the ADC group was significantly reduced compared with that of mice in the WTC group (p<0.05). Compared with mice in the ADC group, the neuronal density ratio in the CA1 region of the brain of mice in the ADC-HFD group tended to be downregulated but was not significantly different. Compared with the ADC-HFD group, the neuronal density ratio in the CA1 region of the brain of mice in the ADE-HFD group showed an upward trend, and although the difference was not significant. Nevertheless, the results suggest that aerobic exercise may have a protective effect on improving neuronal survival. An important feature of AD is the accumulation of Aβ, a process that leads to increased neuronal apoptosis [63] . The ratio of the expression of anti-apoptotic protein B-cell lymphoma-2 (Bcl-2) to pro-apoptotic protein Bcl-2-associated X protein (Bax) is crucial in the regulation of apoptosis, and studies have shown that the downregulation of Bcl-2 and upregulation of Bax in the brain are closely related to neuronal apoptosis. This imbalance may be an important mechanism underlying Aβ-induced neurodegenerative changes [64] . Further studies showed that Bax knockout (KO) mice showed a downregulation of Bcl-2 expression after injection of Aβ oligomers in the brain [65] . Bax expression was significantly increased and Bcl-2 was significantly decreased in 13-17 week human fetal neurons treated with Aβ [66] . These results suggest that an imbalance in the Bcl-2/Bax ratio plays a key role in neuronal apoptosis in AD. Therefore, we examined the levels of Bcl-2 and Bax and their ratio in the brain to assess the effects of aerobic exercise on neuronal apoptosis. As shown in Figure 9A, there was no significant difference in Bcl-2 protein expression in the brains of the four groups of mice. However, there was a tendency toward a decrease in Bcl-2 protein expression in the brains of mice in the ADC group compared to mice in the WTC group. As shown in Figure 9B, compared with the WTC mice, there was a trend of increased Bax protein content in the brains of the ADC mice, although there was no significant difference. Bax protein content in the brains of mice in the ADE-HFD group was significantly decreased compared to that in the ADC-HFD group (p<0.05). As shown in Figure 9C, the Bcl-2/Bax protein ratio was significantly lower in the brains of mice in the ADC group than in the WTC group (p<0.05). The Bcl-2/Bax protein ratio in the brains of mice in the ADC and ADC-HFD groups did not show significant differences; however, the Bcl-2/Bax protein ratio was significantly higher in the brains of mice in the ADE-HFD group compared to mice in the ADC-HFD group (p<0.05). In conclusion, the above results suggest that aerobic exercise ameliorates the imbalance between Bcl-2 and Bax protein expression and may protect against neuronal apoptosis in AD mice fed a high-cholesterol diet by increasing the Bcl-2/Bax ratio. 3. Discussion Defective lysosomal function in nerve cells is associated with the development of neurodegenerative diseases [ 67 ] . Defective lysosomal function leads to the accumulation of cholesterol in the lysosomes of nerve cells and abnormal swelling of nerve axons, resulting in low cholesterol concentrations required for nerve cell membrane repair, axon growth, synaptic plasticity, and ultimately nerve cell death [ 23 ] . Under physiological conditions, lysosomes function normally and can rapidly degrade Aβ and mitochondria encapsulated in autophagosomes, but under AD pathological conditions, the increased neurotoxicity of excessive Aβ in lysosomes can destabilize lysosomal membranes, cause lysosomal enzyme leakage, and reduce the amount of degradative enzymes in lysosomes [ 22 ] . It has been shown that lysosomal dysfunction in AD mice is associated with 27-OHC, which is formed mainly in the liver and catalyzed by the enzyme CYP27A1. 27-OHC is initially released into the blood and is the most abundant cholesterol metabolite in the plasma [ 68 ] . The expression levels of the CYP27A1 gene in patients with AD increase with the progression of AD [ 69 ] . Significantly higher levels of 27-OHC were observed in the brains of deceased patients with AD and in a transgenic mouse model of AD [ 29 ] . Plasma 27-OHC levels are higher than average in patients with mild cognitive impairment and AD [ 18 ] . Lowering serum 27-OHC levels by managing lifestyle and vascular factors benefits cognitive function, as suggested by a randomized controlled trial [ 70 ] , but had no effect on Cyp27KO mice lacking 27-OHC [ 32 ] . Increased blood levels of 27-OHC in rats cause an increase in 27-OHC in the brain tissue, which in turn causes a decrease in spatial learning and memory and decreases the expression of HMG-CR, a key protein that mediates cholesterol synthesis and impairs cholesterol synthesis in the rat brain [ 71 , 72 ] . CYP27A1 overexpressing mice exhibit reduced glucose metabolism and memory deficits [ 73 ] . Research has shown that hypercholesterolemia and a high-fat diet are often accompanied by an increase in 27-OHC and that excess 27-OHC released from circulation into the brain decreases spatial memory [ 32 ] . The liver is the only organ capable of metabolizing cholesterol into bile acids, accounting for approximately one-third of the cholesterol excreted from the body. The enzymatic conversion of cholesterol into bile acids by CYP7A1 is the most important mechanism for removing cholesterol from the body [ 44 ] . 27-OHC reflects the degree of cholesterol saturation in the body [ 74 ] . In the present study, we found that serum cholesterol content was significantly elevated in APP/PS1 mice fed a high-cholesterol diet, that there were no significant changes in CYP7A1 in the liver, and that the elevated serum concentration of 27-OHC may be related to the elevated protein content of CYP27A1 in the liver. 27-OHC can cross the lipophilic membrane and enter the brain through the BBB [ 75 ] . Cerebrospinal fluid 27-OHC levels directly correlate with plasma 27-OHC levels [ 76 ] . A previous study showed that approximately 5 mg of 27-OHC flows into the brain daily, and if the integrity and function of the BBB are compromised, more 27-OHC enters the brain [ 75 ] . Therefore, in the present study, we examined the levels of barrier proteins in the brains of mice and found that a high-cholesterol diet exacerbated the already disrupted BBB damage in the brains of APP/PS1 mice. Subsequently, the 27-OHC content in the brains of the mice was examined and found to be significantly increased in the high-cholesterol diet-fed APP/PS1 mice, which is consistent with BBB damage in these mice. Aerobic exercise reduced the 27-OHC concentration in the brains of the high-cholesterol diet-fed APP/PS1 mice and attenuated BBB barrier protein damage in the APP/PS1 mice. Because cholesterol in the peripheral circulation cannot enter the brain directly through the BBB, it is mainly synthesized by astrocytes and binds to ApoE to form cholesterol-ApoE complexes [ 77 ] . These cholesterol-ApoE complexes are transported into neuronal lysosomes, where cholesterol transport is accomplished by Niemann-Pick C protein (NPC). NPC1 and NPC2 are lysosome-specific cholesterol transport proteins [ 78 ] . The NPC2 protein first binds to the alkyl side chain of cholesterol and then NPC1 protein continues to bind to cholesterol, transporting it to the lysosomal membrane and ultimately to downstream organelles for utilization [ 79 ] . CTSD is an important degradative enzyme that functions within lysosomes, and its expression level is an important indicator of lysosomal function [ 80 ] . Inactivation of CTSD leads to the accumulation of free cholesterol in lysosomes in vivo [ 81 ] . Tian et al. showed that increased Aβ deposition reduces CTSD expression [ 82 ] . Atp6v1h maintains the acidic environment of lysosomes, whereas the maturation of CTSD and protein hydrolase activity depend on the acidic pH environment [ 83 ] . In this study, the volume of lysosomes and the levels of CTSD, LAMP1, LAMP2, LIMP2, and Atp6v1h were examined in the brains of mice. In general, the high-cholesterol diet depleted the already impaired lysosomal function in the brains of APP/PS1 mice, which may be related to the elevated 27-OHC concentration in the brain. After aerobic exercise, the giant lysosomes in the brains of APP/PS1 mice raised on a high-cholesterol diet decreased in size and restored impaired lysosomal function. A decline in synapse-associated proteins is associated with impaired memory in AD [ 84 ] . These proteins are widespread in pre- and postsynaptic membranes and vesicles and are thought to play an important role in the transfer, docking, and release of contents from synaptic vesicles, which have been linked to learning and memory abilities [ 85 , 86 ] . Cholesterol plays an important role in brain plasticity and synaptic function, as well as activation and synaptic transmission during LTP [ 87 ] . Research has shown that elevated levels of 27-OHC significantly reduce spine density, decrease the number of dendritic branches, inhibit PSD-95 synthesis [ 58 ] , and reduce production of Arc, the “memory protein” in the hippocampus [ 88 ] . However, Cyp27Tg mice exhibit lower levels of Arc and PSD-95 in the hippocampus [ 89 ] . In this study, the expression of synapse-associated proteins PSD-95 and SYN, as well as the related genes GAP43, Arc, SNAP25, and MAP2, was examined. The results showed that a high-cholesterol diet exacerbated the already impaired level of synapse-associated function in APP/PS1 mice, which was restored after aerobic exercise. This result is similar to the findings of Chao et al., who used 6-month-old APP/PS1 mice for a 4-month period of running table exercises [ 90 ] . Research has shown that high levels of 27-OHC are cytotoxic and can induce apoptosis [ 91 ] . Therefore, in the present study, we examined apoptotic cell death in the mouse brain using Nissl staining and detected the levels of the anti-apoptotic protein Bcl-2 and the pro-apoptotic protein Bax in mouse brain. The results showed that a high-cholesterol diet exacerbated apoptosis in the brain of APP/PS1 mice, which was restored after aerobic exercise. This study has some limitations. The current findings suggest that aerobic exercise modulates 27-OHC content to improve lysosomal function and further reveal the complex relationship between aerobic exercise, the liver-brain axis (peripheral 27-OHC and intracerebral 27-OHC metabolism), and cognitive functions. However, the synthesis of 27-OHC is influenced by its associated metabolic enzymes. In the present study, the activities of these enzymes were not determined, and only the expression levels of genes related to lysosomal function were assessed. Although the expression of lysosomal function-related proteins is affected by their upstream regulators NPC1 and NPC2, it has been reported that 27-OHC treatment leads to the downregulation of the gene and protein levels of lysosomal proteins NPC1 and NPC2 in SH-SY5Y cells [ 28 ] ; however, the mechanisms were not further explored in this study. In conclusion, our results showed that aerobic exercise could significantly reduce the level of 27-OHC in the brain tissues of APP/PS1 mice induced by a high-cholesterol diet via the liver-brain axis, while upregulating the expression of genes related to lysosomal function, reducing the synthesis of hepatic 27-OHC, and attenuating the damage of the blood-brain barrier (BBB) in mice of the ADE-HFD group. This further reduced the 27-OHC content in the brain and improved cognitive function. These results suggest that modulation of lysosomal function by aerobic exercise may play an important role in ameliorating AD pathology and emphasize the potential of modulating brain 27-OHC content as a therapeutic strategy to attenuate cognitive deficits in patients with AD. 4. Materials and methods 4.1 Experimental Animals and Groups This study used 36 male APP/PS1 double-transgenic mice and 12 male C57BL/6J mice, all aged 3 months. APP/PS1 mice were divided into the AD quiet group (ADC), AD high cholesterol-fed group (ADC-HDF), and AD high cholesterol-fed exercise group (ADE-HDF), and the C57BL/6J mice were the wild-type quiet group (WTC). C57BL/6J male wild-type and APP/PS1 male double-transgenic mice were purchased from Changsha, China (License No. SCXK (Xiang) 2019-0014). The mice were kept in 12 h light: 12 h darkness at a constant temperature of 23–25℃, and they were provided with sufficient food and water. All experimental procedures were approved by the Professional Committee of Animal Behavior of Hunan Normal University. 4.2 Movement Program The treadmill exercise program was based on previous studies of mouse exercise programs [ 92 , 93 ] . The mice in the ADE-HDF group were acclimated to the running platform with 15 min of training per day at speeds of 5, 8, and 12 m/min for 3 days. They were then trained for five days per week, with rest on Thursdays and Sundays, and each training period lasted 45 min. Formal training began in week 1 at an initial speed of 7 m/min, increased in increments of 1 m/min per week to 14 m/min in week 8, and the speed was maintained at 15 m/min from weeks 9 to 12. 4.3 Morris Water Maze Test, MWM The mice were assessed for spatial learning and memory using the Morris water maze (MWM) test as a 7-day behavioral test after 12 weeks of exercise. The methodology used was consistent with that of a previous study [ 94 ] . The mice were tested in a white circular pool kept at 25°C with a diameter of 1.5 m and height of 0.5 m. A platform with a diameter of 10 cm was placed 1.5 cm underwater. The test was divided into three parts: the adaptation phase, the localization and navigation phase, and the spatial exploration phase. During the adaptation phase, each mouse was placed in water for 10 min for acclimatization without placing the platform. The localization and navigation phases were carried out after the adaptation phase. The pool was divided into four quadrants, and each mouse was tested four times a day. The platform was placed in the pool, mice were randomly placed into four quadrants, and each mouse was given 60 s to search for the platform. If the mouse did not find for the platform within 60 s, it was guided to the platform and allowed to stay on it for 10s, and the latency of the mouse was recorded as 60 s. The platform was withdrawn during the spatial exploration phase, and each mouse was subjected to four trials per day. The mice were videorecorded, and the activity trajectories of mice swimming freely in different quadrants were observed for 60 s. Parameters such as latency, number of platform crossings, and total swimming distance were quantified and statistically analyzed from the videorecordings. 4.4 Specimen Collection At the end of the MWM experiment, mice were given free access to water and fasted for 12 h, after which they were anesthetized with isoflurane. Blood was collected from the left ventricle and centrifuged, and the supernatant was stored at -80°C for enzyme-linked immunosorbent assay (ELISA). The mice then underwent cardiac perfusion with 4% paraformaldehyde. Brain tissues and livers from 4 mice per group were dissected out and postfixed in 4% paraformaldehyde, and the brain tissues and livers from the remaining mice were rapidly frozen in liquid nitrogen and stored in at -80℃ for backup. 4.5 ELISA We quantified 27-OHC concentrations in the brain tissue and serum using an ELISA kit (SPS-20041, Saipeisenbio, Shanghai, China). The absorbance at 450 nm (OD450 nm) was measured using a spectrophotometer (Bio-Rad, Hercules, CA, USA), and the measured data were compared with a standard curve to calculate the 27-OHC concentration in the samples. 4.6 Real-Time PCR RT-PCR was performed as described previously [ 94 , 95 ] . Tissue was lysed and total RNA was extracted using TRIzol reagent (RNA extraction solution). According to the detected RNA concentration, reverse transcription was performed using the Reverse Transcription Kit (TRAN, AT311) according to the manufacturer’s instructions. The total reaction volume was 20 µL, with Anchored Oligo 1 µL, 2×TS Reaction Mix 10 µL, Enzyme Mix 1 µL, gDNA Remover 1 µL, and DEPC water 7 µL. The reaction placed into a MiniAmp PCR instrument for reverse transcription and qRT-PCR using the CFX ConnectTM Real-Time System (Bio-Rad, Singapore). GAPDH was detected as an internal reference gene, and the relative expression of the target gene mRNA was calculated using the 2-∆∆CT method, as detailed in Table 1 . Table 1 Sequences of primers for target genes. Gene Forward Primer Reverse Primer Arc GCCGCAGAAGCAGGGTGAAC TCCTCCTCAGCGTCCACATACAG MAP2 GAGAAGGAAGCCCAACACAAGGAC GTGGCGAAGGTGGCAGATTAGC SNAP25 GAGCAGGTGAGCGGCATCATC GTTGCACGTTGGTTGGCTTCATC GAP43 GGCTCAGCGGAGACAGAAAGTG GGTGGTGGCAGCAGCATCAG Atp6V1h TGTTGCTGCTCACGATGTTGGAG GCGAACCTGCTGGTCTTCATGG LIMP2 ACTGGGTGTGTTCTTTGGCTTGG GGTTCGTATGAGGGGTGCTCTTTC LAMP2 CCAACTCCAACTCCAACTCCAACC GGCACCTTCTCCTCAGTGATGTTC LAMP1 GGTTTGGGTCTGTGGAAGAGTGTG AGGTAGGCAATGAGGACGATGAGG GAPDH TGAAGGTCGGTGTGAACGGATTTG TCGCTCCTGGAAGATGGTGATGG 4.7 Immunohistochemistry Tissues were embedded in paraffin and sectioned onto slides. The sections were sequentially placed into environmentally friendly dewaxing solutions Ⅰ, Ⅱ, and Ⅲ for 10 min each, and then placed into anhydrous ethanol Ⅰ, Ⅱ, and Ⅲ for 5 min each, washed with distilled water, and dewaxed with water. Subsequently, antigen repair was performed according to the desired conditions, during which care was taken to prevent excessive evaporation of the buffer to avoid drying out the slices. After antigen repair and natural cooling, the sections were placed in phosphate-buffered saline (PBS) and washed three times for 5 min each. To block endogenous peroxidase activity, sections were incubated with 3% hydrogen peroxide for 25 minutes at room temperature in the dark, washed with PBS three times, and 3% bovine serum albumin (BSA) was added for 30 minutes. The BSA was replaced with the appropriate dilution of primary antibody. After sealing, the excess liquid was gently removed. The sections were placed flat in a wet box and incubated at 4°C overnight. The following day, the sections were removed from the wet box, placed in PBS (pH 7.4), washed three times for 5 min each on a decolorizing shaker, shaken dry, and then horseradish peroxidase-labeled (HRP)-labeled secondary antibody corresponding to the primary antibody species was added dropwise to the histochemistry circle, covering the tissues, and incubated at room temperature for 50 min. The sections were washed again with PBS (pH 7.4) three times, each time for 5 min, and after shaking dry, freshly prepared diaminobenzidine color development solution was added dropwise. Color development was observed under a microscope, and the positive signal was brownish-yellow. The reaction was terminated by rinsing the sections with tap water. Finally, the slides were sequentially dehydrated in 75% alcohol, 85% alcohol, anhydrous ethanol I, II, and n-butanol for 5 min each and then treated with xylene I for 5 min. The slides were removed and dried slightly, sealed with sealing adhesive, examined microscopically, and images were captured for analysis. 4.8 Western Blotting Analysis Western blotting was performed as previously described [ 94 ] . The collected 30 mg of brain tissue or 30 mg of liver tissue was placed in RIPA buffer with protease/phosphatase inhibitor cocktail, and the tissue was sufficiently homogenized with a cryomill. The lysed tissues were allowed to stand at 4℃ for 30 min, with gentle agitation with a pipette every 10 min, and then the tissues were centrifuged at 4℃ and 12,000 rpm for 15 min. The supernatant was extracted, and the protein concentration was determined using the BCA Protein Quantification Kit (Servicebio, G2026-200T, Wuhan, China). The protein samples were electrophoresed and transferred to a PVDF membrane, which was then placed at room temperature in 5% skimmed milk dissolved in TBST for 1.5 h. After the blocking step, the primary antibody was added and the membrane was incubated at 4°C overnight. The following day, the membrane was washed with TBST 3 times for 10 min each. The membrane was incubated in the secondary antibody with shaking at room temperature for 1.5 h and then washed thrice with TBS for 10 min each to ensure that the unbound secondary antibody was completely removed. Subsequently, the ECL luminescence kit was used to take pictures in a Tanon-5200 gel system. The PVDF membrane was immersed in the ECL developer solution, the protein was detected using the Thermo Fisher Imaging System, and the optical density was quantified using ImageJ software. The antibodies used were: ZO-1 (1:20,000, 21773-1-AP, Proteintech, Wuhan, China), Occludin (1:2000, ab216327, abcam, Cambridge, UK), Claudin 5 (1:10,000, ab131259, abcam, Cambridge, UK), Cathepsin D (1:5000, ab75852, abcam, Cambridge, UK), CYP27A1 (1:10000, ab126785, abcam, Cambridge, UK), CYP7B1 (1:8000, ab138497, abcam, Cambridge, UK), Synaptophysin (1:20000, 17785-1-AP, Proteintech, Wuhan, China), PSD-95 (1:2000, ab238135, abcam, Cambridge, UK), GAPDH (1:2000, GB15004, Servicebio, Wuhan, China), HRP-conjugated Goat Anti-Mouse IgG (1:5000, GB23301, Servicebio, Wuhan, China), and HRP-conjugated Goat Anti-Rabbit IgG (1:3000, GB23303, Servicebio, Wuhan, China). 4.9 Nissl Staining After dewaxing in water, the paraffin slices were sequentially washed with environmentally friendly dewaxing solutions I and II for 20 min each, anhydrous ethanol I and II for 5 min each, 75% alcohol for 5 min, and tap water. The slices were stained for 2–5 minutes, washed, differentiated with 0.1% glacial acetic acid, washed again to terminate the reaction, observed under a microscope to control the degree of differentiation, and then oven-dried. The sections were made transparent with xylene for 10 min, sealed with neutral gum, microscopically examined, and imaged. 4.10 HE Staining The slices were conventionally dewaxed by incubating in environmentally friendly dewaxing solution Ⅰ and Ⅱ, each for 20 min; anhydrous ethanol Ⅰ, Ⅱ, each 5 minutes; 75% alcohol for 5 minutes, and washed with tap water. Hematoxylin staining was performed for 3–5 minutes, differentiated, returned to blue, and rinsed with running water. Gradient alcohol (85%, 95%) dehydration was performed for 5 min each and eosin staining for 5 min. The slides were dehydrated with anhydrous ethanol Ⅰ, Ⅱ, and Ⅲ for 5 min each, followed by xylene Ⅰ, Ⅱ transparent for 5 min each, and finally neutral gum sealing. Microscopic examination and image acquisition was performed. 4.11 Statistical Analysis All data were analyzed using GraphPad Prism 8.0 software (GraphPad Software, San Diego, CA, USA). The effects of genotype and exercise on mice were compared by two-way ANOVA with post hoc multiple comparisons using the least significant difference method to assess the statistical significance of differences between groups and independent samples t-tests for simple effects analysis to determine the effect of this factor within groups. Data were expressed as mean and standard deviation (mean ± SD). p < 0.05 was considered statistically significant. Declarations Author contributions: Zeyu Chen and Zelin Hu were responsible for experimental design, data analysis, and article writing; Jingran Xiao, Siqing Luorong, and Fanqi Zeng were responsible for feeding the experimental animals; Xia Tao and Weijia Wu were partially responsible for the experimental data; Zhiyuan Wang, Xia Liu, and Wenfeng Liu Zhiyuan Wang, Xia Liu and Wenfeng Liu provided experimental reagents and supervised the project. All authors have read and agreed to the published version of the manuscript. Ethical Approval The animal study protocol was approved by the Biomedical Research Ethics Committee of Hunan Normal University (Ethics Section 2021 No. 198). Informed Consent Statement Not applicable. Consent to Participate and Publish This study did not involve human subjects. Data Availability Statement Data described in the manuscript are available from the corresponding author on reasonable request. Conflicts of Interest The authors declare no conflict of interest. Funding sources The present study was supported by the Hunan Provincial Natural Science Foundation (2023JJ30429), the Changsha City Natural Science Foundation (kq2202251 and kq2208177), the Key Project of Hunan Provincial Education Department (20A333 and 21B0895), and the Scientific Research Program of Hunan Provincial Department of Education (21B0895 and 23B1015),Key Projects of Scientific Research Program of Hunan Provincial Department of Education (24A0435) Authors and Affiliations First / Given Name:Zeyu Last / Family Name:Chen Work unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China First / Given Name:Zelin Last / Family Name:Hu Work unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China First / Given Name:Jingran Last / Family Name:Xiao Work unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China First / Given Name:Xia Last / Family Name:Tao Work unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China First / Given Name:Fanqi Last / Family Name:Zeng Work unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China First / Given Name:Siqing Last / Family Name:Luorong Work unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China First / Given Name:Weijia Last / Family Name:Wu Work unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China First / Given Name:Zhiyuan Last / Family Name:Wang Work unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China First / Given Name:Xia Last / Family Name:Liu Work unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China First / Given Name:Wenfeng Last / Family Name:Liu Work unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China References Xue-Shan Z, Juan P, Qi W, et al. Imbalanced cholesterol metabolism in Alzheimer's disease. Clin Chim Acta, 2016, 456: 107-114 Zhang J and Liu Q. Cholesterol metabolism and homeostasis in the brain. Protein Cell, 2015, 6(4): 254-64 Ferris HA, Perry RJ, Moreira GV, et al. Loss of astrocyte cholesterol synthesis disrupts neuronal function and alters whole-body metabolism. Proc Natl Acad Sci U S A, 2017, 114(5): 1189-1194 Feringa FM and van der Kant R. Cholesterol and Alzheimer's Disease; From Risk Genes to Pathological Effects. Front Aging Neurosci, 2021, 13: 690372 Roca-Agujetas V, Barbero-Camps E, de Dios C, et al. Cholesterol alters mitophagy by impairing optineurin recruitment and lysosomal clearance in Alzheimer's disease. Mol Neurodegener, 2021, 16(1): 15 Mancini G, Dias C, Lourenco CF, et al. A High Fat/Cholesterol Diet Recapitulates Some Alzheimer's Disease-Like Features in Mice: Focus on Hippocampal Mitochondrial Dysfunction. J Alzheimers Dis, 2021, 82(4): 1619-1633 Barron AM, Rosario ER, Elteriefi R, et al. Sex-specific effects of high fat diet on indices of metabolic syndrome in 3xTg-AD mice: implications for Alzheimer's disease. PLoS One, 2013, 8(10): e78554 Ruan Y, Tang J, Guo X, et al. Dietary Fat Intake and Risk of Alzheimer's Disease and Dementia: A Meta-Analysis of Cohort Studies. Curr Alzheimer Res, 2018, 15(9): 869-876 Ghribi O, Larsen B, Schrag M, et al. High cholesterol content in neurons increases BACE, beta-amyloid, and phosphorylated tau levels in rabbit hippocampus. Exp Neurol, 2006, 200(2): 460-7 Wu M, Zhai Y, Liang X, et al. Connecting the Dots Between Hypercholesterolemia and Alzheimer's Disease: A Potential Mechanism Based on 27-Hydroxycholesterol. Front Neurosci, 2022, 16: 842814 Lutjohann D, Breuer O, Ahlborg G, et al. Cholesterol homeostasis in human brain: evidence for an age-dependent flux of 24S-hydroxycholesterol from the brain into the circulation. Proc Natl Acad Sci U S A, 1996, 93(18): 9799-804 Bjorkhem I. Crossing the barrier: oxysterols as cholesterol transporters and metabolic modulators in the brain. J Intern Med, 2006, 260(6): 493-508 Meaney S, Heverin M, Panzenboeck U, et al. Novel route for elimination of brain oxysterols across the blood-brain barrier: conversion into 7alpha-hydroxy-3-oxo-4-cholestenoic acid. J Lipid Res, 2007, 48(4): 944-51 Brown J, 3rd, Theisler C, Silberman S, et al. Differential expression of cholesterol hydroxylases in Alzheimer's disease. J Biol Chem, 2004, 279(33): 34674-81 Gamba P, Guglielmotto M, Testa G, et al. Up-regulation of beta-amyloidogenesis in neuron-like human cells by both 24- and 27-hydroxycholesterol: protective effect of N-acetyl-cysteine. Aging Cell, 2014, 13(3): 561-72 Loera-Valencia R, Ismail MA, Goikolea J, et al. Hypercholesterolemia and 27-Hydroxycholesterol Increase S100A8 and RAGE Expression in the Brain: a Link Between Cholesterol, Alarmins, and Neurodegeneration. Mol Neurobiol, 2021, 58(12): 6063-6076 Mutemberezi V, Guillemot-Legris O and Muccioli GG. Oxysterols: From cholesterol metabolites to key mediators. Prog Lipid Res, 2016, 64: 152-169 Liu Q, An Y, Yu H, et al. Relationship between oxysterols and mild cognitive impairment in the elderly: a case-control study. Lipids Health Dis, 2016, 15(1): 177 Loera-Valencia R, Vazquez-Juarez E, Munoz A, et al. High levels of 27-hydroxycholesterol results in synaptic plasticity alterations in the hippocampus. Sci Rep, 2021, 11(1): 3736 Zhang X, Lv C, An Y, et al. Increased Levels of 27-Hydroxycholesterol Induced by Dietary Cholesterol in Brain Contribute to Learning and Memory Impairment in Rats. Mol Nutr Food Res, 2018, 62(3): de Duve C. The lysosome turns fifty. Nat Cell Biol, 2005, 7(9): 847-9 Ling D, Magallanes M and Salvaterra PM. Accumulation of amyloid-like Abeta1-42 in AEL (autophagy-endosomal-lysosomal) vesicles: potential implications for plaque biogenesis. ASN Neuro, 2014, 6(2): Platt FM, d'Azzo A, Davidson BL, et al. Lysosomal storage diseases. Nat Rev Dis Primers, 2018, 4(1): 27 Platt FM, Boland B and van der Spoel AC. The cell biology of disease: lysosomal storage disorders: the cellular impact of lysosomal dysfunction. J Cell Biol, 2012, 199(5): 723-34 Nilsson P and Saido TC. Dual roles for autophagy: degradation and secretion of Alzheimer's disease Abeta peptide. Bioessays, 2014, 36(6): 570-8 Song GL, Chen C, Wu QY, et al. Selenium-enriched yeast inhibited beta-amyloid production and modulated autophagy in a triple transgenic mouse model of Alzheimer's disease. Metallomics, 2018, 10(8): 1107-1115 Burns M and Duff K. Cholesterol in Alzheimer's disease and tauopathy. Ann N Y Acad Sci, 2002, 977: 367-75 Chen S, Zhou C, Yu H, et al. 27-Hydroxycholesterol Contributes to Lysosomal Membrane Permeabilization-Mediated Pyroptosis in Co-cultured SH-SY5Y Cells and C6 Cells. Front Mol Neurosci, 2019, 12: 14 Shafaati M, Marutle A, Pettersson H, et al. Marked accumulation of 27-hydroxycholesterol in the brains of Alzheimer's patients with the Swedish APP 670/671 mutation. J Lipid Res, 2011, 52(5): 1004-10 Marwarha G and Ghribi O. Does the oxysterol 27-hydroxycholesterol underlie Alzheimer's disease-Parkinson's disease overlap? Exp Gerontol, 2015, 68: 13-8 Heverin M, Meaney S, Lutjohann D, et al. Crossing the barrier: net flux of 27-hydroxycholesterol into the human brain. J Lipid Res, 2005, 46(5): 1047-52 Heverin M, Maioli S, Pham T, et al. 27-hydroxycholesterol mediates negative effects of dietary cholesterol on cognition in mice. Behav Brain Res, 2015, 278: 356-9 Dai L, Zou L, Meng L, et al. Cholesterol Metabolism in Neurodegenerative Diseases: Molecular Mechanisms and Therapeutic Targets. Mol Neurobiol, 2021, 58(5): 2183-2201 Poirier P, Giles TD, Bray GA, et al. Obesity and cardiovascular disease: pathophysiology, evaluation, and effect of weight loss: an update of the 1997 American Heart Association Scientific Statement on Obesity and Heart Disease from the Obesity Committee of the Council on Nutrition, Physical Activity, and Metabolism. Circulation, 2006, 113(6): 898-918 Guo DH, Yamamoto M, Hernandez CM, et al. Visceral adipose NLRP3 impairs cognition in obesity via IL-1R1 on CX3CR1+ cells. J Clin Invest, 2020, 130(4): 1961-1976 Luo J, Yang H and Song BL. Mechanisms and regulation of cholesterol homeostasis. Nat Rev Mol Cell Biol, 2020, 21(4): 225-245 Okada T, Ikeda K, Wakabayashi M, et al. Formation of toxic Abeta(1-40) fibrils on GM1 ganglioside-containing membranes mimicking lipid rafts: polymorphisms in Abeta(1-40) fibrils. J Mol Biol, 2008, 382(4): 1066-74 Djelti F, Braudeau J, Hudry E, et al. CYP46A1 inhibition, brain cholesterol accumulation and neurodegeneration pave the way for Alzheimer's disease. Brain, 2015, 138(Pt 8): 2383-98 Zhao YF, Wang L, Lee S, et al. Cholesterol induces mitochondrial dysfunction and apoptosis in mouse pancreatic beta-cell line MIN6 cells. Endocrine, 2010, 37(1): 76-82 Newton JL, Hollingsworth KG, Taylor R, et al. Cognitive impairment in primary biliary cirrhosis: symptom impact and potential etiology. Hepatology, 2008, 48(2): 541-9 Serrano-Pozo A, Das S and Hyman BT. APOE and Alzheimer's disease: advances in genetics, pathophysiology, and therapeutic approaches. Lancet Neurol, 2021, 20(1): 68-80 Fraile-Ramos J, Garrit A, Reig-Vilallonga J, et al. Hepatic Oxi-Inflammation and Neophobia as Potential Liver-Brain Axis Targets for Alzheimer's Disease and Aging, with Strong Sensitivity to Sex, Isolation, and Obesity. Cells, 2023, 12(11): Zhang L, Li X, Liu X, et al. High-Carbohydrate Diet Consumption Poses a More Severe Liver Cholesterol Deposition than a High-Fat and High-Calorie Diet in Mice. Int J Mol Sci, 2023, 24(19): Nunes VS, da Silva Ferreira G and Quintao ECR. Cholesterol metabolism in aging simultaneously altered in liver and nervous system. Aging (Albany NY), 2022, 14(3): 1549-1561 Yan M, Man S, Sun B, et al. Gut liver brain axis in diseases: the implications for therapeutic interventions. Signal Transduct Target Ther, 2023, 8(1): 443 Zlokovic BV. Neurovascular pathways to neurodegeneration in Alzheimer's disease and other disorders. Nat Rev Neurosci, 2011, 12(12): 723-38 Roher AE, Kuo YM, Esh C, et al. Cortical and leptomeningeal cerebrovascular amyloid and white matter pathology in Alzheimer's disease. Mol Med, 2003, 9(3-4): 112-22 Daugvilaite V, Arfelt KN, Benned-Jensen T, et al. Oxysterol-EBI2 signaling in immune regulation and viral infection. Eur J Immunol, 2014, 44(7): 1904-12 Lubke T, Lobel P and Sleat DE. Proteomics of the lysosome. Biochim Biophys Acta, 2009, 1793(4): 625-35 Lee JH, Yang DS, Goulbourne CN, et al. Faulty autolysosome acidification in Alzheimer's disease mouse models induces autophagic build-up of Abeta in neurons, yielding senile plaques. Nat Neurosci, 2022, 25(6): 688-701 Fraldi A, Klein AD, Medina DL, et al. Brain Disorders Due to Lysosomal Dysfunction. Annu Rev Neurosci, 2016, 39: 277-95 Chen X, Wagener JF, Ghribi O, et al. Role of Endolysosomes in Skeletal Muscle Pathology Observed in a Cholesterol-Fed Rabbit Model of Alzheimer's Disease. Front Aging Neurosci, 2016, 8: 129 Suire CN, Abdul-Hay SO, Sahara T, et al. Cathepsin D regulates cerebral Abeta42/40 ratios via differential degradation of Abeta42 and Abeta40. Alzheimers Res Ther, 2020, 12(1): 80 Iyaswamy A, Wang X, Krishnamoorthi S, et al. Theranostic F-SLOH mitigates Alzheimer's disease pathology involving TFEB and ameliorates cognitive functions in Alzheimer's disease models. Redox Biol, 2022, 51: 102280 Ramalho RM, Nunes AF, Dias RB, et al. Tauroursodeoxycholic acid suppresses amyloid beta-induced synaptic toxicity in vitro and in APP/PS1 mice. Neurobiol Aging, 2013, 34(2): 551-61 Shankar GM, Li S, Mehta TH, et al. Amyloid-beta protein dimers isolated directly from Alzheimer's brains impair synaptic plasticity and memory. Nat Med, 2008, 14(8): 837-42 Qu L, Xu S, Lan Z, et al. Apolipoprotein E in Alzheimer's Disease: Focus on Synaptic Function and Therapeutic Strategy. Mol Neurobiol, 2025, 62(3): 3040-3052 Staurenghi E, Cerrato V, Gamba P, et al. Oxysterols present in Alzheimer's disease brain induce synaptotoxicity by activating astrocytes: A major role for lipocalin-2. Redox Biol, 2021, 39: 101837 Shao CY, Mirra SS, Sait HB, et al. Postsynaptic degeneration as revealed by PSD-95 reduction occurs after advanced Abeta and tau pathology in transgenic mouse models of Alzheimer's disease. Acta Neuropathol, 2011, 122(3): 285-92 Shupliakov O, Haucke V and Pechstein A. How synapsin I may cluster synaptic vesicles. Semin Cell Dev Biol, 2011, 22(4): 393-9 Ansari MA, Rao MS and Al-Jarallah A. Insights into early pathogenesis of sporadic Alzheimer's disease: role of oxidative stress and loss of synaptic proteins. Front Neurosci, 2023, 17: 1273626 Reddy PH, Yin X, Manczak M, et al. Mutant APP and amyloid beta-induced defective autophagy, mitophagy, mitochondrial structural and functional changes and synaptic damage in hippocampal neurons from Alzheimer's disease. Hum Mol Genet, 2018, 27(14): 2502-2516 Murakami K, Irie K, Morimoto A, et al. Synthesis, aggregation, neurotoxicity, and secondary structure of various A beta 1-42 mutants of familial Alzheimer's disease at positions 21-23. Biochem Biophys Res Commun, 2002, 294(1): 5-10 Callens M, Kraskovskaya N, Derevtsova K, et al. The role of Bcl-2 proteins in modulating neuronal Ca(2+) signaling in health and in Alzheimer's disease. Biochim Biophys Acta Mol Cell Res, 2021, 1868(6): 118997 Kudo W, Lee HP, Smith MA, et al. Inhibition of Bax protects neuronal cells from oligomeric Abeta neurotoxicity. Cell Death Dis, 2012, 3(5): e309 Paradis E, Douillard H, Koutroumanis M, et al. Amyloid beta peptide of Alzheimer's disease downregulates Bcl-2 and upregulates bax expression in human neurons. J Neurosci, 1996, 16(23): 7533-9 Ginsberg SD, Alldred MJ, Counts SE, et al. Microarray analysis of hippocampal CA1 neurons implicates early endosomal dysfunction during Alzheimer's disease progression. Biol Psychiatry, 2010, 68(10): 885-93 Wang Y, Hao L, Wang T, et al. 27-Hydroxycholesterol-Induced Dysregulation of Cholesterol Metabolism Impairs Learning and Memory Ability in ApoE epsilon4 Transgenic Mice. Int J Mol Sci, 2022, 23(19): Testa G, Staurenghi E, Zerbinati C, et al. Changes in brain oxysterols at different stages of Alzheimer's disease: Their involvement in neuroinflammation. Redox Biol, 2016, 10: 24-33 Sandebring-Matton A, Goikolea J, Bjorkhem I, et al. 27-Hydroxycholesterol, cognition, and brain imaging markers in the FINGER randomized controlled trial. Alzheimers Res Ther, 2021, 13(1): 56 Zhang DD, Yu HL, Ma WW, et al. 27-Hydroxycholesterol contributes to disruptive effects on learning and memory by modulating cholesterol metabolism in the rat brain. Neuroscience, 2015, 300: 163-73 Brown MS and Goldstein JL. The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell, 1997, 89(3): 331-40 Ismail MA, Mateos L, Maioli S, et al. 27-Hydroxycholesterol impairs neuronal glucose uptake through an IRAP/GLUT4 system dysregulation. J Exp Med, 2017, 214(3): 699-717 Wang C, Shou Y, Pan J, et al. The relationship between cholesterol level and Alzheimer's disease-associated APP proteolysis/Abeta metabolism. Nutr Neurosci, 2019, 22(7): 453-463 Bjorkhem I, Cedazo-Minguez A, Leoni V, et al. Oxysterols and neurodegenerative diseases. Mol Aspects Med, 2009, 30(3): 171-9 Leoni V, Masterman T, Patel P, et al. Side chain oxidized oxysterols in cerebrospinal fluid and the integrity of blood-brain and blood-cerebrospinal fluid barriers. J Lipid Res, 2003, 44(4): 793-9 Orth M and Bellosta S. Cholesterol: its regulation and role in central nervous system disorders. Cholesterol, 2012, 2012: 292598 Vance JE and Karten B. Niemann-Pick C disease and mobilization of lysosomal cholesterol by cyclodextrin. J Lipid Res, 2014, 55(8): 1609-21 Trinh MN, Brown MS, Seemann J, et al. Lysosomal cholesterol export reconstituted from fragments of Niemann-Pick C1. Elife, 2018, 7: Hattersley KJ, Carosi JM, Hein LK, et al. PICALM regulates cathepsin D processing and lysosomal function. Biochem Biophys Res Commun, 2021, 570: 103-109 Haidar B, Kiss RS, Sarov-Blat L, et al. Cathepsin D, a lysosomal protease, regulates ABCA1-mediated lipid efflux. J Biol Chem, 2006, 281(52): 39971-81 Tian L, Zhang K, Tian ZY, et al. Decreased expression of cathepsin D in monocytes is related to the defective degradation of amyloid-beta in Alzheimer's disease. J Alzheimers Dis, 2014, 42(2): 511-20 Yasuda Y, Tsukuba T, Okamoto K, et al. The role of the cathepsin E propeptide in correct folding, maturation and sorting to the endosome. J Biochem, 2005, 138(5): 621-30 Park SW, Seo MK, McIntyre RS, et al. Effects of olanzapine and haloperidol on mTORC1 signaling, dendritic outgrowth, and synaptic proteins in rat primary hippocampal neurons under toxic conditions. Neurosci Lett, 2018, 686: 59-66 Chen X, Nelson CD, Li X, et al. PSD-95 is required to sustain the molecular organization of the postsynaptic density. J Neurosci, 2011, 31(17): 6329-38 Low P, Norlin T, Risinger C, et al. Inhibition of neurotransmitter release in the lamprey reticulospinal synapse by antibody-mediated disruption of SNAP-25 function. Eur J Cell Biol, 1999, 78(11): 787-93 Brachet A, Norwood S, Brouwers JF, et al. LTP-triggered cholesterol redistribution activates Cdc42 and drives AMPA receptor synaptic delivery. J Cell Biol, 2015, 208(6): 791-806 Mateos L, Akterin S, Gil-Bea FJ, et al. Activity-regulated cytoskeleton-associated protein in rodent brain is down-regulated by high fat diet in vivo and by 27-hydroxycholesterol in vitro. Brain Pathol, 2009, 19(1): 69-80 Merino-Serrais P, Loera-Valencia R, Rodriguez-Rodriguez P, et al. 27-Hydroxycholesterol Induces Aberrant Morphology and Synaptic Dysfunction in Hippocampal Neurons. Cereb Cortex, 2019, 29(1): 429-446 Chao F, Jiang L, Zhang Y, et al. Stereological Investigation of the Effects of Treadmill Running Exercise on the Hippocampal Neurons in Middle-Aged APP/PS1 Transgenic Mice. J Alzheimers Dis, 2018, 63(2): 689-703 Vejux A and Lizard G. Cytotoxic effects of oxysterols associated with human diseases: Induction of cell death (apoptosis and/or oncosis), oxidative and inflammatory activities, and phospholipidosis. Mol Aspects Med, 2009, 30(3): 153-70 Zhang X, He Q, Huang T, et al. Treadmill Exercise Decreases Abeta Deposition and Counteracts Cognitive Decline in APP/PS1 Mice, Possibly via Hippocampal Microglia Modifications. Front Aging Neurosci, 2019, 11: 78 Yuan S, Yang J, Jian Y, et al. Treadmill Exercise Modulates Intestinal Microbes and Suppresses LPS Displacement to Alleviate Neuroinflammation in the Brains of APP/PS1 Mice. Nutrients, 2022, 14(19): Hu Z, Yuan Y, Tong Z, et al. Aerobic Exercise Facilitates the Nuclear Translocation of SREBP2 by Activating AKT/SEC24D to Contribute Cholesterol Homeostasis for Improving Cognition in APP/PS1 Mice. Int J Mol Sci, 2023, 24(16): Yuan S, Wang Y, Yang J, et al. Treadmill exercise can regulate the redox balance in the livers of APP/PS1 mice and reduce LPS accumulation in their brains through the gut-liver-kupffer cell axis. Aging (Albany NY), 2024, 16(2): 1374-1389 Additional Declarations No competing interests reported. Supplementary Files supplementaryfile.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6361968","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":453256900,"identity":"d0951e5f-f59c-4e4b-b7d6-d0037e1bc64f","order_by":0,"name":"Zeyu Chen","email":"","orcid":"","institution":"Hunan Normal University","correspondingAuthor":false,"prefix":"","firstName":"Zeyu","middleName":"","lastName":"Chen","suffix":""},{"id":453256901,"identity":"c22fc646-c127-4eae-bb48-1545a767d22e","order_by":1,"name":"Zelin Hu","email":"","orcid":"","institution":"Hunan Normal University","correspondingAuthor":false,"prefix":"","firstName":"Zelin","middleName":"","lastName":"Hu","suffix":""},{"id":453256902,"identity":"3f5a09ba-3064-4fb8-88bf-e6ef62aea356","order_by":2,"name":"Jingran Xiao","email":"","orcid":"","institution":"Hunan Normal University","correspondingAuthor":false,"prefix":"","firstName":"Jingran","middleName":"","lastName":"Xiao","suffix":""},{"id":453256903,"identity":"b708dfab-90e3-40ff-a676-1f8cc0c72138","order_by":3,"name":"Xia Tao","email":"","orcid":"","institution":"Hunan Normal University","correspondingAuthor":false,"prefix":"","firstName":"Xia","middleName":"","lastName":"Tao","suffix":""},{"id":453256904,"identity":"04f9006a-7d13-4238-9ad0-e138131d9ec8","order_by":4,"name":"Fanqi Zeng","email":"","orcid":"","institution":"Hunan Normal University","correspondingAuthor":false,"prefix":"","firstName":"Fanqi","middleName":"","lastName":"Zeng","suffix":""},{"id":453256905,"identity":"59d542af-e544-4b1e-a116-3ff980847900","order_by":5,"name":"Siqing Luorong","email":"","orcid":"","institution":"Hunan Normal University","correspondingAuthor":false,"prefix":"","firstName":"Siqing","middleName":"","lastName":"Luorong","suffix":""},{"id":453256906,"identity":"1574c433-2389-4ba1-b842-b6bf22f16fee","order_by":6,"name":"Weijia Wu","email":"","orcid":"","institution":"Hunan Normal University","correspondingAuthor":false,"prefix":"","firstName":"Weijia","middleName":"","lastName":"Wu","suffix":""},{"id":453256907,"identity":"49ad74e1-cf48-4a1c-b99e-55f988f39552","order_by":7,"name":"Zhiyuan Wang","email":"","orcid":"","institution":"Hunan Normal University","correspondingAuthor":false,"prefix":"","firstName":"Zhiyuan","middleName":"","lastName":"Wang","suffix":""},{"id":453256908,"identity":"288e2fb3-f0ac-4bd5-9710-985b69e11622","order_by":8,"name":"Xia Liu","email":"","orcid":"","institution":"Hunan Normal University","correspondingAuthor":false,"prefix":"","firstName":"Xia","middleName":"","lastName":"Liu","suffix":""},{"id":453256909,"identity":"1e6a0f9c-d2bb-4dc6-9b7e-d2a66f3a0742","order_by":9,"name":"Wenfeng Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAu0lEQVRIiWNgGAWjYDAC5sMNBxgqDkB5bMRoYUsEajlDqhYGxjZStBgcY2w8zDvvTuJ26R4Dhg9lhxn4ZzcQ1NJwmHfbs8Sdc84YMM44d5hB4s4B/FrM7jeCtBxO3HAjx4CZt+0wg4FEAgEtYFvmQLX8JV5LA1QLIzFa7IFaDs45dth4w420goM959J5JG4Q0CLZxnz4w5uaw7IbbiRvfPCjzFqOfwYBLSjgABDzkKB+FIyCUTAKRgEuAAAfRkzIg4fd3wAAAABJRU5ErkJggg==","orcid":"","institution":"Hunan Normal University","correspondingAuthor":true,"prefix":"","firstName":"Wenfeng","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2025-04-02 13:53:32","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6361968/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6361968/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":82356874,"identity":"00892e1e-7816-4299-ad3c-aa08d2e83d27","added_by":"auto","created_at":"2025-05-09 11:20:02","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":752954,"visible":true,"origin":"","legend":"\u003cp\u003eMorris water maze test .\u003c/p\u003e\n\u003cp\u003e(A) Avoidance latency in mice during the learning phase over time.* All five groups: Day 1 vs. Day 5, p \u0026lt; 0.05; ##ADC Group vs. WTC Group, p \u0026lt; 0.01. (B) Number of times mice crossed the platform during the testing phase, ** p \u0026lt; 0.01. (C) Total swimming path length during the mouse testing phase, * p \u0026lt; 0.01.(D)Swimming path trajectories of mice in the test phase. The area surrounded by the red line represents the quadrant where the platform is located, where the small green circle indicates the platform position. The red dot is the start point of the swim, the blue dot is the end point, and the yellow line shows the path of the swim. All data are expressed as mean±SD (n=12 per group).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6361968/v1/cb0b2eb5f56133b5bba39836.png"},{"id":82354909,"identity":"b5aabdf0-e675-4e22-872d-a3c61ed15aa9","added_by":"auto","created_at":"2025-05-09 11:12:02","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":329457,"visible":true,"origin":"","legend":"\u003cp\u003eBody weight, liver weight and percentage of liver weight in mice.\u003c/p\u003e\n\u003cp\u003e(A) Body weights of mice before and after the experiment, (B) liver weight, (C)percentage of liver to body weight. * p \u0026lt; 0.05; ** p \u0026lt; 0.01; *** p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6361968/v1/b8669c88cc9cd8078e85f1fc.png"},{"id":82359193,"identity":"002ea2d2-7800-4d67-83de-29bcd95597ce","added_by":"auto","created_at":"2025-05-09 11:28:02","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":568973,"visible":true,"origin":"","legend":"\u003cp\u003eSerum cholesterol levels (n = 4/group)\u003c/p\u003e\n\u003cp\u003eLevels of (A) serum TC, (B) serum HDL-C, (C) serum LDL-C, (D) HDL-C/TC ratio, (E) LDL-C/TC ratio, (F) LDL-C/HDL-C ratio. * p \u0026lt; 0.05; ** p \u0026lt; 0.01; *** p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6361968/v1/4f0b86e9c4677e7a9cb35e79.png"},{"id":82354915,"identity":"2519dae6-1cfa-4865-b630-c6a6b00d16d5","added_by":"auto","created_at":"2025-05-09 11:12:02","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":6587410,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of aerobic exercise on liver tissue and liver 27-OHC in mice.\u003c/p\u003e\n\u003cp\u003e(A) HE staining of the liver (n=3); the black dotted box is the enlarged area in the image below, and black arrows indicate inflammatory infiltrates. (B) CYP27A1 protein (n=6), (C) serum 27-OHC concentration (n=5), (D) CYP7A1 protein (n=6). * p \u0026lt; 0.05; ** p \u0026lt; 0.01; *** p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6361968/v1/c0fcccec63265f54d08d3fca.png"},{"id":82354912,"identity":"8412cf76-a861-4084-a099-874406563fab","added_by":"auto","created_at":"2025-05-09 11:12:02","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":989983,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of aerobic exercise on blood-brain barrier related proteins and brain 27-OHC concentrations and related transforming proteins in mice\u003c/p\u003e\n\u003cp\u003e(A) Claudin-5 protein (n=6), (B) Occludin protein (n=6), (C) CYP7A1 protein(n=6), (D)Concentration of 27-OHC in the brain (n=5), (E) CYP27A1 protein (n=6), (F) CYP7B1 protein (n=6). * p \u0026lt; 0.05; ** p \u0026lt; 0.01; *** p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6361968/v1/ba2f88fa45a2b41d190f50c2.png"},{"id":82356879,"identity":"4b1901c6-aec6-407e-b266-00ba42245dea","added_by":"auto","created_at":"2025-05-09 11:20:02","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":7510251,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of aerobic exercise on lysosomal function in the mouse brain\u003c/p\u003e\n\u003cp\u003e(A) CTSD immunohistochemistry results of mouse brain tissue sections (n=3). The black dotted box is the enlarged area in the image below. (B) CTSD protein(n=6), (C) LAMP1 mRNA (n=6), (D) LAMP2 mRNA (n=6), (E) LIMP2 mRNA (n=6), (F) Atp6v1h mRNA (n=6). * p \u0026lt; 0.05; ** p \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-6361968/v1/3da7b547cb8f50d157b24be4.png"},{"id":82359199,"identity":"585fd091-2482-4dfe-9f13-aecd6be3eabf","added_by":"auto","created_at":"2025-05-09 11:28:02","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":802699,"visible":true,"origin":"","legend":"\u003cp\u003eLevels of synapse-related proteins and genes in the mouse brain (n=6)\u003c/p\u003e\n\u003cp\u003e(A) PSD-95 protein,(B) SYN protein, (C) GAP43 mRNA, (D) Arc mRNA, (E) SNAP25 mRNA, (F) MAP2 mRNA; * p \u0026lt; 0.05; ** p \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-6361968/v1/446469f18ba1d1bf9df8cd6a.png"},{"id":82359197,"identity":"f36210fd-4ec7-4f74-b721-087546164756","added_by":"auto","created_at":"2025-05-09 11:28:02","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":4873830,"visible":true,"origin":"","legend":"\u003cp\u003eNysted stained mice brain tissue and neuron density ratio\u003c/p\u003e\n\u003cp\u003e(A) Mouse brain tissue stained with Nysted (n=3), (B) Neuronal density ratio(The neuronal density ratio in the hippocampal CA1 region)(n=3). * p \u0026lt; 0.05. ** p \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-6361968/v1/27dfda0be14347b19f41274d.png"},{"id":82354916,"identity":"b86a6cb4-4982-4ee8-a318-73f4065fa868","added_by":"auto","created_at":"2025-05-09 11:12:02","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":416510,"visible":true,"origin":"","legend":"\u003cp\u003eLevels of apoptotic proteins in the mouse brain (n=3)\u003c/p\u003e\n\u003cp\u003e(A) Bcl-2 protein,(B) Bax protein, (C) Bcl-2/Bax protein. * p \u0026lt; 0.05\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-6361968/v1/d2bdf5f57ad0394f69205869.png"},{"id":83085600,"identity":"e06267d9-aa7f-4fc2-8a94-464c540d873d","added_by":"auto","created_at":"2025-05-19 22:46:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":23463167,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6361968/v1/cac8bc99-de59-4456-9fd1-4197f9e58a58.pdf"},{"id":82354917,"identity":"bd12a099-921a-4423-bb2a-81dffebb64ee","added_by":"auto","created_at":"2025-05-09 11:12:02","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":806315,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfile.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6361968/v1/cbc6bfd0eba21a718c1a267f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Aerobic exercise improves lysosomal function in the brain of high cholesterol diet-fed APP/PS1 mice by modulating 27-hydroxycholesterol via the liver-brain axis","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eDisturbed cholesterol metabolism is a typical pathological feature of Alzheimer\u0026rsquo;s disease (AD)\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. Cholesterol is an important component of neuronal cell membranes and plays an important role in maintaining neural plasticity and synaptic transmission in the brain\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Peripheral cholesterol cannot enter the brain via the blood-brain barrier (BBB), so as the nervous system matures, cholesterol in the brain is mainly synthesized endogenously. The ability to synthesize cholesterol in the brain decreases with age and is particularly severe in AD patients\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e; cholesterol levels in the hippocampal region are significantly reduced in patients with AD \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Many studies have also shown that cholesterol is deposited in neuronal lysosomes in the brains of patients with AD, which prevents lysosomes from fulfilling their physiological function and leads to neuronal damage and premature apoptosis\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. This process is considered a major cause of cognitive impairment in patients with AD.\u003c/p\u003e \u003cp\u003eEvidence suggests that lifestyle-related risk factors play key roles in the development of AD\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. An important risk factor for AD is a high-cholesterol diet\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Epidemiological studies have shown that higher dietary saturated fat intake increases the risk of AD by 39%\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Feeding rabbits for 7 months with food containing 1% cholesterol caused severe hypercholesterolemia and led to cholesterol accumulation in neurons, promoting the formation of Aβ plaques associated with AD\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. This suggests that high cholesterol and high saturated fat diets are not only known risk factors for AD, but also play an important role in contributing to its pathogenesis. Recent studies have shown that the pathology of AD as affected by high-cholesterol diets is associated with 27-hydroxycholesterol (27-OHC)\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. Cholesterol is converted to 24-hydroxycholesterol (24-OHC) by the neuron-specific converting enzyme CYP46A1, which is the main pathway through which the brain metabolizes excess cholesterol. 24-OHC can cross the BBB from the brain into peripheral circulation, driven by a concentration gradient\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. Another small portion of cholesterol is converted to 27-OHC by the CYP27A1 enzyme expressed in the brain, and 27-OHC is further catalyzed by CYP7B1 to form 7α-hydroxy-3-oxo-4-cholestanic acid (7-HOCA), which can traverse the BBB, enter the peripheral circulation, and be excreted\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. Under non-pathological conditions, brain 27-OHC levels are usually low because of its highly efficient metabolism\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. However, high levels of 27-OHC have been observed in the brain and cerebrospinal fluid of patients with both early-onset and sporadic AD\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. High concentrations of 27-OHC in the brain are thought to play important roles in AD pathogenesis \u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. For example, high levels of 27-OHC in the brain significantly reduce neuronal spine density and PSD95 synthesis, leading to hippocampal synaptic dysfunction\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. Recent studies have shown that an increase in plasma 27-OHC caused by a high-cholesterol diet induces abnormal lysosomal function in Sprague-Dawley (SD) rat neuronal cells, leading to Aβ formation and accumulation\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAbnormal cholesterol metabolism is not only an important part of the pathogenesis of AD but also significantly affects lysosomal function. As a membrane-bound organelle present in all eukaryotic cells, lysosomes have an acidic lumen and are restricted by a single lipid bilayer membrane. They are mainly involved in degradation, repair of plasma membrane damage, secretion, signaling, and energy metabolism\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. Under normal physiological conditions, lysosomes can effectively degrade Aβ and mitochondria awaiting degradation in autophagosomes, but in AD, Aβ deposition increases, neurotoxicity increases, and the accumulation of Aβ in lysosomes destabilizes the system, resulting in lysosomal enzyme leakage and reducing the activity of degradative enzymes within lysosomes\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. Substrates requiring lysosomal degradation accumulate in large quantities in the lysosome, ultimately leading to cellular dysfunction and cell death\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. Indeed, reduced lysosomal activity and impaired function in patients with AD and in APP/PS1 mice are recognized as typical pathological features of AD\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. Song et al. found that increasing the level of Cathepsin D, a lysosomal-associated protein, in the brains of 3\u0026times; Tg-AD mice reduced Aβ deposition, suggesting that enhancing lysosomal function can improve AD\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. Research has shown that cholesterol plays an important role in AD pathology, and its abnormal accumulation not only exacerbates neuronal damage but also further promotes Aβ deposition\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. In AD, cholesterol accumulation in lysosomes impairs their function and is accompanied by elevated levels of 27-OHC, and this dual accumulation of cholesterol and 27-OHC leads to structural and functional disorders of lysosomes\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eWith regard to the cause of the increased 27-OHC concentration, available studies indicate that a possible cause of the increased 27-OHC concentration in the AD brain is a decrease in CYP7B1 protease caused by a decrease in the number of neurons in the brain\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. In contrast, CYP27A1 is expressed not only in neurons but also in astrocytes and oligodendrocytes, and increased levels of CYP27A1 protease have been found in the brains of patients with AD, which ultimately leads to an increased proportion of cholesterol metabolized to 27-OHC in the brain\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. In fact, most 27-OHC is not produced in the brain, but in the liver, and 27-OHC is the cholesterol metabolite with the highest concentration in the plasma and lowest concentration in the brain\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Elevated 27-OHC concentrations in the brain are attributed to BBB and blood-cerebrospinal fluid barrier dysfunction\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. Hypercholesterolemia and a high-fat diet are usually accompanied by an increase in 27-OHC, and excess 27-OHC released from circulation into the brain decreases spatial memory\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eExercise interventions as non-pharmacological treatments have been shown to play a role in alleviating neurodegenerative diseases by improving metabolism, enhancing neuroplasticity, and modulating inflammation, among other mechanisms. However, the role of 27-OHC in the improvement of AD by exercise is not well understood; therefore, the aim of this study was to investigate the role of aerobic exercise in modulating 27-OHC concentrations through the liver-brain axis. Our results suggest that aerobic exercise modulates 27-OHC levels in the periphery and brain, restores damaged synaptic and lysosomal functions in the brain, reduces apoptosis, and enhances memory capacity.\u003c/p\u003e"},{"header":"2. Results","content":"\u003cp\u003e\u003cstrong\u003e2.1\u003c/strong\u003e \u003cstrong\u003eAerobic exercise improves learning memory in APP/PS1 mice fed a high-cholesterol diet\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe assessed the effects of aerobic exercise on learning and memory in mice fed a high-cholesterol diet, using the Morris water maze (MWM) test. As shown in Figure 1A, aerobic exercise shortened the latency of the learning phase in all four groups. At five days, the latency of mice in the ADC group was significantly higher than that in the WTC group, and the avoidance latency of mice in the ADC group was significantly increased on day 5 (p \u0026lt; 0.01) compared with that in the WTC group. As shown in Figure 1B, the mice in the ADC group had fewer platform crossings during the testing phase than those in the WTC group (p \u0026lt; 0.01). As shown in Figure 1C, mice in the ADC-HFD group swam a shorter total distance in the test phase than those in the ADC group (p \u0026lt; 0.05). Figure 1D shows the spatially exploratory swimming trajectories of each group of mice during the test phase. These results suggest that aerobic exercise exerts a beneficial effect on the impaired spatial memory capacity of AD mice fed with a high-cholesterol diet.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2\u003c/strong\u003e \u003cstrong\u003eAerobic exercise attenuates body weight and liver weight in high-cholesterol diet-fed APP/PS1 mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWeight gain is often accompanied by an increased risk of obesity, which has been shown to be strongly associated with AD\u003csup\u003e[34]\u003c/sup\u003e. Obesity not only causes insulin resistance and metabolic disorders but also exacerbates the pathological process of AD by activating the inflammatory response in the brain\u003csup\u003e[35]\u003c/sup\u003e. Therefore, weight control and prevention of obesity are important in AD. To investigate the effects of aerobic exercise on the body and liver weights of AD mice fed a high-cholesterol diet, we compared changes in body and liver weights in the four groups of mice before and after the experiments. As shown in Figure 2A, compared with the pre-experimental values, all four groups of mice had gained weight at the end of the experiment, and aerobic exercise significantly reduced the body weight of mice in the ADE-HFD group compared with that of mice in the ADC-HFD group (p\u0026lt;0.01). As shown in Figure 2B, the high-cholesterol diet significantly increased liver weight in the ADC-HFD group compared to the ADC group (p\u0026lt;0.01), while aerobic exercise significantly reduced liver weight in mice in the ADE-HFD group compared to the ADC-HFD group (p\u0026lt;0.001). As shown in Figure 2C, we found that the liver weight ratios of the WTC and ADC groups did not show significant differences. The percentage of liver weight was significantly higher in the ADC-HFD group than in the ADC group (p\u0026lt;0.01), and aerobic exercise significantly reduced the percentage of liver weight in mice in the ADE-HFD group compared to mice in the ADC-HFD group (p\u0026lt;0.05). These results suggest that aerobic exercise can reduce weight gain and liver weight gain in mice fed a high-cholesterol diet, which may reduce the risk of obesity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3\u003c/strong\u003e \u003cstrong\u003eAerobic exercise reduces serum cholesterol levels in high-cholesterol diet-fed APP/PS1 mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCholesterol homeostasis is essential for normal cellular and systemic functions. Cholesterol is involved in the maintenance of cell membrane stability, synthesis of steroid hormones, vitamin D, and bile acids, and supports nerve signaling\u003csup\u003e[36]\u003c/sup\u003e. Recent studies have shown that abnormal cholesterol levels are strongly associated with the onset and progression of AD\u003csup\u003e[37]\u003c/sup\u003e. High cholesterol levels not only increase the burden on the liver but also intensify the inflammatory response and mitochondrial damage and promote the production of \u0026beta;-amyloid, further exacerbating the pathology of AD\u003csup\u003e[38, 39]\u003c/sup\u003e. To explore the effects of aerobic exercise on cholesterol metabolism in AD mice, we measured serum cholesterol levels. As shown in Figure 3A, there was no significant difference in serum cholesterol levels between the WTC and ADC groups; serum cholesterol levels were significantly higher in the ADC-HFD group than in the ADC group (p\u0026lt;0.001) and significantly lower in the ADE-HFD group than in the ADC-HFD group (p\u0026lt;0.05). As shown in Figure 3B and C, serum high-density lipoprotein cholesterol (HDL-C) tended to increase in the ADC-HFD group compared to the ADC group, but the difference was not significant. This may be because high-cholesterol diets usually lead to dyslipidemia, and the body may maintain lipid homeostasis by temporarily increasing HDL-C levels through compensatory mechanisms to help remove excess cholesterol. We also used common ratio measures of lipid levels to assess the effects of exercise on lipid metabolism. As shown in Figure 3D and E, the high-cholesterol diet significantly reduced the HDL-C/total cholesterol (TC) ratio (p\u0026lt;0.01) to the low-density lipoprotein cholesterol (LDL-C)/TC ratio (p\u0026lt;0.01) in the ADC-HFD group. These results indicate that a high-cholesterol diet increased serum cholesterol levels in AD mice, whereas aerobic exercise significantly decreased serum cholesterol levels in AD mice fed a high-cholesterol diet.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4\u003c/strong\u003e \u003cstrong\u003eAerobic exercise ameliorates liver tissue injury and hepatic 27-OHC synthesis in high-cholesterol diet-fed APP/PS1 mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs a major organ in cholesterol metabolism, the liver plays a key role in maintaining systemic lipid homeostasis, and some studies have shown that liver dysfunction is strongly associated with cognitive decline in AD\u003csup\u003e[40]\u003c/sup\u003e. Some risk genes associated with AD, such as \u003cem\u003eABCA7\u003c/em\u003e and \u003cem\u003eAPOE\u003c/em\u003e, are highly expressed in the liver, suggesting that the liver may play a role in AD pathogenesis \u003csup\u003e[41]\u003c/sup\u003e. Inflammation and oxidative stress in the liver have also been implicated in the progression of AD\u003csup\u003e[42]\u003c/sup\u003e. Especially under high-fat dietary conditions, the liver is prone to fat accumulation and tissue damage, which in turn leads to metabolic disorders that may exacerbate the pathological process of AD and further promote the development of neurodegenerative lesions\u003csup\u003e[43]\u003c/sup\u003e. Thus, liver dysfunction plays an important role in AD progression. We performed morphological observations on the liver tissues of mice, and hematoxylin and eosin (HE) staining showed that hepatocytes in the WTC group were clearly demarcated and arranged, of uniform size, radiating from the central vein, with intact walls of the central veins of the lobules. There were rounded and well-defined nuclei located in the center of the cells, with abundant cytoplasm, and normal morphology of the hepatocytes, with no steatosis and inflammatory cell infiltration (Figure 4). The structure of the liver lobules of mice in the ADC group was clear, and the arrangement of hepatocytes was more regular and close to normal. Mice in the ADC-HFD group showed obvious liver pathology, with a blurred liver lobule structure, breaks in the wall of the central venous canaliculi of the lobules, disappearance of the nuclei or indistinct margins, many white neutral lipids between the cytoplasm, and the presence of inflammatory cell infiltration (black arrows in Figure 4A). The liver lesions of mice in the ADE-HFD group were significantly improved. The lobular structure and hepatocytes in the liver tissue were more neatly arranged, and the inflammatory infiltration was alleviated. The cytoplasm was well-preserved, the nuclei were prominent and their morphology was normal. The appearance of the liver in the ADE-HFD group was closer to that of the WTC group.\u0026nbsp;This suggests that aerobic exercise ameliorates liver injury in mice fed with a high-cholesterol diet.\u003c/p\u003e\n\u003cp\u003ePrevious studies have shown that 27-OHC, a key intermediate in cholesterol metabolism catalyzed by CYP27A1, is not only widespread in peripheral tissues but is also able to enter the brain through the BBB and plays an important role in the onset and development of AD\u003csup\u003e[12]\u003c/sup\u003e. It has been shown that CYP7A1 expression decreases with age\u003csup\u003e[44]\u003c/sup\u003e. Therefore, we assayed the hepatic CYP27A1 and CYP7A1 protein\u0026nbsp;levels and serum 27-OHC concentrations in mice. As shown in Figure 4B,C, there was no significant difference between the protein content of CYP27A1 and serum 27-OHC concentration in the livers of mice in the WTC and ADC groups.\u0026nbsp;The hepatic CYP27A1 protein content (p\u0026lt;0.01) as well as serum 27-OHC concentration (p\u0026lt;0.001) were significantly increased in the livers of mice in the ADC-HFD group compared with the ADC group. Compared with mice in the ADC-HFD group, mice in the ADE-HFD group showed a significant decrease in hepatic CYP27A1 protein content (p\u0026lt;0.05), and serum 27-OHC concentration also showed a decreasing trend. As shown in Figure 4D, the hepatic CYP7A1 protein content of mice in the ADC group was significantly lower than that in the WTC group (p\u0026lt;0.05),\u0026nbsp;and the hepatic CYP7A1 protein content of mice in the ADE-HFD group tended to increase but was not significantly different\u0026nbsp;from that in mice in the ADC-HFD group. These results suggest that a high-cholesterol diet significantly increases\u0026nbsp;the CYP27A1 protein content and serum 27-OHC concentration in the livers of AD model mice.\u0026nbsp;27-OHC, a key product of cholesterol metabolism, can act on the brain through the liver-brain axis, affecting neuronal function and cognition\u003csup\u003e[45]\u003c/sup\u003e. When cholesterol metabolism is disturbed, elevated 27-OHC concentrations exacerbate neurodegenerative changes in AD\u003csup\u003e[29]\u003c/sup\u003e. Our results show that aerobic exercise can affect the metabolism of 27-OHC by modulating the expression of CYP27A1 and CYP7A1 in the liver, which may exert a protective effect in AD mice fed a high-cholesterol diet.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5\u003c/strong\u003e \u003cstrong\u003eAerobic exercise ameliorates blood-brain barrier damage and brain 27-OHC turnover in high cholesterol diet-fed APP/PS1 mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe BBB is a highly specialized biological barrier formed the tight junctions, basement membranes, and glia-less cell protrusions of cerebral microvascular endothelial cells. The main function of the BBB is to maintain the stability of the neural environment and the constancy of the internal microenvironment to ensure the normal function and activity of cerebral neurons\u003csup\u003e[46]\u003c/sup\u003e. AD patients often exhibit BBB damage, and abnormal deposition of A\u0026beta; may damage the BBB and exacerbate neurodegenerative processes. When BBB permeability is increased, harmful molecules that are usually blocked, such as inflammatory mediators and toxic substances, are able to enter the brain through the BBB, further exacerbating neuronal damage\u003csup\u003e[47]\u003c/sup\u003e. Therefore, we tested BBB barrier-associated proteins. As shown in Figure 5A\u0026ndash;C, compared with mice in the WTC group, mice in the ADC group had significantly lower levels of Claudin-5 (p\u0026lt;0.01) and Occludin (p\u0026lt;0.05) proteins in the brain, and there was a trend (although not significant) toward lower levels of ZO-1 protein. Compared with mice in the ADC group, the high cholesterol diet significantly reduced Occludin (p\u0026lt;0.05) and ZO-1 (p\u0026lt;0.05) protein levels in the brains of ADC-HFD mice, with a trend toward lower (although not significant) levels in Claudin-5. Aerobic exercise significantly increased the protein content of Claudin-5 (p\u0026lt;0.01) and ZO-1 (p\u0026lt;0.001) in the brains of mice in the ADC-HFD group compared with mice in the ADC-HFD group, and there was a tendency toward an increase in Occludin, which was not significant. This suggests that aerobic exercise has a protective effect on the BBB in AD mice and improves BBB function.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn AD, the overproduction of peripheral 27-OHC leads to an influx of 27-OHC into the brain through a compromised BBB, and excess 27-OHC in the brain can lead to cytotoxicity, promoting apoptosis\u003csup\u003e[48]\u003c/sup\u003e. The liver serves as a major source of 27-OHC production and transports 27-OHC to the brain via the liver-brain axis. Elevated plasma 27-OHC levels are associated with mild cognitive impairment in older adults, further affecting neurological functioning\u003csup\u003e[18]\u003c/sup\u003e. Therefore, we assayed the effects of exercise on 27-OHC-related metabolic enzyme levels to determine 27-OHC turnover. First, the concentration of 27-OHC in the mouse brain was detected. As shown in Figure 5D, the concentration of 27-OHC in the brains of mice in the ADC group was significantly higher than that in the brains of mice in the ADC-HFD group (p\u0026lt;0.05). The concentration of 27-OHC was significantly higher in the brains of mice in the ADC-HFD group fed a high-cholesterol diet than in mice in the ADC group (p\u0026lt;0.001). Aerobic exercise significantly reduced the concentration of 27-OHC in the brains of mice in the ADE-HFD group compared to mice in the ADC-HFD group (p\u0026lt;0.01). Next, we measured the levels of CYP27A1, which is widely expressed in the brain, as well as CYP7B1, which converts 27-OHC to 7\u0026alpha;-hydroxy-3-oxo-4 cholesteric acid (7-OH-4-C), which flows through the BBB to the somatic circulation\u003csup\u003e[13]\u003c/sup\u003e. As shown in Figure 5E, CYP27A1 protein levels were significantly higher in the brains of mice in the ADC group compared to mice in the WTC group (p\u0026lt;0.01), and there was no significant difference in the CYP27A1 protein content in the brains of the ADC group compared to the ADC-HFD group. Aerobic exercise significantly reduced CYP27A1 protein levels in the brains of mice in the ADE-HFD group compared with ADC-HFD mice (p\u0026lt;0.05). As shown in Figure 5F, the amount of CYP7B1 protein in the brains of ADC mice was significantly reduced compared to mice in the WTC group (p\u0026lt;0.01), while aerobic exercise increased CYP7B1 protein levels in the brains of mice in the ADE-HFD group compared to mice in the ADC-HFD group, but the difference was not significant. These results suggest that aerobic exercise may help alleviate AD by ameliorating BBB damage, decreasing the concentration of 27-OHC, and regulating CYP27A1 protein levels to reduce the negative effects of 27-OHC on the brain.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6\u003c/strong\u003e \u003cstrong\u003eAerobic exercise improves brain lysosomal morphology and related protein expression in APP/PS1 mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLysosomes are important intracellular organelles responsible for intracellular signaling, energy metabolism, inflammatory pathways, degradation of intracellular waste products, and recycling of damaged cellular components\u003csup\u003e[49]\u003c/sup\u003e. In AD, lysosomal function is impaired, leading to abnormal accumulation of A\u0026beta; and other proteins that exacerbate the AD process\u003csup\u003e[50]\u003c/sup\u003e. Studies have shown that high cholesterol diets further worsen lysosomal dysfunction and promote the progression of AD\u003csup\u003e[5]\u003c/sup\u003e. Therefore, we examined lysosomal morphology in the mouse brain and labeled brain sections with anti-cathepsin D (CTSD) antibody to detect lysosomal volume. As shown in Figure 6A, compared with mice in the WTC group, mice in the ADC group had increased lysosomal volumes in the CA1 and CA3 regions of the hippocampus in the brain, and the CA3 region was particularly severe. Compared with mice in the ADC group, mice in the ADC-HFD group had increased lysosomal volumes in the CA1 and CA3 regions of the brain, and the CA3 region was particularly severe. The lysosomal volumes of CA1 and CA3 regions in the brain of mice in the ADE-HFD group were significantly reduced compared with those of mice in the ADC-HFD group. These results suggest that after aerobic exercise intervention, the lysosomal volumes of the CA1 and CA3 regions in the brains of mice in the ADE-HFD group were significantly reduced, indicating that aerobic exercise has an ameliorative effect on lysosomal morphological abnormalities induced by a high-cholesterol diet.\u003c/p\u003e\n\u003cp\u003eDiets high in cholesterol not only affect the volume of lysosomes in the brain but may also alter lysosomal function, thereby exacerbating neuronal damage. Abnormal lysosomal function\u0026nbsp;in AD may lead to the accumulation of intracellular waste products and exacerbate neuronal damage\u003csup\u003e[51]\u003c/sup\u003e. In rabbits fed a high-cholesterol diet, increased accumulation of cholesterol in lysosomes was accompanied by elevated levels of 27-OHC in the brain. This accumulation led to lysosomal structural and functional disorganization, which in turn reduced the activity of the lysosomal protease CTSD and ultimately triggered lysosomal dysfunction in neurons\u003csup\u003e[52]\u003c/sup\u003e. CTSD, on the other hand, plays a role in protein hydrolysis in lysosomes, which is especially important in the process of cellular autophagy. CTSD is also involved in the degradation of APP, which plays a protective role in preventing the accumulation of A\u0026beta;\u003csup\u003e[53]\u003c/sup\u003e. Moreover, increasing the concentration of 27-OHC in the plasma of SD rats causes abnormal lysosomal function in neuronal cells\u003csup\u003e[20]\u003c/sup\u003e. This suggests that elevated peripheral 27-OHC levels cause neuronal damage by altering lysosomal function. The lysosome-associated membrane proteins LAMP1, LAMP2, LIMP2, and ATPase H+ transporting V1 subunit H (Atp6v1h) are lysosomal protective and exert neuroprotective effects by enhancing lysosomal function and alleviating neuronal damage\u003csup\u003e[54]\u003c/sup\u003e. Therefore, we assessed the effects of aerobic exercise on lysosomal function in the brains of mice with AD fed a high-cholesterol diet by examining the expression of key lysosome-related proteins and mRNAs. Lysosomal function in the mouse brain was assessed by examining the CTSD levels. As shown in Figure 6B, the level of the 42 kDa (single-stranded) mature form of CTSD in the brains of mice in the ADC group showed a decreasing trend compared to mice in the WTC group, whereas the mature form of CTSD was significantly higher in the brains of mice in the ADC-HFD group than in mice in the ADC group (p\u0026lt;0.05). Mice in the ADE-HFD group showed a decreasing trend in the mature form of CTSD in the brain compared to mice in the ADC-HFD group. Re-examination of lysosome-associated protein and mRNA expression in mouse brain, as shown in Figure 6C\u0026ndash;F, gene expression of LAMP1 (p\u0026lt;0.05), LIMP2 (p\u0026lt;0.05) and Atp6v1h (p\u0026lt;0.01) was significantly reduced in the brains of mice in the ADC group compared with the WTC group. LAMP2 expression was significantly lower in the brains of mice in the ADC-HFD group compared to mice in the ADC group (p\u0026lt;0.05). Aerobic exercise significantly upregulated gene expression of LAMP1 (P\u0026lt;0.01), LAMP2 (p\u0026lt;0.01), and Atp6v1h (p\u0026lt;0.05) in mice in the ADE-HFD group compared with mice in the ADC-HFD group. These results suggest that aerobic exercise may alleviate lysosomal dysfunction caused by a high-cholesterol diet to a certain extent by improving the morphology of lysosomes in the brain, significantly reducing the increase in lysosomal volume induced by the high-cholesterol diet, and thus improving the expression of lysosomal-associated proteins.\u003c/p\u003e\n\u003cp id=\"_Toc12237\"\u003e\u003cstrong\u003e2.7\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eAerobic exercise promotes brain synaptic protein expression in APP/PS1 mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the early stages of AD, cognitive impairment is strongly associated with reduced synaptic density in the cortical and hippocampal regions\u003csup\u003e[55]\u003c/sup\u003e. Accumulation of A\u0026beta; plaques in the AD brain interferes with interneuronal communication at the synapses, leading to neurodegeneration, which in turn impedes long-term potentiation (LTP), an important mechanism for learning and memory formation\u003csup\u003e[56, 57]\u003c/sup\u003e. It has been shown that toxicity from excess 27-OHC in the body decreases spine density, dendritic arborization, and PSD-95 synthesis\u003csup\u003e[58]\u003c/sup\u003e. Postsynaptic terminal density plays a crucial role in memory formation and retention, and postsynaptic protein-95 (PSD-95), a key protein underpinning the postsynaptic locus, has been suggested to be a relevant metric in assessing the pathogenesis of AD. It has been shown that PSD-95 protein expression is significantly decreased in AD mice compared to control mice\u003csup\u003e[59]\u003c/sup\u003e. Synapsin (SYN) is a presynaptic protein involved in the regulation of vesicle storage, mobilization, and release at nerve endings\u003csup\u003e[60]\u003c/sup\u003e and synergizes with PSD-95 to ensure precise neural signaling\u003csup\u003e[61]\u003c/sup\u003e. To address these issues, we examined the levels of the synapse-associated proteins PSD-95 and SYN in the mouse brain and analyzed the expression of the synapse-associated genes GAP43, Arc, SNAP25, and MAP2. As shown in Figure 7A and B, PSD-95 (P\u0026lt;0.05) and SYN (p\u0026lt;0.05) protein contents were significantly downregulated in the brains of mice in the ADC group compared with the WTC group. SYN protein content (p\u0026lt;0.01) was significantly downregulated in the brains of mice in the ADC-HFD group compared to ADC mice, whereas the protein content of PSD-95 (p\u0026lt;0.05) and SYN (p\u0026lt;0.05) was significantly increased in the brains of mice in the ADE-HFD group compared with mice in the ADC-HFD group. As shown in Figure 7C\u0026ndash;F, Arc (p\u0026lt;0.01) and MAP2 (p\u0026lt;0.01) gene expression was significantly downregulated in the brains of mice in the ADC group compared with mice in the WTC group. Compared with the ADC group, the high-cholesterol diet significantly downregulated the expression level of \u003cem\u003eGAP43\u003c/em\u003e gene in the brains of mice in the ADC-HFD group (p\u0026lt;0.01), and there was a tendency to downregulate the expression of SNAP25 gene, but there was no significant difference. Aerobic exercise significantly upregulated \u003cem\u003eGAP43\u003c/em\u003e (p\u0026lt;0.05), \u003cem\u003eSNAP25\u003c/em\u003e (p\u0026lt;0.01), and \u003cem\u003eMAP2\u003c/em\u003e (p\u0026lt;0.05) gene expression levels in the brains of mice in the ADE-HFD group compared with mice in the ADC-HFD group. These results suggest that aerobic exercise can enhance learning and memory by improving the expression of synaptic proteins and genes and slowing synaptic damage.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.\u003c/strong\u003e\u003cstrong\u003e8\u003c/strong\u003e \u003cstrong\u003eAerobic Exercise Improves Brain Neuron Morphology and Increases Density to Reduce Apoptosis in APP/PS1 Mice on a High-Cholesterol Diet\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMemory and cognitive function decline progressively with age, and the risk of neuronal damage increases in patients with AD. Changes in neuronal cell morphology, such as reduced dendritic spine density and neuronal structural degeneration, are considered important markers of AD disease progression\u003csup\u003e[62]\u003c/sup\u003e. We therefore examined hippocampal neurons. As shown in Figure 8A, the results of Nissl staining showed that the neurons in the CA1 area of the hippocampus of mice in the WTC group were morphologically and structurally intact, with well-defined nuclei, uniformly distributed, densely arranged, and rich in Nysted bodies. In the CA1 area of the hippocampus of mice in the ADC and ADE-HFD groups, the neuronal structure was unclear with blurred outlines, and the arrangement was scattered and sparse. The number of neurons in the CA1 area of the hippocampus of mice in the ADC-HFD group was reduced, the cytosolic membrane was ruptured, disintegration was unclear, and the nidus appeared to be dissolved, reduced in number, and lightly colored. Overall, neuronal morphological and structural pathological changes in the CA1 region of the hippocampus improved in the ADE-HFD group compared with those in the ADC-HFD group. These results suggest that aerobic exercise ameliorates the pathological changes in neuronal morphology and structure in the hippocampal CA1 region of mice with AD caused by high-cholesterol diets.\u003c/p\u003e\n\u003cp\u003eIn addition to observing changes in neuronal morphology, we analyzed the distribution of neuronal density in the CA1 region of the hippocampus. As shown in Figure 8B, the neuronal density ratio in the CA1 region of the brain of mice in the ADC group was significantly reduced compared with that of mice in the WTC group (p\u0026lt;0.05). Compared with mice in the ADC group, the neuronal density ratio in the CA1 region of the brain of mice in the ADC-HFD group tended to be downregulated but was not significantly different. Compared with the ADC-HFD group, the neuronal density ratio in the CA1 region of the brain of mice in the ADE-HFD group showed an upward trend, and although the difference was not significant. Nevertheless, the results suggest that aerobic exercise may have a protective effect on improving neuronal survival.\u003c/p\u003e\n\u003cp\u003eAn important feature of AD is the accumulation of A\u0026beta;, a process that leads to increased neuronal apoptosis\u003csup\u003e[63]\u003c/sup\u003e. The ratio of the expression of anti-apoptotic protein B-cell lymphoma-2 (Bcl-2) to pro-apoptotic protein Bcl-2-associated X protein (Bax) is crucial in the regulation of apoptosis, and studies have shown that the downregulation of Bcl-2 and upregulation of Bax in the brain are closely related to neuronal apoptosis. This imbalance may be an important mechanism underlying A\u0026beta;-induced neurodegenerative changes\u003csup\u003e[64]\u003c/sup\u003e. Further studies showed that Bax knockout (KO) mice showed a downregulation of Bcl-2 expression after injection of A\u0026beta; oligomers in the brain\u003csup\u003e[65]\u003c/sup\u003e. Bax expression was significantly increased and Bcl-2 was significantly decreased in 13-17 week human fetal neurons treated with A\u0026beta;\u003csup\u003e[66]\u003c/sup\u003e. These results suggest that an imbalance in the Bcl-2/Bax ratio plays a key role in neuronal apoptosis in AD. Therefore, we examined the levels of Bcl-2 and Bax and their ratio in the brain to assess the effects of aerobic exercise on neuronal apoptosis. As shown in Figure 9A, there was no significant difference in Bcl-2 protein expression in the brains of the four groups of mice. However, there was a tendency toward a decrease in Bcl-2 protein expression in the brains of mice in the ADC group compared to mice in the WTC group. As shown in Figure 9B, compared with the WTC mice, there was a trend of increased Bax protein content in the brains of the ADC mice, although there was no significant difference. Bax protein content in the brains of mice in the ADE-HFD group was significantly decreased compared to that in the ADC-HFD group (p\u0026lt;0.05). As shown in Figure 9C, the Bcl-2/Bax protein ratio was significantly lower in the brains of mice in the ADC group than in the WTC group (p\u0026lt;0.05). The Bcl-2/Bax protein ratio in the brains of mice in the ADC and ADC-HFD groups did not show significant differences; however, the Bcl-2/Bax protein ratio was significantly higher in the brains of mice in the ADE-HFD group compared to mice in the ADC-HFD group (p\u0026lt;0.05). In conclusion, the above results suggest that aerobic exercise ameliorates the imbalance between Bcl-2 and Bax protein expression and may protect against neuronal apoptosis in AD mice fed a high-cholesterol diet by increasing the Bcl-2/Bax ratio.\u003c/p\u003e"},{"header":"3. Discussion","content":"\u003cp\u003eDefective lysosomal function in nerve cells is associated with the development of neurodegenerative diseases\u003csup\u003e[\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]\u003c/sup\u003e. Defective lysosomal function leads to the accumulation of cholesterol in the lysosomes of nerve cells and abnormal swelling of nerve axons, resulting in low cholesterol concentrations required for nerve cell membrane repair, axon growth, synaptic plasticity, and ultimately nerve cell death\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Under physiological conditions, lysosomes function normally and can rapidly degrade Aβ and mitochondria encapsulated in autophagosomes, but under AD pathological conditions, the increased neurotoxicity of excessive Aβ in lysosomes can destabilize lysosomal membranes, cause lysosomal enzyme leakage, and reduce the amount of degradative enzymes in lysosomes\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIt has been shown that lysosomal dysfunction in AD mice is associated with 27-OHC, which is formed mainly in the liver and catalyzed by the enzyme CYP27A1. 27-OHC is initially released into the blood and is the most abundant cholesterol metabolite in the plasma\u003csup\u003e[\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]\u003c/sup\u003e. The expression levels of the \u003cem\u003eCYP27A1\u003c/em\u003e gene in patients with AD increase with the progression of AD\u003csup\u003e[\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]\u003c/sup\u003e. Significantly higher levels of 27-OHC were observed in the brains of deceased patients with AD and in a transgenic mouse model of AD\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. Plasma 27-OHC levels are higher than average in patients with mild cognitive impairment and AD\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Lowering serum 27-OHC levels by managing lifestyle and vascular factors benefits cognitive function, as suggested by a randomized controlled trial \u003csup\u003e[\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e]\u003c/sup\u003e, but had no effect on Cyp27KO mice lacking 27-OHC\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. Increased blood levels of 27-OHC in rats cause an increase in 27-OHC in the brain tissue, which in turn causes a decrease in spatial learning and memory and decreases the expression of HMG-CR, a key protein that mediates cholesterol synthesis and impairs cholesterol synthesis in the rat brain\u003csup\u003e[\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e, \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]\u003c/sup\u003e. CYP27A1 overexpressing mice exhibit reduced glucose metabolism and memory deficits\u003csup\u003e[\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eResearch has shown that hypercholesterolemia and a high-fat diet are often accompanied by an increase in 27-OHC and that excess 27-OHC released from circulation into the brain decreases spatial memory\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. The liver is the only organ capable of metabolizing cholesterol into bile acids, accounting for approximately one-third of the cholesterol excreted from the body. The enzymatic conversion of cholesterol into bile acids by CYP7A1 is the most important mechanism for removing cholesterol from the body\u003csup\u003e[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003c/sup\u003e. 27-OHC reflects the degree of cholesterol saturation in the body\u003csup\u003e[\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e]\u003c/sup\u003e. In the present study, we found that serum cholesterol content was significantly elevated in APP/PS1 mice fed a high-cholesterol diet, that there were no significant changes in CYP7A1 in the liver, and that the elevated serum concentration of 27-OHC may be related to the elevated protein content of CYP27A1 in the liver.\u003c/p\u003e \u003cp\u003e27-OHC can cross the lipophilic membrane and enter the brain through the BBB\u003csup\u003e[\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]\u003c/sup\u003e. Cerebrospinal fluid 27-OHC levels directly correlate with plasma 27-OHC levels\u003csup\u003e[\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e]\u003c/sup\u003e. A previous study showed that approximately 5 mg of 27-OHC flows into the brain daily, and if the integrity and function of the BBB are compromised, more 27-OHC enters the brain\u003csup\u003e[\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]\u003c/sup\u003e. Therefore, in the present study, we examined the levels of barrier proteins in the brains of mice and found that a high-cholesterol diet exacerbated the already disrupted BBB damage in the brains of APP/PS1 mice. Subsequently, the 27-OHC content in the brains of the mice was examined and found to be significantly increased in the high-cholesterol diet-fed APP/PS1 mice, which is consistent with BBB damage in these mice. Aerobic exercise reduced the 27-OHC concentration in the brains of the high-cholesterol diet-fed APP/PS1 mice and attenuated BBB barrier protein damage in the APP/PS1 mice.\u003c/p\u003e \u003cp\u003eBecause cholesterol in the peripheral circulation cannot enter the brain directly through the BBB, it is mainly synthesized by astrocytes and binds to ApoE to form cholesterol-ApoE complexes\u003csup\u003e[\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]\u003c/sup\u003e. These cholesterol-ApoE complexes are transported into neuronal lysosomes, where cholesterol transport is accomplished by Niemann-Pick C protein (NPC). NPC1 and NPC2 are lysosome-specific cholesterol transport proteins\u003csup\u003e[\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e]\u003c/sup\u003e. The NPC2 protein first binds to the alkyl side chain of cholesterol and then NPC1 protein continues to bind to cholesterol, transporting it to the lysosomal membrane and ultimately to downstream organelles for utilization\u003csup\u003e[\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e]\u003c/sup\u003e. CTSD is an important degradative enzyme that functions within lysosomes, and its expression level is an important indicator of lysosomal function\u003csup\u003e[\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e]\u003c/sup\u003e. Inactivation of CTSD leads to the accumulation of free cholesterol in lysosomes in vivo\u003csup\u003e[\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e]\u003c/sup\u003e. Tian et al. showed that increased Aβ deposition reduces CTSD expression\u003csup\u003e[\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e]\u003c/sup\u003e. Atp6v1h maintains the acidic environment of lysosomes, whereas the maturation of CTSD and protein hydrolase activity depend on the acidic pH environment\u003csup\u003e[\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e]\u003c/sup\u003e. In this study, the volume of lysosomes and the levels of CTSD, LAMP1, LAMP2, LIMP2, and Atp6v1h were examined in the brains of mice. In general, the high-cholesterol diet depleted the already impaired lysosomal function in the brains of APP/PS1 mice, which may be related to the elevated 27-OHC concentration in the brain. After aerobic exercise, the giant lysosomes in the brains of APP/PS1 mice raised on a high-cholesterol diet decreased in size and restored impaired lysosomal function.\u003c/p\u003e \u003cp\u003eA decline in synapse-associated proteins is associated with impaired memory in AD\u003csup\u003e[\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e]\u003c/sup\u003e. These proteins are widespread in pre- and postsynaptic membranes and vesicles and are thought to play an important role in the transfer, docking, and release of contents from synaptic vesicles, which have been linked to learning and memory abilities \u003csup\u003e[\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e, \u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e]\u003c/sup\u003e. Cholesterol plays an important role in brain plasticity and synaptic function, as well as activation and synaptic transmission during LTP\u003csup\u003e[\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e]\u003c/sup\u003e. Research has shown that elevated levels of 27-OHC significantly reduce spine density, decrease the number of dendritic branches, inhibit PSD-95 synthesis\u003csup\u003e[\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]\u003c/sup\u003e, and reduce production of Arc, the \u0026ldquo;memory protein\u0026rdquo; in the hippocampus\u003csup\u003e[\u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e]\u003c/sup\u003e. However, Cyp27Tg mice exhibit lower levels of Arc and PSD-95 in the hippocampus\u003csup\u003e[\u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e89\u003c/span\u003e]\u003c/sup\u003e. In this study, the expression of synapse-associated proteins PSD-95 and SYN, as well as the related genes GAP43, Arc, SNAP25, and MAP2, was examined. The results showed that a high-cholesterol diet exacerbated the already impaired level of synapse-associated function in APP/PS1 mice, which was restored after aerobic exercise. This result is similar to the findings of Chao et al., who used 6-month-old APP/PS1 mice for a 4-month period of running table exercises \u003csup\u003e[\u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e90\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eResearch has shown that high levels of 27-OHC are cytotoxic and can induce apoptosis\u003csup\u003e[\u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e91\u003c/span\u003e]\u003c/sup\u003e. Therefore, in the present study, we examined apoptotic cell death in the mouse brain using Nissl staining and detected the levels of the anti-apoptotic protein Bcl-2 and the pro-apoptotic protein Bax in mouse brain. The results showed that a high-cholesterol diet exacerbated apoptosis in the brain of APP/PS1 mice, which was restored after aerobic exercise.\u003c/p\u003e \u003cp\u003eThis study has some limitations. The current findings suggest that aerobic exercise modulates 27-OHC content to improve lysosomal function and further reveal the complex relationship between aerobic exercise, the liver-brain axis (peripheral 27-OHC and intracerebral 27-OHC metabolism), and cognitive functions. However, the synthesis of 27-OHC is influenced by its associated metabolic enzymes. In the present study, the activities of these enzymes were not determined, and only the expression levels of genes related to lysosomal function were assessed. Although the expression of lysosomal function-related proteins is affected by their upstream regulators NPC1 and NPC2, it has been reported that 27-OHC treatment leads to the downregulation of the gene and protein levels of lysosomal proteins NPC1 and NPC2 in SH-SY5Y cells\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e; however, the mechanisms were not further explored in this study.\u003c/p\u003e \u003cp\u003eIn conclusion, our results showed that aerobic exercise could significantly reduce the level of 27-OHC in the brain tissues of APP/PS1 mice induced by a high-cholesterol diet via the liver-brain axis, while upregulating the expression of genes related to lysosomal function, reducing the synthesis of hepatic 27-OHC, and attenuating the damage of the blood-brain barrier (BBB) in mice of the ADE-HFD group. This further reduced the 27-OHC content in the brain and improved cognitive function. These results suggest that modulation of lysosomal function by aerobic exercise may play an important role in ameliorating AD pathology and emphasize the potential of modulating brain 27-OHC content as a therapeutic strategy to attenuate cognitive deficits in patients with AD.\u003c/p\u003e"},{"header":"4. Materials and methods","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e4.1 Experimental Animals and Groups\u003c/h2\u003e\n \u003cp\u003eThis study used 36 male APP/PS1 double-transgenic mice and 12 male C57BL/6J mice, all aged 3 months. APP/PS1 mice were divided into the AD quiet group (ADC), AD high cholesterol-fed group (ADC-HDF), and AD high cholesterol-fed exercise group (ADE-HDF), and the C57BL/6J mice were the wild-type quiet group (WTC). C57BL/6J male wild-type and APP/PS1 male double-transgenic mice were purchased from Changsha, China (License No. SCXK (Xiang) 2019-0014). The mice were kept in 12 h light: 12 h darkness at a constant temperature of 23\u0026ndash;25℃, and they were provided with sufficient food and water. All experimental procedures were approved by the Professional Committee of Animal Behavior of Hunan Normal University.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003e\u003cstrong\u003e4.2 Movement Program\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eThe treadmill exercise program was based on previous studies of mouse exercise programs \u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e92\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e93\u003c/span\u003e]\u003c/sup\u003e. The mice in the ADE-HDF group were acclimated to the running platform with 15 min of training per day at speeds of 5, 8, and 12 m/min for 3 days. They were then trained for five days per week, with rest on Thursdays and Sundays, and each training period lasted 45 min. Formal training began in week 1 at an initial speed of 7 m/min, increased in increments of 1 m/min per week to 14 m/min in week 8, and the speed was maintained at 15 m/min from weeks 9 to 12.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003e4.3 Morris Water Maze Test, MWM\u003c/h2\u003e\n \u003cp\u003eThe mice were assessed for spatial learning and memory using the Morris water maze (MWM) test as a 7-day behavioral test after 12 weeks of exercise. The methodology used was consistent with that of a previous study \u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e94\u003c/span\u003e]\u003c/sup\u003e. The mice were tested in a white circular pool kept at 25\u0026deg;C with a diameter of 1.5 m and height of 0.5 m. A platform with a diameter of 10 cm was placed 1.5 cm underwater. The test was divided into three parts: the adaptation phase, the localization and navigation phase, and the spatial exploration phase. During the adaptation phase, each mouse was placed in water for 10 min for acclimatization without placing the platform. The localization and navigation phases were carried out after the adaptation phase. The pool was divided into four quadrants, and each mouse was tested four times a day. The platform was placed in the pool, mice were randomly placed into four quadrants, and each mouse was given 60 s to search for the platform. If the mouse did not find for the platform within 60 s, it was guided to the platform and allowed to stay on it for 10s, and the latency of the mouse was recorded as 60 s. The platform was withdrawn during the spatial exploration phase, and each mouse was subjected to four trials per day. The mice were videorecorded, and the activity trajectories of mice swimming freely in different quadrants were observed for 60 s. Parameters such as latency, number of platform crossings, and total swimming distance were quantified and statistically analyzed from the videorecordings.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003e\u003cstrong\u003e4.4 Specimen Collection\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eAt the end of the MWM experiment, mice were given free access to water and fasted for 12 h, after which they were anesthetized with isoflurane. Blood was collected from the left ventricle and centrifuged, and the supernatant was stored at -80\u0026deg;C for enzyme-linked immunosorbent assay (ELISA). The mice then underwent cardiac perfusion with 4% paraformaldehyde. Brain tissues and livers from 4 mice per group were dissected out and postfixed in 4% paraformaldehyde, and the brain tissues and livers from the remaining mice were rapidly frozen in liquid nitrogen and stored in at -80℃ for backup.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003e\u003cstrong\u003e4.5 ELISA\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eWe quantified 27-OHC concentrations in the brain tissue and serum using an ELISA kit (SPS-20041, Saipeisenbio, Shanghai, China). The absorbance at 450 nm (OD450 nm) was measured using a spectrophotometer (Bio-Rad, Hercules, CA, USA), and the measured data were compared with a standard curve to calculate the 27-OHC concentration in the samples.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003e4.6 Real-Time PCR\u003c/h2\u003e\n \u003cp\u003eRT-PCR was performed as described previously \u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e94\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e95\u003c/span\u003e]\u003c/sup\u003e. Tissue was lysed and total RNA was extracted using TRIzol reagent (RNA extraction solution). According to the detected RNA concentration, reverse transcription was performed using the Reverse Transcription Kit (TRAN, AT311) according to the manufacturer\u0026rsquo;s instructions. The total reaction volume was 20 \u0026micro;L, with Anchored Oligo 1 \u0026micro;L, 2\u0026times;TS Reaction Mix 10 \u0026micro;L, Enzyme Mix 1 \u0026micro;L, gDNA Remover 1 \u0026micro;L, and DEPC water 7 \u0026micro;L. The reaction placed into a MiniAmp PCR instrument for reverse transcription and qRT-PCR using the CFX ConnectTM Real-Time System (Bio-Rad, Singapore). GAPDH was detected as an internal reference gene, and the relative expression of the target gene mRNA was calculated using the 2-∆∆CT method, as detailed in Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eSequences of primers for target genes.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"3\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eForward Primer\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReverse Primer\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eArc\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCCGCAGAAGCAGGGTGAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCCTCCTCAGCGTCCACATACAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eMAP2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAGAAGGAAGCCCAACACAAGGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTGGCGAAGGTGGCAGATTAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eSNAP25\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAGCAGGTGAGCGGCATCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTTGCACGTTGGTTGGCTTCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eGAP43\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCTCAGCGGAGACAGAAAGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGTGGTGGCAGCAGCATCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eAtp6V1h\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGTTGCTGCTCACGATGTTGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCGAACCTGCTGGTCTTCATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLIMP2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACTGGGTGTGTTCTTTGGCTTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGTTCGTATGAGGGGTGCTCTTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLAMP2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCAACTCCAACTCCAACTCCAACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCACCTTCTCCTCAGTGATGTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLAMP1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGTTTGGGTCTGTGGAAGAGTGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGGTAGGCAATGAGGACGATGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGAAGGTCGGTGTGAACGGATTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCGCTCCTGGAAGATGGTGATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003e\u003cstrong\u003e4.7 Immunohistochemistry\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eTissues were embedded in paraffin and sectioned onto slides. The sections were sequentially placed into environmentally friendly dewaxing solutions Ⅰ, Ⅱ, and Ⅲ for 10 min each, and then placed into anhydrous ethanol Ⅰ, Ⅱ, and Ⅲ for 5 min each, washed with distilled water, and dewaxed with water. Subsequently, antigen repair was performed according to the desired conditions, during which care was taken to prevent excessive evaporation of the buffer to avoid drying out the slices. After antigen repair and natural cooling, the sections were placed in phosphate-buffered saline (PBS) and washed three times for 5 min each. To block endogenous peroxidase activity, sections were incubated with 3% hydrogen peroxide for 25 minutes at room temperature in the dark, washed with PBS three times, and 3% bovine serum albumin (BSA) was added for 30 minutes. The BSA was replaced with the appropriate dilution of primary antibody. After sealing, the excess liquid was gently removed. The sections were placed flat in a wet box and incubated at 4\u0026deg;C overnight. The following day, the sections were removed from the wet box, placed in PBS (pH 7.4), washed three times for 5 min each on a decolorizing shaker, shaken dry, and then horseradish peroxidase-labeled (HRP)-labeled secondary antibody corresponding to the primary antibody species was added dropwise to the histochemistry circle, covering the tissues, and incubated at room temperature for 50 min. The sections were washed again with PBS (pH 7.4) three times, each time for 5 min, and after shaking dry, freshly prepared diaminobenzidine color development solution was added dropwise. Color development was observed under a microscope, and the positive signal was brownish-yellow. The reaction was terminated by rinsing the sections with tap water. Finally, the slides were sequentially dehydrated in 75% alcohol, 85% alcohol, anhydrous ethanol I, II, and n-butanol for 5 min each and then treated with xylene I for 5 min. The slides were removed and dried slightly, sealed with sealing adhesive, examined microscopically, and images were captured for analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003ch2\u003e4.8 Western Blotting Analysis\u003c/h2\u003e\n \u003cp\u003eWestern blotting was performed as previously described \u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e94\u003c/span\u003e]\u003c/sup\u003e. The collected 30 mg of brain tissue or 30 mg of liver tissue was placed in RIPA buffer with protease/phosphatase inhibitor cocktail, and the tissue was sufficiently homogenized with a cryomill. The lysed tissues were allowed to stand at 4℃ for 30 min, with gentle agitation with a pipette every 10 min, and then the tissues were centrifuged at 4℃ and 12,000 rpm for 15 min. The supernatant was extracted, and the protein concentration was determined using the BCA Protein Quantification Kit (Servicebio, G2026-200T, Wuhan, China). The protein samples were electrophoresed and transferred to a PVDF membrane, which was then placed at room temperature in 5% skimmed milk dissolved in TBST for 1.5 h. After the blocking step, the primary antibody was added and the membrane was incubated at 4\u0026deg;C overnight. The following day, the membrane was washed with TBST 3 times for 10 min each. The membrane was incubated in the secondary antibody with shaking at room temperature for 1.5 h and then washed thrice with TBS for 10 min each to ensure that the unbound secondary antibody was completely removed. Subsequently, the ECL luminescence kit was used to take pictures in a Tanon-5200 gel system. The PVDF membrane was immersed in the ECL developer solution, the protein was detected using the Thermo Fisher Imaging System, and the optical density was quantified using ImageJ software. The antibodies used were: ZO-1 (1:20,000, 21773-1-AP, Proteintech, Wuhan, China), Occludin (1:2000, ab216327, abcam, Cambridge, UK), Claudin 5 (1:10,000, ab131259, abcam, Cambridge, UK), Cathepsin D (1:5000, ab75852, abcam, Cambridge, UK), CYP27A1 (1:10000, ab126785, abcam, Cambridge, UK), CYP7B1 (1:8000, ab138497, abcam, Cambridge, UK), Synaptophysin (1:20000, 17785-1-AP, Proteintech, Wuhan, China), PSD-95 (1:2000, ab238135, abcam, Cambridge, UK), GAPDH (1:2000, GB15004, Servicebio, Wuhan, China), HRP-conjugated Goat Anti-Mouse IgG (1:5000, GB23301, Servicebio, Wuhan, China), and HRP-conjugated Goat Anti-Rabbit IgG (1:3000, GB23303, Servicebio, Wuhan, China).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003e4.9 Nissl Staining\u003c/h2\u003e\n \u003cp\u003eAfter dewaxing in water, the paraffin slices were sequentially washed with environmentally friendly dewaxing solutions I and II for 20 min each, anhydrous ethanol I and II for 5 min each, 75% alcohol for 5 min, and tap water. The slices were stained for 2\u0026ndash;5 minutes, washed, differentiated with 0.1% glacial acetic acid, washed again to terminate the reaction, observed under a microscope to control the degree of differentiation, and then oven-dried. The sections were made transparent with xylene for 10 min, sealed with neutral gum, microscopically examined, and imaged.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n \u003ch2\u003e4.10 HE Staining\u003c/h2\u003e\n \u003cp\u003eThe slices were conventionally dewaxed by incubating in environmentally friendly dewaxing solution Ⅰ and Ⅱ, each for 20 min; anhydrous ethanol Ⅰ, Ⅱ, each 5 minutes; 75% alcohol for 5 minutes, and washed with tap water. Hematoxylin staining was performed for 3\u0026ndash;5 minutes, differentiated, returned to blue, and rinsed with running water. Gradient alcohol (85%, 95%) dehydration was performed for 5 min each and eosin staining for 5 min. The slides were dehydrated with anhydrous ethanol Ⅰ, Ⅱ, and Ⅲ for 5 min each, followed by xylene Ⅰ, Ⅱ transparent for 5 min each, and finally neutral gum sealing. Microscopic examination and image acquisition was performed.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n \u003ch2\u003e\u003cstrong\u003e4.11 Statistical Analysis\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eAll data were analyzed using GraphPad Prism 8.0 software (GraphPad Software, San Diego, CA, USA). The effects of genotype and exercise on mice were compared by two-way ANOVA with post hoc multiple comparisons using the least significant difference method to assess the statistical significance of differences between groups and independent samples t-tests for simple effects analysis to determine the effect of this factor within groups. Data were expressed as mean and standard deviation (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD). p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions:\u003c/strong\u003e Zeyu Chen and Zelin Hu were responsible for experimental design, data analysis, and article writing; Jingran Xiao, Siqing Luorong, and Fanqi Zeng were responsible for feeding the experimental animals; Xia Tao and Weijia Wu were partially responsible for the experimental data; Zhiyuan Wang, Xia Liu, and Wenfeng Liu Zhiyuan Wang, Xia Liu and Wenfeng Liu provided experimental reagents and supervised the project. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal study protocol was approved by the Biomedical Research Ethics Committee of Hunan Normal University (Ethics Section 2021 No. 198).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInformed Consent Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate and Publish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study did not involve human subjects.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData described in the manuscript are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding sources\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe present study was supported by the Hunan Provincial Natural Science Foundation (2023JJ30429), the Changsha City Natural Science Foundation (kq2202251 and kq2208177), the Key Project of Hunan Provincial Education Department (20A333 and 21B0895), and the Scientific Research Program of Hunan Provincial Department of Education (21B0895 and 23B1015),Key Projects of Scientific Research Program of Hunan Provincial Department of Education (24A0435)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors and Affiliations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFirst / Given Name:Zeyu\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLast / Family Name:Chen\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWork unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China\u003c/p\u003e\n\u003cp\u003eFirst / Given Name:Zelin\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLast / Family Name:Hu\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWork unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China\u003c/p\u003e\n\u003cp\u003eFirst / Given Name:Jingran\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLast / Family Name:Xiao\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWork unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China\u003c/p\u003e\n\u003cp\u003eFirst / Given Name:Xia\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLast / Family Name:Tao\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWork unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China\u003c/p\u003e\n\u003cp\u003eFirst / Given Name:Fanqi\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLast / Family Name:Zeng\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWork unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China\u003c/p\u003e\n\u003cp\u003eFirst / Given Name:Siqing\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLast / Family Name:Luorong\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWork unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China\u003c/p\u003e\n\u003cp\u003eFirst / Given Name:Weijia\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLast / Family Name:Wu\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWork unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China\u003c/p\u003e\n\u003cp\u003eFirst / Given Name:Zhiyuan\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLast / Family Name:Wang\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWork unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China\u003c/p\u003e\n\u003cp\u003eFirst / Given Name:Xia\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLast / Family Name:Liu\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWork unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China\u003c/p\u003e\n\u003cp\u003eFirst / Given Name:Wenfeng\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLast / Family Name:Liu\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWork unit and organization information:Hunan Provincial Key Laboratory of Physical Fitness and Sports Rehabilitation, Hunan Normal University, Changsha,Hunan, 410012, People’s Republic of China\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eXue-Shan Z, Juan P, Qi W, et al. Imbalanced cholesterol metabolism in Alzheimer\u0026apos;s disease. Clin Chim Acta, 2016, 456: 107-114\u003c/li\u003e\n \u003cli\u003eZhang J and Liu Q. Cholesterol metabolism and homeostasis in the brain. Protein Cell, 2015, 6(4): 254-64\u003c/li\u003e\n \u003cli\u003eFerris HA, Perry RJ, Moreira GV, et al. Loss of astrocyte cholesterol synthesis disrupts neuronal function and alters whole-body metabolism. Proc Natl Acad Sci U S A, 2017, 114(5): 1189-1194\u003c/li\u003e\n \u003cli\u003eFeringa FM and van der Kant R. Cholesterol and Alzheimer\u0026apos;s Disease; From Risk Genes to Pathological Effects. Front Aging Neurosci, 2021, 13: 690372\u003c/li\u003e\n \u003cli\u003eRoca-Agujetas V, Barbero-Camps E, de Dios C, et al. Cholesterol alters mitophagy by impairing optineurin recruitment and lysosomal clearance in Alzheimer\u0026apos;s disease. Mol Neurodegener, 2021, 16(1): 15\u003c/li\u003e\n \u003cli\u003eMancini G, Dias C, Lourenco CF, et al. A High Fat/Cholesterol Diet Recapitulates Some Alzheimer\u0026apos;s Disease-Like Features in Mice: Focus on Hippocampal Mitochondrial Dysfunction. J Alzheimers Dis, 2021, 82(4): 1619-1633\u003c/li\u003e\n \u003cli\u003eBarron AM, Rosario ER, Elteriefi R, et al. Sex-specific effects of high fat diet on indices of metabolic syndrome in 3xTg-AD mice: implications for Alzheimer\u0026apos;s disease. PLoS One, 2013, 8(10): e78554\u003c/li\u003e\n \u003cli\u003eRuan Y, Tang J, Guo X, et al. Dietary Fat Intake and Risk of Alzheimer\u0026apos;s Disease and Dementia: A Meta-Analysis of Cohort Studies. Curr Alzheimer Res, 2018, 15(9): 869-876\u003c/li\u003e\n \u003cli\u003eGhribi O, Larsen B, Schrag M, et al. High cholesterol content in neurons increases BACE, beta-amyloid, and phosphorylated tau levels in rabbit hippocampus. Exp Neurol, 2006, 200(2): 460-7\u003c/li\u003e\n \u003cli\u003eWu M, Zhai Y, Liang X, et al. Connecting the Dots Between Hypercholesterolemia and Alzheimer\u0026apos;s Disease: A Potential Mechanism Based on 27-Hydroxycholesterol. Front Neurosci, 2022, 16: 842814\u003c/li\u003e\n \u003cli\u003eLutjohann D, Breuer O, Ahlborg G, et al. Cholesterol homeostasis in human brain: evidence for an age-dependent flux of 24S-hydroxycholesterol from the brain into the circulation. Proc Natl Acad Sci U S A, 1996, 93(18): 9799-804\u003c/li\u003e\n \u003cli\u003eBjorkhem I. Crossing the barrier: oxysterols as cholesterol transporters and metabolic modulators in the brain. J Intern Med, 2006, 260(6): 493-508\u003c/li\u003e\n \u003cli\u003eMeaney S, Heverin M, Panzenboeck U, et al. Novel route for elimination of brain oxysterols across the blood-brain barrier: conversion into 7alpha-hydroxy-3-oxo-4-cholestenoic acid. J Lipid Res, 2007, 48(4): 944-51\u003c/li\u003e\n \u003cli\u003eBrown J, 3rd, Theisler C, Silberman S, et al. Differential expression of cholesterol hydroxylases in Alzheimer\u0026apos;s disease. J Biol Chem, 2004, 279(33): 34674-81\u003c/li\u003e\n \u003cli\u003eGamba P, Guglielmotto M, Testa G, et al. Up-regulation of beta-amyloidogenesis in neuron-like human cells by both 24- and 27-hydroxycholesterol: protective effect of N-acetyl-cysteine. Aging Cell, 2014, 13(3): 561-72\u003c/li\u003e\n \u003cli\u003eLoera-Valencia R, Ismail MA, Goikolea J, et al. Hypercholesterolemia and 27-Hydroxycholesterol Increase S100A8 and RAGE Expression in the Brain: a Link Between Cholesterol, Alarmins, and Neurodegeneration. Mol Neurobiol, 2021, 58(12): 6063-6076\u003c/li\u003e\n \u003cli\u003eMutemberezi V, Guillemot-Legris O and Muccioli GG. Oxysterols: From cholesterol metabolites to key mediators. Prog Lipid Res, 2016, 64: 152-169\u003c/li\u003e\n \u003cli\u003eLiu Q, An Y, Yu H, et al. Relationship between oxysterols and mild cognitive impairment in the elderly: a case-control study. Lipids Health Dis, 2016, 15(1): 177\u003c/li\u003e\n \u003cli\u003eLoera-Valencia R, Vazquez-Juarez E, Munoz A, et al. High levels of 27-hydroxycholesterol results in synaptic plasticity alterations in the hippocampus. Sci Rep, 2021, 11(1): 3736\u003c/li\u003e\n \u003cli\u003eZhang X, Lv C, An Y, et al. Increased Levels of 27-Hydroxycholesterol Induced by Dietary Cholesterol in Brain Contribute to Learning and Memory Impairment in Rats. Mol Nutr Food Res, 2018, 62(3):\u003c/li\u003e\n \u003cli\u003ede Duve C. The lysosome turns fifty. Nat Cell Biol, 2005, 7(9): 847-9\u003c/li\u003e\n \u003cli\u003eLing D, Magallanes M and Salvaterra PM. Accumulation of amyloid-like Abeta1-42 in AEL (autophagy-endosomal-lysosomal) vesicles: potential implications for plaque biogenesis. ASN Neuro, 2014, 6(2):\u003c/li\u003e\n \u003cli\u003ePlatt FM, d\u0026apos;Azzo A, Davidson BL, et al. Lysosomal storage diseases. Nat Rev Dis Primers, 2018, 4(1): 27\u003c/li\u003e\n \u003cli\u003ePlatt FM, Boland B and van der Spoel AC. The cell biology of disease: lysosomal storage disorders: the cellular impact of lysosomal dysfunction. J Cell Biol, 2012, 199(5): 723-34\u003c/li\u003e\n \u003cli\u003eNilsson P and Saido TC. Dual roles for autophagy: degradation and secretion of Alzheimer\u0026apos;s disease Abeta peptide. Bioessays, 2014, 36(6): 570-8\u003c/li\u003e\n \u003cli\u003eSong GL, Chen C, Wu QY, et al. Selenium-enriched yeast inhibited beta-amyloid production and modulated autophagy in a triple transgenic mouse model of Alzheimer\u0026apos;s disease. Metallomics, 2018, 10(8): 1107-1115\u003c/li\u003e\n \u003cli\u003eBurns M and Duff K. Cholesterol in Alzheimer\u0026apos;s disease and tauopathy. Ann N Y Acad Sci, 2002, 977: 367-75\u003c/li\u003e\n \u003cli\u003eChen S, Zhou C, Yu H, et al. 27-Hydroxycholesterol Contributes to Lysosomal Membrane Permeabilization-Mediated Pyroptosis in Co-cultured SH-SY5Y Cells and C6 Cells. Front Mol Neurosci, 2019, 12: 14\u003c/li\u003e\n \u003cli\u003eShafaati M, Marutle A, Pettersson H, et al. Marked accumulation of 27-hydroxycholesterol in the brains of Alzheimer\u0026apos;s patients with the Swedish APP 670/671 mutation. J Lipid Res, 2011, 52(5): 1004-10\u003c/li\u003e\n \u003cli\u003eMarwarha G and Ghribi O. Does the oxysterol 27-hydroxycholesterol underlie Alzheimer\u0026apos;s disease-Parkinson\u0026apos;s disease overlap? Exp Gerontol, 2015, 68: 13-8\u003c/li\u003e\n \u003cli\u003eHeverin M, Meaney S, Lutjohann D, et al. Crossing the barrier: net flux of 27-hydroxycholesterol into the human brain. J Lipid Res, 2005, 46(5): 1047-52\u003c/li\u003e\n \u003cli\u003eHeverin M, Maioli S, Pham T, et al. 27-hydroxycholesterol mediates negative effects of dietary cholesterol on cognition in mice. Behav Brain Res, 2015, 278: 356-9\u003c/li\u003e\n \u003cli\u003eDai L, Zou L, Meng L, et al. Cholesterol Metabolism in Neurodegenerative Diseases: Molecular Mechanisms and Therapeutic Targets. Mol Neurobiol, 2021, 58(5): 2183-2201\u003c/li\u003e\n \u003cli\u003ePoirier P, Giles TD, Bray GA, et al. Obesity and cardiovascular disease: pathophysiology, evaluation, and effect of weight loss: an update of the 1997 American Heart Association Scientific Statement on Obesity and Heart Disease from the Obesity Committee of the Council on Nutrition, Physical Activity, and Metabolism. Circulation, 2006, 113(6): 898-918\u003c/li\u003e\n \u003cli\u003eGuo DH, Yamamoto M, Hernandez CM, et al. Visceral adipose NLRP3 impairs cognition in obesity via IL-1R1 on CX3CR1+ cells. J Clin Invest, 2020, 130(4): 1961-1976\u003c/li\u003e\n \u003cli\u003eLuo J, Yang H and Song BL. Mechanisms and regulation of cholesterol homeostasis. Nat Rev Mol Cell Biol, 2020, 21(4): 225-245\u003c/li\u003e\n \u003cli\u003eOkada T, Ikeda K, Wakabayashi M, et al. Formation of toxic Abeta(1-40) fibrils on GM1 ganglioside-containing membranes mimicking lipid rafts: polymorphisms in Abeta(1-40) fibrils. J Mol Biol, 2008, 382(4): 1066-74\u003c/li\u003e\n \u003cli\u003eDjelti F, Braudeau J, Hudry E, et al. CYP46A1 inhibition, brain cholesterol accumulation and neurodegeneration pave the way for Alzheimer\u0026apos;s disease. Brain, 2015, 138(Pt 8): 2383-98\u003c/li\u003e\n \u003cli\u003eZhao YF, Wang L, Lee S, et al. Cholesterol induces mitochondrial dysfunction and apoptosis in mouse pancreatic beta-cell line MIN6 cells. Endocrine, 2010, 37(1): 76-82\u003c/li\u003e\n \u003cli\u003eNewton JL, Hollingsworth KG, Taylor R, et al. Cognitive impairment in primary biliary cirrhosis: symptom impact and potential etiology. Hepatology, 2008, 48(2): 541-9\u003c/li\u003e\n \u003cli\u003eSerrano-Pozo A, Das S and Hyman BT. APOE and Alzheimer\u0026apos;s disease: advances in genetics, pathophysiology, and therapeutic approaches. Lancet Neurol, 2021, 20(1): 68-80\u003c/li\u003e\n \u003cli\u003eFraile-Ramos J, Garrit A, Reig-Vilallonga J, et al. Hepatic Oxi-Inflammation and Neophobia as Potential Liver-Brain Axis Targets for Alzheimer\u0026apos;s Disease and Aging, with Strong Sensitivity to Sex, Isolation, and Obesity. Cells, 2023, 12(11):\u003c/li\u003e\n \u003cli\u003eZhang L, Li X, Liu X, et al. High-Carbohydrate Diet Consumption Poses a More Severe Liver Cholesterol Deposition than a High-Fat and High-Calorie Diet in Mice. Int J Mol Sci, 2023, 24(19):\u003c/li\u003e\n \u003cli\u003eNunes VS, da Silva Ferreira G and Quintao ECR. Cholesterol metabolism in aging simultaneously altered in liver and nervous system. Aging (Albany NY), 2022, 14(3): 1549-1561\u003c/li\u003e\n \u003cli\u003eYan M, Man S, Sun B, et al. Gut liver brain axis in diseases: the implications for therapeutic interventions. Signal Transduct Target Ther, 2023, 8(1): 443\u003c/li\u003e\n \u003cli\u003eZlokovic BV. Neurovascular pathways to neurodegeneration in Alzheimer\u0026apos;s disease and other disorders. Nat Rev Neurosci, 2011, 12(12): 723-38\u003c/li\u003e\n \u003cli\u003eRoher AE, Kuo YM, Esh C, et al. Cortical and leptomeningeal cerebrovascular amyloid and white matter pathology in Alzheimer\u0026apos;s disease. Mol Med, 2003, 9(3-4): 112-22\u003c/li\u003e\n \u003cli\u003eDaugvilaite V, Arfelt KN, Benned-Jensen T, et al. Oxysterol-EBI2 signaling in immune regulation and viral infection. Eur J Immunol, 2014, 44(7): 1904-12\u003c/li\u003e\n \u003cli\u003eLubke T, Lobel P and Sleat DE. Proteomics of the lysosome. Biochim Biophys Acta, 2009, 1793(4): 625-35\u003c/li\u003e\n \u003cli\u003eLee JH, Yang DS, Goulbourne CN, et al. Faulty autolysosome acidification in Alzheimer\u0026apos;s disease mouse models induces autophagic build-up of Abeta in neurons, yielding senile plaques. Nat Neurosci, 2022, 25(6): 688-701\u003c/li\u003e\n \u003cli\u003eFraldi A, Klein AD, Medina DL, et al. Brain Disorders Due to Lysosomal Dysfunction. Annu Rev Neurosci, 2016, 39: 277-95\u003c/li\u003e\n \u003cli\u003eChen X, Wagener JF, Ghribi O, et al. Role of Endolysosomes in Skeletal Muscle Pathology Observed in a Cholesterol-Fed Rabbit Model of Alzheimer\u0026apos;s Disease. Front Aging Neurosci, 2016, 8: 129\u003c/li\u003e\n \u003cli\u003eSuire CN, Abdul-Hay SO, Sahara T, et al. Cathepsin D regulates cerebral Abeta42/40 ratios via differential degradation of Abeta42 and Abeta40. Alzheimers Res Ther, 2020, 12(1): 80\u003c/li\u003e\n \u003cli\u003eIyaswamy A, Wang X, Krishnamoorthi S, et al. Theranostic F-SLOH mitigates Alzheimer\u0026apos;s disease pathology involving TFEB and ameliorates cognitive functions in Alzheimer\u0026apos;s disease models. Redox Biol, 2022, 51: 102280\u003c/li\u003e\n \u003cli\u003eRamalho RM, Nunes AF, Dias RB, et al. Tauroursodeoxycholic acid suppresses amyloid beta-induced synaptic toxicity in vitro and in APP/PS1 mice. Neurobiol Aging, 2013, 34(2): 551-61\u003c/li\u003e\n \u003cli\u003eShankar GM, Li S, Mehta TH, et al. Amyloid-beta protein dimers isolated directly from Alzheimer\u0026apos;s brains impair synaptic plasticity and memory. Nat Med, 2008, 14(8): 837-42\u003c/li\u003e\n \u003cli\u003eQu L, Xu S, Lan Z, et al. Apolipoprotein E in Alzheimer\u0026apos;s Disease: Focus on Synaptic Function and Therapeutic Strategy. Mol Neurobiol, 2025, 62(3): 3040-3052\u003c/li\u003e\n \u003cli\u003eStaurenghi E, Cerrato V, Gamba P, et al. Oxysterols present in Alzheimer\u0026apos;s disease brain induce synaptotoxicity by activating astrocytes: A major role for lipocalin-2. Redox Biol, 2021, 39: 101837\u003c/li\u003e\n \u003cli\u003eShao CY, Mirra SS, Sait HB, et al. Postsynaptic degeneration as revealed by PSD-95 reduction occurs after advanced Abeta and tau pathology in transgenic mouse models of Alzheimer\u0026apos;s disease. Acta Neuropathol, 2011, 122(3): 285-92\u003c/li\u003e\n \u003cli\u003eShupliakov O, Haucke V and Pechstein A. How synapsin I may cluster synaptic vesicles. Semin Cell Dev Biol, 2011, 22(4): 393-9\u003c/li\u003e\n \u003cli\u003eAnsari MA, Rao MS and Al-Jarallah A. Insights into early pathogenesis of sporadic Alzheimer\u0026apos;s disease: role of oxidative stress and loss of synaptic proteins. Front Neurosci, 2023, 17: 1273626\u003c/li\u003e\n \u003cli\u003eReddy PH, Yin X, Manczak M, et al. Mutant APP and amyloid beta-induced defective autophagy, mitophagy, mitochondrial structural and functional changes and synaptic damage in hippocampal neurons from Alzheimer\u0026apos;s disease. Hum Mol Genet, 2018, 27(14): 2502-2516\u003c/li\u003e\n \u003cli\u003eMurakami K, Irie K, Morimoto A, et al. Synthesis, aggregation, neurotoxicity, and secondary structure of various A beta 1-42 mutants of familial Alzheimer\u0026apos;s disease at positions 21-23. Biochem Biophys Res Commun, 2002, 294(1): 5-10\u003c/li\u003e\n \u003cli\u003eCallens M, Kraskovskaya N, Derevtsova K, et al. The role of Bcl-2 proteins in modulating neuronal Ca(2+) signaling in health and in Alzheimer\u0026apos;s disease. Biochim Biophys Acta Mol Cell Res, 2021, 1868(6): 118997\u003c/li\u003e\n \u003cli\u003eKudo W, Lee HP, Smith MA, et al. Inhibition of Bax protects neuronal cells from oligomeric Abeta neurotoxicity. Cell Death Dis, 2012, 3(5): e309\u003c/li\u003e\n \u003cli\u003eParadis E, Douillard H, Koutroumanis M, et al. Amyloid beta peptide of Alzheimer\u0026apos;s disease downregulates Bcl-2 and upregulates bax expression in human neurons. J Neurosci, 1996, 16(23): 7533-9\u003c/li\u003e\n \u003cli\u003eGinsberg SD, Alldred MJ, Counts SE, et al. Microarray analysis of hippocampal CA1 neurons implicates early endosomal dysfunction during Alzheimer\u0026apos;s disease progression. Biol Psychiatry, 2010, 68(10): 885-93\u003c/li\u003e\n \u003cli\u003eWang Y, Hao L, Wang T, et al. 27-Hydroxycholesterol-Induced Dysregulation of Cholesterol Metabolism Impairs Learning and Memory Ability in ApoE epsilon4 Transgenic Mice. Int J Mol Sci, 2022, 23(19):\u003c/li\u003e\n \u003cli\u003eTesta G, Staurenghi E, Zerbinati C, et al. Changes in brain oxysterols at different stages of Alzheimer\u0026apos;s disease: Their involvement in neuroinflammation. Redox Biol, 2016, 10: 24-33\u003c/li\u003e\n \u003cli\u003eSandebring-Matton A, Goikolea J, Bjorkhem I, et al. 27-Hydroxycholesterol, cognition, and brain imaging markers in the FINGER randomized controlled trial. Alzheimers Res Ther, 2021, 13(1): 56\u003c/li\u003e\n \u003cli\u003eZhang DD, Yu HL, Ma WW, et al. 27-Hydroxycholesterol contributes to disruptive effects on learning and memory by modulating cholesterol metabolism in the rat brain. Neuroscience, 2015, 300: 163-73\u003c/li\u003e\n \u003cli\u003eBrown MS and Goldstein JL. The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell, 1997, 89(3): 331-40\u003c/li\u003e\n \u003cli\u003eIsmail MA, Mateos L, Maioli S, et al. 27-Hydroxycholesterol impairs neuronal glucose uptake through an IRAP/GLUT4 system dysregulation. J Exp Med, 2017, 214(3): 699-717\u003c/li\u003e\n \u003cli\u003eWang C, Shou Y, Pan J, et al. The relationship between cholesterol level and Alzheimer\u0026apos;s disease-associated APP proteolysis/Abeta metabolism. Nutr Neurosci, 2019, 22(7): 453-463\u003c/li\u003e\n \u003cli\u003eBjorkhem I, Cedazo-Minguez A, Leoni V, et al. Oxysterols and neurodegenerative diseases. Mol Aspects Med, 2009, 30(3): 171-9\u003c/li\u003e\n \u003cli\u003eLeoni V, Masterman T, Patel P, et al. Side chain oxidized oxysterols in cerebrospinal fluid and the integrity of blood-brain and blood-cerebrospinal fluid barriers. J Lipid Res, 2003, 44(4): 793-9\u003c/li\u003e\n \u003cli\u003eOrth M and Bellosta S. Cholesterol: its regulation and role in central nervous system disorders. Cholesterol, 2012, 2012: 292598\u003c/li\u003e\n \u003cli\u003eVance JE and Karten B. Niemann-Pick C disease and mobilization of lysosomal cholesterol by cyclodextrin. J Lipid Res, 2014, 55(8): 1609-21\u003c/li\u003e\n \u003cli\u003eTrinh MN, Brown MS, Seemann J, et al. Lysosomal cholesterol export reconstituted from fragments of Niemann-Pick C1. Elife, 2018, 7:\u003c/li\u003e\n \u003cli\u003eHattersley KJ, Carosi JM, Hein LK, et al. PICALM regulates cathepsin D processing and lysosomal function. Biochem Biophys Res Commun, 2021, 570: 103-109\u003c/li\u003e\n \u003cli\u003eHaidar B, Kiss RS, Sarov-Blat L, et al. Cathepsin D, a lysosomal protease, regulates ABCA1-mediated lipid efflux. J Biol Chem, 2006, 281(52): 39971-81\u003c/li\u003e\n \u003cli\u003eTian L, Zhang K, Tian ZY, et al. Decreased expression of cathepsin D in monocytes is related to the defective degradation of amyloid-beta in Alzheimer\u0026apos;s disease. J Alzheimers Dis, 2014, 42(2): 511-20\u003c/li\u003e\n \u003cli\u003eYasuda Y, Tsukuba T, Okamoto K, et al. The role of the cathepsin E propeptide in correct folding, maturation and sorting to the endosome. J Biochem, 2005, 138(5): 621-30\u003c/li\u003e\n \u003cli\u003ePark SW, Seo MK, McIntyre RS, et al. Effects of olanzapine and haloperidol on mTORC1 signaling, dendritic outgrowth, and synaptic proteins in rat primary hippocampal neurons under toxic conditions. Neurosci Lett, 2018, 686: 59-66\u003c/li\u003e\n \u003cli\u003eChen X, Nelson CD, Li X, et al. PSD-95 is required to sustain the molecular organization of the postsynaptic density. J Neurosci, 2011, 31(17): 6329-38\u003c/li\u003e\n \u003cli\u003eLow P, Norlin T, Risinger C, et al. Inhibition of neurotransmitter release in the lamprey reticulospinal synapse by antibody-mediated disruption of SNAP-25 function. Eur J Cell Biol, 1999, 78(11): 787-93\u003c/li\u003e\n \u003cli\u003eBrachet A, Norwood S, Brouwers JF, et al. LTP-triggered cholesterol redistribution activates Cdc42 and drives AMPA receptor synaptic delivery. J Cell Biol, 2015, 208(6): 791-806\u003c/li\u003e\n \u003cli\u003eMateos L, Akterin S, Gil-Bea FJ, et al. Activity-regulated cytoskeleton-associated protein in rodent brain is down-regulated by high fat diet in vivo and by 27-hydroxycholesterol in vitro. Brain Pathol, 2009, 19(1): 69-80\u003c/li\u003e\n \u003cli\u003eMerino-Serrais P, Loera-Valencia R, Rodriguez-Rodriguez P, et al. 27-Hydroxycholesterol Induces Aberrant Morphology and Synaptic Dysfunction in Hippocampal Neurons. Cereb Cortex, 2019, 29(1): 429-446\u003c/li\u003e\n \u003cli\u003eChao F, Jiang L, Zhang Y, et al. Stereological Investigation of the Effects of Treadmill Running Exercise on the Hippocampal Neurons in Middle-Aged APP/PS1 Transgenic Mice. J Alzheimers Dis, 2018, 63(2): 689-703\u003c/li\u003e\n \u003cli\u003eVejux A and Lizard G. Cytotoxic effects of oxysterols associated with human diseases: Induction of cell death (apoptosis and/or oncosis), oxidative and inflammatory activities, and phospholipidosis. Mol Aspects Med, 2009, 30(3): 153-70\u003c/li\u003e\n \u003cli\u003eZhang X, He Q, Huang T, et al. Treadmill Exercise Decreases Abeta Deposition and Counteracts Cognitive Decline in APP/PS1 Mice, Possibly via Hippocampal Microglia Modifications. Front Aging Neurosci, 2019, 11: 78\u003c/li\u003e\n \u003cli\u003eYuan S, Yang J, Jian Y, et al. Treadmill Exercise Modulates Intestinal Microbes and Suppresses LPS Displacement to Alleviate Neuroinflammation in the Brains of APP/PS1 Mice. Nutrients, 2022, 14(19):\u003c/li\u003e\n \u003cli\u003eHu Z, Yuan Y, Tong Z, et al. Aerobic Exercise Facilitates the Nuclear Translocation of SREBP2 by Activating AKT/SEC24D to Contribute Cholesterol Homeostasis for Improving Cognition in APP/PS1 Mice. Int J Mol Sci, 2023, 24(16):\u003c/li\u003e\n \u003cli\u003eYuan S, Wang Y, Yang J, et al. Treadmill exercise can regulate the redox balance in the livers of APP/PS1 mice and reduce LPS accumulation in their brains through the gut-liver-kupffer cell axis. Aging (Albany NY), 2024, 16(2): 1374-1389\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Alzheimer's disease, cholesterol, lysosome, 27-hydroxycholesterol","lastPublishedDoi":"10.21203/rs.3.rs-6361968/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6361968/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTypical pathological features of Alzheimer's disease include disturbances in cholesterol metabolism and defects in lysosomal function in the brain. With age and disease progression, patients with Alzheimer's disease have decreased cholesterol synthesis in the brain and abnormal cholesterol accumulation in neurons, accompanied by elevated 27-hydroxycholesterol concentrations. High-cholesterol diets are more common in Alzheimer's disease patients, which may promote the accumulation of 27-hydroxycholesterol and further exacerbate the disturbance of cholesterol metabolism in the brain. This leads to the entry of 27-hydroxycholesterol into the brain through the blood-brain barrier, where it disrupts lysosomal and synaptic function and ultimately exacerbates neuronal damage and Aβ deposition, contributing to cognitive decline. However, the mechanism underlying elevated 27-hydroxycholesterol concentrations and its relationship with lysosomal dysfunction have not been fully elucidated. In this study, we investigated the role of exercise in modulating peripheral and brain 27-hydroxycholesterol concentrations through a 12-week treadmill aerobic exercise intervention in mice. We found that aerobic exercise improved the function of cholesterol-metabolizing enzymes and restored lysosomal function. Exercise regulates 27-hydroxycholesterol levels through the liver-brain axis and reduces damage to neuronal and synaptic functions, providing new ideas for intervention in neurodegenerative diseases such as Alzheimer's disease.\u003c/p\u003e","manuscriptTitle":"Aerobic exercise improves lysosomal function in the brain of high cholesterol diet-fed APP/PS1 mice by modulating 27-hydroxycholesterol via the liver-brain axis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-09 11:11:57","doi":"10.21203/rs.3.rs-6361968/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"54201594-1cc8-4486-890c-2dd03baaf3b1","owner":[],"postedDate":"May 9th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-05-19T22:38:17+00:00","versionOfRecord":[],"versionCreatedAt":"2025-05-09 11:11:57","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6361968","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6361968","identity":"rs-6361968","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00