Molecular detection and isolation of foot-and-mouth disease virus from gayal and crossbreed cattle in two recent outbreaks in Bangladesh | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular detection and isolation of foot-and-mouth disease virus from gayal and crossbreed cattle in two recent outbreaks in Bangladesh Md. Abul Basher, Tasnim Islam, Sourav Chakraborty, Muhammad Tofazzal Hossain, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5647631/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 3 You are reading this latest preprint version Abstract Foot-and-mouth disease (FMD) is a significant threat to the livestock industry, causing severe economic losses, especially in enzootic countries like Bangladesh. Despite regular immunization, managing FMD remains challenging due to the continuous mutation and generation of new genotypes of the FMD virus (FMDV). Two recent outbreaks of FMDV have occurred in several districts of Bangladesh, including Gazipur, Pabna, and Noakhali, even though cattle farms in these districts were regularly immunized with commercially available FMDV vaccines. This suggests the emergence of new FMDV strains. Thus, we aimed to molecularly identify and isolate the circulating FMDVs in these three districts, for which we collected 35 tongue epithelium samples from FMD-suspected gayal ( Bos frontalis ) and crossbreed cattle. Among the 35 samples, 80.00% (28/35) were positive by uRT-PCR. Further serotyping of the positive samples (28) using gsRT-PCR revealed three serotypes: O (35.71%), the most predominant one, A (32.14%), and Asia-1 (10.71%). Mixed infections of A + O (14.28%) and A + Asia-1 (7.15%) were also detected. Mixed infections of A + O (14.28%) and A + Asia-1 (7.15%) were also detected. Serotypes A, Asia-1, and O + A contributed equally (each 27.27%) to disease occurrence in the Gazipur district. On the other hand, the leading causes for disease were serotype O (66.67%) and A (62.50%) in Pabna and Noakhali districts, respectively.We then isolated FMDV by inoculating RT-PCR-positive samples into BHK-21 cells, and we observed successful virus propagation in 71.42% (20/28) of the positive samples. Our data indicate that, despite regular immunization, several FMDV serotypes are circulating in Bangladesh, suggesting that continuous monitoring of circulating FMD strains is crucial in implementing a strategic FMD control program. Foot-and-mouth disease virus (FMDV) serotyping RT-PCR BHK-21 cell line Figures Figure 1 Figure 2 Figure 3 Figure 4 Article Highlights FMD outbreaks occur frequently despite regular vaccination in different regions of Bangladesh. Three serotypes of FMDV with some mixed infections were detected in infected animals. The frequent outbreaks underscore the urgent need for ongoing monitoring and updated vaccines. 1. Introduction Foot-and-mouth disease (FMD) is an airborne, acute, and highly contagious transboundary viral disease affecting more than 70 species of cloven-hoofed animals, including cattle, water buffalo, sheep, goats, and pigs [1, 2]. The World Organization for Animal Health (WOAH) has classified this disease as a “notifiable disease” due to its potential for rapid spread within and between countries, significant economic impact, public health consequences, and influence on international trade. The disease is widespread around the world and is enzootic in Africa, South America, and Asia [3], including Bangladesh [4]. In rural Bangladesh, FMD is also known as “Khura Rog” [5, 6]. Gayal and Holstein crossbreed cattle, found in the southeastern hilly districts of Bangladesh, the northeastern part of India, some hilly areas of Myanmar, and Bhutan, are highly susceptible to FMD [7]. The causative agent, foot-and-mouth disease virus (FMDV), is a non-enveloped, single-stranded positive-sense RNA virus under the genus Aphthovirus in the family Picornaviridae [8]. The 8.5 kb viral genome is enclosed within an icosahedral capsid containing four structural proteins: VP1, VP2, VP3, and VP4. Among these, VP1 possesses the major antigenic sites; thus, the VP1 nucleotide sequence is traditionally used to classify the virus [9, 10]. FMDV has seven serotypes (O, A, C, Asia-1, SAT-I, SAT-II, and SAT-III) and over 65 subtypes [11]. These serotypes are geographically distributed in seven regional pools, with the livestock industry of Bangladesh being threatened by Pool 1 (A, O, and Asia-1). Constant monitoring of the FMDV serotypes is essential for implementing a proper control strategy [11, 12]. Gene-specific RT-PCR is one of the most efficient and powerful methods to detect RNA and differentiate between serotypes [13]. In our study, we employed three different primers targeting the VP1 and VP4 genes to trace the circulating FMD serotype in three distinct outbreak regions. Previously, serotype O was identified as the primary (82%) causative agent in the total reported outbreaks in Bangladesh [14]. Out of 11 topotypes of serotype O, only the Middle East-South Asia (ME-SA) topotype has been found in Bangladesh. Within this topotype, there are four lineages, named as Ind-2001, Ind-2011, PanAsia, and PanAsia-2 [15–17]. However, two new lineages, Pak-98 (enzootic in Pakistan) and Srl-97 (enzootic in Sri Lanka), were detected recently. The Ind-2001 lineage is highly diverse and further grouped into five sub-lineages, Ind-2001a to Ind-2001e [15, 18, 19]. The Ind-2001d sub-lineage was found circulating in Bangladesh in 2019 [14]. Between 2012 and 2016, two additional sub-lineages, Ind2001BD1 (also designated as Ind2001e) and Ind2001BD2, were detected in Bangladesh [20, 21]. Interestingly, the novel Ind-2001BD2 sub-lineage could not be detected after 2013. Additionally, a few isolates (BD_BAU_ML1_2013; BD_BAU_ML2_2013; BD_SI_5_2013; O/BAN/BLRI/450.2/2018) detected between 2013 and 2018 could not be classified [22]. Among them, BD_BAU_ ML1_2013 and BD_BAU_ML2_2013 isolates showed 98–99% similarity with some unclassified Indian isolates from 2011 and were thus classified under the PanAsia-2 lineage [23]. The coexistence of antigenically diverse FMDV strains, with no cross-protection between serotypes and even among some subtypes under the same serotype, contributes to severe FMD outbreaks in Bangladesh annually. As an FMD-enzootic country, it is important to regularly assess the effectiveness of existing vaccines through continuous surveillance of circulating FMDV strains. Therefore, this study was designed to isolate and identify the circulating FMDV serotypes in the recently three affected FMD outbreak areas of Bangladesh and determine their prevalence to contribute to developing effective FMD management strategies. 2. Materials and methods 2.1 Sample collection A total of 35 samples (tongue epithelial tissue) were collected from the FMD-suspected cattle (gayal and crossbreed) in three outbreak areas (Gazipur, Pabna, and Noakhali) in Bangladesh from 2020-2021. All the samples were collected aseptically, transferred in ice containing transport box and transported to the Department of Microbiology and Hygiene, Bangladesh Agricultural University, Mymensingh-2202, at 4 ° C immediately after collection. They were then stored at -80 ° C for further use. 2.2 Sample processing, RNA extraction, and cDNA synthesis All epithelial tissue samples were homogenized with a mortar and pestle using sterile sea sand, and a 10% suspension was prepared by adding phosphate-buffered saline (PBS). Afterward, the suspension was centrifuged at 3000 rpm (ESCO Lifescience group, Singapore) for 10 min at 4 ° C, and the supernatant was collected for RNA extraction and virus propagation. Total RNA extraction was performed using the QIAamp RNA mini kit (Hilden, Germany) according to the manufacturer's instructions, followed by confirmation with RT-PCR. 2.3 Polymerase chain reaction‑based amplification and molecular detection of FMDV The RNAs were subjected to one-step RT-PCR targeting the 5′ UTR to detect FMDV positive samples using the QIAGEN One-Step RT-PCR Kit (QIAGEN, Hilden, Germany) with the universal primers listed in Table 1 according to the manufecture's protocol. The amplified products were visualized in 1.0% agarose gel and compared with a 1 kb-DNA ladder (Promega, USA) for the conformation of FMDV . 2.4 Serotype classification of FMDV The FMDV positive samples were further amplified using the gene-specific primers listed in Table 1 to identify the serotype with QIAGEN One-Step RT-PCR Kits. The amplified products were visualized on a 1.0% agarose gel and compared to a 1 kb DNA ladder (Promega, USA) to confirm the FMDV serotypes. Table 1: List of primers used for RT-PCR FMDV serotypes Primer label Sequence (5´-3´) Gene PCR products (bp) All FMDV P32 (F) CAGATGCAGGAGGACATGTC 2B 131 P33 (R) AGCTTGTACCAGGGTTTGGC O A1 (F) ACCAATGTACAGGGATGGGT VP1 639 A2 (R) TTGCACCGTAGTTAAAGGAA A FMDVC-S (F) TCAATATGCTGAA YRC GCGCGAGAAACCG VP4 140 A-C (R) CGTCTCAGTGA THL GGGGG Asia-1 11-F PN29 (F) GCXGCXGACTACGC X TACAC Y GC VP1 854 11-F PN35 (R) GAA R GGCCC R GGGTTGGAC 2.5 Adaptation of FMD in BHK-21 cell line The previously collected supernatants were treated with antibiotics (penicillin 10,000 IU/ml + streptomycin 10,000 µg/ml) and used as inoculum for propagation in the BHK-21 cell line. The sterility of the inoculum was tested on fresh blood agar media by incubating at 37 ° C for 24 hours, and all samples were found to be sterile, with no growth observed. The BHK-21 monolayer cell line was then infected with the sterile inoculum prepared from the tongue epithelium of FMD-suspected cattle. The inoculated vessels were incubated at 37 ° C, and after 24 hours, the cells were observed under an inverted microscope twice daily until they showed characteristic cytopathic effects (CPE). The presence of cell rounding, swelling, breaking down of intercellular bridge, and eventual cell death in cell culture indicated the presence of FMDV in the samples. 2.6 Detection and isolation of FMDV from BHK-21 cell line The fluid from the infected BHK-21 cell line containing the virus was harvested for 48 to 72 hours post-infection to isolate the virus. The RNA was extracted and subjected to RT-PCR using universal primers to confirm the virus, as mentioned earlier. 2.7 Ethical approval Ethical approval for the study was obtained from the Animal Welfare and Experimentation Ethics Committee of Bangladesh Agricultural University, Mymensingh (Approval number: AWEEC/BAU/2019(55). 3. Results 3.1 Detection of FMDV Out of 35 tongue epithelial samples, 28 tested positive by RT-PCR with a universal primer set, with an amplicon size of 131 bp as shown (Fig. 1). 3.2 Classification of FMDV Serotypes All 28 FMDV positive samples were further subjected to RT-PCR using gene-specific primers to confirm FMDV serotypes. Three serotypes were identified: O, A, and Asia-1, with amplicon sizes of 639 bp, 140 bp, and 854 bp, respectively (Fig. 2). 3.3 The overall prevalence of FMDV serotypes and their distribution in three districts A total of 35 tongue epithelial samples were collected from three outbreak districts, with 42.86% from Gazipur and 28.57% equally from Pabna and Noakhali (Fig. 3a). Among the samples collected, the highest number of positive cases were found in Gazipur (39.29%), followed by Pabna (32.14%), and the lowest in Noakhali (28.57%) (Fig. 3b). Among the 28 FMDV positive samples, the most prevalent serotype was O (35.71%, 10/28), followed by serotype A (32.14%, 9/28), and serotype Asia-1 (10.71%, 3/28) (Fig. 3c). The remaining 21.43% (6/28) of samples had mixed infections, with 14.29% being serotypes O plus A and 7.15% being serotypes A plus Asia-1 (Table 2 and Fig. 3c). In Gazipur district, among the three samples collected from Gayal during the first outbreak, all tested positive: one for serotype O, one for serotype A, and one for a mixed infection of serotypes O plus Asia-1. During the second outbreak (recurrent infection), both samples were positive for serotype Asia-1. However, among the five samples collected from the crossbreed cattle during the first outbreak, one was positive for serotype O, two for serotype A, and two for a mixed infection of serotype O plus Asia-1. Interestingly, in the second outbreak of cross-breed cattle, the only positive sample was for serotype Asia-1 (Table 2, Fig. 4). In Pabna district, all samples were collected from crossbreed cattle, and nine tested positive for the RNA of FMDV. Among these, six were positive for serotype O and one for serotype A. Surprisingly, two mixed infections were detected in Pabna: one with serotype O plus A and one with serotype A plus Asia-1 (Table 2, Fig. 4). Lastly, in Noakhali district, out of eight RNA-positive FMDV samples from crossbreed cattle, two were positive for serotype O and five for serotype A. In addition, one mixed infection was detected with serotypes O plus A (Table 2, Fig. 4). 3.5 Isolation of FMDV The 28 FMDV positive samples were propagated in the BHK-21 cell line for virus isolation. Out of 28 RNA-positive samples, 20 samples (71.42%) successfully infected the BHK-21 cell line. Initially, the infection was confirmed by cytopathic effects (CPEs), including rounding of cells, breakdown of intercellular bridges, and detachment of monolayer cells. Eventually, the complete CPE induced by the virus was observed as aggregation and grape-like clustering of infected cells, along with the sloughing of dead cells from the vessel's surface. The results of CPE produced by different serotypes are presented in Table 3. Table 2. Distribution of FMDV serotypes in three districts Location Animal type Infection Samples/District No. of positive samples Positive/District No. of isolation from BHK-21 uRT-PCR gsRT-PCR Total Proportion (%) Serotype Total Proportion (%) O A Asia-1 O+ Asia-1 O+A Gazipur Gayal 1 st 3 42.86 3 1 1 1 5 39.29 5 2 nd 2 2 2 Cross-breed 1 st 7 5 1 2 2 6 4 2 nd 3 1 1 Pabna Cross-breed 1 st 10 28.57 9 6 1 1 1 9 32.14 6 Noakhali Cross-breed 1 st 10 28.57 8 2 5 1 8 28.57 5 Total 35 28 10 9 3 4 2 28 20 Proportion (%) 80 35.71 32.14 10.71 14.29 7.15 71.42 4. Discussion This study focused on the isolation and identification of FMD serotypes circulating in the FMD outbreak regions of Bangladesh to understand the epidemiological patterns for developing effective control strategies. Bangladesh is enzootic for FMD; however, FMDV outbreaks sometimes turn into epizootic forms across the country. Although the disease occurs more frequently in the eastern part of the country [24], it causes massive damage and economic losses to the livestock industry. Therefore, controlling the disease is a prerequisite for sustainable livestock production. Since understanding the epidemiological characteristics of the virus is crucial for proper disease management, we selected three regions to identify the circulating serotypes in Bangladesh. In general, FMDV serotyping is performed using antigen capture ELISA; however, RT-PCR is more sensitive and specific than ELISA in differentiating FMDV serotypes from clinical samples [25]. Molecular biological techniques are rapid, accurate, highly sensitive, and require only small quantities of material to perform the test. In this study, the uRT-PCR and gsRT-PCR were used to confirm the presence of the FMDV genome in clinical samples collected from farm animals (gayal and crossbreed cattle) in three outbreak areas. Of the 35 field samples, 80% (28/35) tested positive by uRT-PCR, which aligns with earlier reports [26]. The reasons for failing to detect FMDV in 20% (7/35) field samples remain unclear; however, possible explanations include sample collection from recovered animals or animals previously treated with antiviral agents. Viral recombination plays a significant role in the emergence of novel variants and alterations in host range. In Bangladesh, the inactivated trivalent vaccine is used to protect against FMDV, formulated with local A, O, and Asia-1 serotypes. However, antigenic variation due to mutation or recombination can render the vaccines ineffective, leading to disease outbreaks in vaccinated animals [27]. One major factor contributing to recombination is coinfection with multiple serotypes. In this study, coinfections with serotypes A+O and A+Asia-1 were observed in 14.28% and 7.15% of cases, respectively. This result was partially similar to the findings of Hossen et al. [28], who reported 30.58% positivity for serotype O, 36.47% for serotype A, 11.76% for serotype Asia-1, and 4.70% for mixed infections of serotypes A+Asia-1. Since animals were found to develop the disease despite vaccination, it is assumed that infection may have resulted from recombination between coinfected strains. Further studies are required to elucidate the molecular mechanisms of FMDV pathogenesis and vaccine escape. Our results indicate that FMDV serotypes O, A, and Asia-1 prevail in three different regions of Bangladesh, with some cases of mixed infections. Among the various cell lines used for FMDV isolation, BHK-21 is one of the most commonly used cell lines for virus propagation and adaptation [29]. Here, we used the BHK-21 cell line to isolate FMDV from 28 RNA-positive samples. FMDV successfully propagated in BHK-21 cells, producing CPE characterized by the rounding and clumping of cells, the breakdown of intercellular bridges, the development of discrete smaller nuclei and desquamation of the cells, and ultimately, cell death. Hossen et al. [30] also reported similar CPE during FMDV isolation. 5. Conclusions In conclusion, this study focused on the molecular detection and isolation of the FMDV from tongue epithelium samples collected from three recent outbreak areas in Bangladesh. Among 35 field samples, 28 (80%) were positive for FMDV , with serotype O being the most prevalent 10 (35.71%), followed by A 9 (32.14%) and Asia-1 3 (10.71%). Importantly, few samples showed coinfections with serotypes A, O, and Asia-1 across the three outbreak areas. Future studies should focus on whole-genome sequencing and phylogenetic and mutational analysis to unveil the genetic variation among the prevailing FMDV serotypes and aid in successful control strategies through effective vaccine formulation. Declarations Funding The authors have not disclosed any funding. Contributions MAB: Data curation, Formal analysis, Investigation, Methodology, Writing – original draft. TI: Formal analysis, Writing – original draft, Writing – review & editing. SC: Writing – original draft, Writing – review & editing. MTH: Data curation, Formal analysis, Investigation, Methodology, Writing – review & editing, Supervision. MAI: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Funding acquisition, Resources, Supervision. Corresponding author Correspondence to Muhammad Tofazzal Hossain and Md. Alimul Islam Ethics approval and consent to participate Not applicable. Competing interests The authors declare no competing interests. References Giasuddin M, Alam J, Rahman M: Incidence and distribution of diseases of gayal (Ros frontalis) under semi-intensive management . The Indian Journal of Animal Sciences 2006, 76 (10). Grubman MJ, Baxt B: Foot-and-mouth disease . Clinical microbiology reviews 2004, 17 (2):465-493. Rweyemamu M, Roeder P, MacKay D, Sumption K, Brownlie J, Leforban Y: Planning for the progressive control of foot-and-mouth disease worldwide . Transbound Emerg Dis 2008, 55 (1):73-87. Nandi SP, Rahman MZ, Momtaz S, Sultana M, Hossain MA: Emergence and Distribution of Foot-and-Mouth Disease Virus Serotype A and O in Bangladesh . Transbound Emerg Dis 2015, 62 (3):328-331. Bary M, Ali M, Chowdhury S, Mannan A, Nur e Azam M, Moula M, Bhuiyan Z, Shaon M, Hossain M: Prevalence and molecular identification of haemoprotozoan diseases of cattle in Bangladesh . Adv Anim Vet Sci 2018, 6 (4):176-182. Ali MZ, Giasuddin M: Detection of an emerging novel sublineage Ind2001BD1 and lineage PanAsia of foot-and-mouth disease virus serotype O in cattle in Manikgonj district of Bangladesh, 2018 . Open Veterinary Journal 2020, 10 (3):347–353-347–353. Huque K, Giasuddin M: Development of beef cattle breed using gayal. Progress report . Animal Production Research Division, Bangladesh Livestock Research Institute, Savar, Dhaka 1998. Rueckert R: The viruses and their replication . Fields virology 1996:609-654. Chitray M: Improvement of foot-and-mouth disease virus vaccines and diagnostics through structural design : University of Pretoria (South Africa); 2018. Samuel AR, Knowles NJ: Foot-and-mouth disease virus: cause of the recent crisis for the UK livestock industry . Trends in Genetics 2001, 17 (8):421-424. Islam M, Akter M, Hassan M, Rahman M, Islam E, Khan M, Chakrabartty A, Giasuddin M: Identification of foot and mouth disease (FMD) virus from recently outbreak crossbred cattle in Rajbari district of Bangladesh . 2021. Lim DR, Ryoo S, Kang H, Oh SH, Jang SH, Kang B, Park HJ, Hwang H, Kim JM, Park CK: Enhanced detection and serotyping of foot‐and‐mouth disease virus serotype O, A, and Asia1 using a novel multiplex real‐time RT‐PCR . Transboundary and Emerging Diseases 2022, 69 (5):e2578-e2589. Bao H-F, Li D, Guo J-H, Lu Z-J, Chen Y-L, Liu Z-X, Liu X-T, Xie Q-G: A highly sensitive and specific multiplex RT-PCR to detect foot-and-mouth disease virus in tissue and food samples . Archives of virology 2008, 153 :205-209. Siddique M, Ali M, Alam A, Ullah H, Rahman A, Chakrabarty R, Amin M, Hoque S, Nandi S, Sultana M: Emergence of two novel sublineages Ind2001 BD 1 and Ind2001 BD 2 of foot‐and‐mouth disease virus serotype O in Bangladesh . Transboundary and emerging diseases 2018, 65 (4):1009-1023. Samuel A, Knowles N: Foot-and-mouth disease type O viruses exhibit genetically and geographically distinct evolutionary lineages (topotypes) . Journal of General Virology 2001, 82 (3):609-621. Tang H, Liu XS, Fang YZ, Pan L, Zhang ZW, Zhou P, Lv JL, Jiang ST, Hu WF, Zhang P: The epitopes of foot and mouth disease . Asian Journal of Animal and Veterinary Advances 2012, 7 (12):1261-1265. Akter S, Rahman MS, Islam MR, Akther M, Anjume H, Marjia M, Rahaman MM, Hossain MA, Sultana M: Development of recombinant proteins for vaccine candidates against serotypes O and A of foot-and-mouth disease virus in Bangladesh . Access Microbiology 2024, 6 (6):000713. v000714. Kim JY, Park SY, Jin JS, Kim D, Park J-H, Park SH, Ko Y-J: Efficacy of binary ethylenimine in the inactivation of foot-and-mouth disease virus for vaccine production in South Korea . Pathogens 2023, 12 (6):760. Ali MZ, Islam E, Giasuddin M: Outbreak investigation, molecular detection, and characterization of foot and mouth disease virus in the Southern part of Bangladesh . Journal of Advanced Veterinary and Animal Research 2019, 6 (3):346. Giasuddin M, Ali M, Sayeed M, Islam E: Financial loss due to foot and mouth disease outbreak in cattle in some affected areas of Bangladesh . Bangladesh Journal of Livestock Research 2020:82-94. Belsham GJ: Distinctive features of foot-and-mouth disease virus, a member of the picornavirus family; aspects of virus protein synthesis, protein processing and structure . Progress in biophysics and molecular biology 1993, 60 (3):241-260. Zinnah M, Islam M, Rahman M, Hossain M, Bari M, Haque M, Khan M, Islam M: Standardization of multiplex reverse transcription-polymerase chain reaction and typing of foot-and-mouth disease virus prevalent in Bangladesh . Bangladesh Journal of Veterinary Medicine 2010, 8 (2):149-155. Ullah H, Siddique M, Al Amin M, Das B, Sultana M, Hossain M: Re‐emergence of circulatory foot‐and‐mouth disease virus serotypes Asia1 in Bangladesh and VP1 protein heterogeneity with vaccine strain IND 63/72 . Letters in applied microbiology 2015, 60 (2):168-173. Rahman AA, Islam SS, Sufian MA, Talukder MH, Ward MP, Martínez-López B: Foot-and-mouth disease space-time clusters and risk factors in cattle and buffalo in Bangladesh . Pathogens 2020, 9 (6):423. Giridharan P, Hemadri D, Tosh C, Sanyal A, Bandyopadhyay SK: Development and evaluation of a multiplex PCR for differentiation of foot-and-mouth disease virus strains native to India . Journal of virological methods 2005, 126 (1-2):1-11. Alamdari M, Ghorashi SA, Ahmadi M, Salehi-Tabar R: Detection of foot-and-mouth disease virus and identification of serotypes in East Azerbaijan province of Iran . Veterinarski arhiv 2006, 76 (5):413-419. Fish I, Stenfeldt C, Spinard E, Medina GN, Azzinaro PA, Bertram MR, Holinka L, Smoliga GR, Hartwig EJ, de Los Santos T et al : Foot-and-Mouth Disease Virus Interserotypic Recombination in Superinfected Carrier Cattle . Pathogens 2022, 11 (6). Alam MA, Rahman M, Hossen ML, Ahmed S, Parvej S, Khan MFR, Rahman MB: Reverse transcription polymerase chain reaction (RT-PCR) based detection and serotyping of FMD Virus from field samples of Gazipur, Bangladesh, and adaptation of the virus in BHK-21 cell . Journal of Advanced Veterinary and Animal Research 2015, 2 (3):291-295. Zabal OA, Fondevila NA: Selection of highly susceptible cell lines to Foot and Mouth Disease virus infection . In . : Scientific Research; 2013. Hossen M, Ahmed S, Khan M, Rahman M, Saha S, Nazir K, Rahman M, Islam M, Rahman M: Typing of foot and mouth disease virus circulating in Bangladesh by reverse transcription polymerase chain reaction . Journal of Veterinary Advances 2014, 4 (12):778-785. Table Table 3 is available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Supplementaryfile.docx Table3.docx Cite Share Download PDF Status: Under Review Version 1 posted Reviewers invited by journal 23 Apr, 2025 Submission checks completed at journal 22 Apr, 2025 First submitted to journal 14 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5647631","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":446802418,"identity":"82f4ed42-3021-4a31-8375-c5c6721f315d","order_by":0,"name":"Md. Abul Basher","email":"","orcid":"","institution":"Bangladesh Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Md.","middleName":"Abul","lastName":"Basher","suffix":""},{"id":446802419,"identity":"65b35dac-7e69-4f7c-95f4-2fef6708603f","order_by":1,"name":"Tasnim Islam","email":"","orcid":"","institution":"Bangladesh Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Tasnim","middleName":"","lastName":"Islam","suffix":""},{"id":446802420,"identity":"f6db0583-13a7-41a7-8be1-71ace5557f82","order_by":2,"name":"Sourav Chakraborty","email":"","orcid":"","institution":"Bangladesh Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Sourav","middleName":"","lastName":"Chakraborty","suffix":""},{"id":446802421,"identity":"b9165423-1cdc-450d-8bd2-23d350aeeecc","order_by":3,"name":"Muhammad Tofazzal Hossain","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5ElEQVRIiWNgGAWjYFACxgcgUoZBgvkYROAAAxsDDx4NPAzMBhBagi2NZC08ZsRpsWdvZvz4448dj+7snm8PfrYxyPHdSGB78AafLTyHmSUkeJJ5zO6c3W7Y28ZgLHkjgd1wDj4tEvkHJAwkmHnMbuRuk+BtY0jcALRFGq9fJJKZfyQY1AO15DyT/NvGUE+MFjaJAwmHQVrYpIG2JBgQ1HLmMJtlw4HjQC1p5sYy5yQMZ5552I7XL+ztzcw3f/ypljO7kfzs4ZsyG3m+48nH8IYYOpAAYsYGEjSMglEwCkbBKMAGAPWqSL4yocZBAAAAAElFTkSuQmCC","orcid":"","institution":"Bangladesh Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Muhammad","middleName":"Tofazzal","lastName":"Hossain","suffix":""},{"id":446802422,"identity":"e906743f-dab7-495e-b6c0-3e795b33f390","order_by":4,"name":"Md. Alimul Islam","email":"","orcid":"","institution":"Bangladesh Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Md.","middleName":"Alimul","lastName":"Islam","suffix":""}],"badges":[],"createdAt":"2024-12-15 13:23:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5647631/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5647631/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":81509961,"identity":"82f295b5-6e44-4e66-a5d0-b5d5c7c759af","added_by":"auto","created_at":"2025-04-28 06:03:07","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":95235,"visible":true,"origin":"","legend":"\u003cp\u003eAmplified RT-PCR products (131 bp) of FMDV after 1% agarose gel electrophoresis. Lane 1: DNA marker (100 bp); Lane 2 to 4: samples of gayal cattle from Gazipur; Lane 5 to 7: samples of crossbreed cattle from Gazipur; Lane 8 to 11: samples of crossbreed cattle from Pabna; Lane 12 to 15: samples of crossbreed cattle from Noakhali; Lane 16: positive control.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5647631/v1/988f3cb90365bfe17f013b1d.png"},{"id":81510027,"identity":"1402f949-9223-4aca-821a-c2eed8fd9a71","added_by":"auto","created_at":"2025-04-28 06:03:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":97663,"visible":true,"origin":"","legend":"\u003cp\u003eAmplified RT-PCR products of FMDV positive samples in 1% agarose gel electrophoresis. (a) Lanes 1 to 3: serotype O (639 bp); Lane 4: DNA marker (100 bp); Lanes 5 and 6: serotype A (140 bp). (b) Lane 2: DNA marker (100 bp); Lane 3: serotype O (639 bp); Lane 5 and 6: serotype Asia-1 (854 bp).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5647631/v1/8a762ec65a1c86a157f70c3f.png"},{"id":81509698,"identity":"663c767b-2ba9-480e-8fe9-e94fd3f47483","added_by":"auto","created_at":"2025-04-28 06:02:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":54678,"visible":true,"origin":"","legend":"\u003cp\u003eGeographic distribution of FMDV infection. (a) Proportion of sample collected from three districts, (b) Proportion of infections in three districts, (c) Proportion of infections by different serotypes.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5647631/v1/e3df2e30e3fbff7d2dca3d9e.png"},{"id":81509722,"identity":"c31aeb1e-e230-44f3-a591-2cf4edcf2d8f","added_by":"auto","created_at":"2025-04-28 06:02:29","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":13521,"visible":true,"origin":"","legend":"\u003cp\u003eDistribution of FMDV serotypes in three districts.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5647631/v1/327a961a47cde4338f48ce78.png"},{"id":81512237,"identity":"5be9ad55-46d5-46a1-ac3d-9d065c5e01ba","added_by":"auto","created_at":"2025-04-28 06:25:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2380759,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5647631/v1/48e87bcf-78be-498b-92d9-5edcce3733f3.pdf"},{"id":81510330,"identity":"e1bf942e-3892-400c-9832-60fbd5f61e1c","added_by":"auto","created_at":"2025-04-28 06:04:49","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":319602,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfile.docx","url":"https://assets-eu.researchsquare.com/files/rs-5647631/v1/64d47713dede8e89657ffa0d.docx"},{"id":81510002,"identity":"68ccb6bf-ac91-4adc-9cdf-5f4175716591","added_by":"auto","created_at":"2025-04-28 06:03:30","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":3635506,"visible":true,"origin":"","legend":"","description":"","filename":"Table3.docx","url":"https://assets-eu.researchsquare.com/files/rs-5647631/v1/7ad1e888a578132550d9938b.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Molecular detection and isolation of foot-and-mouth disease virus from gayal and crossbreed cattle in two recent outbreaks in Bangladesh","fulltext":[{"header":"Article Highlights","content":"\u003cul\u003e\n \u003cli\u003eFMD outbreaks occur frequently despite regular vaccination in different regions of Bangladesh.\u003c/li\u003e\n \u003cli\u003eThree serotypes of FMDV with some mixed infections were detected in infected animals.\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003eThe frequent outbreaks underscore the urgent need for ongoing monitoring and updated vaccines.\u003c/p\u003e"},{"header":"1. Introduction","content":"\u003cp\u003eFoot-and-mouth disease (FMD) is an airborne, acute, and highly contagious transboundary viral disease affecting more than 70 species of cloven-hoofed animals, including cattle, water buffalo, sheep, goats, and pigs [1, 2]. The World Organization for Animal Health (WOAH) has classified this disease as a \u0026ldquo;notifiable disease\u0026rdquo; due to its potential for rapid spread within and between countries, significant economic impact, public health consequences, and influence on international trade. The disease is widespread around the world and is enzootic in Africa, South America, and Asia [3], including Bangladesh [4]. In rural Bangladesh, FMD is also known as \u0026ldquo;Khura Rog\u0026rdquo; [5, 6]. Gayal and Holstein crossbreed cattle, found in the southeastern hilly districts of Bangladesh, the northeastern part of India, some hilly areas of Myanmar, and Bhutan, are highly susceptible to FMD [7].\u003c/p\u003e \u003cp\u003eThe causative agent, foot-and-mouth disease virus (FMDV), is a non-enveloped, single-stranded positive-sense RNA virus under the genus \u003cem\u003eAphthovirus\u003c/em\u003e in the family \u003cem\u003ePicornaviridae\u003c/em\u003e [8]. The 8.5 kb viral genome is enclosed within an icosahedral capsid containing four structural proteins: VP1, VP2, VP3, and VP4. Among these, VP1 possesses the major antigenic sites; thus, the VP1 nucleotide sequence is traditionally used to classify the virus [9, 10].\u003c/p\u003e \u003cp\u003eFMDV has seven serotypes (O, A, C, Asia-1, SAT-I, SAT-II, and SAT-III) and over 65 subtypes [11]. These serotypes are geographically distributed in seven regional pools, with the livestock industry of Bangladesh being threatened by Pool 1 (A, O, and Asia-1). Constant monitoring of the FMDV serotypes is essential for implementing a proper control strategy [11, 12]. Gene-specific RT-PCR is one of the most efficient and powerful methods to detect RNA and differentiate between serotypes [13]. In our study, we employed three different primers targeting the VP1 and VP4 genes to trace the circulating FMD serotype in three distinct outbreak regions. Previously, serotype O was identified as the primary (82%) causative agent in the total reported outbreaks in Bangladesh [14].\u003c/p\u003e \u003cp\u003eOut of 11 topotypes of serotype O, only the Middle East-South Asia (ME-SA) topotype has been found in Bangladesh. Within this topotype, there are four lineages, named as Ind-2001, Ind-2011, PanAsia, and PanAsia-2 [15\u0026ndash;17]. However, two new lineages, Pak-98 (enzootic in Pakistan) and Srl-97 (enzootic in Sri Lanka), were detected recently. The Ind-2001 lineage is highly diverse and further grouped into five sub-lineages, Ind-2001a to Ind-2001e [15, 18, 19]. The Ind-2001d sub-lineage was found circulating in Bangladesh in 2019 [14].\u003c/p\u003e \u003cp\u003eBetween 2012 and 2016, two additional sub-lineages, Ind2001BD1 (also designated as Ind2001e) and Ind2001BD2, were detected in Bangladesh [20, 21]. Interestingly, the novel Ind-2001BD2 sub-lineage could not be detected after 2013. Additionally, a few isolates (BD_BAU_ML1_2013; BD_BAU_ML2_2013; BD_SI_5_2013; O/BAN/BLRI/450.2/2018) detected between 2013 and 2018 could not be classified [22]. Among them, BD_BAU_ ML1_2013 and BD_BAU_ML2_2013 isolates showed 98\u0026ndash;99% similarity with some unclassified Indian isolates from 2011 and were thus classified under the PanAsia-2 lineage [23].\u003c/p\u003e \u003cp\u003eThe coexistence of antigenically diverse FMDV strains, with no cross-protection between serotypes and even among some subtypes under the same serotype, contributes to severe FMD outbreaks in Bangladesh annually. As an FMD-enzootic country, it is important to regularly assess the effectiveness of existing vaccines through continuous surveillance of circulating FMDV strains. Therefore, this study was designed to isolate and identify the circulating FMDV serotypes in the recently three affected FMD outbreak areas of Bangladesh and determine their prevalence to contribute to developing effective FMD management strategies.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cp\u003e\u003cstrong\u003e2.1\u003c/strong\u003e \u003cstrong\u003eSample collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 35 samples (tongue epithelial tissue) were collected from the FMD-suspected cattle (gayal and crossbreed) in three\u0026nbsp;outbreak areas (Gazipur, Pabna, and Noakhali) in Bangladesh\u0026nbsp;from 2020-2021. All the samples were collected aseptically, transferred in ice containing transport box and transported to the\u0026nbsp;Department of Microbiology and Hygiene, Bangladesh Agricultural University, Mymensingh-2202, at 4\u003csup\u003e\u0026deg;\u003c/sup\u003eC immediately after collection. They were then stored at -80\u003csup\u003e\u0026deg;\u003c/sup\u003eC for further use.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 Sample processing, RNA extraction, and cDNA synthesis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll epithelial tissue samples were homogenized with a mortar and pestle using sterile sea sand, and a 10% suspension was prepared by adding phosphate-buffered saline (PBS). Afterward, the suspension was centrifuged at 3000 rpm (ESCO Lifescience group, Singapore) for 10 min at 4\u003csup\u003e\u0026deg;\u003c/sup\u003eC, and the supernatant was collected for RNA extraction and virus propagation. Total RNA extraction was performed using the QIAamp RNA mini kit (Hilden, Germany) according to the manufacturer\u0026apos;s instructions, followed by confirmation with RT-PCR. \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 Polymerase chain reaction‑based amplification and molecular detection of FMDV\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe RNAs were subjected to one-step RT-PCR targeting the 5\u0026prime; UTR to detect FMDV positive samples using the QIAGEN One-Step RT-PCR Kit (QIAGEN, Hilden, Germany) with the universal primers listed in Table 1 according to the manufecture\u0026apos;s protocol. The amplified products were visualized in 1.0% agarose gel and compared with a 1 kb-DNA ladder (Promega, USA) for the conformation of FMDV .\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Serotype classification of FMDV\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe FMDV positive samples were further amplified using the gene-specific primers listed in Table 1 to identify the serotype\u0026nbsp;with QIAGEN One-Step RT-PCR Kits. The amplified products were visualized on a 1.0% agarose gel and compared to a 1 kb DNA ladder (Promega, USA) to confirm the FMDV serotypes.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1: List of primers used for RT-PCR\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"642\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFMDV serotypes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer label\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSequence (5\u0026acute;-3\u0026acute;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 54px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 108px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePCR products (bp)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 84px;\"\u003e\n \u003cp\u003eAll FMDV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003eP32 (F)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 282px;\"\u003e\n \u003cp\u003eCAGATGCAGGAGGACATGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 54px;\"\u003e\n \u003cp\u003e2B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 108px;\"\u003e\n \u003cp\u003e131\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003eP33 (R)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 282px;\"\u003e\n \u003cp\u003eAGCTTGTACCAGGGTTTGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 84px;\"\u003e\n \u003cp\u003eO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003eA1 (F)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 282px;\"\u003e\n \u003cp\u003eACCAATGTACAGGGATGGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 54px;\"\u003e\n \u003cp\u003eVP1\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 108px;\"\u003e\n \u003cp\u003e639\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003eA2 (R)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 282px;\"\u003e\n \u003cp\u003eTTGCACCGTAGTTAAAGGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 84px;\"\u003e\n \u003cp\u003eA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003eFMDVC-S (F)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 282px;\"\u003e\n \u003cp\u003eTCAATATGCTGAA\u003cstrong\u003eYRC\u003c/strong\u003eGCGCGAGAAACCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 54px;\"\u003e\n \u003cp\u003eVP4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 108px;\"\u003e\n \u003cp\u003e140\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003eA-C (R)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 282px;\"\u003e\n \u003cp\u003eCGTCTCAGTGA\u003cstrong\u003eTHL\u003c/strong\u003eGGGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 84px;\"\u003e\n \u003cp\u003eAsia-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003e11-F PN29 (F)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 282px;\"\u003e\n \u003cp\u003eGCXGCXGACTACGC\u003cstrong\u003eX\u003c/strong\u003eTACAC\u003cstrong\u003eY\u003c/strong\u003eGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 54px;\"\u003e\n \u003cp\u003eVP1\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 108px;\"\u003e\n \u003cp\u003e854\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003e11-F PN35 (R)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 282px;\"\u003e\n \u003cp\u003eGAA\u003cstrong\u003eR\u003c/strong\u003eGGCCC\u003cstrong\u003eR\u003c/strong\u003eGGGTTGGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e2.5 Adaptation of FMD in BHK-21 cell line\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe previously collected supernatants were treated with antibiotics (penicillin 10,000 IU/ml + streptomycin 10,000 \u0026micro;g/ml) and used as inoculum for propagation in the BHK-21 cell line.\u0026nbsp;The sterility of the inoculum was tested on fresh blood agar media by incubating at 37\u003csup\u003e\u0026deg;\u003c/sup\u003eC for 24 hours, and all samples were found to be sterile, with no growth observed. The BHK-21 monolayer cell line was then infected with the sterile inoculum prepared from the tongue epithelium of FMD-suspected cattle. The inoculated vessels were incubated at 37\u003csup\u003e\u0026deg;\u003c/sup\u003eC, and after 24 hours, the cells were observed under an inverted microscope twice daily until they showed characteristic cytopathic effects (CPE). The presence of cell rounding, swelling, breaking down of intercellular bridge, and eventual cell death in cell culture indicated the presence of FMDV in the samples.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6 Detection and isolation of FMDV from BHK-21 cell line\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe fluid from the infected BHK-21 cell line containing the virus was harvested for 48 to 72 hours post-infection to isolate the virus. The RNA was extracted and subjected to RT-PCR using universal primers to confirm the virus, as mentioned earlier.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7 Ethical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEthical approval for the study was obtained from the Animal Welfare and Experimentation Ethics Committee of Bangladesh Agricultural University, Mymensingh (Approval number: AWEEC/BAU/2019(55).\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cstrong\u003e3.1 Detection of FMDV\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOut of 35 tongue epithelial samples, 28 tested positive by RT-PCR with a universal primer set, with an amplicon size of 131 bp as shown (Fig. 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 Classification of FMDV Serotypes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll 28 FMDV positive samples were further subjected to RT-PCR using gene-specific primers to confirm FMDV serotypes. Three serotypes were identified: O, A, and Asia-1, with amplicon sizes of 639 bp, 140 bp, and 854 bp, respectively (Fig. 2).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 The overall prevalence of FMDV serotypes and their distribution in three districts\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 35 tongue epithelial samples were collected from three outbreak districts, with 42.86% from Gazipur and 28.57% equally from Pabna and Noakhali (Fig. 3a). Among the samples collected, the highest number of positive cases were found in Gazipur (39.29%), followed by Pabna (32.14%), and the lowest in Noakhali (28.57%) (Fig. 3b).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAmong the 28 FMDV positive samples, the most prevalent serotype was O (35.71%, 10/28), followed by serotype A (32.14%, 9/28), and serotype Asia-1 (10.71%, 3/28) (Fig. 3c). The remaining 21.43% (6/28) of samples had mixed infections, with 14.29% being serotypes O plus A and 7.15% being serotypes A plus Asia-1 (Table 2 and Fig. 3c).\u003c/p\u003e\n\u003cp\u003eIn Gazipur district, among the three samples collected from Gayal during the first outbreak, all tested positive: one for serotype O, one for serotype A, and one for a mixed infection of serotypes O plus Asia-1. During the second outbreak (recurrent infection), both samples were positive for serotype Asia-1. However, among the five samples collected from the crossbreed cattle during the first outbreak, one was positive for serotype O, two for serotype A, and two for a mixed infection of serotype O plus Asia-1. Interestingly, in the second outbreak of cross-breed cattle, the only positive sample was for serotype Asia-1 (Table 2, Fig. 4).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn Pabna district, all samples were collected from crossbreed cattle, and nine tested positive for the RNA of FMDV. Among these, six were positive for serotype O and one for serotype A. Surprisingly, two mixed infections were detected in Pabna: one with serotype O plus A and one with serotype A plus Asia-1 (Table 2, Fig. 4).\u003c/p\u003e\n\u003cp\u003eLastly, in Noakhali district, out of eight RNA-positive FMDV samples from crossbreed cattle, two were positive for serotype O and five for serotype A. In addition, one mixed infection was detected with serotypes O plus A (Table 2, Fig. 4).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5 Isolation of FMDV \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe 28 FMDV positive samples were propagated in the BHK-21 cell line for virus isolation. Out of 28 RNA-positive samples, 20 samples (71.42%) successfully infected the BHK-21 cell line. Initially, the infection was confirmed by cytopathic effects (CPEs), including rounding of cells, breakdown of intercellular bridges, and detachment of monolayer cells. Eventually, the complete CPE induced by the virus was observed as aggregation and grape-like clustering of infected cells, along with the sloughing of dead cells from the vessel\u0026apos;s surface. The results of CPE produced by different serotypes are presented in Table 3.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u0026nbsp;\u003c/strong\u003eDistribution of FMDV serotypes in three districts\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"863\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"4\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eLocation\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" style=\"width: 64px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAnimal type\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" style=\"width: 75px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eInfection\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" rowspan=\"2\" style=\"width: 139px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSamples/District\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"6\" style=\"width: 300px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNo. of positive samples\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" rowspan=\"2\" style=\"width: 139px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePositive/District\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" style=\"width: 71px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNo. of isolation from BHK-21\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"3\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u003cstrong\u003euRT-PCR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"5\" style=\"width: 250px;\"\u003e\n \u003cp\u003e\u003cstrong\u003egsRT-PCR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eProportion\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"5\" valign=\"top\" style=\"width: 250px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSerotype\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eProportion\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eO\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAsia-1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eO+ Asia-1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eO+A\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"4\" valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003eGazipur\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 64px;\"\u003e\n \u003cp\u003eGayal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e1\u003csup\u003est\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e42.86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" style=\"width: 89px;\"\u003e\n \u003cp\u003e39.29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 71px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e2\u003csup\u003end\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 64px;\"\u003e\n \u003cp\u003eCross-breed\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e1\u003csup\u003est\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 71px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e2\u003csup\u003end\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003ePabna\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 64px;\"\u003e\n \u003cp\u003eCross-breed\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e1\u003csup\u003est\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e28.57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003e32.14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003eNoakhali\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 64px;\"\u003e\n \u003cp\u003eCross-breed\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e1\u003csup\u003est\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e28.57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003e28.57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" valign=\"top\" style=\"width: 213px;\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\" valign=\"top\" style=\"width: 213px;\"\u003e\n \u003cp\u003eProportion\u0026nbsp;\u003cstrong\u003e(%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e35.71\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e32.14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e10.71\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e14.29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e7.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 50px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\n \u003cp\u003e71.42\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThis study focused on the isolation and identification of FMD serotypes circulating in the FMD outbreak regions of Bangladesh to understand the epidemiological patterns for developing effective control strategies. Bangladesh is enzootic for FMD; however, FMDV outbreaks sometimes turn into epizootic forms across the country. Although the disease occurs more frequently in the eastern part of the country [24], it causes massive damage and economic losses to the livestock industry. Therefore, controlling the disease is a prerequisite for sustainable livestock production. Since understanding the epidemiological characteristics of the virus is crucial for proper disease management, we selected three regions to identify the circulating serotypes in Bangladesh. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn general, FMDV serotyping is performed using antigen capture ELISA; however, RT-PCR is more sensitive and specific than ELISA in differentiating FMDV serotypes from clinical samples [25]. Molecular biological techniques are rapid, accurate, highly sensitive, and require only small quantities of material to perform the test. In this study, the uRT-PCR and gsRT-PCR were used to confirm the presence of the FMDV genome in clinical samples collected from farm animals (gayal and crossbreed cattle) in three outbreak areas. Of the 35 field samples, 80% (28/35) tested positive by uRT-PCR, which aligns with earlier reports [26]. The reasons for failing to detect FMDV in 20% (7/35) field samples remain unclear; however, possible explanations include sample collection from recovered animals or animals previously treated with antiviral agents. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eViral recombination plays a significant role in the emergence of novel variants and alterations in host range. In Bangladesh, the inactivated trivalent vaccine is used to protect against FMDV, formulated with local A, O, and Asia-1 serotypes. However, antigenic variation due to mutation or recombination can render the vaccines ineffective, leading to disease outbreaks in vaccinated animals [27]. One major factor contributing to recombination is coinfection with multiple serotypes. In this study, coinfections with serotypes A+O and A+Asia-1 were observed in 14.28% and 7.15% of cases, respectively. This result was partially similar to the findings of Hossen et al. [28], who reported 30.58% positivity for serotype O, 36.47% for serotype A, 11.76% for serotype Asia-1, and 4.70% for mixed infections of serotypes A+Asia-1. Since animals were found to develop the disease despite vaccination, it is assumed that infection may have resulted from recombination between coinfected strains. Further studies are required to elucidate the molecular mechanisms of FMDV pathogenesis and vaccine escape.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOur results indicate that FMDV serotypes O, A, and Asia-1 prevail in three different regions of Bangladesh, with some cases of mixed infections. Among the various cell lines used for FMDV isolation, BHK-21 is one of the most commonly used cell lines for virus propagation and adaptation [29]. Here, we used the BHK-21 cell line to isolate FMDV from 28 RNA-positive samples. FMDV successfully propagated in BHK-21 cells, producing CPE characterized by the rounding and clumping of cells, the breakdown of intercellular bridges, the development of discrete smaller nuclei and desquamation of the cells, and ultimately, cell death. Hossen et al. [30] also reported similar CPE during FMDV isolation. \u0026nbsp;\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eIn conclusion, this study focused on the molecular detection and isolation of the FMDV from tongue epithelium samples collected from three recent outbreak areas in Bangladesh. Among 35 field samples, 28 (80%) were positive for FMDV , with serotype O being the most prevalent 10 (35.71%), followed by A 9 (32.14%) and Asia-1 3 (10.71%). Importantly, few samples showed coinfections with serotypes A, O, and Asia-1 across the three outbreak areas. Future studies should focus on whole-genome sequencing and phylogenetic and mutational analysis to unveil the genetic variation among the prevailing FMDV serotypes and aid in successful control strategies through effective vaccine formulation.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have not disclosed any funding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMAB: Data curation, Formal analysis, Investigation, Methodology, Writing \u0026ndash; original draft. TI: Formal analysis, Writing \u0026ndash; original draft, Writing \u0026ndash; review \u0026amp; editing. SC: Writing \u0026ndash; original draft, Writing \u0026ndash; review \u0026amp; editing. MTH: Data curation, Formal analysis, Investigation, Methodology, Writing \u0026ndash; review \u0026amp; editing, Supervision. MAI: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Funding acquisition, Resources, Supervision.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding author\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence to Muhammad Tofazzal Hossain and Md. Alimul Islam\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eGiasuddin M, Alam J, Rahman M: \u003cstrong\u003eIncidence and distribution of diseases of gayal (Ros frontalis) under semi-intensive management\u003c/strong\u003e. \u003cem\u003eThe Indian Journal of Animal Sciences \u003c/em\u003e2006, \u003cstrong\u003e76\u003c/strong\u003e(10).\u003c/li\u003e\n\u003cli\u003eGrubman MJ, Baxt B: \u003cstrong\u003eFoot-and-mouth disease\u003c/strong\u003e. \u003cem\u003eClinical microbiology reviews \u003c/em\u003e2004, \u003cstrong\u003e17\u003c/strong\u003e(2):465-493.\u003c/li\u003e\n\u003cli\u003eRweyemamu M, Roeder P, MacKay D, Sumption K, Brownlie J, Leforban Y: \u003cstrong\u003ePlanning for the progressive control of foot-and-mouth disease worldwide\u003c/strong\u003e. \u003cem\u003eTransbound Emerg Dis \u003c/em\u003e2008, \u003cstrong\u003e55\u003c/strong\u003e(1):73-87.\u003c/li\u003e\n\u003cli\u003eNandi SP, Rahman MZ, Momtaz S, Sultana M, Hossain MA: \u003cstrong\u003eEmergence and Distribution of Foot-and-Mouth Disease Virus Serotype A and O in Bangladesh\u003c/strong\u003e. \u003cem\u003eTransbound Emerg Dis \u003c/em\u003e2015, \u003cstrong\u003e62\u003c/strong\u003e(3):328-331.\u003c/li\u003e\n\u003cli\u003eBary M, Ali M, Chowdhury S, Mannan A, Nur e Azam M, Moula M, Bhuiyan Z, Shaon M, Hossain M: \u003cstrong\u003ePrevalence and molecular identification of haemoprotozoan diseases of cattle in Bangladesh\u003c/strong\u003e. \u003cem\u003eAdv Anim Vet Sci \u003c/em\u003e2018, \u003cstrong\u003e6\u003c/strong\u003e(4):176-182.\u003c/li\u003e\n\u003cli\u003eAli MZ, Giasuddin M: \u003cstrong\u003eDetection of an emerging novel sublineage Ind2001BD1 and lineage PanAsia of foot-and-mouth disease virus serotype O in cattle in Manikgonj district of Bangladesh, 2018\u003c/strong\u003e. \u003cem\u003eOpen Veterinary Journal \u003c/em\u003e2020, \u003cstrong\u003e10\u003c/strong\u003e(3):347\u0026ndash;353-347\u0026ndash;353.\u003c/li\u003e\n\u003cli\u003eHuque K, Giasuddin M: \u003cstrong\u003eDevelopment of beef cattle breed using gayal. Progress report\u003c/strong\u003e. \u003cem\u003eAnimal Production Research Division, Bangladesh Livestock Research Institute, Savar, Dhaka \u003c/em\u003e1998.\u003c/li\u003e\n\u003cli\u003eRueckert R: \u003cstrong\u003eThe viruses and their replication\u003c/strong\u003e. \u003cem\u003eFields virology \u003c/em\u003e1996:609-654.\u003c/li\u003e\n\u003cli\u003eChitray M: \u003cstrong\u003eImprovement of foot-and-mouth disease virus vaccines and diagnostics through structural design\u003c/strong\u003e: University of Pretoria (South Africa); 2018.\u003c/li\u003e\n\u003cli\u003eSamuel AR, Knowles NJ: \u003cstrong\u003eFoot-and-mouth disease virus: cause of the recent crisis for the UK livestock industry\u003c/strong\u003e. \u003cem\u003eTrends in Genetics \u003c/em\u003e2001, \u003cstrong\u003e17\u003c/strong\u003e(8):421-424.\u003c/li\u003e\n\u003cli\u003eIslam M, Akter M, Hassan M, Rahman M, Islam E, Khan M, Chakrabartty A, Giasuddin M: \u003cstrong\u003eIdentification of foot and mouth disease (FMD) virus from recently outbreak crossbred cattle in Rajbari district of Bangladesh\u003c/strong\u003e. 2021.\u003c/li\u003e\n\u003cli\u003eLim DR, Ryoo S, Kang H, Oh SH, Jang SH, Kang B, Park HJ, Hwang H, Kim JM, Park CK: \u003cstrong\u003eEnhanced detection and serotyping of foot‐and‐mouth disease virus serotype O, A, and Asia1 using a novel multiplex real‐time RT‐PCR\u003c/strong\u003e. \u003cem\u003eTransboundary and Emerging Diseases \u003c/em\u003e2022, \u003cstrong\u003e69\u003c/strong\u003e(5):e2578-e2589.\u003c/li\u003e\n\u003cli\u003eBao H-F, Li D, Guo J-H, Lu Z-J, Chen Y-L, Liu Z-X, Liu X-T, Xie Q-G: \u003cstrong\u003eA highly sensitive and specific multiplex RT-PCR to detect foot-and-mouth disease virus in tissue and food samples\u003c/strong\u003e. \u003cem\u003eArchives of virology \u003c/em\u003e2008, \u003cstrong\u003e153\u003c/strong\u003e:205-209.\u003c/li\u003e\n\u003cli\u003eSiddique M, Ali M, Alam A, Ullah H, Rahman A, Chakrabarty R, Amin M, Hoque S, Nandi S, Sultana M: \u003cstrong\u003eEmergence of two novel sublineages Ind2001 BD 1 and Ind2001 BD 2 of foot‐and‐mouth disease virus serotype O in Bangladesh\u003c/strong\u003e. \u003cem\u003eTransboundary and emerging diseases \u003c/em\u003e2018, \u003cstrong\u003e65\u003c/strong\u003e(4):1009-1023.\u003c/li\u003e\n\u003cli\u003eSamuel A, Knowles N: \u003cstrong\u003eFoot-and-mouth disease type O viruses exhibit genetically and geographically distinct evolutionary lineages (topotypes)\u003c/strong\u003e. \u003cem\u003eJournal of General Virology \u003c/em\u003e2001, \u003cstrong\u003e82\u003c/strong\u003e(3):609-621.\u003c/li\u003e\n\u003cli\u003eTang H, Liu XS, Fang YZ, Pan L, Zhang ZW, Zhou P, Lv JL, Jiang ST, Hu WF, Zhang P: \u003cstrong\u003eThe epitopes of foot and mouth disease\u003c/strong\u003e. \u003cem\u003eAsian Journal of Animal and Veterinary Advances \u003c/em\u003e2012, \u003cstrong\u003e7\u003c/strong\u003e(12):1261-1265.\u003c/li\u003e\n\u003cli\u003eAkter S, Rahman MS, Islam MR, Akther M, Anjume H, Marjia M, Rahaman MM, Hossain MA, Sultana M: \u003cstrong\u003eDevelopment of recombinant proteins for vaccine candidates against serotypes O and A of foot-and-mouth disease virus in Bangladesh\u003c/strong\u003e. \u003cem\u003eAccess Microbiology \u003c/em\u003e2024, \u003cstrong\u003e6\u003c/strong\u003e(6):000713. v000714.\u003c/li\u003e\n\u003cli\u003eKim JY, Park SY, Jin JS, Kim D, Park J-H, Park SH, Ko Y-J: \u003cstrong\u003eEfficacy of binary ethylenimine in the inactivation of foot-and-mouth disease virus for vaccine production in South Korea\u003c/strong\u003e. \u003cem\u003ePathogens \u003c/em\u003e2023, \u003cstrong\u003e12\u003c/strong\u003e(6):760.\u003c/li\u003e\n\u003cli\u003eAli MZ, Islam E, Giasuddin M: \u003cstrong\u003eOutbreak investigation, molecular detection, and characterization of foot and mouth disease virus in the Southern part of Bangladesh\u003c/strong\u003e. \u003cem\u003eJournal of Advanced Veterinary and Animal Research \u003c/em\u003e2019, \u003cstrong\u003e6\u003c/strong\u003e(3):346.\u003c/li\u003e\n\u003cli\u003eGiasuddin M, Ali M, Sayeed M, Islam E: \u003cstrong\u003eFinancial loss due to foot and mouth disease outbreak in cattle in some affected areas of Bangladesh\u003c/strong\u003e. \u003cem\u003eBangladesh Journal of Livestock Research \u003c/em\u003e2020:82-94.\u003c/li\u003e\n\u003cli\u003eBelsham GJ: \u003cstrong\u003eDistinctive features of foot-and-mouth disease virus, a member of the picornavirus family; aspects of virus protein synthesis, protein processing and structure\u003c/strong\u003e. \u003cem\u003eProgress in biophysics and molecular biology \u003c/em\u003e1993, \u003cstrong\u003e60\u003c/strong\u003e(3):241-260.\u003c/li\u003e\n\u003cli\u003eZinnah M, Islam M, Rahman M, Hossain M, Bari M, Haque M, Khan M, Islam M: \u003cstrong\u003eStandardization of multiplex reverse transcription-polymerase chain reaction and typing of foot-and-mouth disease virus prevalent in Bangladesh\u003c/strong\u003e. \u003cem\u003eBangladesh Journal of Veterinary Medicine \u003c/em\u003e2010, \u003cstrong\u003e8\u003c/strong\u003e(2):149-155.\u003c/li\u003e\n\u003cli\u003eUllah H, Siddique M, Al Amin M, Das B, Sultana M, Hossain M: \u003cstrong\u003eRe‐emergence of circulatory foot‐and‐mouth disease virus serotypes Asia1 in Bangladesh and VP1 protein heterogeneity with vaccine strain IND 63/72\u003c/strong\u003e. \u003cem\u003eLetters in applied microbiology \u003c/em\u003e2015, \u003cstrong\u003e60\u003c/strong\u003e(2):168-173.\u003c/li\u003e\n\u003cli\u003eRahman AA, Islam SS, Sufian MA, Talukder MH, Ward MP, Mart\u0026iacute;nez-L\u0026oacute;pez B: \u003cstrong\u003eFoot-and-mouth disease space-time clusters and risk factors in cattle and buffalo in Bangladesh\u003c/strong\u003e. \u003cem\u003ePathogens \u003c/em\u003e2020, \u003cstrong\u003e9\u003c/strong\u003e(6):423.\u003c/li\u003e\n\u003cli\u003eGiridharan P, Hemadri D, Tosh C, Sanyal A, Bandyopadhyay SK: \u003cstrong\u003eDevelopment and evaluation of a multiplex PCR for differentiation of foot-and-mouth disease virus strains native to India\u003c/strong\u003e. \u003cem\u003eJournal of virological methods \u003c/em\u003e2005, \u003cstrong\u003e126\u003c/strong\u003e(1-2):1-11.\u003c/li\u003e\n\u003cli\u003eAlamdari M, Ghorashi SA, Ahmadi M, Salehi-Tabar R: \u003cstrong\u003eDetection of foot-and-mouth disease virus and identification of serotypes in East Azerbaijan province of Iran\u003c/strong\u003e. \u003cem\u003eVeterinarski arhiv \u003c/em\u003e2006, \u003cstrong\u003e76\u003c/strong\u003e(5):413-419.\u003c/li\u003e\n\u003cli\u003eFish I, Stenfeldt C, Spinard E, Medina GN, Azzinaro PA, Bertram MR, Holinka L, Smoliga GR, Hartwig EJ, de Los Santos T\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eFoot-and-Mouth Disease Virus Interserotypic Recombination in Superinfected Carrier Cattle\u003c/strong\u003e. \u003cem\u003ePathogens \u003c/em\u003e2022, \u003cstrong\u003e11\u003c/strong\u003e(6).\u003c/li\u003e\n\u003cli\u003eAlam MA, Rahman M, Hossen ML, Ahmed S, Parvej S, Khan MFR, Rahman MB: \u003cstrong\u003eReverse transcription polymerase chain reaction (RT-PCR) based detection and serotyping of FMD Virus from field samples of Gazipur, Bangladesh, and adaptation of the virus in BHK-21 cell\u003c/strong\u003e. \u003cem\u003eJournal of Advanced Veterinary and Animal Research \u003c/em\u003e2015, \u003cstrong\u003e2\u003c/strong\u003e(3):291-295.\u003c/li\u003e\n\u003cli\u003eZabal OA, Fondevila NA: \u003cstrong\u003eSelection of highly susceptible cell lines to Foot and Mouth Disease virus infection\u003c/strong\u003e. In\u003cem\u003e.\u003c/em\u003e: Scientific Research; 2013.\u003c/li\u003e\n\u003cli\u003eHossen M, Ahmed S, Khan M, Rahman M, Saha S, Nazir K, Rahman M, Islam M, Rahman M: \u003cstrong\u003eTyping of foot and mouth disease virus circulating in Bangladesh by reverse transcription polymerase chain reaction\u003c/strong\u003e. \u003cem\u003eJournal of Veterinary Advances \u003c/em\u003e2014, \u003cstrong\u003e4\u003c/strong\u003e(12):778-785.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cp\u003eTable 3 is available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"discover-applied-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Discover Applied Sciences](https://link.springer.com/journal/42452)","snPcode":"42452","submissionUrl":"https://submission.springernature.com/new-submission/42452/3","title":"Discover Applied Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Discover Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Foot-and-mouth disease virus (FMDV), serotyping, RT-PCR, BHK-21 cell line","lastPublishedDoi":"10.21203/rs.3.rs-5647631/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5647631/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eFoot-and-mouth disease (FMD) is a significant threat to the livestock industry, causing severe economic losses, especially in enzootic countries like Bangladesh. Despite regular immunization, managing FMD remains challenging due to the continuous mutation and generation of new genotypes of the FMD virus (FMDV). Two recent outbreaks of FMDV have occurred in several districts of Bangladesh, including Gazipur, Pabna, and Noakhali, even though cattle farms in these districts were regularly immunized with commercially available FMDV vaccines. This suggests the emergence of new FMDV strains. Thus, we aimed to molecularly identify and isolate the circulating FMDVs in these three districts, for which we collected 35 tongue epithelium samples from FMD-suspected gayal (\u003cem\u003eBos frontalis\u003c/em\u003e) and crossbreed cattle. Among the 35 samples, 80.00% (28/35) were positive by uRT-PCR. Further serotyping of the positive samples (28) using gsRT-PCR revealed three serotypes: O (35.71%), the most predominant one, A (32.14%), and Asia-1 (10.71%). Mixed infections of A\u0026thinsp;+\u0026thinsp;O (14.28%) and A\u0026thinsp;+\u0026thinsp;Asia-1 (7.15%) were also detected. Mixed infections of A\u0026thinsp;+\u0026thinsp;O (14.28%) and A\u0026thinsp;+\u0026thinsp;Asia-1 (7.15%) were also detected. Serotypes A, Asia-1, and O\u0026thinsp;+\u0026thinsp;A contributed equally (each 27.27%) to disease occurrence in the Gazipur district. On the other hand, the leading causes for disease were serotype O (66.67%) and A (62.50%) in Pabna and Noakhali districts, respectively.We then isolated FMDV by inoculating RT-PCR-positive samples into BHK-21 cells, and we observed successful virus propagation in 71.42% (20/28) of the positive samples. Our data indicate that, despite regular immunization, several FMDV serotypes are circulating in Bangladesh, suggesting that continuous monitoring of circulating FMD strains is crucial in implementing a strategic FMD control program.\u003c/p\u003e","manuscriptTitle":"Molecular detection and isolation of foot-and-mouth disease virus from gayal and crossbreed cattle in two recent outbreaks in Bangladesh","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-28 05:46:08","doi":"10.21203/rs.3.rs-5647631/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewersInvited","content":"","date":"2025-04-23T08:52:04+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-04-22T07:06:53+00:00","index":"","fulltext":""},{"type":"submitted","content":"Discover Applied Sciences","date":"2025-04-14T17:15:18+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"discover-applied-sciences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Discover Applied Sciences](https://link.springer.com/journal/42452)","snPcode":"42452","submissionUrl":"https://submission.springernature.com/new-submission/42452/3","title":"Discover Applied Sciences","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Discover Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f6792088-6887-473a-a645-06ed3da302ef","owner":[],"postedDate":"April 28th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-06-27T18:53:09+00:00","versionOfRecord":[],"versionCreatedAt":"2025-04-28 05:46:08","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5647631","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5647631","identity":"rs-5647631","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.