IFN-beta promotes RSAD2 expression and Lupus plasma cell differentiation via DNA Demethylation

preprint OA: closed
Full text JSON View at publisher
Full text 164,446 characters · extracted from preprint-html · click to expand
IFN-beta promotes RSAD2 expression and Lupus plasma cell differentiation via DNA Demethylation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article IFN-beta promotes RSAD2 expression and Lupus plasma cell differentiation via DNA Demethylation yang mei, Xi Li, Yue Xin, Zhenghao He, Yongjian Chen, Hongmei Yao, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4003534/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Systemic lupus erythematosus (SLE) is an autoimmune disease, in which the pathogenesis is revealed as abnormalities in B cells with no clear mechanism. Radical s-adenosyl methionine domain-containing 2 (RSAD2) is an interferon-stimulated gene (ISG), and it has been found to play an important role in innate immunity. Recent years the function of RSAD2 in autoimmune diseases, but its still unknown for RSAD2 in B cells from SLE patients still. Result In this study, we found RSAD2 was abnormal in SLE by analysis of database, which was relative with interferon (IFN). Further, we found that RSAD2 in peripheral blood B cell subsets was generally higher in SLE patients than healthy controls (HCs). In the meantime, differentiated B cells showed significantly higher expression of RSAD2 than naïve B cells in human tonsils. In the functional study in vitro , the frequencies of differentiated B cells and the expression of RSAD2 were enhanced by interferon-β (IFN-β). Simultaneously, the frequency of plasma cells (PC) was significantly reduced in sorted peripheral CD19 + B cells which was knock-down RSAD2 and stimulated with IFN-β. Mechanically, IFN-β can induce the hypomethylation of RSAD2 in B cells in vitro , which might be one of mechanisms for increased expression level of RSAD2 in B cells from SLE patients. Conclusion This study uncovered that IFN-β up-regulated the expression of RSAD2 by down-regulating the methylation of it to promote B cell differentiation. SLE B cells RSAD2 IFN-β Methylation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Systemic lupus erythematosus (SLE) is a complicated autoimmune disease with a staggering variety of clinical manifestations. Its main pathological feature is that abnormal secretion of antibodies results in the deposition of immune complex in small blood vessels and eventually leads to the over activation of immune response in organism. The morbidity of SLE is 28–86 per 10000000 and the prevalence is 265–1030 per 10000000 in Asia [ 1 ] . SLE tends to occur in women of reproductive age and is one of the main causes of death in young women [ 2 ] . The pathogenesis of this disease is unclear and the progress of research for diagnostic markers and therapeutic drugs is slow. The role of B cells in adaptive immunity includes T-B cell interaction, antigen presentation, antibody and cytokine secretion. Dysregulated B cells will lead to disorder of the immune system and induce immune system diseases which included multiple sclerosis with abnormal secretion of cytokines, myasthenia gravis, rheumatoid arthritis, primary sjogren's syndrome, pemphigus and optic neuromyelitis with abnormal secretion of antibodies [ 3 , 4 ] . As an important part of adaptive immunity, B cells play an important role in the pathogenesis and development of SLE [ 5 ] .On the current study, the mutation of B cell receptor (BCR) in SLE produces autoreactive B cells, and the abnormal interaction between B-T cells weakens the ability to clear autoreactive B cells resulting in the further increase of autoreactive B cells in the body [ 6 ] . In addition, BCR-mediated signal transmission is enhanced which can reduce the threshold of activation of peripheral B cells and promote the onset of SLE [ 7 ] . Other immunological abnormalities associated with B cell autoreactivity in SLE include increased plasma cell (PC) differentiation and survival, upregulation of toll-like receptor (TLR) signaling, and increased expression of key B cytokines such as BAFF, IL-6, and IL-21, which further activate the autoreactive B cells [ 8 ] . A series of dysfunction of B cells accelerates the development of SLE. Although biologics targeting B cells have been applied clinically, their safety and efficacy need to be further optimized [ 3 ] . RSAD2 (Radical s-adenosyl methionine domain-containing 2) was first discovered in fibroblasts infected with human cytomegalovirus [ 9 ] . The gene is located in the short arm of human chromosome 2 [ 10 ] , and the protein is called viperin. The central domain of viperin is highly homologous to the radical S-adenosyl-L-methionine (radical SAM) family, so viperin is also called RSAD2 [ 11 ] . Previous studies have found that RSAD2 played an important role in innate immunity which could inhibit viral replication in vivo [ 12 ] , affect the maturation of dendritic cells through IRF7 pathway [ 13 ] , affect NK cells through STAT1-related epigenetic regulation [ 14 ] , and highly expresse in proinflammatory M1 macrophages [ 15 ] . However, the relationship between RSAD2 and adaptive immunity needs further exploration. RSAD2 is highly expressed in B cells of primary sjogren's syndrome [ 16 ] , but the expression of RSAD2 in B cells from SLE is still not known and the function of RSAD2 in B cells is unclear. In this study, we found that the dysregulated genes which included RSAD2 in SLE were mainly concentrated on the interferon signaling pathway and the most significant differences are found in plasma cells (PC) by bioinformatics analysis, which was consistent with that RSAD2 was higher in peripheral blood B cell subsets in SLE. In addition to that, we found the expression of RSAD2 in differentiated B cells (including memory B and PC) was significantly higher than that in naïve B cells in human tonsils. When we silenced RSAD2 in vitro , the differentiation frequency of PC was significantly decreased. We also found that there were low methylation levels in the promoter region of RSAD2 in B cells from SLE patients, and the site of RSAD2 was also hypomethylated after IFN-β stimulation. Therefore, we described that RSAD2 demethylation mediated by IFN-β promotes lupus B cell differentiation, which might provide better understanding for the pathogenesis of SLE. Materials and Methods Sample and clinical information SLE patients and HC were collected from the Department of Dermatology and Health Examination Center of the Second Xiangya Hospital, Central South University. SLE was diagnosed according to the 1997 classification criteria of the American College of Rheumatology (Table 1 and Table 2 ). Human tonsil samples were collected from the Department of Otolaryngology Head and Neck Surgery, Second Xiangya Hospital, Central South University (Table 3 ). Table 1 Clinical information of SLE for flow cytometry Number Gender Age SLEDAI scores Number Gender Age SLEDAI scores SLE1 Female 15 11 SLE20 Female 25 2 SLE2 Female 30 19 SLE21 Female 41 2 SLE3 Female 64 13 SLE22 Male 32 16 SLE4 Female 26 1 SLE23 Female 18 14 SLE5 Female 20 0 SLE24 Female 20 2 SLE6 Female 33 2 SLE25 Female 28 6 SLE7 Female 37 0 SLE26 Female 56 6 SLE8 Female 20 5 SLE27 Female 15 6 SLE9 Female 12 0 SLE28 Female 33 8 SLE10 Female 12 7 SLE29 Female 36 4 SLE11 Female 67 3 SLE30 Female 40 10 SLE12 Female 14 8 SLE31 Female 35 2 SLE13 Female 53 12 SLE32 Female 17 18 SLE14 Male 30 20 SLE33 Female 47 14 SLE15 Female 37 16 SLE34 Female 43 14 SLE16 Female 43 8 SLE35 Male 59 0 SLE17 Male 68 8 SLE36 Female 9 12 SLE18 Male 31 8 SLE37 Female 30 8 SLE19 Female 51 2 SLE38 Female 43 4 Table 2 Information of HC for FCM Number Gender Age Number Gender Age HC1 Female 27 HC13 Female 37 HC2 Female 36 HC14 Female 43 HC3 Male 36 HC15 Female 23 HC4 Female 26 HC16 Female 23 HC5 Female 31 HC17 Male 28 HC6 Female 46 HC18 Female 29 HC7 Female 35 HC19 Female 24 HC8 Female 39 HC20 Male 26 HC9 Female 40 HC21 Male 24 HC10 Female 38 HC22 Female 29 HC11 Male 24 HC23 Female 37 HC12 Male 40 Table 3 Clinical information of tonsil tissue Number Gender Age Diagnosis Tonsil-1 Male 13 Tonsil hypertrophy/Adenoid hypertrophy /Snoring disorder Tonsil-2 Female 10 Tonsil hypertrophy/Adenoid hypertrophy/Snoring disorder Tonsil-3 Female 8 Tonsil hypertrophy Tonsil-4 Male 3 Adenoid hypertrophy/Tonsil hypertrophy Tonsil-5 Male 10 Tonsil hypertrophy/Snoring disorder/Adenoid hypertrophy Tonsil-6 Female 7 Cerumen embolism/Tonsil hypertrophy/Adenoid hypertrophy Tonsil-7 Male 6 Cerumen embolism/Adenoid hypertrophy Tonsil-8 Male 5 Tonsil hypertrophy/Nerve deafness Tonsil-9 Male 3 Tonsil hypertrophy/Adenoid hypertrophy/Cerumen embolism Tonsil-10 Female 4 Adenoid hypertrophy/Tonsil hypertrophy Tonsil-11 Female 9 Tonsil hypertrophy/Adenoid hypertrophy/Cerumen embolism Tonsil-12 Female 9 Tonsil hypertrophy/Adenoid hypertrophy Tonsil-13 Male 13 Tonsil hypertrophy/Adenoid hypertrophy/Snoring disorder Tonsil-14 Male 10 Tonsil hypertrophy/Adenoid hypertrophy/Sleep apnea syndrome Tonsil-15 Male 12 Tonsil hypertrophy Tonsil-16 Female 5 Tonsil hypertrophy/Adenoid hypertrophy Tonsil-17 Female 13 Adenoid hypertrophy/Tonsil hypertrophy/Nerve deafness Tonsil-18 Female 5 Adenoid hypertrophy/Tonsil hypertrophy FCM staining Tonsillar or peripheral blood lymphocyte suspensions of 1×10 6 cells were supplemented to 100 µL with PBS. Then the surface marker flow staining mixture was prepared, and 10 µL the mixture (antibody: cells = 0.5 µL: 1×10 6 cells) was added to each flow tube: ① Tonsillar lymphocyte flow staining mixture: BV605 CD19 (BL, cat.302244), APC-Cy7 CD20 (BL, cat.302314), PE-Dazzle594 CD27 (BL, cat.124228), PerCP-Cy5.5 CD38 (BL, cat.303522), PE-Cy7 IgD (BL, cat.348210), BV421 IgM (BL, cat.314516) and Zombie Aqua (BL, cat.423102); ② Flow staining mixture of peripheral blood lymphocytes: FITC CD19 (BL, cat.392508), PE CD27 (BL, cat.302808), PerCP-Cy5.5 CD38 (BL, cat.303522), PE-Cy7 IgD (BL, cat.348210) and Zombie NIR (BL, cat.423106). Added the prepared mixture to the cell suspension, and incubated in a 4℃ refrigerator in the dark for 45 min. The reaction was stopped by PBS, then 500 µL of fixed film breaking agent(BD, cat.562574) was added, incubated at 4℃ in the dark for 90 min, and then 500 µL of washing buffer was added. After centrifugation, the mixture was supplemented with PBS to 100 µL. AF647-RSAD2 (SAB, cat. #C47852) was added to mix thoroughly, incubated at 4° C in the dark for 90 min, the reaction was terminated by adding PBS, and the centrifugation was complemented with PBS to 150 µL. B cell sorting Added buffer solution and magnetic beads according to the instructions (Miltenyi, cat.130-050-301) (1×10 7 :40 µL buffer and 5 µL magnetic beads conjugated antibody) and incubated at 4℃ in the dark for 15 min; then, the cell suspension was filtered in a positive sorting column, and the cells adsorbed in the sorting column were collected as CD19 + B cells. RT-qPCR Total RNA was extracted by Trizol according to the protocol (AG, cat.AG21102), and then the RNA was used to reverse transcription to get cDNA for qPCR (AG, cat.AG11728). Primer sequence is shown in Table 4 . Table 4 Information of primer sequence Species Genes Sequence(5’→3’) Human RSAD2 Forward: CAGCGTCAACTATCACTTCACT Reverse: AACTCTACTTTGCAGAACCTCAC BLIMP1 Former: TAAAGCAACCGAGCACTGAGA Reverse: ACGGTAGAGGTCCTTTCCTTTG BCL6 Former: ACACATCTCGGCTCAATTTGC Reverse: AGTGTCCACAACATGCTCCAT PAX5 Former: ACTTGCTCATCAAGGTGTCAG Reverse: TCCTCCAATTACCCCAGGCTT MTA3 Former: GACTTGACCGATAAGCAGAAACA Reverse: AGGGCAACACTGCACTTTCC IRF4 Former: GCTGATCGACCAGATCGACAG Reverse: CGGTTGTAGTCCTGCTTGC CD38 Former: AGACTGCCAAAGTGTATGGGA Reverse: GCAAGGTACGGTCTGAGTTCC GAPDH Former: GGAGCGAGATCCCTCCAAAAT Reverse: GGCTGTTGTCATACTTCTCATGG Cell immunofluorescence A mixture (PBS: Corning® Cell-Tak ™ = 1:100) was added to a 24-well plate, into which the slides were placed and incubated in a cell incubator for 20 min; then the cells were cultured in 24-well plate for 30 min; 4% paraformaldehyde fixative was added to a 24-well plate, and the slide were placed in the fixative and incubated for 30 min at room temperature on a shaker. The membrane rupture mixture (0.5% TritonX-100: PBS = 1:200) was added into 24-well plate and incubated at room temperature for 15 min; anti-human RSAD2 antibody (1:100 dilution, Sigma, cat.MABF106) was added and incubated for 1 h at room temperature; then secondary antibody was kept in the dark at room temperature for 0.5 h; opal620 (1:200 dilution, Akoya Biosciences) was kept at room temperature in the dark for 1.5 hours; anti-human CD38 antibody (1:300 dilution, Abcam, cat.216343) was added and incubated at room temperature for 1 h; anti-rabbit secondary antibody (1:500 dilution) was added and incubated at room temperature in the dark for 0.5 h; opal520 (1:200 dilution, Akoya Biosciences) was added and kept in the dark at room temperature for 1 h; DAPI was added for nuclear staining and incubated at room temperature for 10 min before observation. Electric transfer 1 mL 1640 complete medium (contained IFN-β of which final concentration of was 20 ng/mL) was added to the well of 24-well plate in advance; then 4×10 6 CD19 + B cells were taken out and placed in a centrifuge tube and was centrifuged to get cell pellet; electrotransfer mixture was prepared (electric transfer fluid: interference sequence = 40:1, LONZA, cat.PBP3-02250); 100 µL of the electrotransfer mixture was added to each centrifuge tube and transferred to the electrotransfer cup; put the electric rotor cup into the electric rotor instrument (LONZA) and run the program "Human B cell"; the cells were transferred to the medium and cultured for 48 h in a cell incubator at 37° C after electroporation. DNA methylation chip PBMCs were isolated from peripheral blood of SLE and HC; CD19 + B cells were sorted by magnetic beads; DNA of CD19 + B cells was extracted with the kit (TIANGEN, cat.#DP304-02); the original idat files were obtained from the Genergy Bio company, the data were analyzed (β value difference ≥ 0.2, P < 0.05; Hypomethylation sites: β value difference ≤ -0.2, P < 0.05). Pyrosequencing The genomic DNA of IFN-β stimulated B cells was extracted by DNA kit; the DNA samples were hydrogenated by bisulfite using the kit(ZYMO, cat.D5030); the hydrogenated DNA samples were amplified by PCR according to the designed primers (Table 5 ), and then tested by the computer. Table 5 Sequence of RSAD2 for DNA methylation Position Sequence(5’→3’) cg10549986 Forward PCR primer TAGTAGTTGGTTTTGAGAGGGTTAGATGA Reverse PCR primer CCTTAAACAAAAACAATCCTCTCTTTACTT Sequencing Primer AAGAGGATTTTTTTTTGTTTATTA Sequence to Analyze TTTTAATTAGYGTTAATTATTATTTTATT cg10771443 Forward PCR primer GGATTTAGTTTTTAAGAATGTTTATTGAG Reverse PCR primer AAACAAAAACCAAAAACAAAACAAATCTA Sequencing Primer GTATTATTATATTAGTAATTGGTAG Sequence to Analyze YGTTTTGGAGAGAATTTAGTA cg23213327 Forward PCR primer TTTGGGTTAAGTATTTGGAGTTTTTTTAAG Reverse PCR primer TTCCCCTTTCTAACTAAAACAACCT Sequencing Primer GTTTGTAAGAGATTTTTATTAGG Sequence to Analyze ATYGTGTTGATTTAATTTTTGAGATTTT cg10959651 Forward PCR primer ATTTGTTATAATGTGGGTGTTTATATTTG Reverse PCR primer CCAACTACTACTTTCTCCTCTTAATAACTA Sequencing Primer GGAGGAGTTTGGTTT Sequence to Analyze YGTTGTTTTGTTGGTTGAGGGTAATT Results Enhanced expression level of RSAD2 in B cells of peripheral blood mononuclear cells (PBMC) from SLE patients We analyzed the transcriptome data of peripheral blood B cells from SLE patients based on bioinformatics technology. Than, we found 80 up-regulated genes and 20 down-regulated genes in GSE149050, while 560 up-regulated genes and 458 down-regulated genes in GSE4588 (Fig. 1A-B). The intersection of two datasets resulted in 18 differential genes (Fig. 1C). We further analyzed the interactions between the proteins encoded by the 18 differential genes and found that other proteins were interacted with RSAD2 suggesting these proteins may have a certain functional relationship (Fig. 1D), in addition to CLEC7A, FCGR1B, LILRA5, RNASE2, TMEM176B and MS4A4A. Furthermore, we discovered that IFI6, IFI44, IFI44L, IFIT1, IFIT3, IFI27, CMPK2, IFITM1, USP18 and RSAD2 were a key module (Fig. 1E). Enrichment analysis of 10 proteins for the key modules demonstrated that they were mainly related to interferon-related pathways and virus-related pathways (Fig. 1F). To validate the results of bioinformatics data, we analyzed mRNA of the RSAD2 and its relation with some genes related to B cells from SLE. We found RSAD2 in peripheral blood B cells of SLE was much higher than that of HC (Fig. 2A), and other molecules including the expression of BLIMP1 , CD38 which were in line with the previous findings [ 17 ] . And the mRNA of RSAD2 was positively correlated with BLIMP1 (Fig. 2B), but there were no obvious trends between RSAD2 and other genes. In order to analyse the expression of RSAD2 in various B-cell subsets of SLE, we collected peripheral blood from patients and found that the frequencies of CD19 + B cells and IgD - CD27 - B cells (double negative B cells, DN B) in SLE were higher than those in HC, while the frequencies of IgD + CD27 + B cells (double positive B cells, DP B) and naive B cells were lower than HC (Additional file 1). The results showed that the mean fluorescence intensity (MFI) of RSAD2 in peripheral blood B-cell subsets was generally higher in SLE (Additional file 2, Fig. 3A-B). In addition to that, RSAD2 MFI was highly expressed in differentiated B cells from SLE and HC (Fig. 3C). Similarly, single cell analysis of RSAD2 in B cell subsets (Fig. 3D-E) indicated that the expression level of RSAD2 was higher in SLE than HC in three B cell subsets except for switching memory B cells, and the difference was most obvious in PC. There is an important relationship between progression and disease activity in SLE, hence we divided patients into active and inactive groups according to SLEDAI scores. However, there was no significant difference in the expression of RSAD2 between the two groups (Fig. 3C). Furthermore, correlation analysis showed that there was no significant correlation between RSAD2 and SLEDAI scores (Fig. 3F). RSAD2 is highly expressed in differentiated B cells from human tonsil As a vital immune organ, human tonsil is a special model to explore the development of B cells. To further analyze the relationship between RSAD2 and B cells. We collected relatively healthy tonsil tissues and extracted individual cell suspensions for further analysis. The expression of RSAD2 in B cell subsets including CD19 + B cells, CD19 + CD27 + B cells, CD19 + CD27 - B cells, CD19 + CD20 - CD38 + B cells (plasma cells, PC), CD19 + IgM + IgD + B cells (naïve B cells), CD19 + IgD - CD27 + B cells (class memory B cells, CMB), CD19 + CD20 + CD38 + B cells (germinal central B cells, GCB), CD19 + IgD + CD27 + B cells (double positive B cells, DP) and CD19 + IgD - CD27 - B cells(double negative B cells, DN) (Fig. 4A). Our experiment showed that RSAD2 MFI in CD27 + B cells was higher than that in CD27 - B cells. Compared with CMBs, GCBs and PCs, naïve B cells had the lowest expression of RSAD2 MFI. Among the memory B cell subsets, RSAD2 MFI in IgD - CD27 - B cells was the lowest (Fig. 4B). In the B cell subsets of human tonsil, RSAD2 expression is higher in differentiated B cells which is accordance with the peripheral blood results. IFN-β upregulate the expression of RSAD2 and increase the differentiation frequency of PC Previous studies and our bioinformatics analysis suggest that IFN can affect the expression of RSAD2 [ 18 ] , so we detected the mRNA of RSAD2 in response to IFN-I and IFN-II stimulation and found that IFN-β upregulated RSAD2 most significantly (Fig. 5A-B). In addition to RSAD2 , BCL6 was decreased after stimulation, but BLIMP1 , PAX5 , MTA3 and IRF4 did not change significantly (Fig. 5C). By immunocytofluorescence (ICC), we found that RSAD2 was mainly expressed in the nucleus and its expression was also increased in CD38 + RSAD2 + B cells (Fig. 5D) after IFN-β stimulation. Flow cytometry (FCM) showed (Fig. 6A) that the frequency of PCs (Fig. 6B) and the expression of RSAD2 were also increased (Fig. 6C-D) after IFN-β treatment. These experimental results are consistent with the results of single-cell sequencing analysis. Knockout of RSAD2 in B cells inhibits PC differentiation Sorted B cells were silenced with RSAD2 siRNA in vitro and stimulated with IFN-β. Decreased frequencies of PCs, CD19 + CD27 + B cells and DPs were found, while there were no significant changes in other B cell subsets (Fig. 7A). The result of mRNA level showed that the mRNA of RSAD2 , CD38 , CD27 , IRF4 , PAX5 , and MTA3 was decreased after silenced RSAD2, but that of BLIMP1 and BCL-6 was not obviously changed (Fig. 7B).These data meant that RSAD2 may promote B cell differentiation. DNA methylation of RSAD2 regulated by IFN-β controlled the effect of RSAD2 on B cells Previous studies have discovered DNA hypomethylation in SLE [ 19 ] and RSAD2 also appears hypomethylation in SLE, suggesting that DNA methylation of RSAD2 may have some relationship with the pathogenesis of SLE [ 20 ] .So we analyzed the DNA methylation level of RSAD2 in sorted B cells from SLE and these position was further tested in sorted B cells after IFN-β stimulation. We showed that there were four hypomethylation sites in the promoter position of RSAD2 from SLE in DNA sequencing chip (Fig. 8A) including cg10549986, cg23213327, cg10771443, and cg10959651. It was interesting that the methylation level of the IFN-β stimulated group was significantly lower than that of the control group at position cg10771443, but there was no significant difference in the other three sites (Fig. 8B). Discussion Interferon-stimulated gene (ISG) is a class gene which can be stimulated by IFN [ 21 ] . Approximately 10% of the human genome is regulated by IFN in the human. Studies have uncovered that ISG inhibits virus invasion through a variety of pathways. IFITM3 blocks the membrane fusion of viruses through the endocytic pathway by the palmitoylated amphipathic α-helix [ 22 ] . NCOA7 can bind to vacuolar H + -ATPase to promote the degradation of the endocytosed virus [ 23 ] and VP30 regulates viral RNA synthesis by interacting with RBBP6, a ubiquitin ligase that plays a role in cell cycle progression and transcription [ 24 ] . In short, ISG can inhibit virus entry, virus proliferation in cells, and virus release. Studies have found that in addition to resisting viruses, ISG is also abnormally expressed in many diseases. The concentration of bile acid precursor 25-hydroxycholesterol (25-HC) in cerebrospinal fluid of multiple sclerosis (MS) is increased, which may due to the up-regulation of ISG-CH25H in macrophages [ 25 ] . ISG15 was significantly increased in the cerebral ischemia model without obvious signs of inflammation and the cortical shock-induced brain injury model [ 26 ] . Aberrant expression of ISG has been found in the synovium of rheumatoid arthritis (RA), and recent studies, including RNA-seq analysis, have further identified the expression of ISG in other tissues of RA lesions, such as joints [ 27 ] and these are sensitive to JAK inhibitors [ 28 ] . These results suggest that the efficacy of these compounds may be related to the inhibition of ISG. In SLE, microarray analysis data show that hundreds of ISG are up-regulated, suggesting that ISG may play an important role in the course of SLE [ 29 ] . In this study, we investigated the role of RSAD2 in B cells from SLE. Firstly, 18 genes were found to be highly expressed in B cells of SLE by RNA-seq which included RSAD2. Further screening the genes, we found a key module in the pathogenesis of SLE. Enrichment analysis of these genes revealed that they play vital roles in SLE mainly through IFN-related pathways. We found that RSAD2 was highly expressed in all B cell subsets of SLE, but the difference was more significant in PC. These results suggested that the presence of RSAD2 may increase the proliferation of B cells and be more closely related to the function of PC and the results were consistent with the bioinformatics results in single cell sequencing from public data. We also found that the expression level of mRNA of BLIMP1 in B cells from PBMCs was positively correlated with of RSAD2. BLIMP1 promotes the differentiation of B cells into PC [ 30 ] , which further confirmed that RSAD2 may be related to the differentiation of B cells. RSAD2 can be used as a preferred biomarker for disease activity in Aicardi-Goutières syndrome (AGS) [ 31 ] , and as a specific biomarker for onset of antibody-mediated rejection (ABMR) after renal transplantation [ 32 ] . It is also a potential biomarker and therapeutic target for post-traumatic acute respiratory distress syndrome [ 33 ] . The disease severity of SLE has an important relationship with disease progression which even affects the prognosis of patients, but there is no sensitive and simple index to distinguish the progression of SLE now. Therefore, we analyzed the expression of RSAD2 in patients with active and inactive SLE. Unfortunately, it was no significant difference in the expression of RSAD2 between active and inactive SLE patients, and there was no clear correlation between RSAD2 and SLEDAI scores. What's interesting was that RSAD2 was generally more differentially expressed in active SLE, so we can further expand our sample to explore the role of RSAD2 as an indicator of active SLE. In addition to its diagnostic role, RSAD2 can also be used as a prognostic marker for IFN-β therapy in MS [ 34 ] . RSAD2 also can predict the prognosis of melanoma in the prediction model of CD8 + T lymphocyte involvement [ 35 ] . Therefore, whether RSAD2 can be used as a marker for SLE specific drug treatment warrants further study. After the treatment of malignant tumors or hepatitis with IFN-I, individuals will produce autoantibodies and autoimmunity, which can induce SLE and SSc [ 36 ] . Anilumab, as a receptor antagonist of IFN-I, has a certain effect in the treatment of patients with moderate to severe SLE, which confirms the role of IFN in the pathogenesis of SLE from another perspective. IFN-I can induce the maturation and activation of dendritic cells (DC), increase the expression of MHC class I and II molecules of DC [ 37 ] , and increase the presentation of self-antigens to B cells. It can also activate T cells and induce autoreactive PC to secrete autoantibodies. In this study, the frequency of PC and the expression of RSAD2 were increased after the sorted CD19 + B cells were stimulated with IFN-β in vitro , which provided a new idea that IFN-I could promote B cell differentiation by regulating ISG. Previous studies mainly focused on the effect of IFN-α on SLE and B cells, but in this study, the function of IFN-β was more intense on RSAD2, which uncovered a new role of IFN-β. In contrast to peripheral blood mRNA expression, BLIMP1 was not differentially expressed, but BCL6 was significantly decreased. BCL6 and BLIMP1 are antagonistic transcription factors in the differentiation and maturation of B cells [ 38 ] , and the protein translated by BCL6 can inhibit the effect of BLIMP1 [ 39 ] . Although there was no significant change in mRNA of BLIMP1 , BCL6 was decreased and the final result was similar to that of increased BLIMP1 expression. However, the reasons for this difference in expression are still unclear. The expression of transcription factors IRF4 , PAX5 and MTA3 did not change significantly in IFN-β stimulated sorted B cells. It was found that the frequency of PC was lower than that of the control group after silencing RSAD2 in vitro , which further indicated that IFN-β could regulate the function of B cells through RSAD2. IRF4 belongs to interferon regulatory factors (IRF) [ 40 ] . In the upstream of BLIMP1 , IRF4 can promote the transformation of B cells to PC. PAX5 regulates the expression of genes related to tissue development [ 41 ] . In the process of B cell development, PAX5 regulates the formation of BCR in immature B cells [ 42 ] . PAX5 can also activate cytidylate deaminase (AID) gene, which is essential for somatic hypermutation and antibody class switching [ 43 ] , but PAX5 inhibits BLIMP1 expression and B cell differentiation towards PC [ 44 , 45 ] . MTA3 is a member of the transfer-related family, and its encoded protein can activate histone deacetylase to change the acetylation state of BCL6 and cooperate with BCL6 to inhibit PC differentiation [ 46 ] . After RSAD2 silencing, the mRNA levels of IRF4 , PAX5 and MTA3 decreased, suggesting that RSAD2 may be upstream. When RSAD2 is silenced, the coordinating effect of their RNA changes is no obvious change of BLIMP1 and BCL6 . Nevertheless, the specific regulation methods need to be further explored. IFN-I signaling is the result of the interaction of multiple molecules, and epigenetic modification is also a regulatory mechanism of IFN-I signaling. IFNs can activate the STAT pathway, and when IFN-α acts, STAT2 can recruit the histone acetyltransferase GCN5 to promote the acetylation of histone H3, which is a marker of general transcriptional activation [ 46 ] . Two studies have shown the genomic DNA hypomethylation signature of T cells and neutrophils from SLE [ 47 , 48 ] . Similar to these results, RSAD2 hypomethylation sites were identified in B cells from SLE and corresponding hypomethylation was also observed after IFN-β treatment. Conclusion All in all, RSAD2 was higher in B cells from SLE patients and promoted B cell differentiation to PC. Except that, the expression of RSAD2 can be up-regulated by IFN-β by down-regulating DNA methylation level. These founding may provide a new insight for SLE pathogenesis. Abbreviations CMB Class memory B cell DC Dendritic cell DP Double positive B cells DN Double negative B cells FCM Flow cytometry GC B Germinal central B cell HC Healthy control ICC Immunocytofluorescence IFN Interferon ISG Interferon-stimulated gene MFI Mean fluorescence intensity PBMC Peripheral blood mononuclear cells PC Plasma cell RA Rheumatoid arthritis RSAD2 Radical s-adenosyl methionine domain-containing 2 SLEDAI SLE disease activity index SLE Systemic lupus erythematosus Declarations Acknowledgments We thank all participants for providing blood samples. Availability of data and materials The data presented in this study are contained within the article. Funding This work was supported by grants from the National Natural Science Foundation of China (81773332, 82373488); Natural Science Foundation of Hunan Province of China (2021JJ40848, 2022JJ40722, 2023JJ60435); Outstanding Youth Fund of Hunan Provincial Department of Education of China (22B0060); Health research project of Hunan Provincial Health Commission (No. W20243055); Science and Health joint project of Hunan Science Foundation(S2023JJBMLH0972. Authors and Affiliations Department of Dermatology, The Second Xiangya Hospital of Central South University, 139 Middle Renmin Road, Changsha, Human 410011, China. Hunan Key Laboratory of Medical Epigenomics, 139 Middle Renmin Road, Changsha, Human 410011, China. Yang Mei, Xi Li, Yue Xin, Hongmei Yao, Ming Yang & Haijing Wu Department of Plastic Surgery, Zhongshan City People's Hospital, Zhongshan, Guangdong, China. Zhenghao He Department of Dermatology, The First Affiliated Hospital of Hunan Normal University, Hunan Provincial People's Hospital, Changsha 410005, China. Yongjian Chen Contributions Yang Mei: Conceptualization, investigation, formal analysis, writing – original draft. Xi Li: Investigation, formal analysis – original draft. Yue Xin and Zhenghao He: Investigation, formal analysis. Yongjian Chen and Hongmei Yao : Investigation, formal analysis. Ming Yang: Project administration, conceptualization, writing – original draft. Haijing Wu: Project administration, conceptualization, writing – original draft. Corresponding author Haijing Wu and Ming Yang are joint corresponding author. Ethics declarations Ethics approval and consent to participate This study has been approved by the Ethics Committee of the Second Xiangya Hospital of Central South University (Ethics number: 2019044). Consent for publication Not applicable. Declaration of Competing Interests We declare no competing interests.Additional information Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. References BARBER M R W, DRENKARD C, FALASINNU T, et al. Global epidemiology of systemic lupus erythematosus [J]. Nat Rev Rheumatol, 2021, 17(9): 515–32. YEN E Y, SINGH R R. Brief Report: Lupus-An Unrecognized Leading Cause of Death in Young Females: A Population-Based Study Using Nationwide Death Certificates, 2000–2015 [J]. Arthritis Rheumatol, 2018, 70(8): 1251–5. KIROU K A, DALL ERA M, ARANOW C, et al. Belimumab or anifrolumab for systemic lupus erythematosus? A risk-benefit assessment [J]. Front Immunol, 2022, 13: 980079. LEE D S W, ROJAS O L, GOMMERMAN J L. B cell depletion therapies in autoimmune disease: advances and mechanistic insights [J]. Nat Rev Drug Discov, 2021, 20(3): 179–99. PARODIS I, GATTO M, SJöWALL C. B cells in systemic lupus erythematosus: Targets of new therapies and surveillance tools [J]. Front Med (Lausanne), 2022, 9: 952304. SINAI P, DOZMOROV I M, SONG R, et al. T/B-cell interactions are more transient in response to weak stimuli in SLE-prone mice [J]. Eur J Immunol, 2014, 44(12): 3522–31. NASHI E, WANG Y, DIAMOND B. The role of B cells in lupus pathogenesis [J]. Int J Biochem Cell Biol, 2010, 42(4): 543–50. MALKIEL S, BARLEV A N, ATISHA-FREGOSO Y, et al. Plasma Cell Differentiation Pathways in Systemic Lupus Erythematosus [J]. Front Immunol, 2018, 9: 427. ZHU H, CONG J P, SHENK T. Use of differential display analysis to assess the effect of human cytomegalovirus infection on the accumulation of cellular RNAs: induction of interferon-responsive RNAs [J]. Proc Natl Acad Sci U S A, 1997, 94(25): 13985–90. LEI M, LIU H, LIU S, et al. Identification and functional characterization of viperin of amphioxus Branchiostoma japonicum: Implications for ancient origin of viperin-mediated antiviral response [J]. Dev Comp Immunol, 2015, 53(2): 293–302. CHIN K C, CRESSWELL P. Viperin (cig5), an IFN-inducible antiviral protein directly induced by human cytomegalovirus [J]. Proc Natl Acad Sci U S A, 2001, 98(26): 15125–30. RIVERA-SERRANO E E, GIZZI A S, ARNOLD J J, et al. Viperin Reveals Its True Function [J]. Annu Rev Virol, 2020, 7(1): 421–46. JANG J S, LEE J H, JUNG N C, et al. Rsad2 is necessary for mouse dendritic cell maturation via the IRF7-mediated signaling pathway [J]. Cell Death Dis, 2018, 9(8): 823. WIEDEMANN G M, GEARY C D, LAU C M, et al. Cutting Edge: STAT1-Mediated Epigenetic Control of Rsad2 Promotes Clonal Expansion of Antiviral NK Cells [J]. J Immunol, 2020, 205(1): 21–5. LI P, HAO Z, WU J, et al. Comparative Proteomic Analysis of Polarized Human THP-1 and Mouse RAW264.7 Macrophages [J]. Front Immunol, 2021, 12: 700009. ZHU H, ZHENG J, ZHOU Y, et al. Knockdown of RSAD2 attenuates B cell hyperactivity in patients with primary Sjögren's syndrome (pSS) via suppressing NF-κb signaling pathway [J]. Mol Cell Biochem, 2021, 476(5): 2029–37. YANG M, LONG D, HU L, et al. AIM2 deficiency in B cells ameliorates systemic lupus erythematosus by regulating Blimp-1-Bcl-6 axis-mediated B-cell differentiation [J]. Signal Transduct Target Ther, 2021, 6(1): 341. GAO X, GAO L-F, ZHANG Y-N, et al. Huc-MSCs-derived exosomes attenuate neuropathic pain by inhibiting activation of the TLR2/MyD88/NF-κB signaling pathway in the spinal microglia by targeting Rsad2 [J]. Int Immunopharmacol, 2023, 114: 109505. FASANO S, MILONE A, NICOLETTI G F, et al. Precision medicine in systemic lupus erythematosus [J]. Nature Reviews Rheumatology, 2023. FANG Q, LI T, CHEN P, et al. Comparative Analysis on Abnormal Methylome of Differentially Expressed Genes and Disease Pathways in the Immune Cells of RA and SLE [J]. Front Immunol, 2021, 12: 668007. SCHOGGINS J W. Interferon-Stimulated Genes: What Do They All Do? [J]. Annual Review of Virology, 2019, 6(1): 567–84. SPENCE J S, HE R, HOFFMANN H-H, et al. IFITM3 directly engages and shuttles incoming virus particles to lysosomes [J]. Nat Chem Biol, 2019, 15(3): 259–68. DOYLE T, MONCORGé O, BONAVENTURE B, et al. The interferon-inducible isoform of NCOA7 inhibits endosome-mediated viral entry [J]. Nat Microbiol, 2018, 3(12): 1369–76. SHAW A E, HUGHES J, GU Q, et al. Fundamental properties of the mammalian innate immune system revealed by multispecies comparison of type I interferon responses [J]. PLoS Biol, 2017, 15(12): e2004086. CRICK P J, GRIFFITHS W J, ZHANG J, et al. Reduced Plasma Levels of 25-Hydroxycholesterol and Increased Cerebrospinal Fluid Levels of Bile Acid Precursors in Multiple Sclerosis Patients [J]. Mol Neurobiol, 2017, 54(10): 8009–20. WANG R-G, KAUL M, ZHANG D-X. Interferon-stimulated gene 15 as a general marker for acute and chronic neuronal injuries [J]. Sheng Li Xue Bao, 2012, 64(5): 577–83. ORANGE D E, AGIUS P, DICARLO E F, et al. Identification of Three Rheumatoid Arthritis Disease Subtypes by Machine Learning Integration of Synovial Histologic Features and RNA Sequencing Data [J]. Arthritis & Rheumatology (Hoboken, NJ), 2018, 70(5): 690–701. BOYLE D L, SOMA K, HODGE J, et al. The JAK inhibitor tofacitinib suppresses synovial JAK1-STAT signalling in rheumatoid arthritis [J]. Ann Rheum Dis, 2015, 74(6): 1311–6. CATALINA M D, BACHALI P, GERACI N S, et al. Gene expression analysis delineates the potential roles of multiple interferons in systemic lupus erythematosus [J]. Commun Biol, 2019, 2: 140. OLIVA L, CENCI S. Autophagy in plasma cell pathophysiology [J]. Frontiers In Immunology, 2014, 5: 103. WANG B X, GROVER S A, KANNU P, et al. Interferon-Stimulated Gene Expression as a Preferred Biomarker for Disease Activity in Aicardi-Goutières Syndrome [J]. Journal of Interferon & Cytokine Research: the Official Journal of the International Society For Interferon and Cytokine Research, 2017, 37(4): 147–52. MATZ M, HEINRICH F, ZHANG Q, et al. The regulation of interferon type I pathway-related genes RSAD2 and ETV7 specifically indicates antibody-mediated rejection after kidney transplantation [J]. Clin Transplant, 2018, 32(12): e13429. QI P, HUANG M, LI T. Identification of potential biomarkers and therapeutic targets for posttraumatic acute respiratory distress syndrome [J]. BMC Med Genomics, 2023, 16(1): 54. RAMOS P S, ZIMMERMAN K D, HADDAD S, et al. Integrative analysis of DNA methylation in discordant twins unveils distinct architectures of systemic sclerosis subsets [J]. Clinical Epigenetics, 2019, 11(1): 58. SUN S, ZHI Z, SU Y, et al. A CD8 + T cell-associated immune gene panel for prediction of the prognosis and immunotherapeutic effect of melanoma [J]. Frontiers In Immunology, 2022, 13: 1039565. RAMASWAMY M, TUMMALA R, STREICHER K, et al. The Pathogenesis, Molecular Mechanisms, and Therapeutic Potential of the Interferon Pathway in Systemic Lupus Erythematosus and Other Autoimmune Diseases [J]. International Journal of Molecular Sciences, 2021, 22(20). RöNNBLOM L, PASCUAL V. The innate immune system in SLE: type I interferons and dendritic cells [J]. Lupus, 2008, 17(5): 394–9. CROTTY S, JOHNSTON R J, SCHOENBERGER S P. Effectors and memories: Bcl-6 and Blimp-1 in T and B lymphocyte differentiation [J]. Nat Immunol, 2010, 11(2): 114–20. TUNYAPLIN C, SHAFFER A L, ANGELIN-DUCLOS C D, et al. Direct repression of prdm1 by Bcl-6 inhibits plasmacytic differentiation [J]. Journal of Immunology (Baltimore, Md: 1950), 2004, 173(2): 1158–65. NAM S, LIM J-S. Essential role of interferon regulatory factor 4 (IRF4) in immune cell development [J]. Arch Pharm Res, 2016, 39(11): 1548–55. THOMPSON B, DAVIDSON E A, LIU W, et al. Overview of PAX gene family: analysis of human tissue-specific variant expression and involvement in human disease [J]. Hum Genet, 2021, 140(3): 381–400. PRIDANS C, HOLMES M L, POLLI M, et al. Identification of Pax5 target genes in early B cell differentiation [J]. Journal of Immunology (Baltimore, Md: 1950), 2008, 180(3): 1719–28. GONDA H, SUGAI M, NAMBU Y, et al. The balance between Pax5 and Id2 activities is the key to AID gene expression [J]. The Journal of Experimental Medicine, 2003, 198(9): 1427–37. DELOGU A, SCHEBESTA A, SUN Q, et al. Gene repression by Pax5 in B cells is essential for blood cell homeostasis and is reversed in plasma cells [J]. Immunity, 2006, 24(3): 269–81. NERA K-P, KOHONEN P, NARVI E, et al. Loss of Pax5 promotes plasma cell differentiation [J]. Immunity, 2006, 24(3): 283–93. FUJITA N, JAYE D L, GEIGERMAN C, et al. MTA3 and the Mi-2/NuRD complex regulate cell fate during B lymphocyte differentiation [J]. Cell, 2004, 119(1): 75–86. COIT P, JEFFRIES M, ALTOROK N, et al. Genome-wide DNA methylation study suggests epigenetic accessibility and transcriptional poising of interferon-regulated genes in naïve CD4 + T cells from lupus patients [J]. Journal of Autoimmunity, 2013, 43: 78–84. COIT P, YALAVARTHI S, OGNENOVSKI M, et al. Epigenome profiling reveals significant DNA demethylation of interferon signature genes in lupus neutrophils [J]. Journal of Autoimmunity, 2015, 58: 59–66. Additional Declarations No competing interests reported. Supplementary Files Additionalfile1.docx Additionalfile2.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4003534","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":284833314,"identity":"5dafe812-5721-4ead-9484-3fa26e56c244","order_by":0,"name":"yang mei","email":"","orcid":"","institution":"The Second Xiangya Hospital of Central South University","correspondingAuthor":false,"prefix":"","firstName":"yang","middleName":"","lastName":"mei","suffix":""},{"id":284833317,"identity":"bd5008ea-2bca-465f-8f2c-fd0321a388e6","order_by":1,"name":"Xi Li","email":"","orcid":"","institution":"The Second Xiangya Hospital of Central South University","correspondingAuthor":false,"prefix":"","firstName":"Xi","middleName":"","lastName":"Li","suffix":""},{"id":284833320,"identity":"ba1b6b60-2835-48d6-bc9a-a09c139064fa","order_by":2,"name":"Yue Xin","email":"","orcid":"","institution":"The Second Xiangya Hospital of Central South University","correspondingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Xin","suffix":""},{"id":284833321,"identity":"365c3d1a-f8b4-45b0-91e5-c21968a9c05e","order_by":3,"name":"Zhenghao He","email":"","orcid":"","institution":"Department of Plastic Surgery, Zhongshan City People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zhenghao","middleName":"","lastName":"He","suffix":""},{"id":284833323,"identity":"9ceeafab-ac71-4cf4-a36d-01053bf1b7b2","order_by":4,"name":"Yongjian Chen","email":"","orcid":"","institution":"Hunan Provincial People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yongjian","middleName":"","lastName":"Chen","suffix":""},{"id":284833324,"identity":"54d3e10a-e0b2-4677-a326-53f2eba82329","order_by":5,"name":"Hongmei Yao","email":"","orcid":"","institution":"The Second Xiangya Hospital of Central South University","correspondingAuthor":false,"prefix":"","firstName":"Hongmei","middleName":"","lastName":"Yao","suffix":""},{"id":284833326,"identity":"cc5da0bb-7a54-45d6-a04a-d3debe05ef41","order_by":6,"name":"Ming Yang","email":"","orcid":"","institution":"The Second Xiangya Hospital of Central South University","correspondingAuthor":false,"prefix":"","firstName":"Ming","middleName":"","lastName":"Yang","suffix":""},{"id":284833328,"identity":"533e39db-c24f-4ebf-8d97-a3d6ba28409d","order_by":7,"name":"Haijing Wu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIie3OMWsCMRjG8TcE4pIja46KnyGTywl+jRsLhbg4FLo4KkJcDF39Gi6l4x3v0OXofMVFF6cO7WZAxMi5WaJuHfIf3iHwIw9ALPYPEwuAghjgjJLJunl7DBNZN6QtWhTVTUTl/njSS1+ZlreRB7spnUGukHdHuz2CaA0VuPcAaX8oTN4a8mUNQjr/VsRWASI1IDmTFRkjqHqoqJ8aJKU7kxfww/pXSa6hSA7I0ynTFJj/RV4hsvbDks8BF5Rias2Ay2r7XNoAEQtNf53J+kyUk5/dPuuI2dNy7QLkIn46xR0gFovFYn90BK9OUKUPyLheAAAAAElFTkSuQmCC","orcid":"","institution":"The Second Xiangya Hospital of Central South University","correspondingAuthor":true,"prefix":"","firstName":"Haijing","middleName":"","lastName":"Wu","suffix":""}],"badges":[],"createdAt":"2024-03-01 14:44:35","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4003534/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4003534/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":53959046,"identity":"b5a25a77-deb4-4f02-b8e2-b1b46a902128","added_by":"auto","created_at":"2024-04-02 17:50:13","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":447867,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBioinformatics analysis for the expression of RSAD2 in B cells of SLE from public database\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Volcano plot of gene expression in B cells of HC and SLE samples from dataset GSE4588. Blue plots represent expressions of genes with P \u0026lt; 0.05 and log2 FC \u0026lt; −1.1. Red plots represent expressions of genes mRNA with P \u0026lt; 0.05 and log2 FC \u0026gt; 1.1. Black plots represent genes expressed in mRNA normally.\u003c/p\u003e\n\u003cp\u003eB. Volcano plot of gene expression in B cells of HC and SLE samples from dataset GSE149050.\u003c/p\u003e\n\u003cp\u003eC. Venn diagram of intersecting genes between GSE4588 and GSE149050.\u003c/p\u003e\n\u003cp\u003eD. Analysis of 18 genes for their key module by string.\u003c/p\u003e\n\u003cp\u003eE. Key modules formed by the proteins encoded by the 10 genes.\u003c/p\u003e\n\u003cp\u003eF. Enrichment of DEGs in two datasets.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4003534/v1/bb27c707afb57f44e277011f.png"},{"id":53960652,"identity":"24fb9c31-b968-4783-9848-7af6d92d1fab","added_by":"auto","created_at":"2024-04-02 17:58:13","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":286481,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003emRNA expression of RSAD2 positively correlated with of BLIMP1 in B cells from SLE\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Statistical Comparison of mRNA expression levels of B cell-related genes in sorting B cells from HC (n = 8) and SLE patients (n = 8).\u003c/p\u003e\n\u003cp\u003eB. Correlation analysis between mRNA expression levels RSAD2 and other genes in B cells from SLE patients.\u003c/p\u003e\n\u003cp\u003eAll data are shown as the Mean ± SEM and analyzed by an unpaired two-tailed Student’s t-test or a one-way analysis of variance (ANOVA). ****P \u0026lt; 0.0001. ***P \u0026lt; 0.001. **P \u0026lt; 0.01. *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4003534/v1/9b00ab3ef852309bba79e49b.png"},{"id":53959051,"identity":"f21393f8-ef2b-4f29-899a-cbfcb35fe0c6","added_by":"auto","created_at":"2024-04-02 17:50:14","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":490679,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEnhanced RSAD2 MFI in B cells of PBMCs from SLE patients than of HC\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Representative flow cytometric histogram of the RSAD2 MFI expression in B cell subsets of PBMCs from HC and SLE.\u003c/p\u003e\n\u003cp\u003eB. Statistical comparison of RSAD2 MFI expression in SLE (n = 38) and HC (n = 23).\u003c/p\u003e\n\u003cp\u003eC. Statistical analysis of RSAD2 MFI in inactive SLE (n = 12), active SLE (n = 26), and HC (n = 23) in peripheral B cells.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4003534/v1/83f8f82c1e8cc0c894655ec1.png"},{"id":53959054,"identity":"a76f820f-db82-4704-ba41-38bdb7b7180a","added_by":"auto","created_at":"2024-04-02 17:50:14","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":323758,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIncreased expression of RSAD2 in differentiated B cells from human tonsil tissues\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Gating strategy of B cell subsets in human tonsil tissues.\u003c/p\u003e\n\u003cp\u003eB. Statistical comparison of RSAD2 MFI expression level in each B cell subset from human tonsil tissues. (n = 18).\u003c/p\u003e\n\u003cp\u003eAll data are shown as the Mean ± SEM and analyzed by an unpaired two-tailed Student’s t-test or a one-way analysis of variance (ANOVA). ****P \u0026lt; 0.0001. ***P \u0026lt; 0.001. **P \u0026lt; 0.01. *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4003534/v1/5fe5acc7dac85dca6202dbab.png"},{"id":53959050,"identity":"f2913bd3-f382-459f-b8dc-987a290cddfb","added_by":"auto","created_at":"2024-04-02 17:50:14","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":901069,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUp-regulating expression of RSAD2 from PBMCs by IFN stimulated \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003evitro.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eA. \u003cem\u003eRSAD2, BLIMP1, CD38 \u003c/em\u003emRNA level of PBMC (n = 3) after IFN Ⅰ, IFN Ⅱ stimulation at different time.\u003c/p\u003e\n\u003cp\u003eB. \u003cem\u003eRSAD2, BLIMP1, CD38 \u003c/em\u003emRNA level of sorting B cells (n = 4) after IFN Ⅰ stimulation for 48h.\u003c/p\u003e\n\u003cp\u003eC. Statistical analysis of mRNA level of sorting B cells after sorting B cells stimulated by IFN-β for 48h (n = 6).\u003c/p\u003e\n\u003cp\u003eD. Immunocytochemistry of B cells after stimulation \u003cem\u003ein vitro\u003c/em\u003e(yellow arrows represented cells which expressed CD38 and RSAD2).\u003c/p\u003e\n\u003cp\u003eAll data are shown as the Mean ± SEM and analyzed by a paired two-tailed Student’s t-test or a one-way analysis of variance (ANOVA). ****P \u0026lt; 0.0001. ***P \u0026lt; 0.001. **P \u0026lt; 0.01. *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4003534/v1/7279aedfe294f8de74365f10.png"},{"id":53959048,"identity":"ea11440b-aded-40b8-93bf-30a58158b528","added_by":"auto","created_at":"2024-04-02 17:50:13","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":501663,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUp-regulating expression of RSAD2 from PBMCs by IFN stimulated \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003evitro.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eE. \u003cem\u003eRSAD2, BLIMP1, CD38 \u003c/em\u003emRNA level of PBMC (n = 3) after IFN Ⅰ, IFN Ⅱ stimulation at different time.\u003c/p\u003e\n\u003cp\u003eF. \u003cem\u003eRSAD2, BLIMP1, CD38 \u003c/em\u003emRNA level of sorting B cells (n = 4) after IFN Ⅰ stimulation for 48h.\u003c/p\u003e\n\u003cp\u003eG. Statistical analysis of mRNA level of sorting B cells after sorting B cells stimulated by IFN-β for 48h (n = 6).\u003c/p\u003e\n\u003cp\u003eH. Immunocytochemistry of B cells after stimulation \u003cem\u003ein vitro\u003c/em\u003e(yellow arrows represented cells which expressed CD38 and RSAD2).\u003c/p\u003e\n\u003cp\u003eAll data are shown as the Mean ± SEM and analyzed by a paired two-tailed Student’s t-test or a one-way analysis of variance (ANOVA). ****P \u0026lt; 0.0001. ***P \u0026lt; 0.001. **P \u0026lt; 0.01. *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4003534/v1/424759c25c0f44ecb57ebf22.png"},{"id":53959047,"identity":"577872e8-9c27-4a71-990e-6a87fbc3bfa6","added_by":"auto","created_at":"2024-04-02 17:50:13","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":438533,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDecreased frequency of PCs after IFNβ stimulation in sorted B cells silenced RSAD2 \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003evitro\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Statistical analysis of B-cell frequency after silenced RSAD2 in sorted B cells stimulated by IFN-β for 48 h (n = 14).\u003c/p\u003e\n\u003cp\u003eB. Statistical analysis of mRNA level of sorted B cells after silenced RSAD2 and stimulated by IFN-β for 48 h (n = 14).\u003c/p\u003e\n\u003cp\u003eAll data are shown as the Mean ± SEM and analyzed by a paired two-tailed Student’s t-test or a one-way analysis of variance (ANOVA). ****P \u0026lt; 0.0001. ***P \u0026lt; 0.001. **P \u0026lt; 0.01. *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4003534/v1/c34c9ac58ec7b84664f0745a.png"},{"id":53959052,"identity":"e6451755-60de-4f61-bf61-6db0ac9d5f07","added_by":"auto","created_at":"2024-04-02 17:50:14","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":102034,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIFN-β down-regulating DNA methylation of RSAD2.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA. Heat map of the difference in methylation levels of RSAD2 between SLE and HC groups (n = 4).\u003c/p\u003e\n\u003cp\u003eB. Changes in methylation levels of RSAD2 after IFN-β stimulation (n = 14).\u003c/p\u003e\n\u003cp\u003eAll data are shown as the Mean ± SEM and analyzed by a paired two-tailed Student’s t-test or a one-way analysis of variance (ANOVA). ****P \u0026lt; 0.0001. ***P \u0026lt; 0.001. **P \u0026lt; 0.01. *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-4003534/v1/6912d08e09c7a0d8d75f488f.png"},{"id":54026388,"identity":"6bb60303-c999-4e2f-989b-8f65c2ae74e1","added_by":"auto","created_at":"2024-04-03 14:59:59","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3092097,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4003534/v1/2aa3a67a-f86e-4386-8b06-e9a325b8af7f.pdf"},{"id":53959049,"identity":"3d468494-3f1c-47e0-b795-b45054dd4a9d","added_by":"auto","created_at":"2024-04-02 17:50:13","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":136524,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile1.docx","url":"https://assets-eu.researchsquare.com/files/rs-4003534/v1/ed0070276654af8cc17c325d.docx"},{"id":53959044,"identity":"1182f805-67ce-46bf-b991-509731ee631b","added_by":"auto","created_at":"2024-04-02 17:50:13","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":356552,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile2.docx","url":"https://assets-eu.researchsquare.com/files/rs-4003534/v1/677dfa8c79ec7f57e8de1ca8.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"IFN-beta promotes RSAD2 expression and Lupus plasma cell differentiation via DNA Demethylation","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSystemic lupus erythematosus (SLE) is a complicated autoimmune disease with a staggering variety of clinical manifestations. Its main pathological feature is that abnormal secretion of antibodies results in the deposition of immune complex in small blood vessels and eventually leads to the over activation of immune response in organism. The morbidity of SLE is 28\u0026ndash;86 per 10000000 and the prevalence is 265\u0026ndash;1030 per 10000000 in Asia\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. SLE tends to occur in women of reproductive age and is one of the main causes of death in young women\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. The pathogenesis of this disease is unclear and the progress of research for diagnostic markers and therapeutic drugs is slow.\u003c/p\u003e \u003cp\u003eThe role of B cells in adaptive immunity includes T-B cell interaction, antigen presentation, antibody and cytokine secretion. Dysregulated B cells will lead to disorder of the immune system and induce immune system diseases which included multiple sclerosis with abnormal secretion of cytokines, myasthenia gravis, rheumatoid arthritis, primary sjogren's syndrome, pemphigus and optic neuromyelitis with abnormal secretion of antibodies\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. As an important part of adaptive immunity, B cells play an important role in the pathogenesis and development of SLE\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e.On the current study, the mutation of B cell receptor (BCR) in SLE produces autoreactive B cells, and the abnormal interaction between B-T cells weakens the ability to clear autoreactive B cells resulting in the further increase of autoreactive B cells in the body\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. In addition, BCR-mediated signal transmission is enhanced which can reduce the threshold of activation of peripheral B cells and promote the onset of SLE\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Other immunological abnormalities associated with B cell autoreactivity in SLE include increased plasma cell (PC) differentiation and survival, upregulation of toll-like receptor (TLR) signaling, and increased expression of key B cytokines such as BAFF, IL-6, and IL-21, which further activate the autoreactive B cells\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. A series of dysfunction of B cells accelerates the development of SLE. Although biologics targeting B cells have been applied clinically, their safety and efficacy need to be further optimized\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eRSAD2 (Radical s-adenosyl methionine domain-containing 2) was first discovered in fibroblasts infected with human cytomegalovirus\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. The gene is located in the short arm of human chromosome 2 \u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e, and the protein is called viperin. The central domain of viperin is highly homologous to the radical S-adenosyl-L-methionine (radical SAM) family, so viperin is also called RSAD2\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. Previous studies have found that RSAD2 played an important role in innate immunity which could inhibit viral replication \u003cem\u003ein vivo\u003c/em\u003e \u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e, affect the maturation of dendritic cells through IRF7 pathway\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e, affect NK cells through STAT1-related epigenetic regulation\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e, and highly expresse in proinflammatory M1 macrophages\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. However, the relationship between RSAD2 and adaptive immunity needs further exploration. RSAD2 is highly expressed in B cells of primary sjogren's syndrome\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e, but the expression of RSAD2 in B cells from SLE is still not known and the function of RSAD2 in B cells is unclear.\u003c/p\u003e \u003cp\u003eIn this study, we found that the dysregulated genes which included RSAD2 in SLE were mainly concentrated on the interferon signaling pathway and the most significant differences are found in plasma cells (PC) by bioinformatics analysis, which was consistent with that RSAD2 was higher in peripheral blood B cell subsets in SLE. In addition to that, we found the expression of RSAD2 in differentiated B cells (including memory B and PC) was significantly higher than that in na\u0026iuml;ve B cells in human tonsils. When we silenced RSAD2 \u003cem\u003ein vitro\u003c/em\u003e, the differentiation frequency of PC was significantly decreased. We also found that there were low methylation levels in the promoter region of RSAD2 in B cells from SLE patients, and the site of RSAD2 was also hypomethylated after IFN-β stimulation. Therefore, we described that RSAD2 demethylation mediated by IFN-β promotes lupus B cell differentiation, which might provide better understanding for the pathogenesis of SLE.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSample and clinical information\u003c/h2\u003e \u003cp\u003eSLE patients and HC were collected from the Department of Dermatology and Health Examination Center of the Second Xiangya Hospital, Central South University. SLE was diagnosed according to the 1997 classification criteria of the American College of Rheumatology (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Human tonsil samples were collected from the Department of Otolaryngology Head and Neck Surgery, Second Xiangya Hospital, Central South University (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eClinical information of SLE for flow cytometry\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGender\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAge\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSLEDAI scores\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNumber\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGender\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAge\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSLEDAI scores\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLE19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSLE38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eInformation of HC for FCM\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGender\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAge\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNumber\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGender\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAge\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHC1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHC13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHC2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHC14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHC3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHC15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHC4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHC16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHC5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHC17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHC6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHC18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHC7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHC19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHC8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHC20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHC9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHC21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHC10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHC22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHC11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHC23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHC12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eClinical information of tonsil tissue\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGender\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAge\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDiagnosis\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTonsil hypertrophy/Adenoid hypertrophy /Snoring disorder\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTonsil hypertrophy/Adenoid hypertrophy/Snoring disorder\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTonsil hypertrophy\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAdenoid hypertrophy/Tonsil hypertrophy\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTonsil hypertrophy/Snoring disorder/Adenoid hypertrophy\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCerumen embolism/Tonsil hypertrophy/Adenoid hypertrophy\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCerumen embolism/Adenoid hypertrophy\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTonsil hypertrophy/Nerve deafness\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTonsil hypertrophy/Adenoid hypertrophy/Cerumen embolism\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAdenoid hypertrophy/Tonsil hypertrophy\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTonsil hypertrophy/Adenoid hypertrophy/Cerumen embolism\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTonsil hypertrophy/Adenoid hypertrophy\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTonsil hypertrophy/Adenoid hypertrophy/Snoring disorder\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTonsil hypertrophy/Adenoid hypertrophy/Sleep apnea syndrome\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTonsil hypertrophy\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTonsil hypertrophy/Adenoid hypertrophy\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAdenoid hypertrophy/Tonsil hypertrophy/Nerve deafness\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTonsil-18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAdenoid hypertrophy/Tonsil hypertrophy\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eFCM staining\u003c/h2\u003e \u003cp\u003eTonsillar or peripheral blood lymphocyte suspensions of 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells were supplemented to 100 \u0026micro;L with PBS. Then the surface marker flow staining mixture was prepared, and 10 \u0026micro;L the mixture (antibody: cells\u0026thinsp;=\u0026thinsp;0.5 \u0026micro;L: 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells) was added to each flow tube: ① Tonsillar lymphocyte flow staining mixture: BV605 CD19 (BL, cat.302244), APC-Cy7 CD20 (BL, cat.302314), PE-Dazzle594 CD27 (BL, cat.124228), PerCP-Cy5.5 CD38 (BL, cat.303522), PE-Cy7 IgD (BL, cat.348210), BV421 IgM (BL, cat.314516) and Zombie Aqua (BL, cat.423102); ② Flow staining mixture of peripheral blood lymphocytes: FITC CD19 (BL, cat.392508), PE CD27 (BL, cat.302808), PerCP-Cy5.5 CD38 (BL, cat.303522), PE-Cy7 IgD (BL, cat.348210) and Zombie NIR (BL, cat.423106). Added the prepared mixture to the cell suspension, and incubated in a 4℃ refrigerator in the dark for 45 min. The reaction was stopped by PBS, then 500 \u0026micro;L of fixed film breaking agent(BD, cat.562574) was added, incubated at 4℃ in the dark for 90 min, and then 500 \u0026micro;L of washing buffer was added. After centrifugation, the mixture was supplemented with PBS to 100 \u0026micro;L. AF647-RSAD2 (SAB, cat. #C47852) was added to mix thoroughly, incubated at 4\u0026deg; C in the dark for 90 min, the reaction was terminated by adding PBS, and the centrifugation was complemented with PBS to 150 \u0026micro;L.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eB cell sorting\u003c/h2\u003e \u003cp\u003eAdded buffer solution and magnetic beads according to the instructions (Miltenyi, cat.130-050-301) (1\u0026times;10\u003csup\u003e7\u003c/sup\u003e:40 \u0026micro;L buffer and 5 \u0026micro;L magnetic beads conjugated antibody) and incubated at 4℃ in the dark for 15 min; then, the cell suspension was filtered in a positive sorting column, and the cells adsorbed in the sorting column were collected as CD19\u003csup\u003e+\u003c/sup\u003e B cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eRT-qPCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted by Trizol according to the protocol (AG, cat.AG21102), and then the RNA was used to reverse transcription to get cDNA for qPCR (AG, cat.AG11728). Primer sequence is shown in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eInformation of primer sequence\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence(5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"15\" rowspan=\"16\"\u003e \u003cp\u003eHuman\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eRSAD2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward: CAGCGTCAACTATCACTTCACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse: AACTCTACTTTGCAGAACCTCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eBLIMP1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFormer: TAAAGCAACCGAGCACTGAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse: ACGGTAGAGGTCCTTTCCTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eBCL6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFormer: ACACATCTCGGCTCAATTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse: AGTGTCCACAACATGCTCCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ePAX5\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFormer: ACTTGCTCATCAAGGTGTCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse: TCCTCCAATTACCCCAGGCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eMTA3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFormer: GACTTGACCGATAAGCAGAAACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse: AGGGCAACACTGCACTTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eIRF4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFormer: GCTGATCGACCAGATCGACAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse: CGGTTGTAGTCCTGCTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCD38\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFormer: AGACTGCCAAAGTGTATGGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse: GCAAGGTACGGTCTGAGTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFormer: GGAGCGAGATCCCTCCAAAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse: GGCTGTTGTCATACTTCTCATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCell immunofluorescence\u003c/h2\u003e \u003cp\u003eA mixture (PBS: Corning\u0026reg; Cell-Tak\u003csup\u003e\u0026trade;\u003c/sup\u003e = 1:100) was added to a 24-well plate, into which the slides were placed and incubated in a cell incubator for 20 min; then the cells were cultured in 24-well plate for 30 min; 4% paraformaldehyde fixative was added to a 24-well plate, and the slide were placed in the fixative and incubated for 30 min at room temperature on a shaker. The membrane rupture mixture (0.5% TritonX-100: PBS\u0026thinsp;=\u0026thinsp;1:200) was added into 24-well plate and incubated at room temperature for 15 min; anti-human RSAD2 antibody (1:100 dilution, Sigma, cat.MABF106) was added and incubated for 1 h at room temperature; then secondary antibody was kept in the dark at room temperature for 0.5 h; opal620 (1:200 dilution, Akoya Biosciences) was kept at room temperature in the dark for 1.5 hours; anti-human CD38 antibody (1:300 dilution, Abcam, cat.216343) was added and incubated at room temperature for 1 h; anti-rabbit secondary antibody (1:500 dilution) was added and incubated at room temperature in the dark for 0.5 h; opal520 (1:200 dilution, Akoya Biosciences) was added and kept in the dark at room temperature for 1 h; DAPI was added for nuclear staining and incubated at room temperature for 10 min before observation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eElectric transfer\u003c/h2\u003e \u003cp\u003e1 mL 1640 complete medium (contained IFN-β of which final concentration of was 20 ng/mL) was added to the well of 24-well plate in advance; then 4\u0026times;10\u003csup\u003e6\u003c/sup\u003e CD19\u003csup\u003e+\u003c/sup\u003e B cells were taken out and placed in a centrifuge tube and was centrifuged to get cell pellet; electrotransfer mixture was prepared (electric transfer fluid: interference sequence\u0026thinsp;=\u0026thinsp;40:1, LONZA, cat.PBP3-02250); 100 \u0026micro;L of the electrotransfer mixture was added to each centrifuge tube and transferred to the electrotransfer cup; put the electric rotor cup into the electric rotor instrument (LONZA) and run the program \"Human B cell\"; the cells were transferred to the medium and cultured for 48 h in a cell incubator at 37\u0026deg; C after electroporation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eDNA methylation chip\u003c/h2\u003e \u003cp\u003ePBMCs were isolated from peripheral blood of SLE and HC; CD19\u003csup\u003e+\u003c/sup\u003e B cells were sorted by magnetic beads; DNA of CD19\u003csup\u003e+\u003c/sup\u003e B cells was extracted with the kit (TIANGEN, cat.#DP304-02); the original idat files were obtained from the Genergy Bio company, the data were analyzed (β value difference\u0026thinsp;\u0026ge;\u0026thinsp;0.2, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Hypomethylation sites: β value difference \u0026le; -0.2, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003ePyrosequencing\u003c/h2\u003e \u003cp\u003eThe genomic DNA of IFN-β stimulated B cells was extracted by DNA kit; the DNA samples were hydrogenated by bisulfite using the kit(ZYMO, cat.D5030); the hydrogenated DNA samples were amplified by PCR according to the designed primers (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e), and then tested by the computer.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequence of RSAD2 for DNA methylation\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePosition\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence(5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003ecg10549986\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward PCR primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAGTAGTTGGTTTTGAGAGGGTTAGATGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse PCR primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTTAAACAAAAACAATCCTCTCTTTACTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequencing Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGAGGATTTTTTTTTGTTTATTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence to Analyze\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTTAATTAGYGTTAATTATTATTTTATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003ecg10771443\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward PCR primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGATTTAGTTTTTAAGAATGTTTATTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse PCR primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAACAAAAACCAAAAACAAAACAAATCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequencing Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTATTATTATATTAGTAATTGGTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence to Analyze\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eYGTTTTGGAGAGAATTTAGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003ecg23213327\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward PCR primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTGGGTTAAGTATTTGGAGTTTTTTTAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse PCR primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCCCCTTTCTAACTAAAACAACCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequencing Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTTTGTAAGAGATTTTTATTAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence to Analyze\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATYGTGTTGATTTAATTTTTGAGATTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003ecg10959651\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward PCR primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATTTGTTATAATGTGGGTGTTTATATTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse PCR primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAACTACTACTTTCTCCTCTTAATAACTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequencing Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGGAGTTTGGTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence to Analyze\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eYGTTGTTTTGTTGGTTGAGGGTAATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eEnhanced expression level of RSAD2 in B cells of peripheral blood mononuclear cells (PBMC) from SLE patients\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe analyzed the transcriptome data of peripheral blood B cells from SLE patients based on bioinformatics technology. Than, we found 80 up-regulated genes and 20 down-regulated genes in GSE149050, while 560 up-regulated genes and 458 down-regulated genes in GSE4588 (Fig.\u0026nbsp;1A-B). The intersection of two datasets resulted in 18 differential genes (Fig.\u0026nbsp;1C). We further analyzed the interactions between the proteins encoded by the 18 differential genes and found that other proteins were interacted with RSAD2 suggesting these proteins may have a certain functional relationship (Fig.\u0026nbsp;1D), in addition to CLEC7A, FCGR1B, LILRA5, RNASE2, TMEM176B and MS4A4A. Furthermore, we discovered that IFI6, IFI44, IFI44L, IFIT1, IFIT3, IFI27, CMPK2, IFITM1, USP18 and RSAD2 were a key module (Fig.\u0026nbsp;1E). Enrichment analysis of 10 proteins for the key modules demonstrated that they were mainly related to interferon-related pathways and virus-related pathways (Fig.\u0026nbsp;1F).\u003c/p\u003e \u003cp\u003eTo validate the results of bioinformatics data, we analyzed mRNA of the \u003cem\u003eRSAD2\u003c/em\u003e and its relation with some genes related to B cells from SLE. We found \u003cem\u003eRSAD2\u003c/em\u003e in peripheral blood B cells of SLE was much higher than that of HC (Fig.\u0026nbsp;2A), and other molecules including the expression of \u003cem\u003eBLIMP1\u003c/em\u003e, \u003cem\u003eCD38\u003c/em\u003e which were in line with the previous findings\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. And the mRNA of \u003cem\u003eRSAD2\u003c/em\u003e was positively correlated with \u003cem\u003eBLIMP1\u003c/em\u003e (Fig.\u0026nbsp;2B), but there were no obvious trends between \u003cem\u003eRSAD2\u003c/em\u003e and other genes. In order to analyse the expression of RSAD2 in various B-cell subsets of SLE, we collected peripheral blood from patients and found that the frequencies of CD19\u003csup\u003e+\u003c/sup\u003e B cells and IgD\u003csup\u003e-\u003c/sup\u003eCD27\u003csup\u003e-\u003c/sup\u003e B cells (double negative B cells, DN B) in SLE were higher than those in HC, while the frequencies of IgD\u003csup\u003e+\u003c/sup\u003eCD27\u003csup\u003e+\u003c/sup\u003eB cells (double positive B cells, DP B) and naive B cells were lower than HC (Additional file 1). The results showed that the mean fluorescence intensity (MFI) of RSAD2 in peripheral blood B-cell subsets was generally higher in SLE (Additional file 2, Fig.\u0026nbsp;3A-B). In addition to that, RSAD2 MFI was highly expressed in differentiated B cells from SLE and HC (Fig.\u0026nbsp;3C). Similarly, single cell analysis of RSAD2 in B cell subsets (Fig.\u0026nbsp;3D-E) indicated that the expression level of RSAD2 was higher in SLE than HC in three B cell subsets except for switching memory B cells, and the difference was most obvious in PC. There is an important relationship between progression and disease activity in SLE, hence we divided patients into active and inactive groups according to SLEDAI scores. However, there was no significant difference in the expression of RSAD2 between the two groups (Fig.\u0026nbsp;3C). Furthermore, correlation analysis showed that there was no significant correlation between RSAD2 and SLEDAI scores (Fig.\u0026nbsp;3F).\u003c/p\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eRSAD2 is highly expressed in differentiated B cells from human tonsil\u003c/h2\u003e \u003cp\u003eAs a vital immune organ, human tonsil is a special model to explore the development of B cells. To further analyze the relationship between RSAD2 and B cells. We collected relatively healthy tonsil tissues and extracted individual cell suspensions for further analysis. The expression of RSAD2 in B cell subsets including CD19\u003csup\u003e+\u003c/sup\u003e B cells, CD19\u003csup\u003e+\u003c/sup\u003e CD27\u003csup\u003e+\u003c/sup\u003e B cells, CD19\u003csup\u003e+\u003c/sup\u003e CD27\u003csup\u003e-\u003c/sup\u003e B cells, CD19\u003csup\u003e+\u003c/sup\u003e CD20\u003csup\u003e-\u003c/sup\u003e CD38\u003csup\u003e+\u003c/sup\u003e B cells (plasma cells, PC), CD19\u003csup\u003e+\u003c/sup\u003e IgM\u003csup\u003e+\u003c/sup\u003e IgD\u003csup\u003e+\u003c/sup\u003e B cells (na\u0026iuml;ve B cells), CD19\u003csup\u003e+\u003c/sup\u003e IgD\u003csup\u003e-\u003c/sup\u003e CD27\u003csup\u003e+\u003c/sup\u003e B cells (class memory B cells, CMB), CD19\u003csup\u003e+\u003c/sup\u003e CD20\u003csup\u003e+\u003c/sup\u003e CD38\u003csup\u003e+\u003c/sup\u003e B cells (germinal central B cells, GCB), CD19\u003csup\u003e+\u003c/sup\u003e IgD\u003csup\u003e+\u003c/sup\u003e CD27\u003csup\u003e+\u003c/sup\u003e B cells (double positive B cells, DP) and CD19\u003csup\u003e+\u003c/sup\u003e IgD\u003csup\u003e-\u003c/sup\u003e CD27\u003csup\u003e-\u003c/sup\u003e B cells(double negative B cells, DN) (Fig.\u0026nbsp;4A). Our experiment showed that RSAD2 MFI in CD27\u003csup\u003e+\u003c/sup\u003e B cells was higher than that in CD27\u003csup\u003e-\u003c/sup\u003e B cells. Compared with CMBs, GCBs and PCs, na\u0026iuml;ve B cells had the lowest expression of RSAD2 MFI. Among the memory B cell subsets, RSAD2 MFI in IgD\u003csup\u003e-\u003c/sup\u003eCD27\u003csup\u003e-\u003c/sup\u003e B cells was the lowest (Fig.\u0026nbsp;4B). In the B cell subsets of human tonsil, RSAD2 expression is higher in differentiated B cells which is accordance with the peripheral blood results.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eIFN-β upregulate the expression of RSAD2 and increase the differentiation frequency of PC\u003c/h2\u003e \u003cp\u003ePrevious studies and our bioinformatics analysis suggest that IFN can affect the expression of RSAD2\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e, so we detected the mRNA of RSAD2 in response to IFN-I and IFN-II stimulation and found that IFN-β upregulated RSAD2 most significantly (Fig.\u0026nbsp;5A-B). In addition to \u003cem\u003eRSAD2\u003c/em\u003e, \u003cem\u003eBCL6\u003c/em\u003e was decreased after stimulation, but \u003cem\u003eBLIMP1\u003c/em\u003e, \u003cem\u003ePAX5\u003c/em\u003e, \u003cem\u003eMTA3\u003c/em\u003e and \u003cem\u003eIRF4\u003c/em\u003e did not change significantly (Fig.\u0026nbsp;5C). By immunocytofluorescence (ICC), we found that RSAD2 was mainly expressed in the nucleus and its expression was also increased in CD38\u003csup\u003e+\u003c/sup\u003e RSAD2\u003csup\u003e+\u003c/sup\u003e B cells (Fig.\u0026nbsp;5D) after IFN-β stimulation. Flow cytometry (FCM) showed (Fig.\u0026nbsp;6A) that the frequency of PCs (Fig.\u0026nbsp;6B) and the expression of RSAD2 were also increased (Fig.\u0026nbsp;6C-D) after IFN-β treatment. These experimental results are consistent with the results of single-cell sequencing analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eKnockout of RSAD2 in B cells inhibits PC differentiation\u003c/h2\u003e \u003cp\u003eSorted B cells were silenced with RSAD2 siRNA \u003cem\u003ein vitro\u003c/em\u003e and stimulated with IFN-β. Decreased frequencies of PCs, CD19\u003csup\u003e+\u003c/sup\u003eCD27\u003csup\u003e+\u003c/sup\u003e B cells and DPs were found, while there were no significant changes in other B cell subsets (Fig.\u0026nbsp;7A). The result of mRNA level showed that the mRNA of \u003cem\u003eRSAD2\u003c/em\u003e, \u003cem\u003eCD38\u003c/em\u003e, \u003cem\u003eCD27\u003c/em\u003e, \u003cem\u003eIRF4\u003c/em\u003e, \u003cem\u003ePAX5\u003c/em\u003e, and \u003cem\u003eMTA3\u003c/em\u003e was decreased after silenced RSAD2, but that of \u003cem\u003eBLIMP1\u003c/em\u003e and \u003cem\u003eBCL-6\u003c/em\u003e was not obviously changed (Fig.\u0026nbsp;7B).These data meant that RSAD2 may promote B cell differentiation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eDNA methylation of RSAD2 regulated by IFN-β controlled the effect of RSAD2 on B cells\u003c/h2\u003e \u003cp\u003ePrevious studies have discovered DNA hypomethylation in SLE\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e and RSAD2 also appears hypomethylation in SLE, suggesting that DNA methylation of RSAD2 may have some relationship with the pathogenesis of SLE\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e.So we analyzed the DNA methylation level of RSAD2 in sorted B cells from SLE and these position was further tested in sorted B cells after IFN-β stimulation. We showed that there were four hypomethylation sites in the promoter position of RSAD2 from SLE in DNA sequencing chip (Fig.\u0026nbsp;8A) including cg10549986, cg23213327, cg10771443, and cg10959651. It was interesting that the methylation level of the IFN-β stimulated group was significantly lower than that of the control group at position cg10771443, but there was no significant difference in the other three sites (Fig.\u0026nbsp;8B).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eInterferon-stimulated gene (ISG) is a class gene which can be stimulated by IFN \u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. Approximately 10% of the human genome is regulated by IFN in the human. Studies have uncovered that ISG inhibits virus invasion through a variety of pathways. IFITM3 blocks the membrane fusion of viruses through the endocytic pathway by the palmitoylated amphipathic α-helix\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. NCOA7 can bind to vacuolar H\u003csup\u003e+\u003c/sup\u003e-ATPase to promote the degradation of the endocytosed virus\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e and VP30 regulates viral RNA synthesis by interacting with RBBP6, a ubiquitin ligase that plays a role in cell cycle progression and transcription\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. In short, ISG can inhibit virus entry, virus proliferation in cells, and virus release. Studies have found that in addition to resisting viruses, ISG is also abnormally expressed in many diseases. The concentration of bile acid precursor 25-hydroxycholesterol (25-HC) in cerebrospinal fluid of multiple sclerosis (MS) is increased, which may due to the up-regulation of ISG-CH25H in macrophages\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. ISG15 was significantly increased in the cerebral ischemia model without obvious signs of inflammation and the cortical shock-induced brain injury model\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. Aberrant expression of ISG has been found in the synovium of rheumatoid arthritis (RA), and recent studies, including RNA-seq analysis, have further identified the expression of ISG in other tissues of RA lesions, such as joints\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e and these are sensitive to JAK inhibitors\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. These results suggest that the efficacy of these compounds may be related to the inhibition of ISG. In SLE, microarray analysis data show that hundreds of ISG are up-regulated, suggesting that ISG may play an important role in the course of SLE\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn this study, we investigated the role of RSAD2 in B cells from SLE. Firstly, 18 genes were found to be highly expressed in B cells of SLE by RNA-seq which included RSAD2. Further screening the genes, we found a key module in the pathogenesis of SLE. Enrichment analysis of these genes revealed that they play vital roles in SLE mainly through IFN-related pathways. We found that RSAD2 was highly expressed in all B cell subsets of SLE, but the difference was more significant in PC. These results suggested that the presence of RSAD2 may increase the proliferation of B cells and be more closely related to the function of PC and the results were consistent with the bioinformatics results in single cell sequencing from public data. We also found that the expression level of mRNA of BLIMP1 in B cells from PBMCs was positively correlated with of RSAD2. BLIMP1 promotes the differentiation of B cells into PC\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e, which further confirmed that RSAD2 may be related to the differentiation of B cells.\u003c/p\u003e \u003cp\u003eRSAD2 can be used as a preferred biomarker for disease activity in Aicardi-Gouti\u0026egrave;res syndrome (AGS)\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e, and as a specific biomarker for onset of antibody-mediated rejection (ABMR) after renal transplantation\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. It is also a potential biomarker and therapeutic target for post-traumatic acute respiratory distress syndrome\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. The disease severity of SLE has an important relationship with disease progression which even affects the prognosis of patients, but there is no sensitive and simple index to distinguish the progression of SLE now. Therefore, we analyzed the expression of RSAD2 in patients with active and inactive SLE. Unfortunately, it was no significant difference in the expression of RSAD2 between active and inactive SLE patients, and there was no clear correlation between RSAD2 and SLEDAI scores. What's interesting was that RSAD2 was generally more differentially expressed in active SLE, so we can further expand our sample to explore the role of RSAD2 as an indicator of active SLE. In addition to its diagnostic role, RSAD2 can also be used as a prognostic marker for IFN-β therapy in MS\u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. RSAD2 also can predict the prognosis of melanoma in the prediction model of CD8\u003csup\u003e+\u003c/sup\u003e T lymphocyte involvement\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. Therefore, whether RSAD2 can be used as a marker for SLE specific drug treatment warrants further study.\u003c/p\u003e \u003cp\u003eAfter the treatment of malignant tumors or hepatitis with IFN-I, individuals will produce autoantibodies and autoimmunity, which can induce SLE and SSc\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. Anilumab, as a receptor antagonist of IFN-I, has a certain effect in the treatment of patients with moderate to severe SLE, which confirms the role of IFN in the pathogenesis of SLE from another perspective. IFN-I can induce the maturation and activation of dendritic cells (DC), increase the expression of MHC class I and II molecules of DC\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e, and increase the presentation of self-antigens to B cells. It can also activate T cells and induce autoreactive PC to secrete autoantibodies. In this study, the frequency of PC and the expression of RSAD2 were increased after the sorted CD19\u003csup\u003e+\u003c/sup\u003e B cells were stimulated with IFN-β \u003cem\u003ein vitro\u003c/em\u003e, which provided a new idea that IFN-I could promote B cell differentiation by regulating ISG. Previous studies mainly focused on the effect of IFN-α on SLE and B cells, but in this study, the function of IFN-β was more intense on RSAD2, which uncovered a new role of IFN-β. In contrast to peripheral blood mRNA expression, \u003cem\u003eBLIMP1\u003c/em\u003e was not differentially expressed, but \u003cem\u003eBCL6\u003c/em\u003e was significantly decreased. \u003cem\u003eBCL6\u003c/em\u003e and \u003cem\u003eBLIMP1\u003c/em\u003e are antagonistic transcription factors in the differentiation and maturation of B cells\u003csup\u003e[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e, and the protein translated by \u003cem\u003eBCL6\u003c/em\u003e can inhibit the effect of \u003cem\u003eBLIMP1\u003c/em\u003e\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e. Although there was no significant change in mRNA of \u003cem\u003eBLIMP1\u003c/em\u003e, \u003cem\u003eBCL6\u003c/em\u003e was decreased and the final result was similar to that of increased \u003cem\u003eBLIMP1\u003c/em\u003e expression. However, the reasons for this difference in expression are still unclear. The expression of transcription factors \u003cem\u003eIRF4\u003c/em\u003e, \u003cem\u003ePAX5\u003c/em\u003e and \u003cem\u003eMTA3\u003c/em\u003e did not change significantly in IFN-β stimulated sorted B cells.\u003c/p\u003e \u003cp\u003eIt was found that the frequency of PC was lower than that of the control group after silencing RSAD2 \u003cem\u003ein vitro\u003c/em\u003e, which further indicated that IFN-β could regulate the function of B cells through RSAD2. \u003cem\u003eIRF4\u003c/em\u003e belongs to interferon regulatory factors (IRF) \u003csup\u003e[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e. In the upstream of \u003cem\u003eBLIMP1\u003c/em\u003e, \u003cem\u003eIRF4\u003c/em\u003e can promote the transformation of B cells to PC. \u003cem\u003ePAX5\u003c/em\u003e regulates the expression of genes related to tissue development\u003csup\u003e[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e. In the process of B cell development, \u003cem\u003ePAX5\u003c/em\u003e regulates the formation of BCR in immature B cells\u003csup\u003e[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e. \u003cem\u003ePAX5\u003c/em\u003e can also activate cytidylate deaminase (AID) gene, which is essential for somatic hypermutation and antibody class switching\u003csup\u003e[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]\u003c/sup\u003e, but \u003cem\u003ePAX5\u003c/em\u003e inhibits \u003cem\u003eBLIMP1\u003c/em\u003e expression and B cell differentiation towards PC\u003csup\u003e[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]\u003c/sup\u003e. \u003cem\u003eMTA3\u003c/em\u003e is a member of the transfer-related family, and its encoded protein can activate histone deacetylase to change the acetylation state of \u003cem\u003eBCL6\u003c/em\u003e and cooperate with \u003cem\u003eBCL6\u003c/em\u003e to inhibit PC differentiation\u003csup\u003e[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]\u003c/sup\u003e. After \u003cem\u003eRSAD2\u003c/em\u003e silencing, the mRNA levels of \u003cem\u003eIRF4\u003c/em\u003e, \u003cem\u003ePAX5\u003c/em\u003e and \u003cem\u003eMTA3\u003c/em\u003e decreased, suggesting that \u003cem\u003eRSAD2\u003c/em\u003e may be upstream. When \u003cem\u003eRSAD2\u003c/em\u003e is silenced, the coordinating effect of their RNA changes is no obvious change of \u003cem\u003eBLIMP1\u003c/em\u003e and \u003cem\u003eBCL6\u003c/em\u003e. Nevertheless, the specific regulation methods need to be further explored.\u003c/p\u003e \u003cp\u003eIFN-I signaling is the result of the interaction of multiple molecules, and epigenetic modification is also a regulatory mechanism of IFN-I signaling. IFNs can activate the STAT pathway, and when IFN-α acts, STAT2 can recruit the histone acetyltransferase GCN5 to promote the acetylation of histone H3, which is a marker of general transcriptional activation\u003csup\u003e[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]\u003c/sup\u003e. Two studies have shown the genomic DNA hypomethylation signature of T cells and neutrophils from SLE\u003csup\u003e[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/sup\u003e. Similar to these results, RSAD2 hypomethylation sites were identified in B cells from SLE and corresponding hypomethylation was also observed after IFN-β treatment.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eAll in all, RSAD2 was higher in B cells from SLE patients and promoted B cell differentiation to PC. Except that, the expression of RSAD2 can be up-regulated by IFN-β by down-regulating DNA methylation level. These founding may provide a new insight for SLE pathogenesis.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eCMB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eClass memory B cell\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eDC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eDendritic cell\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eDP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eDouble positive B cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eDN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eDouble negative B cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eFCM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eFlow cytometry\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eGC B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eGerminal central B cell\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eHC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eHealthy control\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eICC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eImmunocytofluorescence\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eIFN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eInterferon\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eISG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eInterferon-stimulated gene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eMFI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eMean fluorescence intensity\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003ePBMC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003ePeripheral blood mononuclear cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003ePC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003ePlasma cell\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eRA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eRheumatoid arthritis\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eRSAD2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eRadical s-adenosyl methionine domain-containing 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eSLEDAI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eSLE\u0026nbsp;disease activity index\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eSLE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50%\" valign=\"top\"\u003e\n \u003cp\u003eSystemic lupus erythematosus\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank all participants for providing blood samples.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data presented in this study are contained within the article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from the National Natural Science Foundation of China (81773332, 82373488); Natural Science Foundation of Hunan Province of China (2021JJ40848, 2022JJ40722, 2023JJ60435); Outstanding Youth Fund of Hunan Provincial Department of Education of China (22B0060); Health research project of Hunan Provincial Health Commission (No. W20243055); Science and Health joint project of Hunan Science Foundation(S2023JJBMLH0972.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors and Affiliations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDepartment of Dermatology, The Second Xiangya Hospital of Central South University, 139 Middle Renmin Road, Changsha, Human 410011, China.\u003c/p\u003e\n\u003cp\u003eHunan Key Laboratory of Medical Epigenomics, 139 Middle Renmin Road, Changsha, Human 410011, China.\u003c/p\u003e\n\u003cp\u003eYang Mei, Xi Li, Yue Xin, Hongmei Yao, Ming Yang \u0026amp; Haijing Wu\u003c/p\u003e\n\u003cp\u003eDepartment of Plastic Surgery, Zhongshan City People\u0026apos;s Hospital, Zhongshan, Guangdong, China.\u003c/p\u003e\n\u003cp\u003eZhenghao He\u003c/p\u003e\n\u003cp\u003eDepartment of Dermatology, The First Affiliated Hospital of Hunan Normal University, Hunan Provincial People\u0026apos;s Hospital, Changsha 410005, China.\u003c/p\u003e\n\u003cp\u003eYongjian Chen\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eYang Mei:\u003c/strong\u003e Conceptualization, investigation, formal analysis, writing \u0026ndash; original draft. \u003cstrong\u003eXi Li:\u003c/strong\u003e Investigation, formal analysis \u0026ndash; original draft. \u003cstrong\u003eYue Xin and Zhenghao He:\u003c/strong\u003e Investigation, formal analysis. \u003cstrong\u003eYongjian Chen and Hongmei Yao\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e Investigation, formal analysis.\u003cstrong\u003e\u0026nbsp;Ming Yang:\u003c/strong\u003e Project administration, conceptualization, writing \u0026ndash; original draft. \u003cstrong\u003eHaijing Wu:\u003c/strong\u003e Project administration, conceptualization, writing \u0026ndash; original draft.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding author\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHaijing Wu and Ming Yang are joint corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study has been approved by the Ethics Committee of the Second Xiangya Hospital of Central South University (Ethics number: 2019044).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Competing Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe declare no competing interests.Additional information\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePublisher\u0026apos;s Note\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBARBER M R W, DRENKARD C, FALASINNU T, et al. Global epidemiology of systemic lupus erythematosus [J]. Nat Rev Rheumatol, 2021, 17(9): 515\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYEN E Y, SINGH R R. Brief Report: Lupus-An Unrecognized Leading Cause of Death in Young Females: A Population-Based Study Using Nationwide Death Certificates, 2000\u0026ndash;2015 [J]. Arthritis Rheumatol, 2018, 70(8): 1251\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKIROU K A, DALL ERA M, ARANOW C, et al. Belimumab or anifrolumab for systemic lupus erythematosus? A risk-benefit assessment [J]. Front Immunol, 2022, 13: 980079.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLEE D S W, ROJAS O L, GOMMERMAN J L. B cell depletion therapies in autoimmune disease: advances and mechanistic insights [J]. Nat Rev Drug Discov, 2021, 20(3): 179\u0026ndash;99.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePARODIS I, GATTO M, SJ\u0026ouml;WALL C. B cells in systemic lupus erythematosus: Targets of new therapies and surveillance tools [J]. Front Med (Lausanne), 2022, 9: 952304.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSINAI P, DOZMOROV I M, SONG R, et al. T/B-cell interactions are more transient in response to weak stimuli in SLE-prone mice [J]. Eur J Immunol, 2014, 44(12): 3522\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNASHI E, WANG Y, DIAMOND B. The role of B cells in lupus pathogenesis [J]. Int J Biochem Cell Biol, 2010, 42(4): 543\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMALKIEL S, BARLEV A N, ATISHA-FREGOSO Y, et al. Plasma Cell Differentiation Pathways in Systemic Lupus Erythematosus [J]. Front Immunol, 2018, 9: 427.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHU H, CONG J P, SHENK T. Use of differential display analysis to assess the effect of human cytomegalovirus infection on the accumulation of cellular RNAs: induction of interferon-responsive RNAs [J]. Proc Natl Acad Sci U S A, 1997, 94(25): 13985\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLEI M, LIU H, LIU S, et al. Identification and functional characterization of viperin of amphioxus Branchiostoma japonicum: Implications for ancient origin of viperin-mediated antiviral response [J]. Dev Comp Immunol, 2015, 53(2): 293\u0026ndash;302.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCHIN K C, CRESSWELL P. Viperin (cig5), an IFN-inducible antiviral protein directly induced by human cytomegalovirus [J]. Proc Natl Acad Sci U S A, 2001, 98(26): 15125\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRIVERA-SERRANO E E, GIZZI A S, ARNOLD J J, et al. Viperin Reveals Its True Function [J]. Annu Rev Virol, 2020, 7(1): 421\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJANG J S, LEE J H, JUNG N C, et al. Rsad2 is necessary for mouse dendritic cell maturation via the IRF7-mediated signaling pathway [J]. Cell Death Dis, 2018, 9(8): 823.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWIEDEMANN G M, GEARY C D, LAU C M, et al. Cutting Edge: STAT1-Mediated Epigenetic Control of Rsad2 Promotes Clonal Expansion of Antiviral NK Cells [J]. J Immunol, 2020, 205(1): 21\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLI P, HAO Z, WU J, et al. Comparative Proteomic Analysis of Polarized Human THP-1 and Mouse RAW264.7 Macrophages [J]. Front Immunol, 2021, 12: 700009.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHU H, ZHENG J, ZHOU Y, et al. Knockdown of RSAD2 attenuates B cell hyperactivity in patients with primary Sj\u0026ouml;gren's syndrome (pSS) via suppressing NF-κb signaling pathway [J]. Mol Cell Biochem, 2021, 476(5): 2029\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYANG M, LONG D, HU L, et al. AIM2 deficiency in B cells ameliorates systemic lupus erythematosus by regulating Blimp-1-Bcl-6 axis-mediated B-cell differentiation [J]. Signal Transduct Target Ther, 2021, 6(1): 341.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGAO X, GAO L-F, ZHANG Y-N, et al. Huc-MSCs-derived exosomes attenuate neuropathic pain by inhibiting activation of the TLR2/MyD88/NF-κB signaling pathway in the spinal microglia by targeting Rsad2 [J]. Int Immunopharmacol, 2023, 114: 109505.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFASANO S, MILONE A, NICOLETTI G F, et al. Precision medicine in systemic lupus erythematosus [J]. Nature Reviews Rheumatology, 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFANG Q, LI T, CHEN P, et al. Comparative Analysis on Abnormal Methylome of Differentially Expressed Genes and Disease Pathways in the Immune Cells of RA and SLE [J]. Front Immunol, 2021, 12: 668007.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSCHOGGINS J W. Interferon-Stimulated Genes: What Do They All Do? [J]. Annual Review of Virology, 2019, 6(1): 567\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSPENCE J S, HE R, HOFFMANN H-H, et al. IFITM3 directly engages and shuttles incoming virus particles to lysosomes [J]. Nat Chem Biol, 2019, 15(3): 259\u0026ndash;68.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDOYLE T, MONCORG\u0026eacute; O, BONAVENTURE B, et al. The interferon-inducible isoform of NCOA7 inhibits endosome-mediated viral entry [J]. Nat Microbiol, 2018, 3(12): 1369\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSHAW A E, HUGHES J, GU Q, et al. Fundamental properties of the mammalian innate immune system revealed by multispecies comparison of type I interferon responses [J]. PLoS Biol, 2017, 15(12): e2004086.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCRICK P J, GRIFFITHS W J, ZHANG J, et al. Reduced Plasma Levels of 25-Hydroxycholesterol and Increased Cerebrospinal Fluid Levels of Bile Acid Precursors in Multiple Sclerosis Patients [J]. Mol Neurobiol, 2017, 54(10): 8009\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWANG R-G, KAUL M, ZHANG D-X. Interferon-stimulated gene 15 as a general marker for acute and chronic neuronal injuries [J]. Sheng Li Xue Bao, 2012, 64(5): 577\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eORANGE D E, AGIUS P, DICARLO E F, et al. Identification of Three Rheumatoid Arthritis Disease Subtypes by Machine Learning Integration of Synovial Histologic Features and RNA Sequencing Data [J]. Arthritis \u0026amp; Rheumatology (Hoboken, NJ), 2018, 70(5): 690\u0026ndash;701.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBOYLE D L, SOMA K, HODGE J, et al. The JAK inhibitor tofacitinib suppresses synovial JAK1-STAT signalling in rheumatoid arthritis [J]. Ann Rheum Dis, 2015, 74(6): 1311\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCATALINA M D, BACHALI P, GERACI N S, et al. Gene expression analysis delineates the potential roles of multiple interferons in systemic lupus erythematosus [J]. Commun Biol, 2019, 2: 140.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOLIVA L, CENCI S. Autophagy in plasma cell pathophysiology [J]. Frontiers In Immunology, 2014, 5: 103.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWANG B X, GROVER S A, KANNU P, et al. Interferon-Stimulated Gene Expression as a Preferred Biomarker for Disease Activity in Aicardi-Gouti\u0026egrave;res Syndrome [J]. Journal of Interferon \u0026amp; Cytokine Research: the Official Journal of the International Society For Interferon and Cytokine Research, 2017, 37(4): 147\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMATZ M, HEINRICH F, ZHANG Q, et al. The regulation of interferon type I pathway-related genes RSAD2 and ETV7 specifically indicates antibody-mediated rejection after kidney transplantation [J]. Clin Transplant, 2018, 32(12): e13429.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQI P, HUANG M, LI T. Identification of potential biomarkers and therapeutic targets for posttraumatic acute respiratory distress syndrome [J]. BMC Med Genomics, 2023, 16(1): 54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRAMOS P S, ZIMMERMAN K D, HADDAD S, et al. Integrative analysis of DNA methylation in discordant twins unveils distinct architectures of systemic sclerosis subsets [J]. Clinical Epigenetics, 2019, 11(1): 58.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSUN S, ZHI Z, SU Y, et al. A CD8\u0026thinsp;+\u0026thinsp;T cell-associated immune gene panel for prediction of the prognosis and immunotherapeutic effect of melanoma [J]. Frontiers In Immunology, 2022, 13: 1039565.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRAMASWAMY M, TUMMALA R, STREICHER K, et al. The Pathogenesis, Molecular Mechanisms, and Therapeutic Potential of the Interferon Pathway in Systemic Lupus Erythematosus and Other Autoimmune Diseases [J]. International Journal of Molecular Sciences, 2021, 22(20).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR\u0026ouml;NNBLOM L, PASCUAL V. The innate immune system in SLE: type I interferons and dendritic cells [J]. Lupus, 2008, 17(5): 394\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCROTTY S, JOHNSTON R J, SCHOENBERGER S P. Effectors and memories: Bcl-6 and Blimp-1 in T and B lymphocyte differentiation [J]. Nat Immunol, 2010, 11(2): 114\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTUNYAPLIN C, SHAFFER A L, ANGELIN-DUCLOS C D, et al. Direct repression of prdm1 by Bcl-6 inhibits plasmacytic differentiation [J]. Journal of Immunology (Baltimore, Md: 1950), 2004, 173(2): 1158\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNAM S, LIM J-S. Essential role of interferon regulatory factor 4 (IRF4) in immune cell development [J]. Arch Pharm Res, 2016, 39(11): 1548\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTHOMPSON B, DAVIDSON E A, LIU W, et al. Overview of PAX gene family: analysis of human tissue-specific variant expression and involvement in human disease [J]. Hum Genet, 2021, 140(3): 381\u0026ndash;400.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePRIDANS C, HOLMES M L, POLLI M, et al. Identification of Pax5 target genes in early B cell differentiation [J]. Journal of Immunology (Baltimore, Md: 1950), 2008, 180(3): 1719\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGONDA H, SUGAI M, NAMBU Y, et al. The balance between Pax5 and Id2 activities is the key to AID gene expression [J]. The Journal of Experimental Medicine, 2003, 198(9): 1427\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDELOGU A, SCHEBESTA A, SUN Q, et al. Gene repression by Pax5 in B cells is essential for blood cell homeostasis and is reversed in plasma cells [J]. Immunity, 2006, 24(3): 269\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNERA K-P, KOHONEN P, NARVI E, et al. Loss of Pax5 promotes plasma cell differentiation [J]. Immunity, 2006, 24(3): 283\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFUJITA N, JAYE D L, GEIGERMAN C, et al. MTA3 and the Mi-2/NuRD complex regulate cell fate during B lymphocyte differentiation [J]. Cell, 2004, 119(1): 75\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCOIT P, JEFFRIES M, ALTOROK N, et al. Genome-wide DNA methylation study suggests epigenetic accessibility and transcriptional poising of interferon-regulated genes in na\u0026iuml;ve CD4\u0026thinsp;+\u0026thinsp;T cells from lupus patients [J]. Journal of Autoimmunity, 2013, 43: 78\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCOIT P, YALAVARTHI S, OGNENOVSKI M, et al. Epigenome profiling reveals significant DNA demethylation of interferon signature genes in lupus neutrophils [J]. Journal of Autoimmunity, 2015, 58: 59\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"SLE, B cells, RSAD2, IFN-β, Methylation","lastPublishedDoi":"10.21203/rs.3.rs-4003534/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4003534/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eSystemic lupus erythematosus (SLE) is an autoimmune disease, in which the pathogenesis is revealed as abnormalities in B cells with no clear mechanism. Radical s-adenosyl methionine domain-containing 2 (RSAD2) is an interferon-stimulated gene (ISG), and it has been found to play an important role in innate immunity. Recent years the function of RSAD2 in autoimmune diseases, but its still unknown for RSAD2 in B cells from SLE patients still.\u003c/p\u003e\u003ch2\u003eResult\u003c/h2\u003e \u003cp\u003eIn this study, we found RSAD2 was abnormal in SLE by analysis of database, which was relative with interferon (IFN). Further, we found that RSAD2 in peripheral blood B cell subsets was generally higher in SLE patients than healthy controls (HCs). In the meantime, differentiated B cells showed significantly higher expression of RSAD2 than na\u0026iuml;ve B cells in human tonsils. In the functional study \u003cem\u003ein vitro\u003c/em\u003e, the frequencies of differentiated B cells and the expression of RSAD2 were enhanced by interferon-β (IFN-β). Simultaneously, the frequency of plasma cells (PC) was significantly reduced in sorted peripheral CD19\u003csup\u003e+\u003c/sup\u003e B cells which was knock-down RSAD2 and stimulated with IFN-β. Mechanically, IFN-β can induce the hypomethylation of RSAD2 in B cells \u003cem\u003ein vitro\u003c/em\u003e, which might be one of mechanisms for increased expression level of RSAD2 in B cells from SLE patients.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThis study uncovered that IFN-β up-regulated the expression of RSAD2 by down-regulating the methylation of it to promote B cell differentiation.\u003c/p\u003e","manuscriptTitle":"IFN-beta promotes RSAD2 expression and Lupus plasma cell differentiation via DNA Demethylation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-02 17:50:08","doi":"10.21203/rs.3.rs-4003534/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"172467ed-44ae-4a8f-acde-d231abf3551e","owner":[],"postedDate":"April 2nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-03T14:59:44+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-02 17:50:08","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4003534","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4003534","identity":"rs-4003534","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00