Construction of Salmonella typhimurium sptP mutant and evaluation of its characterization and immunoprotective effect

Construction of Salmonella typhimurium sptP mutant and evaluation of its characterization and immunoprotective effect | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Construction of Salmonella typhimurium sptP mutant and evaluation of its characterization and immunoprotective effect Nanlong Zhou, Yonghui Ding, Ting He, Hongfang Chen, Yuling Sun, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3845934/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Salmonella typhimurium is a pathogen that poses a severe health risk to humans and animals. We discussed the feasibility of the Salmonella typhimurium Δ sptP mutant as a live attenuated vaccine, constructed a Salmonella typhimurium Δ sptP mutant by homologous recombination, and evaluated its biological functions, such as growth characteristics, immunogenicity, and protective properties. We found that the Δ sptP gene mutant of Salmonella typhimurium is a safe and effective live attenuated vaccine. The mutation of the sptP gene does not affect the growth and character of bacteria and has genetic stability. Compared with wild-type Salmonella typhimurium, the colonization ability of the mutant in RAW264.7 mouse macrophages and mice was significantly weakened. The median lethal dose (LD 50 ) of the Δ sptP mutant was 39.92 times that of the wild-type strain, indicating that the virulence of the Δ sptP mutant was significantly weakened. After inoculation with 2×10 4 CFU Δ sptP mutant and one booster immunization, the mice were able to resist 87.5% of the virulent strains compared to the PBS control group, and the level of IgG antibodies produced by the mutant was similar to that of the wild-type strain. These results show that Δ sptP mutants of Salmonella typhimurium are significantly less virulent to mice than wild-type strains. The sptP mutant is immunogenic and protective in mice, and Δ sptP can be used as a live attenuated vaccine for Salmonella typhimurium disease. Salmonella typhimurium sptP live attenuated vaccine Mutant Immunogenicity Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Salmonella typhimurium is a gram-negative bacterium that is widely distributed in the environment, livestock, and wild animals[ 1 ]. It is a conditionally pathogenic bacterium that poses a severe health risk to humans and domestic animals and can be transmitted through food and water sources[ 2 ]. Infection with Salmonella typhimurium will cause a series of intestinal diseases in animals or humans[ 3 ], inducing systemic symptoms and tissue damage, which can lead to typhoid fever, paratyphoid fever, gastroenteritis, and septicemia in the host[ 4 ], as well as abortion. It not only leads to the death of livestock but also leads to the decline of livestock production and growth retardation, resulting in significant economic losses[ 5 ]. Salmonella typhimurium mainly spreads through the fecal-oral pathway and invades the host[ 6 ] and parasitics the macrophages of the host[ 7 ]. Through a series of unique virulence factors and typhoid toxins, the infection symptoms of the host organism continue to develop, and virulence proteins interact with the host cells to achieve the survival and reproduction of the bacteria in the host cells[ 8 , 9 , 10 ]. The particular region encoding virulence-related genes on the Salmonella genome is called the Salmonella virulence island (SPI)[ 11 ], which plays a crucial role in the process of Salmonella invasion and disease, such as SPI-1 and SPI-2, which are closely related to pathogenicity[ 12 , 13 ]. Currently, the use of antibiotics is quite effective in controlling Salmonella typhimurium infection. However, the long-term use of antibiotics has led to a growing problem of drug residues and bacterial resistance[ 14 , 15 , 16 ]. Therefore, vaccination has become an effective means to prevent Salmonella typhimurium infection[ 17 ]. With an increasing number of studies on the pathogenic mechanism of Salmonella typhimurium, constructing attenuated strains by deleting virulence genes is also increasingly applied to the development of attenuated vaccines[ 18 , 19 , 20 , 21 ] The SptP protein, one of the vital virulence proteins of Salmonella typhimurium[ 22 , 23 ], induces rearrangement of the actin skeleton of the cell after Salmonella entry and facilitates bacterial invasion[ 24 , 25 ]. SptP plays an essential regulatory role in the intracellular survival of Salmonella typhimurium. Therefore, we constructed the sptP gene mutant of Salmonella typhimurium by the homologous recombination method, analyzed its biological characteristics, such as growth characteristics, immunogenicity, and bacterial invasion ability, and preliminarily evaluated the immune protection of the mutant, to reveal whether sptP gene mutation can cause virulence changes in Salmonella Typhimurium. Researching and developing live attenuated vaccines and preventing and controlling Salmonella typhimurium disease is essential. Materials and Methods 1 Bacterial strains, plasmids, and primers The wild-type strain used in this study was Salmonella typhimurium ATCC 14028 kept in our laboratory, and the sptP gene mutant ATCC14028Δ sptP was constructed by a homologous recombination system using the plasmids pACYC184 and pKD46 and the primers sptP -cat-F/ sptP -cat-R. Strains were cultured in Luriae Bertani (LB) medium (1% [wt/vol] tryptone, 0.5% [wt/vol] yeast extract and 0.5% [wt/vol] NaCl) or LB agar medium (1% [wt/vol] tryptone, 0.5% [wt/vol] yeast extract, 0.5% [wt/vol] NaCl, and 1.5% [wt/vol] agar) according to the different needs. Ampicillin (Amp, 50 µg/mL) or chloramphenicol (Cm, 25 µg/mL) was added to the medium if necessary. The primers used are listed in Table 1. 2 Construction of the sptP mutant The sptP gene mutant ATCC14028Δ sptP was constructed by the suicide vector pKD46 using the homologous recombination method. Briefly, the sequence of the chloramphenicol resistance gene was amplified from plasmid pACYC184 using primers sptP -cat-F/ sptP -cat-R, and there was a 50 bp homologous fragment extending at the 5' and 3' ends of the sptP gene. The PCR-amplified product was purified and transferred by electrotransformation to Salmonella typhimurium competent cells containing the pKD46 plasmid. Single crossover mutants were screened through chloramphenicol-resistant AGAR LB medium, PCR amplification with primers sptP -out-F/ sptP -out-R, and sequencing was performed to determine whether the Sptp gene was mutated. 3 Identification of the biological characteristics of ATCC14028Δ sptP in vitro The growth characteristics of ATCC14028Δ sptP were tested using MacConkey AGAR medium, including colony morphology and biochemical identification of the strain. The results were compared with wild-type Salmonella typhimurium ATCC14028. Next, the growth curve and genetic stability were tested. ATCC14028 and ATCC14028Δ sptP were cultured at 180 r/min and 37°C, respectively, and the optical density (OD 600 ) was measured every 2 hours for 36 hours. Under the same conditions as above, ATCC14028Δ sptP was continuously cultured and passed for 30 generations, and the 5th, 10th, 15th, 20th, 25th, and 30th generation strains were collected for PCR validation using the primers sptP -out-F/ sptP -out-R and then sequenced. 4 The ability of bacteria to invade cells Mouse macrophage RAW264.7 cells were grown in medium (10% fetal bovine serum (FBS), 50 µg/ml penicillin and 50 µg/ml Dulbecco’s modified Eagle’s medium (DMEM, high glucose), 37°C, 5% CO2/95% air). At 90% cell density, ATCC14028 and ATCC14028Δ sptP of the same OD 600 were used to infect the cells for 1 h with a 100:1 multiplicity of infection (MOI). Extracellular bacteria were washed away with PBS and maintained in DMEM containing 100 μg/mL gentamicin for 1 h. The infected cells were washed with PBS 3 times at different time points (0 h, 2 h, 4 h, 8 h, 12 h, 24 h, 48 h) and cleaved with 1% (wt/vol) Triton X-100. The lysates were continuously diluted and grown in MacConkey's medium at 37°C for 12 h. The number of colony-forming units (CFU) was calculated. 5 Assessment of bacterial virulence BALB/c mice (4-5 weeks old) were preserved in our laboratory, and the animal experiments were approved by the Animal Protection and Ethics Committee of Hainan University, Haikou, China. To determine the virulence of ATCC14028Δ sptP in mice, 60 mice were divided randomly into 14 groups (n=5), and each group was inoculated intraperitoneally with 10 dilutions of SPA017ΔS ptP from 1×10 5 to 1×10 10 CFU in 200 μL PBS. Ten mice were inoculated with 200 μL PBS in the same way. The death of each group of mice was counted within two weeks after the challenge, and the median lethal dose (LD 50 ) of the two strains of bacteria was calculated according to the modified Cole method. 6 Histopathological tests The surviving mice were killed, and the livers and spleens of the mice were collected and fixed in 4% paraformaldehyde. The tissue blocks were cut for paraffin embedding, H&E staining was performed, and histopathological analysis was performed under an optical microscope. 7 Bacterial colonization ability test Sixty female BALB/c mice aged 4-5 weeks were randomly divided into three groups (wild-type strain group, Δ sptP group, PBS group) and injected intraperitoneally with 2×10 4 CFU. The mice were anesthetized on the 3rd, 6th, 9th, and 12th days after injection, and the mice's liver, spleen, lung, and kidney samples were collected aseptically and ground in sterile PBS. The homogenate samples were diluted 10 times, inoculated in McConkey medium, and cultured at 37°C for 12-16 h to calculate the number of CFUs. 8 Immunoprotective assessment of ATCC14028 Δ sptP The immunoprotective effect of ATCC14028Δ sptP on mice was evaluated by intraperitoneal injection. 18 female BALB/c mice aged 4-5 weeks were randomly divided into three groups (immune group, nonimmune group, blank group, n=6). The immune group was injected with 2×10 4 CFU intraperitoneally, and the other two groups were injected with 200 μL sterile PBS. Two weeks after the first immunization, the booster immunization was given twice. After two weeks of enhanced immunization, wild-type ATCC14028 was intraperitoneally injected with 10 times the LD50 (5.01×10 6 CFU) bacterial volume in both the immunized and nonimmunized groups and 200 μL of PBS buffer was injected into the blank group in the same way. The morbidity and survival of mice within two weeks after challenge were recorded and the liver and spleen of nondead mice were taken for histopathological analysis. 9 Serum IgG assay The mice were immunized by injection according to the immunization procedure and dosage in the immunoprotection evaluation test. Blood was collected from the eyeballs of the mice using capillary tubes, and the upper serum was collected by centrifugation. The changes in IgG were measured by a mouse Salmonella ELISA kit, and the results were displayed by an enzyme-linked immunosorbent assay at 492 nm. 10 Data analysis All data were analyzed using GraphPad Prism 8 software. Data are presented as the mean±SEM. The independent sample T-test was used within the group, and the analysis of the variance of repeated measurement data was used to compare the mean between the groups. (*p <0.05; **p <0.01; ***p <0.001) Results 1 Construction and biological characteristics of mutant ATCC14028Δ sptP A mutant of the sptP gene was established in Salmonella typhimurium ATCC14028 by a homologous recombination technique. PCR identification of ATCC14028Δ sptP was performed using the sptP -cat-F/ sptP -cat-R primers, and the results showed that the sptP gene fragment was successfully inserted with the chloramphenicol resistance gene. The mutant and wild-type strains were identified by PCR using the lateral primers sptP -out-F and sptP -out-R. The 1145 bp and 285 bp fragments confirmed that ATCC14028Δ sptP was successfully constructed (Figure 1A), and the mutant successfully passed the genetic stability test and was finally confirmed by DNA sequencing (Additional file 1, Figure S1A). The results of the growth curve showed no significant difference in the growth rate between the mutant strain and the wild-type strain at 37°C in LB medium (Figure 1B), and the results of biochemical experiments also showed no difference between the two strains (Additional file 2, Table S1). The colony size, morphology, and characteristics of the two strains cultured in the McConkey medium were consistent. (Additional file 1, Figure S1B) 2 Mutations in sptP reduce bacterial colonization in cells The number of bacteria colonized in RAW264.7 mouse macrophages was measured by a gentamicin protection assay. The results showed that the bacterial quantity of ATCC14028Δ sptP in cells was lower than that of wild-type strains at all stages during the infection process (Figure 2) (P≤0.001). The results showed that mutations in the sptP gene weakened the intracellular colonization ability of Salmonella typhimurium. 3 ATCC14028Δ sptP showed reduced virulence in mice To assess the virulence of ATCC14028Δ sptP in mice, ATCC14028Δ sptP and the wild-type strain were injected intraperitoneally, and the survival of mice was recorded. The results showed that the LD 50 of ATCC14028Δ sptP was 2×10 7 CFU, 40 times higher than that of the wild-type strain (5.01×10 5 CFU), indicating that the mutation of the sptP gene could significantly reduce the virulence of Salmonella typhimurium (Table 2). 4 ATCC14028Δ sptP showed fewer pathological changes than wild-type strains H&E staining and histological analysis were performed on the liver and spleen of mice after the challenge. Compared with the PBS control group, the liver veins of the wild-type group were significantly dilated, with congestion and bleeding symptoms, and there were more inflammatory cells in the blood vessels and tissues. There were only a few inflammatory cells and no other lesions in the Δ sptP group (Figure 3 A). Compared with the PBS control group, the spleen nodules of the wild-type group were significantly increased, and a large number of inflammatory cells exuded and bleeding occurred. In the Δ sptP group, the symptoms were milder, the splenic nodules were slightly enlarged, there was a small amount of inflammatory cell exudation, and there were no other lesions (Figure 3 B). The results showed that the sptP mutation of Salmonella typhimurium was more soothing to the pathogenic symptoms of mice. 5 The colonization ability of ATCC14028Δ sptP in mouse visceral tissues was weaker than that of the wild-type strain The CFU in mice's liver, spleen, lung, and kidney was calculated by injection of ATCC14028Δ sptP and the wild-type strain ATCC14028. The results showed that ATCC14028Δ sptP showed a decreasing trend on the 3rd day in the organs, while the wild-type strains showed an increasing trend. The reproduction and replication of ATCC14028Δ sptP reached the highest value on the 6th day and were then cleared. The removal rate of ATCC14028Δ sptP in the first three days was significantly higher than that of wild-type strains, and the maximum colonization value of ATCC14028Δ sptP in vivo was also lower than that of wild-type strains on the 6th day. These results indicated that after mutation of the sptP gene, the infection and colonization abilities of Salmonella typhimurium in mice were significantly reduced (Figure 4). 6 ATCC14028Δ sptP protects mice against wild-type Salmonella typhimurium After immunization with ATCC14028Δ sptP twice, the survival of mice attacked by strong strains is shown in Figure 5C. In the blank control group, one mouse died at 5, 8, 10, and 12 DPI, two died at 9 DPI after a wild-type strain attack, and one died at 7 DPI after immunization with ATCC14028Δ sptP . The results showed that the Δ sptP strain of Salmonella typhimurium could protect mice against the invasion of strong strains after immunization, providing 87.5% immune protection. Histological analysis showed that compared with those in the PBS control group, the liver veins in the wild-type group were dilated, the splenic nodules were significantly enlarged, and there were inflammatory cells in the blood vessels. There were no apparent symptoms in the ATCC14028Δ sptP group (Figure 5A, 5B). 7 The ATCC14028Δ sptP strain induced an immune response similar to that of the wild-type strain The IgG levels of mice were measured after immunization (Figure 5D). The IgG levels of the ATCC14028Δ sptP and wild-type strain groups were not significantly different from those of the PBS group in the first and second weeks after the first immunization. Still, the IgG levels were significantly increased after enhanced immunization, and the Δ sptP strain of Salmonella typhimurium was not substantially different from that of the wild-type strain group. These results suggested that the Δ sptP strain of Salmonella typhimurium could induce an immune response similar to that of wild-type strain. Discussion Salmonella typhimurium, one of the most common intestinal pathogens, can cause various intestinal diseases in animals and humans and lead to persistent infection, further inducing systemic symptoms and tissue damage[ 26 , 27 , 28 ]. With the increased antibiotic resistance in Salmonella and the lack of new antibiotics[ 29 ], vaccinating attenuated Salmonella is an ideal option to control and prevent Salmonella infections. Several live attenuated vaccines against Salmonella have been developed and are generally more effective than inactivated vaccines[ 30 ]. Although attenuated strains of Salmonella typhimurium can reduce or eliminate virulence by knocking out virulence genes by various means, they still have shortcomings, such as recovery of pathogenicity caused by knockout gene repair, so there are few live attenuated vaccines of Salmonella typhimurium mutants that can be used in the clinic[ 31 ]. In this study, we constructed a mutant strain of Salmonella typhimurium ATCC14028Δ sptP by the homologous recombination method. Vaccine strains need to have a transparent genetic background and stabilize genetics, which is very important for the development of attenuated vaccines. The Δ sptP mutant of Salmonella typhimurium can still mutate the sptP gene stably after 30 generations of inheritance. We also verified that the mutation of the sptP gene had no significant effect on the colony morphology, biochemical indexes, or growth rate of Salmonella typhimurium because the sptP gene was obtained through the horizontal gene transfer of SPI-1[ 32 ], which proved that the sptP gene could be used as a candidate gene for live attenuated vaccines. Next, we investigated Δ sptP mutants in terms of safety, serum immunoglobulin levels, and protective effect, demonstrating that the sptP gene is closely related to the pathogenicity of Salmonella typhimurium and providing robust evidence for the effectiveness of ATCC14028Δ sptP as a live attenuated vaccine to control Salmonella Typhimurium infection. Our results showed that after mutation of the sptP gene in Salmonella Typhimurium, the number of viable bacteria in the mutant strain was significantly lower than in the wild-type strain when infecting RAW264.7 macrophages. This phenomenon was pronounced in the early stage of infection, indicating that sptP was conducive to mediating the entry of bacteria into cells in the early infection stage. In addition, the ability of the sptP gene mutant to colonize organs in mice was also significantly weakened. These results indicate that sptP effector molecules benefit Salmonella typhimurium invasion and host cell colonization. The ideal characteristics and requirements of live attenuated vaccines are safety and nontoxicity. Therefore, in our study, after intraperitoneal injection of the Δ sptP mutant and wild-type strain in two groups of BALB/c mice, the LD 50 of the Δ sptP mutant was 39.92 times higher than that of the wild-type strain, indicating that the virulence of the Δ sptP mutant was significantly reduced. In addition to being attenuated, live attenuated vaccines should have no side effects on animals. Only slight histopathological changes were observed after immunizing mice with the SptP mutant. At the same time, the wild-type strain caused a large number of inflammatory cells in the liver and spleen and congestion symptoms, which proved that the mutant had good safety and was attenuated enough to be used as a live vaccine. For live attenuated vaccines, immune protection is one of the important indexes to evaluate the efficacy of vaccines. Therefore, live attenuated vaccines can effectively stimulate host-specific humoral and cellular immune responses and can effectively prevent secondary pathogen infection, which is crucial[ 33 ]. After immunizing mice with mutant strains, IGg levels produced in serum at days 21 and 28 were similar to those of wild-type strains and significantly higher than those of the PBS blank control group. At the same time, Δ sptP can provide up to 87.5% immune protection against the intense strain of Salmonella typhimurium. Mice immunized with the Δ sptP mutant strain did not show significant pathological changes in the liver and spleen after infection with the wild-type strain, the same as that of the PBS control group. Therefore, the virulence of Salmonella typhimurium is decreased after the sptP gene mutation. Still, it has good immunogenicity and can provide a high level of humoral and cellular immunity to protect the host. In summary, we constructed a mutant of the Δ sptP gene of Salmonella typhimurium. The results showed that the invasion and virulence of Salmonella typhimurium were significantly reduced after mutation of the SptP gene. Meanwhile, the Δ SptP mutant can cause high levels of immunogenicity and immune protection in mice, indicating that the Δ sptP mutant can potentially become a live attenuated vaccine of Salmonella Typhimurium. This provides a theoretical basis for the study of live attenuated vaccines. References Branchu P, Bawn M, Kingsley RA (2018) Genome Variation and Molecular Epidemiology of Salmonella enterica Serovar Typhimurium Pathovariants. Infect Immun 86:e00079-18. https://doi.org/10.1128/IAI.00079-18 Fàbrega A, Vila J (2013) Salmonella enterica serovar Typhimurium skills to succeed in the host: virulence and regulation. Clin Microbiol Rev 26:308–341. https://doi.org/10.1128/CMR.00066-12 Broz P, Ohlson MB, Monack DM (2012) Innate immune response to Salmonella typhimurium, a model enteric pathogen. Gut Microbes 3:62–70. https://doi.org/10.4161/gmic.19141 Ménard S, Lacroix-Lamandé S, Ehrhardt K, et al (2022) Cross-Talk Between the Intestinal Epithelium and Salmonella Typhimurium. Front Microbiol 13:906238. https://doi.org/10.3389/fmicb.2022.906238 Soliani L, Rugna G, Prosperi A, et al (2023) Salmonella Infection in Pigs: Disease, Prevalence, and a Link between Swine and Human Health. Pathogens 12:1267. https://doi.org/10.3390/pathogens12101267 Liu Q, Li P, Luo H, et al (2019) Attenuated Salmonella Typhimurium expressing Salmonella Paratyphoid A O-antigen induces protective immune responses against two Salmonella strains. Virulence 10:82–96. https://doi.org/10.1080/21505594.2018.1559673 Jiang L, Wang P, Song X, et al (2021) Salmonella Typhimurium reprograms macrophage metabolism via T3SS effector SopE2 to promote intracellular replication and virulence. Nat Commun 12:879. https://doi.org/10.1038/s41467-021-21186-4 Beuzón CR, Méresse S, Unsworth KE, et al (2000) Salmonella maintains the integrity of its intracellular vacuole through the action of SifA. EMBO J 19:3235–3249. https://doi.org/10.1093/emboj/19.13.3235 Luk CH, Enninga J, Valenzuela C (2022) Fit to dwell in many places - The growing diversity of intracellular Salmonella niches. Front Cell Infect Microbiol 12:989451. https://doi.org/10.3389/fcimb.2022.989451 Bäumler AJ, Tsolis RM, Heffron F (1996) Contribution of fimbrial operons to attachment to and invasion of epithelial cell lines by Salmonella typhimurium. Infect Immun 64:1862–1865. https://doi.org/10.1128/iai.64.5.1862-1865.1996 Hapfelmeier S, Stecher B, Barthel M, et al (2005) The Salmonella pathogenicity island (SPI)-2 and SPI-1 type III secretion systems allow Salmonella serovar typhimurium to trigger colitis via MyD88-dependent and MyD88-independent mechanisms. J Immunol 174:1675–1685. https://doi.org/10.4049/jimmunol.174.3.1675 Siriken B (2013) Salmonella Pathogenicity Islands. Mikrobiyol Bul 181–188. https://doi.org/10.5578/mb.4138 Jennings E, Thurston TLM, Holden DW (2017) Salmonella SPI-2 Type III Secretion System Effectors: Molecular Mechanisms And Physiological Consequences. Cell Host Microbe 22:217–231. https://doi.org/10.1016/j.chom.2017.07.009 Siceloff AT, Ohta N, Norman KN, et al (2021) Antimicrobial Resistance Hidden within Multiserovar Salmonella Populations. Antimicrob Agents Chemother 65:e00048-21. https://doi.org/10.1128/AAC.00048-21 Pulford CV, Perez-Sepulveda BM, Canals R, et al (2021) Stepwise evolution of Salmonella Typhimurium ST313 causing bloodstream infection in Africa. Nat Microbiol 6:327–338. https://doi.org/10.1038/s41564-020-00836-1 Zhao X, Ju Z, Wang G, et al (2021) Prevalence and Antimicrobial Resistance of Salmonella Isolated From Dead-in-Shell Chicken Embryos in Shandong, China. Front Vet Sci 8:581946. https://doi.org/10.3389/fvets.2021.581946 Sears KT, Galen JE, Tennant SM (2021) Advances in the development of Salmonella -based vaccine strategies for protection against Salmonellosis in humans. J Appl Microbiol 131:2640–2658. https://doi.org/10.1111/jam.15055 Tennant SM, Levine MM (2015) Live attenuated vaccines for invasive Salmonella infections. Vaccine 33 Suppl 3:C36-41. https://doi.org/10.1016/j.vaccine.2015.04.029 ung B, Park S, Kim E, et al (2022) Salmonella Typhimurium lacking phoBR as a live vaccine candidate against poultry infection. Vet Microbiol 266:109342. https://doi.org/10.1016/j.vetmic.2022.109342 Park S, Jung B, Kim E, et al (2020) Salmonella Typhimurium Lacking YjeK as a Candidate Live Attenuated Vaccine Against Invasive Salmonella Infection. Front Immunol 11:1277. https://doi.org/10.3389/fimmu.2020.01277 Lin Z, Tang P, Jiao Y, et al (2017) Immunogenicity and protective efficacy of a Salmonella Enteritidis sptP mutant as a live attenuated vaccine candidate. BMC Vet Res 13:194. https://doi.org/10.1186/s12917-017-1115-3 Johnson R, Byrne A, Berger CN, et al (2017) The Type III Secretion System Effector SptP of Salmonella enterica Serovar Typhi. J Bacteriol 199:e00647-16. https://doi.org/10.1128/JB.00647-16 Fu Y, Galán JE (1998) The Salmonella typhimurium tyrosine phosphatase SptP is translocated into host cells and disrupts the actin cytoskeleton. Mol Microbiol 27:359–368. https://doi.org/10.1046/j.1365-2958.1998.00684.x Zhou D, Galán J (2001) Salmonella entry into host cells: the work in concert of type III secreted effector proteins. Microbes Infect 3:1293–1298. https://doi.org/10.1016/s1286-4579(01)01489-7 Stebbins CE, Galán JE (2000) Modulation of host signaling by a bacterial mimic: structure of the Salmonella effector SptP bound to Rac1. Mol Cell 6:1449–1460. https://doi.org/10.1016/s1097-2765(00)00141-6 Galán JE (2021) Salmonella Typhimurium and inflammation: a pathogen-centric affair. Nat Rev Microbiol 19:716–725. https://doi.org/10.1038/s41579-021-00561-4 Chen S, Zhang C, Liao C, et al (2015) Deletion of Invasion Protein B in Salmonella enterica Serovar Typhimurium Influences Bacterial Invasion and Virulence. Curr Microbiol 71:687–692. https://doi.org/10.1007/s00284-015-0903-x Hamed S, Shawky RM, Emara M, et al (2021) HilE is required for synergistic activation of SPI-1 gene expression in Salmonella enterica serovar Typhimurium. BMC Microbiol 21:49. https://doi.org/10.1186/s12866-021-02110-8 Dawan J, Ahn J (2020) Assessment of cross-resistance potential to serial antibiotic treatments in antibiotic-resistant Salmonella Typhimurium. Microb Pathog 148:104478. https://doi.org/10.1016/j.micpath.2020.104478 Pei Y, Parreira VR, Roland KL, et al (2014) Assessment of attenuated Salmonella vaccine strains in controlling experimental Salmonella Typhimurium infection in chickens. Can J Vet Res 78:23–30 Gebauer J, Tesařík R, Králová N, et al (2023) Salmonella Typhimurium-based inactivated vaccine containing a wide spectrum of bacterial antigens which mimics protein expression changes during different stages of an infection process. Vet Microbiol 282:109756. https://doi.org/10.1016/j.vetmic.2023.109756 Arricau N, Hermant D, Waxin H, Popoff MY (1997) Molecular characterization of the Salmonella typhi StpA protein that is related to both Yersinia YopE cytotoxin and YopH tyrosine phosphatase. Res Microbiol 148:21–26. https://doi.org/10.1016/S0923-2508(97)81896-7 Ji HJ, Jang A-Y, Song JY, et al (2022) Development of Live Attenuated Salmonella Typhimurium Vaccine Strain Using Radiation Mutation Enhancement Technology (R-MET). Front Immunol 13:931052. https://doi.org/10.3389/fimmu.2022.931052 Tables Table 1 Primers used in this study Primers Sequences (5′-3′) Production (size, bp) Usage Source sptP -cat-F GTTTGCTGATTAATTGGAATGCTGCTGACCGCAAATCGTGCAGGCCCAGttacgccccgccctgccac 960 Capital letters: sptP homologous arm; Lowercase letter: Cm r cassette amplification This study sptP -cat-R AGAAAATAGAACCGGCGCGCCAATGCCACAGACGATGAGCGGACCGCAtacctgtgacggaagatcacttc sptP -out-F GTACGAACCGCTAATGCCACAGG 1145 or 285 Identification of sptP mutant This study sptP -out-R GAGAGGTGGTTGTAAAGCTCTACTCATG Table 2 Median lethal dose of ATCC14028 and ATCC14028Δ sptP injected intraperitoneally in mice groups Challenge dose( CFU) Number of dead mice/total number of mice Mortality LD 50 ( CFU) ATCC14028 10 5 0/5 0% 5.01×10 5 10 6 4/5 0% 10 7 5/5 100% 10 8 5/5 0% 10 9 5/5 0% 10 10 5/5 100% ATCC14028Δ sptP 10 5 0/5 0% 2×10 7 10 6 0/5 0% 10 7 2/5 40% 10 8 4/5 80% 10 9 5/5 100% 10 10 5/5 100% PBS - 0/10 0% - Supplementary Files Additionalfile1.docx => Additional file 1 => Supplementary figure => Biological characteristic test of ATCC14028Δ sptP . Additionalfile2.docx => Additional file 2 => Supplementary table => Biochemical properties of Salmonella typhimurium ATCC14028 and ATCC14028Δ sptP . Additionalfile3.doc => Additional file 3 => Cover letter => A cover letter that includes the following information, as well as any additional information requested in the instructions for your specific article type. Additionalfile4.doc => Additional file 4 => Declaration => Supporting information includes Acknowledgments, Author information, Funding, Ethical approval and consent to participate, Competing interestsand Availability of data and materials. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3845934","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":269300519,"identity":"0837f0f5-7250-423a-8b67-60ed0df1c075","order_by":0,"name":"Nanlong Zhou","email":"","orcid":"","institution":"Hainan University","correspondingAuthor":false,"prefix":"","firstName":"Nanlong","middleName":"","lastName":"Zhou","suffix":""},{"id":269300520,"identity":"1d956bec-8492-4fda-b82a-d191dc917837","order_by":1,"name":"Yonghui Ding","email":"","orcid":"","institution":"Hainan University","correspondingAuthor":false,"prefix":"","firstName":"Yonghui","middleName":"","lastName":"Ding","suffix":""},{"id":269300521,"identity":"48d2248e-6e64-4dd6-880f-e6e8eb632307","order_by":2,"name":"Ting He","email":"","orcid":"","institution":"Hainan University","correspondingAuthor":false,"prefix":"","firstName":"Ting","middleName":"","lastName":"He","suffix":""},{"id":269300522,"identity":"cb4ce000-8605-4f5a-b2a8-2fefaf9e4ffb","order_by":3,"name":"Hongfang Chen","email":"","orcid":"","institution":"Hainan University","correspondingAuthor":false,"prefix":"","firstName":"Hongfang","middleName":"","lastName":"Chen","suffix":""},{"id":269300523,"identity":"c9ab7a4d-9b50-4b23-8111-eb46e37c44a6","order_by":4,"name":"Yuling Sun","email":"","orcid":"","institution":"Hainan University","correspondingAuthor":false,"prefix":"","firstName":"Yuling","middleName":"","lastName":"Sun","suffix":""},{"id":269300524,"identity":"5b1033c2-0a52-4e27-af45-5098634cea22","order_by":5,"name":"Meiling Huang","email":"","orcid":"","institution":"Hainan Medical University","correspondingAuthor":false,"prefix":"","firstName":"Meiling","middleName":"","lastName":"Huang","suffix":""},{"id":269300525,"identity":"e4725379-11bb-4e6e-a12d-6169e6cc4235","order_by":6,"name":"Tiansen Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwElEQVRIiWNgGAWjYFAC5oYDDBUScvzMzIcfEKWBh4ERqOWMhbFkO1uaAdFaGBjbKhI3nOdRkCBKiz3/wcYDjG0SxsaHeRgMGGpsognbIpEIdNg5CTmzw7wHHjAcS8ttIKwF5JcyCWOzw3wJBowNh4nQwn8QqIVNInFzM4+BBHFaGEAOa5NI3MBMtJYbIC1nJIwlDgMDOYEYv7D3Hz78gaGiTo4fyHjwocaGsBYQYP4DYyUQo3wUjIJRMApGAWEAAIY0PNVq5c4/AAAAAElFTkSuQmCC","orcid":"https://orcid.org/0009-0006-2122-8268","institution":"Hainan University","correspondingAuthor":true,"prefix":"","firstName":"Tiansen","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2024-01-08 16:59:33","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3845934/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3845934/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":50314631,"identity":"58bf69fd-60fa-4934-b8ff-082c92dce88b","added_by":"auto","created_at":"2024-01-29 15:30:40","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":982874,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eConstruction and biological characteristics of mutant ATCC14028Δ\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003esptP\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e(A) PCR validation of the lateral primers. M, DL5000 DNA Marker; Lane 1, negative control; Lane 2, wild-type strain ATCC14028 genomic DNA; Lane 3: ATCC14028Δ\u003cem\u003esptP\u003c/em\u003e genomic DNA. The length of the PCR product of ATCC14028 was 285 bp, while the mutant ATCC14028Δ\u003cem\u003esptP \u003c/em\u003ehad inserted a chloramphenicol resistance gene, and the length of the PCR product was 1145 bp. (B) Growth curves of ATCC14028 and ATCC14028Δ\u003cem\u003esptP\u003c/em\u003e. ATCC14028 and ATCC14028Δ\u003cem\u003esptP \u003c/em\u003ewere cultured in LB medium at 37°C and 180 r/min for 36 h, and OD600 values were measured every 2 hours.\u003c/p\u003e","description":"","filename":"Fig.1jpg.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3845934/v1/a608ac1d1a8dbf7719fe75c1.jpg"},{"id":50314660,"identity":"9be52e4b-71a5-4a5f-ae04-0b2300a04fa7","added_by":"auto","created_at":"2024-01-29 15:30:41","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":471257,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eColonization of ATCC14028 and ATCC14028Δ\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003esptP\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e in RAW264.7 mouse macrophages.\u003c/strong\u003eBacterial counts were measured, and the results were expressed as Lg CFU/mL. Data are presented as the mean ± SEM. ***\u003cem\u003ep\u003c/em\u003e \u0026lt;0.001\u003c/p\u003e","description":"","filename":"Fig.2jpg.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3845934/v1/1d62015f898c0544765eb123.jpg"},{"id":50314656,"identity":"ebeaeec5-3b60-4a9a-b412-a75bd2a788d6","added_by":"auto","created_at":"2024-01-29 15:30:40","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":8086826,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHistological analysis of mice after intraperitoneal injection of ATCC14028 and ATCC14028Δ\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003esptP\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e At 14 days, histopathological changes in the liver (A) and spleen (B) were detected by H\u0026amp;E staining. The results were observed using an optical microscope at magnifications of 100× and 400×. Note: The black and red arrows indicate inflammatory cells.\u003c/p\u003e","description":"","filename":"Fig.3jpg.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3845934/v1/b74331ab05131f1d76836994.jpg"},{"id":50314635,"identity":"aaa59037-05db-4fa7-bc63-f678cd084e8d","added_by":"auto","created_at":"2024-01-29 15:30:40","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1470160,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe colonization capacity of ATCC14028 and ATCC14028Δ\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003esptP\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e in mouse organs. \u003c/strong\u003eBacterial colonization and persistence in the liver (A), spleen (B), lungs (C), and kidneys (D) of mice after intraperitoneal injection of ATCC14028 and ATCC14028Δ\u003cem\u003esptP\u003c/em\u003e at 2×10\u003csup\u003e4 \u003c/sup\u003eCFU. Bacterial counts were measured, and the results were expressed as Lg CFU/mL. Data are presented as the mean ± SEM. ***\u003cem\u003ep\u003c/em\u003e \u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Fig.4jpg.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3845934/v1/3acbfbd82defdf50740f7bd4.jpg"},{"id":50314658,"identity":"bac46d62-5a62-4176-afaf-fca8be512312","added_by":"auto","created_at":"2024-01-29 15:30:41","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":8764249,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImmunoprotective effect and antibody level of ATCC14028Δ\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003esptP\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e Histopathological changes in the liver (A) and spleen (B) after immunization with ATCC14028Δ\u003cem\u003esptP\u003c/em\u003e were detected by H\u0026amp;E staining. (C) Survival of mice immunized with ATCC14028Δ\u003cem\u003esptP\u003c/em\u003e. (D) Testing of serum IgG expression levels in mice. Data are presented as the mean ± SEM. *\u003cem\u003eP\u003c/em\u003e ≤ 0.05, **\u003cem\u003eP\u003c/em\u003e ≤ 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Fig.5jpg.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3845934/v1/ad2d60e3298f9bb512aa972a.jpg"},{"id":52435594,"identity":"448a5a3d-07cc-438a-917a-b34bbaa72d97","added_by":"auto","created_at":"2024-03-11 16:01:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1060745,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3845934/v1/75f31724-21d5-4933-be76-8c58146a585a.pdf"},{"id":50314634,"identity":"a87ef642-8ffc-4e9a-bcec-d7e02a68aa7f","added_by":"auto","created_at":"2024-01-29 15:30:40","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":4228475,"visible":true,"origin":"","legend":"\u003cp\u003e=\u0026gt; Additional file 1\u003c/p\u003e\n\u003cp\u003e=\u0026gt; Supplementary figure\u003c/p\u003e\n\u003cp\u003e=\u0026gt; Biological characteristic test of ATCC14028Δ\u003cem\u003esptP\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"Additionalfile1.docx","url":"https://assets-eu.researchsquare.com/files/rs-3845934/v1/43320b53f1df1adb5e44661a.docx"},{"id":50314657,"identity":"61110a5a-3a2e-43c5-b9ed-6b105e61fd0c","added_by":"auto","created_at":"2024-01-29 15:30:40","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":3825709,"visible":true,"origin":"","legend":"\u003cp\u003e=\u0026gt; Additional file 2\u003c/p\u003e\n\u003cp\u003e=\u0026gt; Supplementary table\u003c/p\u003e\n\u003cp\u003e=\u0026gt; Biochemical properties of Salmonella typhimurium ATCC14028 and ATCC14028Δ\u003cem\u003esptP\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"Additionalfile2.docx","url":"https://assets-eu.researchsquare.com/files/rs-3845934/v1/8e0a34ea497262767b7ecb57.docx"},{"id":50314632,"identity":"5d94180b-0b56-4507-887d-220461ff57c9","added_by":"auto","created_at":"2024-01-29 15:30:40","extension":"doc","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":30720,"visible":true,"origin":"","legend":"\u003cp\u003e=\u0026gt; Additional file 3\u003c/p\u003e\n\u003cp\u003e=\u0026gt; Cover letter\u003c/p\u003e\n\u003cp\u003e=\u0026gt; A cover letter that includes the following information, as well as any additional information requested in the instructions for your specific article type.\u003c/p\u003e","description":"","filename":"Additionalfile3.doc","url":"https://assets-eu.researchsquare.com/files/rs-3845934/v1/9bddde2ee9871219041d9ee0.doc"},{"id":50314633,"identity":"fbbba2bd-f868-4880-9db0-ef1b39737a4e","added_by":"auto","created_at":"2024-01-29 15:30:40","extension":"doc","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":30208,"visible":true,"origin":"","legend":"\u003cp\u003e=\u0026gt; Additional file 4\u003c/p\u003e\n\u003cp\u003e=\u0026gt; Declaration\u003c/p\u003e\n\u003cp\u003e=\u0026gt; Supporting information includes \u003cstrong\u003eAcknowledgments\u003c/strong\u003e, \u003cstrong\u003eAuthor information\u003c/strong\u003e, \u003cstrong\u003eFunding\u003c/strong\u003e, \u003cstrong\u003eEthical approval and consent to participate\u003c/strong\u003e, \u003cstrong\u003eCompeting interests\u003c/strong\u003eand \u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"Additionalfile4.doc","url":"https://assets-eu.researchsquare.com/files/rs-3845934/v1/5bb06affd248f2e57bdc0fa2.doc"}],"financialInterests":"","formattedTitle":"Construction of Salmonella typhimurium sptP mutant and evaluation of its characterization and immunoprotective effect","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cem\u003eSalmonella\u003c/em\u003e typhimurium is a gram-negative bacterium that is widely distributed in the environment, livestock, and wild animals[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It is a conditionally pathogenic bacterium that poses a severe health risk to humans and domestic animals and can be transmitted through food and water sources[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Infection with \u003cem\u003eSalmonella\u003c/em\u003e typhimurium will cause a series of intestinal diseases in animals or humans[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], inducing systemic symptoms and tissue damage, which can lead to typhoid fever, paratyphoid fever, gastroenteritis, and septicemia in the host[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], as well as abortion. It not only leads to the death of livestock but also leads to the decline of livestock production and growth retardation, resulting in significant economic losses[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eSalmonella\u003c/em\u003e typhimurium mainly spreads through the fecal-oral pathway and invades the host[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] and parasitics the macrophages of the host[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Through a series of unique virulence factors and typhoid toxins, the infection symptoms of the host organism continue to develop, and virulence proteins interact with the host cells to achieve the survival and reproduction of the bacteria in the host cells[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The particular region encoding virulence-related genes on the \u003cem\u003eSalmonella\u003c/em\u003e genome is called the \u003cem\u003eSalmonella\u003c/em\u003e virulence island (SPI)[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], which plays a crucial role in the process of \u003cem\u003eSalmonella\u003c/em\u003e invasion and disease, such as SPI-1 and SPI-2, which are closely related to pathogenicity[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCurrently, the use of antibiotics is quite effective in controlling \u003cem\u003eSalmonella\u003c/em\u003e typhimurium infection. However, the long-term use of antibiotics has led to a growing problem of drug residues and bacterial resistance[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Therefore, vaccination has become an effective means to prevent \u003cem\u003eSalmonella\u003c/em\u003e typhimurium infection[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. With an increasing number of studies on the pathogenic mechanism of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium, constructing attenuated strains by deleting virulence genes is also increasingly applied to the development of attenuated vaccines[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] The SptP protein, one of the vital virulence proteins of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], induces rearrangement of the actin skeleton of the cell after \u003cem\u003eSalmonella\u003c/em\u003e entry and facilitates bacterial invasion[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. SptP plays an essential regulatory role in the intracellular survival of Salmonella typhimurium.\u003c/p\u003e \u003cp\u003eTherefore, we constructed the \u003cem\u003esptP\u003c/em\u003e gene mutant of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium by the homologous recombination method, analyzed its biological characteristics, such as growth characteristics, immunogenicity, and bacterial invasion ability, and preliminarily evaluated the immune protection of the mutant, to reveal whether \u003cem\u003esptP\u003c/em\u003e gene mutation can cause virulence changes in \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium. Researching and developing live attenuated vaccines and preventing and controlling Salmonella typhimurium disease is essential.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003e1 Bacterial strains, plasmids, and primers\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe wild-type strain used in this study was \u003cem\u003eSalmonella\u003c/em\u003e typhimurium ATCC 14028 kept in our laboratory, and the \u003cem\u003esptP\u003c/em\u003e gene mutant ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e was constructed by a homologous recombination system using the plasmids pACYC184 and pKD46 and the primers \u003cem\u003esptP\u003c/em\u003e-cat-F/\u003cem\u003esptP\u003c/em\u003e-cat-R. Strains were cultured in Luriae Bertani (LB) medium (1% [wt/vol] tryptone, 0.5% [wt/vol] yeast extract and 0.5% [wt/vol] NaCl) or LB agar medium (1% [wt/vol] tryptone, 0.5% [wt/vol] yeast extract, 0.5% [wt/vol] NaCl, and 1.5% [wt/vol] agar) according to the different needs. Ampicillin (Amp, 50 \u0026micro;g/mL) or chloramphenicol (Cm, 25 \u0026micro;g/mL) was added to the medium if necessary. The primers used are listed in Table 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2 Construction of the \u003cem\u003esptP\u003c/em\u003e mutant\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003esptP\u003c/em\u003e gene mutant ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e was constructed by the suicide vector pKD46 using the homologous recombination method. Briefly, the sequence of the chloramphenicol resistance gene was amplified from plasmid pACYC184 using primers \u003cem\u003esptP\u003c/em\u003e-cat-F/\u003cem\u003esptP\u003c/em\u003e-cat-R, and there was a 50 bp homologous fragment extending at the 5\u0026apos; and 3\u0026apos; ends of the \u003cem\u003esptP\u0026nbsp;\u003c/em\u003egene. The PCR-amplified product was purified and transferred by electrotransformation to \u003cem\u003eSalmonella\u003c/em\u003e typhimurium competent cells containing the pKD46 plasmid. Single crossover mutants were screened through chloramphenicol-resistant AGAR LB medium, PCR amplification with primers \u003cem\u003esptP\u003c/em\u003e-out-F/\u003cem\u003esptP\u003c/em\u003e-out-R, and sequencing was performed to determine whether the \u003cem\u003eSptp\u0026nbsp;\u003c/em\u003egene was mutated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3 Identification of the biological characteristics of ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e in vitro\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe growth characteristics of ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e were tested using MacConkey AGAR medium, including colony morphology and biochemical identification of the strain. The results were compared with wild-type \u003cem\u003eSalmonella\u003c/em\u003e typhimurium ATCC14028. Next, the growth curve and genetic stability were tested. ATCC14028 and ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e were cultured at 180 r/min and 37\u0026deg;C, respectively, and the optical density (OD\u003csub\u003e600\u003c/sub\u003e) was measured every 2 hours for 36 hours. Under the same conditions as above, ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e was continuously cultured and passed for 30 generations, and the 5th, 10th, 15th, 20th, 25th, and 30th generation strains were collected for PCR validation using the primers\u003cem\u003e\u0026nbsp;sptP\u003c/em\u003e-out-F/\u003cem\u003esptP\u003c/em\u003e-out-R and then sequenced.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4 The ability of bacteria to invade cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMouse macrophage RAW264.7 cells were grown in medium (10% fetal bovine serum (FBS), 50 \u0026micro;g/ml penicillin and 50 \u0026micro;g/ml Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM, high glucose), 37\u0026deg;C, 5% CO2/95% air). At 90% cell density, ATCC14028 and ATCC14028\u0026Delta;\u003cem\u003esptP\u0026nbsp;\u003c/em\u003eof the same OD\u003csub\u003e600\u0026nbsp;\u003c/sub\u003ewere used to infect the cells for 1 h with a 100:1 multiplicity of infection (MOI). Extracellular bacteria were washed away with PBS and maintained in DMEM containing 100 \u0026mu;g/mL gentamicin for 1 h. The infected cells were washed with PBS 3 times at different time points (0 h, 2 h, 4 h, 8 h, 12 h, 24 h, 48 h) and cleaved with 1% (wt/vol) Triton X-100. The lysates were continuously diluted and grown in MacConkey\u0026apos;s medium at 37\u0026deg;C for 12 h. The number of colony-forming units (CFU) was calculated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e5 Assessment of bacterial virulence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBALB/c\u0026nbsp;mice (4-5 weeks old) were preserved in our laboratory, and the animal experiments were approved by the Animal Protection and Ethics Committee of Hainan University, Haikou, China. To determine the virulence of ATCC14028\u0026Delta;\u003cem\u003esptP\u0026nbsp;\u003c/em\u003ein mice, 60 mice were divided randomly into 14 groups (n=5), and each group was inoculated intraperitoneally with 10 dilutions of SPA017\u0026Delta;S\u003cem\u003eptP\u0026nbsp;\u003c/em\u003efrom 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e to 1\u0026times;10\u003csup\u003e10\u0026nbsp;\u003c/sup\u003eCFU in 200 \u0026mu;L PBS. Ten mice were inoculated with 200 \u0026mu;L PBS in the same way. The death of each group of mice was counted within two weeks after the challenge, and the median lethal dose (LD\u003csub\u003e50\u003c/sub\u003e) of the two strains of bacteria was calculated according to the modified Cole method.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e6 Histopathological tests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe surviving mice were killed, and the livers and spleens of the mice were collected and fixed in 4% paraformaldehyde. The tissue blocks were cut for paraffin embedding, H\u0026amp;E staining was performed, and histopathological analysis was performed under an optical microscope.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e7 Bacterial colonization ability test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSixty female BALB/c mice aged 4-5 weeks were randomly divided into three groups (wild-type strain group, \u0026Delta;\u003cem\u003esptP\u003c/em\u003e group, PBS group) and injected intraperitoneally with 2\u0026times;10\u003csup\u003e4\u003c/sup\u003e CFU. The mice were anesthetized on the 3rd, 6th, 9th, and 12th days after injection, and the mice\u0026apos;s liver, spleen, lung, and kidney samples were collected aseptically and ground in sterile PBS. The homogenate samples were diluted 10 times, inoculated in McConkey medium, and cultured at 37\u0026deg;C for 12-16 h to calculate the number of CFUs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e8 Immunoprotective assessment of ATCC14028\u003c/strong\u003e\u003cstrong\u003e\u0026Delta;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003esptP\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe immunoprotective effect of ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e on mice was evaluated by intraperitoneal injection. 18 female BALB/c mice aged 4-5 weeks were randomly divided into three groups (immune group, nonimmune group, blank group, n=6). The immune group was injected with 2\u0026times;10\u003csup\u003e4\u003c/sup\u003e CFU intraperitoneally, and the other two groups were injected with 200 \u0026mu;L sterile PBS. Two weeks after the first immunization, the booster immunization was given twice. After two weeks of enhanced immunization, wild-type ATCC14028 was intraperitoneally injected with 10 times the LD50 (5.01\u0026times;10\u003csup\u003e6\u0026nbsp;\u003c/sup\u003eCFU) bacterial volume in both the immunized and nonimmunized groups and 200 \u0026mu;L of PBS buffer was injected into the blank group in the same way. The morbidity and survival of mice within two weeks after challenge were recorded and the liver and spleen of nondead mice were taken for histopathological analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e9 Serum IgG assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe mice were immunized by injection according to the immunization procedure and dosage in the immunoprotection evaluation test. Blood was collected from the eyeballs of the mice using capillary tubes, and the upper serum was collected by centrifugation. The changes in IgG were measured by a mouse \u003cem\u003eSalmonella\u003c/em\u003e ELISA kit, and the results were displayed by an enzyme-linked immunosorbent assay at 492 nm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e10 Data analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data were analyzed using GraphPad Prism 8 software. Data are presented as the mean\u0026plusmn;SEM. The independent sample T-test was used within the group, and the analysis of the variance of repeated measurement data was used to compare the mean between the groups. (*p \u0026lt;0.05; **p \u0026lt;0.01; ***p \u0026lt;0.001)\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e1 Construction and biological characteristics of mutant ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA mutant of the \u003cem\u003esptP\u003c/em\u003e gene was established in \u003cem\u003eSalmonella\u003c/em\u003e typhimurium ATCC14028 by a homologous recombination technique. PCR identification of ATCC14028\u0026Delta;\u003cem\u003esptP\u0026nbsp;\u003c/em\u003ewas performed using the\u003cem\u003e\u0026nbsp;sptP\u003c/em\u003e-cat-F/\u003cem\u003esptP\u003c/em\u003e-cat-R primers, and the results showed that the \u003cem\u003esptP\u003c/em\u003e gene fragment was successfully inserted with the chloramphenicol resistance gene. The mutant and wild-type strains were identified by PCR using the lateral primers \u003cem\u003esptP\u003c/em\u003e-out-F and \u003cem\u003esptP\u003c/em\u003e-out-R. The 1145 bp and 285 bp fragments confirmed that ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e was successfully constructed (Figure 1A), and the mutant successfully passed the genetic stability test and was finally confirmed by DNA sequencing (Additional file 1, Figure S1A).\u003c/p\u003e\n\u003cp\u003eThe results of the growth curve showed no significant difference in the growth rate between the mutant strain and the wild-type strain at 37\u0026deg;C in LB medium (Figure 1B), and the results of biochemical experiments also showed no difference between the two strains (Additional file 2, Table S1). The colony size, morphology, and characteristics of the two strains cultured in the McConkey medium were consistent. (Additional file 1, Figure S1B)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2 Mutations in \u003cem\u003esptP\u003c/em\u003e reduce bacterial colonization in cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe number of bacteria colonized in RAW264.7 mouse macrophages was measured by a gentamicin protection assay. The results showed that the bacterial quantity of ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e in cells was lower than that of wild-type strains at all stages during the infection process (Figure 2) (P\u0026le;0.001). The results showed that mutations in the \u003cem\u003esptP\u003c/em\u003e gene weakened the intracellular colonization ability of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3 ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e showed reduced virulence in mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo\u0026nbsp;assess the virulence of ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e in mice, ATCC14028\u0026Delta;\u003cem\u003esptP\u0026nbsp;\u003c/em\u003eand the wild-type strain were injected intraperitoneally, and the survival of mice was recorded. The results showed that the LD\u003csub\u003e50\u003c/sub\u003e of ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e was 2\u0026times;10\u003csup\u003e7\u003c/sup\u003e CFU, 40 times higher than that of the wild-type strain (5.01\u0026times;10\u003csup\u003e5\u0026nbsp;\u003c/sup\u003eCFU), indicating that the mutation of the \u003cem\u003esptP\u0026nbsp;\u003c/em\u003egene could significantly reduce the virulence of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium (Table 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4 ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e showed fewer pathological changes than wild-type strains\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eH\u0026amp;E staining and histological analysis were performed on the liver and spleen of mice after the challenge. Compared with the PBS control group, the liver veins of the wild-type group were significantly dilated, with congestion and bleeding symptoms, and there were more inflammatory cells in the blood vessels and tissues. There were only a few inflammatory cells and no other lesions in the \u0026Delta;\u003cem\u003esptP\u003c/em\u003e group (Figure 3 A). Compared with the PBS control group, the spleen nodules of the wild-type group were significantly increased, and a large number of inflammatory cells exuded and bleeding occurred. In the \u0026Delta;\u003cem\u003esptP\u003c/em\u003e group, the symptoms were milder, the splenic nodules were slightly enlarged, there was a small amount of inflammatory cell exudation, and there were no other lesions (Figure 3 B). The results showed that the \u003cem\u003esptP\u0026nbsp;\u003c/em\u003emutation of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium was more soothing to the pathogenic symptoms of mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e5 The colonization ability of ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e in mouse visceral tissues was weaker than that of the wild-type strain\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe CFU in mice\u0026apos;s liver, spleen, lung, and kidney was calculated by injection of ATCC14028\u0026Delta;\u003cem\u003esptP\u0026nbsp;\u003c/em\u003eand the wild-type strain ATCC14028. The results showed that ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e showed a decreasing trend on the 3rd day in the organs, while the wild-type strains showed an increasing trend. The reproduction and replication of ATCC14028\u0026Delta;\u003cem\u003esptP\u0026nbsp;\u003c/em\u003ereached the highest value on the 6th day and were then cleared. The removal rate of ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e in the first three days was significantly higher than that of wild-type strains, and the maximum colonization value of ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e in vivo was also lower than that of wild-type strains on the 6th day. These results indicated that after mutation of the \u003cem\u003esptP\u003c/em\u003e gene, the infection and colonization abilities of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium in mice were significantly reduced (Figure 4).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e6 ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e protects mice against wild-type Salmonella typhimurium\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter immunization with ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e twice, the survival of mice attacked by strong strains is shown in Figure 5C. In the blank control group, one mouse died at 5, 8, 10, and 12 DPI, two died at 9 DPI after a wild-type strain attack, and one died at 7 DPI after immunization with ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e. The results showed that the \u0026Delta;\u003cem\u003esptP\u003c/em\u003e strain of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium could protect mice against the invasion of strong strains after immunization, providing 87.5% immune protection. Histological analysis showed that compared with those in the PBS control group, the liver veins in the wild-type group were dilated, the splenic nodules were significantly enlarged, and there were inflammatory cells in the blood vessels. There were no apparent symptoms in the ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e group (Figure 5A, 5B).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e7 The ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e strain induced an immune response similar to that of the wild-type strain\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe IgG levels of mice were measured after immunization (Figure 5D). The IgG levels of the ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e and wild-type strain groups were not significantly different from those of the PBS group in the first and second weeks after the first immunization. Still, the IgG levels were significantly increased after enhanced immunization, and the \u0026Delta;\u003cem\u003esptP\u003c/em\u003e strain of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium was not substantially different from that of the wild-type strain group. These results suggested that the \u0026Delta;\u003cem\u003esptP\u003c/em\u003e strain of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium could induce an immune response similar to that of wild-type strain.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cem\u003eSalmonella\u003c/em\u003e typhimurium, one of the most common intestinal pathogens, can cause various intestinal diseases in animals and humans and lead to persistent infection, further inducing systemic symptoms and tissue damage[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. With the increased antibiotic resistance in \u003cem\u003eSalmonella\u003c/em\u003e and the lack of new antibiotics[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], vaccinating attenuated \u003cem\u003eSalmonella\u003c/em\u003e is an ideal option to control and prevent \u003cem\u003eSalmonella\u003c/em\u003e infections. Several live attenuated vaccines against \u003cem\u003eSalmonella\u003c/em\u003e have been developed and are generally more effective than inactivated vaccines[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Although attenuated strains of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium can reduce or eliminate virulence by knocking out virulence genes by various means, they still have shortcomings, such as recovery of pathogenicity caused by knockout gene repair, so there are few live attenuated vaccines of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium mutants that can be used in the clinic[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, we constructed a mutant strain of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium ATCC14028Δ\u003cem\u003esptP\u003c/em\u003e by the homologous recombination method. Vaccine strains need to have a transparent genetic background and stabilize genetics, which is very important for the development of attenuated vaccines. The Δ\u003cem\u003esptP\u003c/em\u003e mutant of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium can still mutate the \u003cem\u003esptP\u003c/em\u003e gene stably after 30 generations of inheritance. We also verified that the mutation of the \u003cem\u003esptP\u003c/em\u003e gene had no significant effect on the colony morphology, biochemical indexes, or growth rate of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium because the \u003cem\u003esptP\u003c/em\u003e gene was obtained through the horizontal gene transfer of SPI-1[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], which proved that the \u003cem\u003esptP\u003c/em\u003e gene could be used as a candidate gene for live attenuated vaccines.\u003c/p\u003e \u003cp\u003eNext, we investigated Δ\u003cem\u003esptP\u003c/em\u003e mutants in terms of safety, serum immunoglobulin levels, and protective effect, demonstrating that the \u003cem\u003esptP\u003c/em\u003e gene is closely related to the pathogenicity of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium and providing robust evidence for the effectiveness of ATCC14028Δ\u003cem\u003esptP\u003c/em\u003e as a live attenuated vaccine to control \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium infection. Our results showed that after mutation of the \u003cem\u003esptP\u003c/em\u003e gene in \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium, the number of viable bacteria in the mutant strain was significantly lower than in the wild-type strain when infecting RAW264.7 macrophages. This phenomenon was pronounced in the early stage of infection, indicating that \u003cem\u003esptP\u003c/em\u003e was conducive to mediating the entry of bacteria into cells in the early infection stage. In addition, the ability of the \u003cem\u003esptP\u003c/em\u003e gene mutant to colonize organs in mice was also significantly weakened. These results indicate that \u003cem\u003esptP\u003c/em\u003e effector molecules benefit \u003cem\u003eSalmonella\u003c/em\u003e typhimurium invasion and host cell colonization. The ideal characteristics and requirements of live attenuated vaccines are safety and nontoxicity. Therefore, in our study, after intraperitoneal injection of the Δ\u003cem\u003esptP\u003c/em\u003e mutant and wild-type strain in two groups of BALB/c mice, the LD\u003csub\u003e50\u003c/sub\u003e of the Δ\u003cem\u003esptP\u003c/em\u003e mutant was 39.92 times higher than that of the wild-type strain, indicating that the virulence of the Δ\u003cem\u003esptP\u003c/em\u003e mutant was significantly reduced. In addition to being attenuated, live attenuated vaccines should have no side effects on animals. Only slight histopathological changes were observed after immunizing mice with the SptP mutant. At the same time, the wild-type strain caused a large number of inflammatory cells in the liver and spleen and congestion symptoms, which proved that the mutant had good safety and was attenuated enough to be used as a live vaccine.\u003c/p\u003e \u003cp\u003eFor live attenuated vaccines, immune protection is one of the important indexes to evaluate the efficacy of vaccines. Therefore, live attenuated vaccines can effectively stimulate host-specific humoral and cellular immune responses and can effectively prevent secondary pathogen infection, which is crucial[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. After immunizing mice with mutant strains, IGg levels produced in serum at days 21 and 28 were similar to those of wild-type strains and significantly higher than those of the PBS blank control group. At the same time, Δ\u003cem\u003esptP\u003c/em\u003e can provide up to 87.5% immune protection against the intense strain of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium. Mice immunized with the Δ\u003cem\u003esptP\u003c/em\u003e mutant strain did not show significant pathological changes in the liver and spleen after infection with the wild-type strain, the same as that of the PBS control group. Therefore, the virulence of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium is decreased after the \u003cem\u003esptP\u003c/em\u003e gene mutation. Still, it has good immunogenicity and can provide a high level of humoral and cellular immunity to protect the host.\u003c/p\u003e \u003cp\u003eIn summary, we constructed a mutant of the Δ\u003cem\u003esptP\u003c/em\u003e gene of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium. The results showed that the invasion and virulence of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium were significantly reduced after mutation of the \u003cem\u003eSptP\u003c/em\u003e gene. Meanwhile, the Δ\u003cem\u003eSptP\u003c/em\u003e mutant can cause high levels of immunogenicity and immune protection in mice, indicating that the Δ\u003cem\u003esptP\u003c/em\u003e mutant can potentially become a live attenuated vaccine of \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium. This provides a theoretical basis for the study of live attenuated vaccines.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBranchu P, Bawn M, Kingsley RA (2018) Genome Variation and Molecular Epidemiology of \u003cem\u003eSalmonella\u003c/em\u003e enterica Serovar Typhimurium Pathovariants. Infect Immun 86:e00079-18. https://doi.org/10.1128/IAI.00079-18\u003c/li\u003e\n\u003cli\u003eF\u0026agrave;brega A, Vila J (2013) \u003cem\u003eSalmonella\u003c/em\u003e enterica serovar Typhimurium skills to succeed in the host: virulence and regulation. Clin Microbiol Rev 26:308\u0026ndash;341. https://doi.org/10.1128/CMR.00066-12\u003c/li\u003e\n\u003cli\u003eBroz P, Ohlson MB, Monack DM (2012) Innate immune response to \u003cem\u003eSalmonella\u003c/em\u003e typhimurium, a model enteric pathogen. Gut Microbes 3:62\u0026ndash;70. https://doi.org/10.4161/gmic.19141\u003c/li\u003e\n\u003cli\u003eM\u0026eacute;nard S, Lacroix-Lamand\u0026eacute; S, Ehrhardt K, et al (2022) Cross-Talk Between the Intestinal Epithelium and \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium. Front Microbiol 13:906238. https://doi.org/10.3389/fmicb.2022.906238\u003c/li\u003e\n\u003cli\u003eSoliani L, Rugna G, Prosperi A, et al (2023) \u003cem\u003eSalmonella\u003c/em\u003e Infection in Pigs: Disease, Prevalence, and a Link between Swine and Human Health. Pathogens 12:1267. https://doi.org/10.3390/pathogens12101267\u003c/li\u003e\n\u003cli\u003eLiu Q, Li P, Luo H, et al (2019) Attenuated \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium expressing \u003cem\u003eSalmonella\u003c/em\u003e Paratyphoid A O-antigen induces protective immune responses against two \u003cem\u003eSalmonella\u003c/em\u003e strains. Virulence 10:82\u0026ndash;96. https://doi.org/10.1080/21505594.2018.1559673\u003c/li\u003e\n\u003cli\u003eJiang L, Wang P, Song X, et al (2021) \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium reprograms macrophage metabolism via T3SS effector SopE2 to promote intracellular replication and virulence. Nat Commun 12:879. https://doi.org/10.1038/s41467-021-21186-4\u003c/li\u003e\n\u003cli\u003eBeuz\u0026oacute;n CR, M\u0026eacute;resse S, Unsworth KE, et al (2000) \u003cem\u003eSalmonella\u003c/em\u003e maintains the integrity of its intracellular vacuole through the action of SifA. EMBO J 19:3235\u0026ndash;3249. https://doi.org/10.1093/emboj/19.13.3235\u003c/li\u003e\n\u003cli\u003eLuk CH, Enninga J, Valenzuela C (2022) Fit to dwell in many places - The growing diversity of intracellular \u003cem\u003eSalmonella\u003c/em\u003e niches. Front Cell Infect Microbiol 12:989451. https://doi.org/10.3389/fcimb.2022.989451\u003c/li\u003e\n\u003cli\u003eB\u0026auml;umler AJ, Tsolis RM, Heffron F (1996) Contribution of fimbrial operons to attachment to and invasion of epithelial cell lines by \u003cem\u003eSalmonella\u003c/em\u003e typhimurium. Infect Immun 64:1862\u0026ndash;1865. https://doi.org/10.1128/iai.64.5.1862-1865.1996\u003c/li\u003e\n\u003cli\u003eHapfelmeier S, Stecher B, Barthel M, et al (2005) The \u003cem\u003eSalmonella\u003c/em\u003e pathogenicity island (SPI)-2 and SPI-1 type III secretion systems allow \u003cem\u003eSalmonella\u003c/em\u003e serovar typhimurium to trigger colitis via MyD88-dependent and MyD88-independent mechanisms. J Immunol 174:1675\u0026ndash;1685. https://doi.org/10.4049/jimmunol.174.3.1675\u003c/li\u003e\n\u003cli\u003eSiriken B (2013) \u003cem\u003eSalmonella\u003c/em\u003e Pathogenicity Islands. Mikrobiyol Bul 181\u0026ndash;188. https://doi.org/10.5578/mb.4138\u003c/li\u003e\n\u003cli\u003eJennings E, Thurston TLM, Holden DW (2017) \u003cem\u003eSalmonella\u003c/em\u003e SPI-2 Type III Secretion System Effectors: Molecular Mechanisms And Physiological Consequences. Cell Host Microbe 22:217\u0026ndash;231. https://doi.org/10.1016/j.chom.2017.07.009\u003c/li\u003e\n\u003cli\u003eSiceloff AT, Ohta N, Norman KN, et al (2021) Antimicrobial Resistance Hidden within Multiserovar \u003cem\u003eSalmonella\u003c/em\u003e Populations. Antimicrob Agents Chemother 65:e00048-21. https://doi.org/10.1128/AAC.00048-21\u003c/li\u003e\n\u003cli\u003ePulford CV, Perez-Sepulveda BM, Canals R, et al (2021) Stepwise evolution of \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium ST313 causing bloodstream infection in Africa. Nat Microbiol 6:327\u0026ndash;338. https://doi.org/10.1038/s41564-020-00836-1\u003c/li\u003e\n\u003cli\u003eZhao X, Ju Z, Wang G, et al (2021) Prevalence and Antimicrobial Resistance of \u003cem\u003eSalmonella\u003c/em\u003e Isolated From Dead-in-Shell Chicken Embryos in Shandong, China. Front Vet Sci 8:581946. https://doi.org/10.3389/fvets.2021.581946\u003c/li\u003e\n\u003cli\u003eSears KT, Galen JE, Tennant SM (2021) Advances in the development of \u003cem\u003eSalmonella\u003c/em\u003e-based vaccine strategies for protection against \u003cem\u003eSalmonellosis\u003c/em\u003e in humans. J Appl Microbiol 131:2640\u0026ndash;2658. https://doi.org/10.1111/jam.15055\u003c/li\u003e\n\u003cli\u003eTennant SM, Levine MM (2015) Live attenuated vaccines for invasive \u003cem\u003eSalmonella\u003c/em\u003e infections. Vaccine 33 Suppl 3:C36-41. https://doi.org/10.1016/j.vaccine.2015.04.029\u003c/li\u003e\n\u003cli\u003eung B, Park S, Kim E, et al (2022) \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium lacking \u003cem\u003ephoBR\u003c/em\u003e as a live vaccine candidate against poultry infection. Vet Microbiol 266:109342. https://doi.org/10.1016/j.vetmic.2022.109342\u003c/li\u003e\n\u003cli\u003ePark S, Jung B, Kim E, et al (2020) \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium Lacking YjeK as a Candidate Live Attenuated Vaccine Against Invasive Salmonella Infection. Front Immunol 11:1277. https://doi.org/10.3389/fimmu.2020.01277\u003c/li\u003e\n\u003cli\u003eLin Z, Tang P, Jiao Y, et al (2017) Immunogenicity and protective efficacy of a \u003cem\u003eSalmonella\u003c/em\u003e Enteritidis \u003cem\u003esptP\u003c/em\u003e mutant as a live attenuated vaccine candidate. BMC Vet Res 13:194. https://doi.org/10.1186/s12917-017-1115-3\u003c/li\u003e\n\u003cli\u003eJohnson R, Byrne A, Berger CN, et al (2017) The Type III Secretion System Effector SptP of \u003cem\u003eSalmonella\u003c/em\u003e enterica Serovar Typhi. J Bacteriol 199:e00647-16. https://doi.org/10.1128/JB.00647-16\u003c/li\u003e\n\u003cli\u003eFu Y, Gal\u0026aacute;n JE (1998) The \u003cem\u003eSalmonella\u003c/em\u003e typhimurium tyrosine phosphatase SptP is translocated into host cells and disrupts the actin cytoskeleton. Mol Microbiol 27:359\u0026ndash;368. https://doi.org/10.1046/j.1365-2958.1998.00684.x\u003c/li\u003e\n\u003cli\u003eZhou D, Gal\u0026aacute;n J (2001) \u003cem\u003eSalmonella\u003c/em\u003e entry into host cells: the work in concert of type III secreted effector proteins. Microbes Infect 3:1293\u0026ndash;1298. https://doi.org/10.1016/s1286-4579(01)01489-7\u003c/li\u003e\n\u003cli\u003eStebbins CE, Gal\u0026aacute;n JE (2000) Modulation of host signaling by a bacterial mimic: structure of the \u003cem\u003eSalmonella\u003c/em\u003e effector SptP bound to Rac1. Mol Cell 6:1449\u0026ndash;1460. https://doi.org/10.1016/s1097-2765(00)00141-6\u003c/li\u003e\n\u003cli\u003eGal\u0026aacute;n JE (2021) \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium and inflammation: a pathogen-centric affair. Nat Rev Microbiol 19:716\u0026ndash;725. https://doi.org/10.1038/s41579-021-00561-4\u003c/li\u003e\n\u003cli\u003eChen S, Zhang C, Liao C, et al (2015) Deletion of Invasion Protein B in \u003cem\u003eSalmonella\u003c/em\u003e enterica Serovar Typhimurium Influences Bacterial Invasion and Virulence. Curr Microbiol 71:687\u0026ndash;692. https://doi.org/10.1007/s00284-015-0903-x\u003c/li\u003e\n\u003cli\u003eHamed S, Shawky RM, Emara M, et al (2021) HilE is required for synergistic activation of SPI-1 gene expression in \u003cem\u003eSalmonella\u003c/em\u003e enterica serovar Typhimurium. BMC Microbiol 21:49. https://doi.org/10.1186/s12866-021-02110-8\u003c/li\u003e\n\u003cli\u003eDawan J, Ahn J (2020) Assessment of cross-resistance potential to serial antibiotic treatments in antibiotic-resistant \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium. Microb Pathog 148:104478. https://doi.org/10.1016/j.micpath.2020.104478\u003c/li\u003e\n\u003cli\u003ePei Y, Parreira VR, Roland KL, et al (2014) Assessment of attenuated \u003cem\u003eSalmonella\u003c/em\u003e vaccine strains in controlling experimental \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium infection in chickens. Can J Vet Res 78:23\u0026ndash;30\u003c/li\u003e\n\u003cli\u003eGebauer J, Tesař\u0026iacute;k R, Kr\u0026aacute;lov\u0026aacute; N, et al (2023) \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium-based inactivated vaccine containing a wide spectrum of bacterial antigens which mimics protein expression changes during different stages of an infection process. Vet Microbiol 282:109756. https://doi.org/10.1016/j.vetmic.2023.109756\u003c/li\u003e\n\u003cli\u003eArricau N, Hermant D, Waxin H, Popoff MY (1997) Molecular characterization of the \u003cem\u003eSalmonella\u003c/em\u003e typhi StpA protein that is related to both \u003cem\u003eYersinia\u003c/em\u003e YopE cytotoxin and YopH tyrosine phosphatase. Res Microbiol 148:21\u0026ndash;26. https://doi.org/10.1016/S0923-2508(97)81896-7\u003c/li\u003e\n\u003cli\u003eJi HJ, Jang A-Y, Song JY, et al (2022) Development of Live Attenuated \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium Vaccine Strain Using Radiation Mutation Enhancement Technology (R-MET). Front Immunol 13:931052. https://doi.org/10.3389/fimmu.2022.931052\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1 Primers used in this study\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"729\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.031550068587105%\"\u003e\n \u003cp\u003ePrimers\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.03292181069959%\"\u003e\n \u003cp\u003eSequences (5\u0026prime;-3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.659807956104252%\"\u003e\n \u003cp\u003eProduction\u003c/p\u003e\n \u003cp\u003e(size, bp)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.301783264746227%\"\u003e\n \u003cp\u003eUsage\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.973936899862826%\"\u003e\n \u003cp\u003eSource\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.031550068587105%\"\u003e\n \u003cp\u003e\u003cem\u003esptP\u003c/em\u003e-cat-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.03292181069959%\"\u003e\n \u003cp\u003eGTTTGCTGATTAATTGGAATGCTGCTGACCGCAAATCGTGCAGGCCCAGttacgccccgccctgccac\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.659807956104252%\" rowspan=\"2\"\u003e\n \u003cp\u003e960\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.301783264746227%\" rowspan=\"2\"\u003e\n \u003cp\u003eCapital letters: \u003cem\u003esptP\u003c/em\u003e homologous arm; Lowercase letter: Cm\u003csup\u003er\u003c/sup\u003e cassette amplification\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.973936899862826%\" rowspan=\"2\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.83653846153846%\"\u003e\n \u003cp\u003e\u003cem\u003esptP\u003c/em\u003e-cat-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.16346153846153%\"\u003e\n \u003cp\u003eAGAAAATAGAACCGGCGCGCCAATGCCACAGACGATGAGCGGACCGCAtacctgtgacggaagatcacttc\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.031550068587105%\"\u003e\n \u003cp\u003e\u003cem\u003esptP\u003c/em\u003e-out-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.03292181069959%\"\u003e\n \u003cp\u003eGTACGAACCGCTAATGCCACAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.659807956104252%\" rowspan=\"2\"\u003e\n \u003cp\u003e1145 or 285\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.301783264746227%\" rowspan=\"2\"\u003e\n \u003cp\u003eIdentification of \u003cem\u003esptP\u003c/em\u003e mutant\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.973936899862826%\" rowspan=\"2\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"22.83653846153846%\"\u003e\n \u003cp\u003e\u003cem\u003esptP\u003c/em\u003e-out-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"77.16346153846153%\"\u003e\n \u003cp\u003eGAGAGGTGGTTGTAAAGCTCTACTCATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2 Median lethal dose of ATCC14028 and ATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e injected intraperitoneally in mice\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"632\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.145569620253166%\"\u003e\n \u003cp\u003egroups\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.79113924050633%\"\u003e\n \u003cp\u003eChallenge dose( CFU)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.89873417721519%\"\u003e\n \u003cp\u003eNumber of dead mice/total number of mice\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.917721518987342%\"\u003e\n \u003cp\u003eMortality\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.246835443037973%\"\u003e\n \u003cp\u003eLD\u003csub\u003e50\u003c/sub\u003e( CFU)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.145569620253166%\" rowspan=\"6\"\u003e\n \u003cp\u003eATCC14028\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.79113924050633%\"\u003e\n \u003cp\u003e10\u003csup\u003e5\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.89873417721519%\"\u003e\n \u003cp\u003e0/5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.917721518987342%\"\u003e\n \u003cp\u003e0%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.246835443037973%\" rowspan=\"6\"\u003e\n \u003cp\u003e5.01\u0026times;10\u003csup\u003e5\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.54726368159204%\"\u003e\n \u003cp\u003e10\u003csup\u003e6\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.288557213930346%\"\u003e\n \u003cp\u003e4/5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.16417910447761%\"\u003e\n \u003cp\u003e0%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.54726368159204%\"\u003e\n \u003cp\u003e10\u003csup\u003e7\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.288557213930346%\"\u003e\n \u003cp\u003e5/5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.16417910447761%\"\u003e\n \u003cp\u003e100%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.54726368159204%\"\u003e\n \u003cp\u003e10\u003csup\u003e8\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.288557213930346%\"\u003e\n \u003cp\u003e5/5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.16417910447761%\"\u003e\n \u003cp\u003e0%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.54726368159204%\"\u003e\n \u003cp\u003e10\u003csup\u003e9\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.288557213930346%\"\u003e\n \u003cp\u003e5/5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.16417910447761%\"\u003e\n \u003cp\u003e0%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.54726368159204%\"\u003e\n \u003cp\u003e10\u003csup\u003e10\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.288557213930346%\"\u003e\n \u003cp\u003e5/5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.16417910447761%\"\u003e\n \u003cp\u003e100%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.145569620253166%\" rowspan=\"6\"\u003e\n \u003cp\u003eATCC14028\u0026Delta;\u003cem\u003esptP\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.79113924050633%\"\u003e\n \u003cp\u003e10\u003csup\u003e5\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.89873417721519%\"\u003e\n \u003cp\u003e0/5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.917721518987342%\"\u003e\n \u003cp\u003e0%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.246835443037973%\" rowspan=\"6\"\u003e\n \u003cp\u003e2\u0026times;10\u003csup\u003e7\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.54726368159204%\"\u003e\n \u003cp\u003e10\u003csup\u003e6\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.288557213930346%\"\u003e\n \u003cp\u003e0/5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.16417910447761%\"\u003e\n \u003cp\u003e0%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.54726368159204%\"\u003e\n \u003cp\u003e10\u003csup\u003e7\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.288557213930346%\"\u003e\n \u003cp\u003e2/5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.16417910447761%\"\u003e\n \u003cp\u003e40%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.54726368159204%\"\u003e\n \u003cp\u003e10\u003csup\u003e8\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.288557213930346%\"\u003e\n \u003cp\u003e4/5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.16417910447761%\"\u003e\n \u003cp\u003e80%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.54726368159204%\"\u003e\n \u003cp\u003e10\u003csup\u003e9\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.288557213930346%\"\u003e\n \u003cp\u003e5/5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.16417910447761%\"\u003e\n \u003cp\u003e100%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"40.54726368159204%\"\u003e\n \u003cp\u003e10\u003csup\u003e10\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.288557213930346%\"\u003e\n \u003cp\u003e5/5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.16417910447761%\"\u003e\n \u003cp\u003e100%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.145569620253166%\"\u003e\n \u003cp\u003ePBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.79113924050633%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.89873417721519%\"\u003e\n \u003cp\u003e0/10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.917721518987342%\"\u003e\n \u003cp\u003e0%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.246835443037973%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Salmonella typhimurium, sptP, live attenuated vaccine, Mutant, Immunogenicity","lastPublishedDoi":"10.21203/rs.3.rs-3845934/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3845934/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eSalmonella\u003c/em\u003e typhimurium is a pathogen that poses a severe health risk to humans and animals. We discussed the feasibility of the \u003cem\u003eSalmonella\u003c/em\u003e typhimurium Δ\u003cem\u003esptP\u003c/em\u003e mutant as a live attenuated vaccine, constructed a \u003cem\u003eSalmonella\u003c/em\u003e typhimurium Δ\u003cem\u003esptP\u003c/em\u003e mutant by homologous recombination, and evaluated its biological functions, such as growth characteristics, immunogenicity, and protective properties. We found that the Δ\u003cem\u003esptP\u003c/em\u003e gene mutant of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium is a safe and effective live attenuated vaccine. The mutation of the \u003cem\u003esptP\u003c/em\u003e gene does not affect the growth and character of bacteria and has genetic stability. Compared with wild-type \u003cem\u003eSalmonella\u003c/em\u003e typhimurium, the colonization ability of the mutant in RAW264.7 mouse macrophages and mice was significantly weakened. The median lethal dose (LD\u003csub\u003e50\u003c/sub\u003e) of the Δ\u003cem\u003esptP\u003c/em\u003e mutant was 39.92 times that of the wild-type strain, indicating that the virulence of the Δ\u003cem\u003esptP\u003c/em\u003e mutant was significantly weakened. After inoculation with 2\u0026times;10\u003csup\u003e4\u003c/sup\u003e CFU Δ\u003cem\u003esptP\u003c/em\u003e mutant and one booster immunization, the mice were able to resist 87.5% of the virulent strains compared to the PBS control group, and the level of IgG antibodies produced by the mutant was similar to that of the wild-type strain. These results show that Δ\u003cem\u003esptP\u003c/em\u003e mutants of \u003cem\u003eSalmonella\u003c/em\u003e typhimurium are significantly less virulent to mice than wild-type strains. The \u003cem\u003esptP\u003c/em\u003e mutant is immunogenic and protective in mice, and Δ\u003cem\u003esptP\u003c/em\u003e can be used as a live attenuated vaccine for \u003cem\u003eSalmonella\u003c/em\u003e typhimurium disease.\u003c/p\u003e","manuscriptTitle":"Construction of Salmonella typhimurium sptP mutant and evaluation of its characterization and immunoprotective effect","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-29 15:30:27","doi":"10.21203/rs.3.rs-3845934/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"61060003-7a17-4e89-89be-9e13beff0370","owner":[],"postedDate":"January 29th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-03-11T15:53:11+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-29 15:30:27","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3845934","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3845934","identity":"rs-3845934","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}