In vitro anticoagulant and antiviral properties of low molecular weight sulfated chitosan from Loligo duvauceli against herpes simplex virus

preprint OA: closed
Full text JSON View at publisher
Full text 149,926 characters · extracted from preprint-html · click to expand
In vitro anticoagulant and antiviral properties of low molecular weight sulfated chitosan from Loligo duvauceli against herpes simplex virus | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article In vitro anticoagulant and antiviral properties of low molecular weight sulfated chitosan from Loligo duvauceli against herpes simplex virus Vignesh Narasimman, Saravanan Ramachandran This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6715411/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background This research investigates the anticoagulant and antiviral properties of chitosan (CH), a non-toxic marine polymer derived from squid waste. Chitin was extracted from the gladius of L. duvauceli and subsequently converted into CH. Following purification and freeze-drying, sulfated chitosan (SCH) was produced. To create low-molecular-weight sulfated chitosan (LMW-SCH), SCH was exposed to 100 Gy of gamma irradiation (GIR). Results The structural characteristics and molecular weight of LMW-SCH were analyzed using FT-IR, NMR, and MALDI-TOF/MS, which confirmed the transformation and reduction in molecular weight. In terms of anticoagulant activity, LMW-SCH exhibited prothrombin time (PT) and activated partial thromboplastin time (APTT) values of 1.93 IU/mg and 6.96 IU/mg, respectively, indicating its potential as an anticoagulant agent, although these values should be compared to standard heparin. The antiviral efficacy of LMW-SCH was assessed against herpes simplex virus type 1 (HSV-1) in vitro, revealing a CC 50 of 100 µg/ml, EC 50 value of 200 µg/ml and SI = 0.5 in DMEM medium. Notably, LMW-SCH demonstrated a significant reduction in HSV-1 gene expression, suggesting a potential mechanism of action that warrants further investigation. Conclusions This study highlights the impact of GIR on the molecular weight and subsequent antiviral effectiveness of LMW-SCH, providing a foundation for future research into its therapeutic applications against HSV-1. LMW-SCH NMR MALDI-TOF HSV-1 Anticoagulant Antiviral activity Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 Figure 16 Figure 17 Figure 18 1. INTRODUCTION The herpes simplex virus (HSV) is a significant human pathogen that causes a variety of clinical manifestations, including lesions of the lips and tongue, keratitis, and encephalitis (Dolin et al., 1975 ; Gilbert et al., 2011 ; Hamroush & Welch, 2014 ; Rabinstein, 2017 ). According to recent estimates, approximately 3.75 billion people globally (66.6% of individuals aged 0–49 years) are infected with HSV-1, while about 491.5 million people (13.2% of the population aged 15–49 years) are living with HSV-2 infection. The prevalence of these infections varies significantly by age, sex, and geographical region, with HSV-2 being more prevalent among women and in the WHO African Region (James et al., 2020 ). After initial infection, HSV often remains dormant in sensory neurons for the host's lifetime, with the potential for reactivation leading to recurrent diseases. HSV is classified into two serotypes: type 1 (HSV-1) and type 2 (HSV-2). HSV-1 is primarily responsible for oral herpes labialis, commonly known as cold sores, and can also cause genital herpes. The viral particles consist of a double-stranded DNA molecule and an icosahedral capsid, both surrounded by an amorphous tegument and an envelope containing specific antiviral glycoproteins (Huang et al., 2019 ). These viral proteins are crucial for the replication process of HSV. Key proteins involved in viral DNA synthesis include UL5, UL8, UL30, UL42, and UL52 (Crute et al., 1989 ; Weller & Coen, 2012 ) , which participate in helicase activity and DNA polymerase function. Additionally, ICP8 binds to single-stranded DNA and recruits other replication factors for efficient DNA replication. The DNA polymerase is composed of the UL30 and UL42 subunits, while the helicase-primase complex consists of the UL5, UL8, and UL52 subunits. HSV gene expression occurs in a sequential manner, divided into three phases: immediate early (IE), early, and late. The immediate early phase includes five critical genes: ICP0, ICP4, ICP22, ICP27, and ICP47. The importance of these IE genes in early gene expression, necessary for viral DNA replication, is underscored by findings that demonstrate the profound impact of deleting either ICP4 or ICP27 on the regulation of early and late viral genes (Everett, 2000 ; Watson & Clements, 1980 ). Consequently, inhibiting these crucial IE genes significantly impedes viral replication. Current antiviral treatments, such as acyclovir, a widely used nucleoside analogue, specifically target viral DNA polymerase and DNA elongation by undergoing phosphorylation from both viral and cellular kinases. Other antiviral agents, including penciclovir and foscarnet, operate similarly. However, the emergence of drug-resistant HSV strains due to these treatments highlights the urgent need for novel and effective anti-HSV medications (Huang et al., 2019 ). In this context, chitosan (CH), a linear cationic carbohydrate derived from chitin, presents a promising alternative. CH, or poly-α-(1,4)-2-amino-2-deoxy-β-D-glucan, is a hydrophilic polymer known for its non-toxic, non-allergenic, biocompatible, and biodegradable properties. The degree of deacetylation (DDA) is a critical parameter that differentiates chitin from CH, quantifying the amount of free amino groups present. CH can undergo modifications through both physiological and chemical reactions, resulting in derivatives with distinct properties and applications. While chemical methods for depolymerizing chitin and CH can yield limited products and require harsh conditions, enzymatic processes face challenges due to high costs and limited accessibility. CH and its derivatives, particularly those derived from marine sources, exhibit a wide range of biological activities (Boroumand et al., 2021 ; Cheung et al., 2015 ; Mustafa et al., 2020 ; Ngo & Kim, 2014 ; Szymańska et al., 2015; Wardani & Sudjarwo, 2018 ; Yadu Nath et al., 2017 ). Notably, the chemical modification of CH enhances its solubility and expands its biomedical applications. This study highlights the anticoagulant and antiviral properties of low molecular weight sulfated chitosan (LMW-SCH) derived from the gladius of L. duvauceli (IP No. 524634), suggesting its potential as a novel therapeutic agent against HSV. 2. RESULTS 2.1. Purification and Gamma- irradiation of SCH The 150 g of raw gladius from L. duvauceli yielded50 g of chitin. Upon deacetylating the chitin, 22 g of CH was produced. It was estimated that the gladius had 10 g of net yield of purified LMW-SCH [ Fig. 1 ]. Purified SCH samples from squid ( L. duvauceli ) were irradiated in a Gamma Chamber 5000 (Nordion International Co. Ltd, ON, Ottawa, Canada) for 3 hr at 4 k Gy and a set dose rate of 100Gy/s from a 60 Co source. The irradiator was calibrated using a Fricke dosimeter. 2.2. Elemental analysis of LMW-SCH The elemental composition of LMW-SCH was analysed and found to consist of carbon (41.4%), hydrogen (6.09%), nitrogen (4.85%), and sulphate (20.2%) [ Fig. 2 ] . 2.3. FT-IR spectroscopy of LMW-SCH FT-IR spectra of LMW-SCH purified from squid of L. duvauceli was obtained and compared with that of standard CH represented in the [ Fig. 3 ] . The frequency appeared at 3394 cm − 1 confirms the O-H stretching. The C-H stretch was observed within the region of 2952.47-2728.02 cm − 1 , indicating the presence of alkane and aldehyde functional groups. The peak recognized at 1458.66 cm − 1 signifies the N-H bend of primary amine and CO (amide). Also, moderate transmittance peak at 1371.56 cm − 1 indicated the CH 3 (amide). The peak at 1250.36 cm − 1 authorizes the existence of asymmetrical S = O vibration signal and COS stretching confirm the sulfation of LMWSC. C-N stretch peak was acquired at 1149 cm − 1 , it represents the amines of NGlc and NGlcAc. 2.4. NMR spectroscopy of LMW-SCH The LMW-SCH’s 1 H-NMR spectra were shown in [ Fig. 4 ] . The signal exhibited the anomeric hydrogen signal (H1) at = 4.63 ppm. The distinctive peak for the non-anomeric ring hydrogen (H2-H6) was represented by the broad signals that were seen in the region between = 2.9–3.8 ppm. At δ = 1.8 ppm, the N-acetyl methyl hydrogen signals (CH 3 ) became visible. The ring carbon signals were confirmed in the range between δ = 55 ˗100 ppm for the 13 C-NMR spectra of LMW-SCH. The -CO signal emerged at δ = 171.63 ppm and N-acetyl CH 3 at δ = 23.34 ppm [ Fig. 5 ] . The COSY spectrum may potentially be used to identify the assignment of each directly coupled proton (H1, H2, H3, H4, H5, and H6) in the glycopyranose moiety, as shown in Fig. 6 A. The HSQC spectrum was used to prepare an association between C1-H1, C2-H2, C3-H3, C4-H4, C5-H5, and C6-H6, as represented in Fig. 6 (A-B) . The task of assigning of 13 C chemical shifts from C-1 to C-6 was also completed. The HSQC spectrum could also be used to determine the chemical shift reassignment of the methyl CH 3 of the N-acetyl molecule. The DDA of the LMW-SCH has been determined to be 82.92%. 2.5. MALDI-TOF/ MS of LMW-SCH The purified LMM-SCH of L. duvauceli has a molecular weight of 813.339 Da and includes NAcGlc at the reducing ends. This structure enables straightforward fragmentation and subsequent polymerization. When squid-derived chitooligosaccharides are dissolved in water, they exhibit moderately intense quasi-molecular [M + Na] + ions and less intense [M + K] + ions during MS analysis. The identification and characterization of primary products, such as NGlc2, NGlc3-NGlcAc1, NGlc4-NGlcAc1, NGlc5-GlcNAc1, and NGlc8-GlcNAc2, were achieved using MALDI-TOF/MS [ Fig. 7 ] . It is worth noting that ionisation is compatible with both homopolymerization and heteropolymerization of NGlc and NAcGlc, which occur due to the equal cleavage of the LMW-SCH. 2.6. In silico prediction of LMW-SCH with HSV protein The linking of the LMW-SCH molecule to the HSV glycoprotein envelope proteins D and E. The Avogadro software generates the ligand structure. Supercomputer-supported molecular techniques were used to identify the binding sites of the receptors, and the Discovery studio was utilized to optimize their crystal structures [ Fig. 8 ] . Using AutoDock, the docking between the sulfated CH and the HSV glycoprotein receptors gD and gE was finished; the results are displayed in [ Figs. 9 , 10 , 11 & 12 ] , and Table 1 summarises the molecular binding properties. The molecular docking analysis revealed that the compound LMW-SCH exhibited varying binding affinities across the four target proteins. Among these, LMW-SCH showed the strongest binding with the 2F5U protein, demonstrated by the most binding energy of -4.41 Kcal/mol and the formation of ten hydrogen bonds involving residues such as GLY225, GLN226, and ARG227. This interaction also corresponded to a lower reference RMSDA value (7.166), suggesting better structural alignment. Conversely, the weakest interaction was observed with 1JMA, with a binding energy of -2.41 Kcal/mol and a higher inhibition constant of 17.09 mM, despite forming six hydrogen bonds. These results suggest that LMW-SCH may have higher affinity and specificity toward 2F5U, making it a potential target for further structural and functional studies. Table 1 Binding properties of HSV glycoprotein receptors Protein Compound Binding energy (Kcal/mol) Reference RMSDA Inhibition constant (mM) No. of H 2 bonds Residues involved in H 2 bond 2GIY SCH -3.18 56.037 4.6 4 Vel 224, Met 226, Trp 370, Glu 227 1JMA SCH -2.41 93.404 17.09 6 Arg 110, Glu 174, Asp 175, Asn 178, Leu 152, Ser 151 5MHJ SCH -2.42 15.80 16.81 4 ASP384, ALA385, GLU 386, ARG 460 2F5U SCH -4.41 7.166 589.73 10 GLY225, GLN226, ARG227, ALA301, GLY304, GLU370, ASP371, THR373, ASN 365, His364 2.7. Anticoagulant Activity of LMW-SCH The anticoagulant activity of LMW-SCH from L. duvauceli , was investigated in vitro by the APTT and PT tests. LMW-SCH affected human plasma coagulation. Despite the fact that LMW-SCH anticoagulant activities were weaker than those of heparin, APTT and PT were significantly ( P < 0.05 ) prolonged by using LMW-SCH at concentrations of 5, 10, 15, 20, 25 µl/ml and higher. The anticoagulant activity of LMW-SCH was found to be 1.93 IU/mg for PT and 6.96 IU/mg for APTT, which is lower than the standard heparin activity of approximately 200 IU/mg. This comparison highlights the relative efficacy of LMW-SCH in comparison to heparin. APTT prolongation indicates that the intrinsic and/or commonplace pathways have been inhibited, whereas PT prolongation indicates that SCH can also inhibit the extrinsic coagulation pathway. All measurements were taken in triplicate [ Fig. 13 ] . The 2F5U protein represents a segment of the HSV pUL25 protein and plays a pivotal role in maintaining the integrity of the viral capsid and facilitating DNA packaging. It is a component of the capsid-associated tegument complex and engages in interactions with other key structural proteins, including VP5 and VP26. These interactions are essential for the accurate assembly and stability of the capsid, ensuring the successful encapsulation of the viral genome during replication. 2.8. Cytotoxicity Assay of LMW-SCH In vitro cell viability study was used to assess the cytotoxic effects of LMW-SCH from L. duvauceli . The cytotoxicity of LMW-SCH against the HSV vero cells was evaluated using the MTT test. Vero cells were exposed to various doses of the compounds (25–200 µg/mL) for 48 hr, and the CC 50 values of cell viability were determined using an ELISA plate reader. The result shows that, in comparison to control and standard (Acycovir-PC), cells exposed to LMW-SCH demonstrated significant cell damage. Additionally, morphological changes such cell rounding, shrinkage, and lack of adherence to the surface were brought on by increasing the dose [ Fig. 14 ] . 2.9. Plague assay of LMW-SCH against HSV-1 HSV-1 was serially diluted in media until it reached 100 PFU (plaque forming unit) in 100 µl, then the viral suspension was introduced to Vero cells and cultured for 1 h at 37°C with the LMW-SCH from L. duvauceli , found to have a plaque-inhibitory effect against HSV-1. The cells were then exposed upto 200 µg/ml concentrations of LMW-SCH in DMEM media. The standard anti-viral drug used was acyclovir, which was utilized at a concentration of 20 µM. After three days, the plaques were seen using crystal violet staining. The results indicate that LMW-SCH (100 µg/ml) exhibited a significant ( P < 0.001 ) antiviral effect against HSV-1, reducing plaque formation when compared to acyclovir (20 µM), thereby providing a clearer context for its efficacy. According to the findings, L. duvauceli (55%) and LMW-SCH (100 µg/ml) had an antiviral impact and reduced plaque formation when compared to acyclovir (positive control-PC) therapy at a concentration of 20 µM [Fig. 15] . Dose-response assays were conducted to determine the CC 50 , EC 50 , and SI = CC 50 /EC 50 for LMW-SCH and PC. LMW-SCH exhibited a CC 50 of 100 µg/mL and an EC 50 of 200 µg/ml, yielding an SI of 0.5, while PC showed a selectivity index of 20. The results of each experiment were presented as ± mean standard deviation after being repeated three times. 2.10. Time-dependent inhibition LMW-SCH was added to the cultured cells at various times throughout the incubation process to assess its antiviral effectiveness against HSV-1. Each 24 well plate used in the experiment received 100 PFUs of the virus (HSV-1) for inoculation. In addition to being administered immediately after infection, the compounds were also added at 0, 3, 6, 12 and 24 hr later host pathogen interaction (HPI). L. duvauceli , LMW-SCH (100 µg/ml) inhibited more than 20 PFU/ml, the results were presented as mean ± standard deviation after each experiment was carried out three times.When the host cells were pre-treated with polysaccharides prior to infection, the tested drug candidates and acyclovir showed no effect on viral infection [ Fig. 16 ] . 2.11. Analysis of viral protein expression To ascertain the effect of LMW-SCH on HSV-1 gene expression, total RNA was extracted from the treated cells and subjected to RT-qPCR using particular primers as outlined in the protocols. ICP4, UL13, UL52, and UL30 are genes involved in the replication of the HSV-1 virus. In order to ascertain the compound’s effectiveness in the HSV replication cycle, the gene expression levels were assessed using the normalised reference gene β-actin and the 2-∆∆Ct method for the relative quantification RT‐qPCR. We discovered that LMW-SCH also reduced the transcription levels of these genes [ Fig. 17 ] . The immediate early genes ICP4, UL13, UL52, and UL30, all of which are necessary for the expression of early and late viral genes—had their transcription levels dramatically decreased by LMW-SCH. These findings imply that LMW-SCH suppresses immediate early gene expression, which in turn prevents HSV-1 reproduction. 2.12. Western blot analysis The anti-apoptotic protein expression was studied in control and experimental groups by western blot analysis. The cells were treated for 24 hr with 100 µg/ml doses of LMW-SCH in the range of the EC 50 value whereas the control samples contained DMSO. The expression of the four viral proteins (ICP4, UL13, UL52, and UL30) was reduced after treatment with LMW-SCH at a dose of 100 µg/ml. SDS-PAGE was used to separate total cellular proteins from lysed samples. TINA imaging analysis software (version 2.10, Raytest, Straubenhardt, Germany) was used to calculate the optical densitometry of western Blot band intensity relative to the housekeeping gene β-actin (Fig. 18 ). 3. DISCUSSION Marine organisms are a rich source of potentially bioactive chemicals with a wide range of biological functions as well as structurally diverse, unique chemical structures. Recently, there has been a great deal of interest in the bioactivity of naturally occurring bioactive chemicals that come from the marine environment. The most prevalent forms of polysaccharides are chitin and CH, which are derived from a variety of marine living organisms. Polysaccharides play an important role in living organisms, supplying energy to the cell and protecting the cell structure (De Borba Gurpilhares et al., 2018 ). Potential medical applications exist for the polysaccharides that are produced by marine bacteria and fungi or derived from marine plants and animal life. Examples of marine polysaccharides include agar, fucan, glucan, laminarin, carrageenan, glycosaminoglycans, cellulose, chitin, CH, and alginic acid; they possess anti-oxidative, immunostimulatory, anticoagulant, antibacterial, antiviral, and antitumor properties (Kang et al., 2015 ; Patel, 2012 ). Chitin and CH are naturally biodegradable and biocompatible biopolymers, hence they have extensive applications in biomedical, food, agricultural, and chemical industries. The potential applications of CH in the sectors of agriculture, food, and health are limited by its high molecular weight, which causes poor solubility at neutral pH and high-viscosity water solutions. However, considering they are harmless and biocompatible, water-soluble CH oligosaccharides and their derivatives can circumvent most of these limitations (Liaqat & Eltem, 2018 ). Moreover, chemical modification of CH further enhances and opens different ways to utilize CH and sulfated CH (Jiao et al., 2011 ; Xing et al., 2004 ). LMW-SCH isolated from squid has various biological activities like antioxidant, anticancer, anticoagulant, anti-hyperlipidaemic, antiviral, and antitumor activities. Sulfated polysaccharides are able to interact with various molecules and receptors—differentiation, cell development, cell-cell recognition, cell adhesion, and cell-cell interaction (Maia et al., 2016 ). The activity depends on several structural parameters like glycosidic linkages, conformation, molecular weight, and degree of sulfation (Caputo et al., 2013; Cunha & Grenha, 2016 ). They can be synthesized by attaching a sulfate and saccharide hydroxyl group. An important direction of sulfated modification becomes a structural modification of polysaccharides. The substitution group such as hydroxyl, carboxyl, or amino-terminal groups with sulfate groups is used to synthesize sulfated polysaccharides. The sulfate group plays an important role in bioactivities. The goal of the current work was to extract the LMW-SCH from the gladius of L. duvauceli , characterize it structurally, and investigate its physiochemical characteristics. The variations in seasonality, species, and geographic location were factors contributing to the disparity in the yield of LMW-SCH isolated from cephalopod waste. The yield of CH recovered from the cuttlebone of several cuttlefish species reflects the inherent characteristics of the mollusk, even though the variation is not very great. The elemental composition result was comparable to the findings of a previously published study by Vairamani et al. ( 2013 ) on the cuttlebone of CH, with carbon (41.4%), hydrogen (6.09%), nitrogen (4.85%), and sulfate (20.2%), respectively. The FT-IR spectrum showed the occurrence of sulfo groups at 810 and 1240 cm − 1 corresponding to COS and S = O stretches, which can be correlated to the peaks attained in the LMW-SCH. The bands corresponded to 580 ˗ 625 cm − 1 (SO 2 ) and 1060 cm − 1 (SO 2 ) attributed to the sulfo groups. The identified functional groups present in the LMW-SCH show fine concurrence with the outer shell of D. scortum , with peaks agreeing to C = O stretches, NH, OH, and sulfo groups (Subhapradha et al., 2013 ; Suwan et al., 2009 ). The outcomes are similar to that obtained by Zhang et al. ( 2010 ) who had reported the sulfation by the presence of IR peaks at 580, 610, 1014, and 1170 cm − 1 for the sulfated CH with a DS S of 0.86. The comprehensive evaluation of LMW-SCH using 1D and 2D-NMR signals is in perfect concordance with earlier findings. The sulfation signal found in the current analysis of the HSQC spectrum was consistent. Based on the Di Martino et al. ( 2005 ) report, source of CH and preparation process, DD may vary from 30–90%. In the present study, DD of the LMW-SCH was predicted from the NMR chemical comparable to the study of Zhang et al. ( 2010 ). Because of the differences in molecular mass and molecular weight distribution, polysaccharides have distinct physicochemical, rheological, and biological properties. LMW-SCH chito-oligosaccharides (COS) showed significant anti-inflammatory activity compared to medium and high molecular weight sulphated COS. Lopatin et al. ( 1995 ) have demonstrated that the hydrolysis of COS with acetic acid at reducing ends of sulphated COS displayed a subunit range between 447 to 1478 m/z. The tendency of the SCH to divide into NGlc and NGlcAc based on the hydrolysis induced by the acidic atmosphere and degree of DA. The present study suggest that extracted and structurally characterized LMW-SCH exhibits considerable yield, higher degree of deacetylation with lower molecular weight than the commercial CH. Glycoproteins are the key molecular targets for HSV. The HSV infection begins with the effective adherence of glycoprotein-D (gD) viral envelope to the cell surface receptor. These glycoproteins are soluble, truncated ectodomains of the herpesvirus cell receptor input mediator A (HveA). Glycoproteins D have a possible restriction of the local receptor called the gD receptor. The gD receptor binds to 6-O-sulfate CH. The structures reveal a V-shaped immunoglobulin (Ig) crease in the middle of the gD, which is surrounded by massive N- and C-terminal extensions and is clearly associated with cell attachment atoms. The adaptability of the N-terminal bar, the receptor adhering portion of gD, indicates that a conformational shift with a restriction can be a component of the viral entrance mechanism. The mutation in glycoprotein D (glD) is unable to infect the host by penetrating the host cell membrane (Spear et al., 2003). The anticoagulant capacity of SCH synthesised from D. scortum was reported to be 6.45 IU/mg and 1.73 IU/mg, respectively (Drozd et al., 2019 ; Subhapradha et al., 2013 ). Furthermore, the APTT and PT activities of SCH in S. pharaonis were slightly higher than the previously stated values of 6.96 and 1.93 IU/mg, respectively (Jayalakshmi, 2012 ). Similarly, the anticoagulant efficacy of SCH obtained from the squid D. singhalensis was revealed as 6.91 IU/mg (APTT) and 1.85 IU/mg (PT), as demonstrated by our previous research (Ramasamy et al., 2017 ). The current study results showed the anticoagulant activity of LMW-SCH from L. duvauceli , was investigated APTT and PT were significantly ( P > 0.05) extended at higher concentrations. In vitro cell viability study result shows that, in comparison to control and standard, cells exposed to LMW-SCH demonstrated prevented cell damage, morphological changes such cell rounding, shrinkage, and lack of adherence to the surface were brought on by increasing the dose. When the medications were administered to HSV-1 24 hr before infection, there was a significant decrease in the development of plaque in LMW-SCH. Infectivity was decreased by more than 90% at the highest non-cytotoxic concentrations of the examined polysaccharides. When acyclovir was administered during the replication period, it exhibited the strongest anti-viral activity, with a 98.6% reduction of viral replication. These findings indicated that, as had been previously demonstrated for plant-derived extracts and isolated compounds, the anti-HSV-1 activity of these macromolecules was directly achieved by interfering with virion envelope structures or hiding viral structures that are required for adsorption or entry into host cells (Astani et al., 2010 ; Schnitzler et al., 2008 ). LMW-SCH showed a CC 50 of 100 µg/mL and an EC 50 of 200 µg/mL, resulting in an SI of 0.5. ACV exhibited a CC 50 of approximately 200 µM and an EC 50 of around 2 µM (SI ≈ 100) as reported in the previous studies (Jin et al., 2015 ; Pourianfar et al., 2012 ), while our findings using 20 µM ACV showed an SI of approximately 20. The present study found that LMW-SCH inhibits the transcription of ICP4, UL13, UL52, and UL30, essential for viral DNA synthesis, compared to β-actin. Additionally, LMW-SCH reduces the transcription of the immediate early gene ICP47. These findings suggest that LMW-SCH disrupts viral protein synthesis by interfering with the transcription of immediate early genes. It was discovered that concurrent treatment with LMW-SCH at a concentration of 100 µg/ml decreased the expression of the four viral proteins. Meanwhile, it was demonstrated that the chemical treatment entirely stifled the expression of the HSV-1 viral proteins.HSV-1 causes tissue lesions and cellular damage by infecting the epithelium and starting lytic replication. Cellular RNA polymerase II transcribes HSV-1 genes in a highly controlled cascade with the help of cellular transcription factors. ICP0 and ICP4 are among the immediate early genes that are crucial for starting viral transcription as soon as the viral genome enters the host nucleus. Early genes, which are controlled by the immediate early genes, start to express 2 to 8 hr after infection. Early genes provide products that aid in the reproduction of viruses, whereas late genes typically produce structural proteins (Gillis et al., 2009 ). For viral DNA replication, HSV-1 genes including UL5, UL8, UL9, UL42, and UL52 are necessary. Huang et al. ( 2019 ) discovered that mitoxantrone dihydrochloride (MD) also reduced the transcription levels of several genes. ICP0, ICP22, ICP27, and ICP47 are immediate early genes that are also necessary for the development of late and early viral gene products. These genes had their transcription levels decreased by MD. Similarly, recent research has shown that LMW-SCH suppresses immediate early gene expression to prevent HSV-1 multiplication. A probable mechanism for the observed anti-HSV-1 activity of LMW-SCH from gladius rivets the inhibition of viral gene transcription. Particularly, we hypothesize that LMW-SCH interrupts the function of key HSV-1 transcriptional regulators, especially ICP4, which is crucial for the temporal cascade of viral gene expression. This interference may occur through direct interaction with ICP4, or indirectly via modulation of host cell signalling pathways that impact viral transcription. The present findings align with Huang et al. 6 , and Boroumand et al. ( 2021 ) they also described the HSV-1 infects sensory neurons during the latent phase and remains dormant in the nucleus until reactivation. Upon reactivation, HSV-1 triggers lytic replication, leading to cellular damage and tissue lesions, with transcription factors facilitating the viral gene expression cascade. To investigate this, the anti-HSV activity of LMW-SCH should be assessed using chromatin immunoprecipitation (ChIP) and reporter assays to evaluate its impact on ICP4 binding to viral promoters. These experiments will elucidate the molecular mechanisms by which LMW-SCH potentially inhibits HSV-1 gene expression at the transcriptional level. Limitation of the work LMW-SCH, a CH derivative from gladius, presents a unique antiviral mechanism that may target viral gene expression through transcriptional repression or epigenetic modulation. However, further studies are needed to determine HSV-1 RNA content, transfection and immunofluorescent techniques are required to confirm the specific mechanism of LMW-SCH against HSV-1. 4. CONCLUSION The study focused on the purification, freeze-drying, and modification of CH into low LMW-SCH derived from L. duvauceli . The purified LMW-SCH demonstrated increased anticoagulant activity at higher concentrations. In vitro experiments, including plaque reduction, cytotoxicity, and time-dependent inhibition assays, revealed that LMW-SCH exhibits significant resistance to HSV-1, with a CC 50 value of 100 µg/ml, EC50 value of 200 µg/ml and SI = 0.5. Gene and protein expression studies indicate that LMW-SCH effectively suppresses HSV-1 infection in vitro . While the findings suggest that LMW-SCH could be a valuable resource from cephalopods for the development of antiviral treatments against HSV-1, it is important to note that no in vivo studies have been conducted to confirm its clinical relevance. Additionally, the investigation regarding LMW-SCH having the “highest inhibitory effect” is deceptive, as it has not been compared to other antiviral agents in a standardized manner. Further studies are required to assess HSV-1 RNA content, and transfection along with immunofluorescent techniques is necessary to confirm the specific mechanism of LMW-SCH against HSV-1. 5. MATERIALS AND METHODS 5.1. Sample collection The samples ( L. duvauceli ), which contained squid gladius, were acquired at the Nagapattinam landing center located on the southeast coast of Tamil Nadu, India (Latitude 10.7607° N, Longitude 79.8500° E). The material was properly conserved, purified, dried naturally, and then converted into powder. The gladius powder was subsequently used for the extraction of chitin and CH. 5.2. Extraction, purification and of SCH The gladius powder was demineralized at room temperature (RT) in 1% HCl for 36 hr after deproteinization in 0.5 N NaOH for 16 hrs. After that, 50% NaOH deacetylated the isolated chitin for 2–3 hr, producing CH. Dichlorosulfonic acid sulfation and 4 hr of RT agitation followed. After filtering and purifying with an Amberlite IRA 900 column (Anionic-exchange resin), the mixture was dialyzed with a low molecular-weight dialysis membrane (2 kDa cut-off, Himedia, India) for 48 hr in PBS (pH 7.2), lyophilized as SCH, and stored at room temperature (Gomathy et al., 2021 ). 5.3. Gamma- irradiation of SCH 2 g of SCH was irradiated at 4 kGy/h in glass vials in the Gamma Chamber 5000. The radiation exposure levels for the samples ranged from 100 kGy to 140 kGy. The dosimetry rate was calibrated using Fricke dosimeters, and the exact exposure time was recorded to ensure accurate dosing (Chung et al., 2015 ). LMW-SCH was selected for further study. 5.4. Elemental analysis of SCH The elements such as carbon, hydrogen, nitrogen and sulfate contents of purified SCH’s were analyzed using an elemental analyzer CHN/O system (Perkin-Elmer’s Series II 2400, USA) (Chung et al., 2015 ). 5.5. FT-IR spectroscopy of LMW-SCH The purified compound was determined using an FT-IR spectrophotometer (Bruker alpha, 1800, USA) in the frequency range of 4000 to 500 cm -1 . 50 mg of the lyophilized, purified LMW-SCH was pressed into a disc of 1 mm using KBr pellet and impregnated to the sample slot and studied for FT-IR absorbance (Gomathy et al., 2021 ). The resultant spectrum was interpreted for the presence of functional groups with reference FT-IR absorption peak values in the NIST database 5.6. NMR spectroscopy of LMW-SCH 5.7. MALDI- TOF/MS The molecular weights of extracted SCH were also determined (UltrafleXtreme, Bruker Daltonics, Germany). MALDI-TOF/MS was used to conduct reflection-based investigations at 20 kV. An emission of 330 nm nitrogen 45 laser at 50 Hz powers the mass spectrometer. The sample was a 1:1 (v/v) matrix consisting extracted SCH (-cyano-4-hydroxycinnamic acid), and the external control was nonspecific CH (Ramachandran et al., 2022 ). 5.8. Molecular docking analysis of LMW- SCH The structure of LMW-SCH was drawn using the Avogadro software. The crystal structure of glycoprotein D and glycoprotein E [Protein Data Bank (PDB) code 1JMA, 2GIY, 5MHJ and 2F5U (Davood et al., 2009 ) of HSV has been used in this study. 5.9. Anticoagulant activity The anticoagulant activities of the synthesised polysaccharide LMW-SCH were determined using in vitro coagulation assays APTT and PT at concentrations ranging from 0.5 mg/ml. As a reference, sodium heparin (25,000 UI/5 ml) was used, and the evaluation was performed on the star analyzer. All blood suspensions were incubated for 30 min at 80 rpm at 37°C. By centrifuging at 2500 g for 15 min at 14°C, platelet-poor plasma (PPP) was obtained in compliance with the protocol for citrated plasma preparation for hemostaseological evaluation in preparation for ensuing coagulation tests (IHEC – II/0177/22/dated 4.4.2022). a. Activated partial thromboplastin time (APTT) assay 10 µl of LMW-SCH was combined with 90 µl of normal human plasma at 37°C for 3 min. After adding 100 ml of APTTT reagent and letting it sit at 37°C for 1 min, 20 mM CaCl 2 was added. The clotting time was recorded (Dhahri et al., 2020 ). b. Prothrombin time (PT) assay PT experiments were conducted by Dhahri et al ( 2020 ) combining 90 µl of citrated normal human plasma with 10 µl of LMW-SCH and incubating the mixture for 3 min at a temperature of 37°C. Following pre-incubation (10 min) at 37°C, 200 µl of PT test reagent was added, and the clotting time was recorded. c. Cytotoxicity assay The Vero cells from the kidney cell of African green monkey (King’s Institute, Guindy, Chennai) were propagated in EMEM medium containing Earle's salts, 10% heat-inactivated NBCS, 100 µg/ml streptomycin, 100 IU/ml penicillin, and 5 µg/ml amphotericin B in the presence of Earle’s salts. A humidified atmosphere with 5% CO 2 at 37°C was used to incubate vero cells, which were sub-cultured two times each week. LMW-SCH were dissolved in water at 500 µg/ml, sterilised using a Millipore membrane filter (0.22 µm), and stored at -80ºC until use. The cytotoxicity of LMW-SCH in Vero cells was measured using MTT assays. Vero cells in 96-well plates in 100 µl growth medium were cultivated overnight and exposed to various LMW-SCH concentrations for 48 hr. Acyclovir (20 µM) was used as a Positive control (PC). The CC 50 value was calculated, and the selectivity index (SI) was determined to assess the safety of LMW-SCH (Jin et al., 2015 ). d. Plague assay The infected vero cells were spun down at 13000 x g for 5 min after frozen and thawed 3 times. The supernatant was collected and treated to infect the cells for 12 hr. Then, the viral plaque formations were counted with the inverted microscope from the 2% of crystal violet solution-stained vero cells (Huang et al., 2019 ).Controls included DMSO and untreated virus controls. The SI was calculated using the formula: SI = CC 50 / EC 50 , where CC 50 represents the concentration of the compound that causes 50% cytotoxicity in host cells, and EC 50 denotes the concentration required to achieve 50% inhibition of viral replication (Jin et al., 2015 ; Pourianfar et al., 2012 ). e. Time of addition assay Cells treated with10 µl of HSV-1 suspension 1 × 10 4 were maintained with LMW-SCH for identifying the viral infection stage. The antiviral effect of LMW-SCH was calculated at different times of infection. The tested plates were maintained at 37°C, 5% CO 2 for 24 hr and the fresh media containing D-glucosamine (300 mM) was replaced with plates and placed in incubation for 48 hr. The cells were collected after incubation with the monolayers treated to freeze-thaw cycles. The time of addition was examined to measure the effect of LMW-SCH on ELISA plate reader (Pourianfar et al., 2012 ). f. RT-qPCR gene expression The total RNA from Vero cells were isolated based on Qiagen RNeasy mini kit. NanoDrop 2000c spectrophotometers (Thermo Fisher Scientific, USA) quantified RNA concentration. The cDNA was synthesized using the QuantiTect Reverse Transcription kit (Qiagen, Germany). The qRT-PCR used extracted RNA, antioxidant gene primers (Table 2 ) (ICP4, UL13, UL52, and UL30), and β-actin as an internal housekeeping gene. The qRT-PCR used the KAPA SYBR FAST one-step quantitative RT-PCR kit. Real-time cycling settings were initial activation (94°C, 5 min) and 40 cycling (denaturation-94℃ for 30 sec; annealing-60℃ for 20 sec and final extension-72℃ for 1 min). The ABI 7500 Fast RT- PCR System set up the experiment and recorded the threshold cycle value (Ct). β-actin expression was used for normalization to obtain the 2 − ΔCT values and fold change calculation. Table 2 The designed HSV-1 gene primers sequences Genes Forward Reverse β-actin CCCCATTGAGCACGGTATTG ATACATGGCAGGGGTGTTGA ICP4 CGGTGATGAAGGAGCTGCTGTTGC CTGATCACGCGGCTGCTGTACA UL13 ACGTCATACGCCAGGCCGT CAGCTGTCGCCGGACTTCG UL52 TGTCCGACCGTGAATTCATTAC TTGGGGTCCTGGGTCGTCA UL30 CATCACCGACCCGGAGAGGGAC GGGCCAGGCGCTTGTTGGTGTA g. Western blot analysis Centrifugation was performed for 1 min at 2000 rpm in order to extract the cellular pellet. The extracted pellet was then again suspended in a lysis solution (pH 7.4) that contained the following ingredients: a full protease inhibitor set, 20 mM Tris–HCl, 150 mM NaCl, 1% Triton X–100, 10% glycerol, 1 mM Na 3 PO4, 0.1 mM PMSF, and 25 mM β-glycerol-phosphate (Roche).After being re-suspended, the cell pellet was lysed on ice for 20 min and vortexed for 20 sec. Centrifuge cell lysates for 20 min at 13,000 rpm at 4°C. Western blot analysis was performed on the liquid part that was collected. An appropriate antibody was used to identify the proteins (Huang et al., 2019 ). While the control contained DMSO, the cells were treated for 24 hr with a 200 µg/ml dosage of LMW-SCH from gladius within the range of the EC 50 value. h. Statistical analyses The mean SD of duplicates is used to illustrate the costs of cell survival. All of the tests were carried out at least three times with the same results. ANOVA were used to assess significance ( P < 0.05 & P < 0.001 ) (GraphPad Prism software). Declarations The current study was done after approval from Institutional Human Ethical Committee of Chettinad Hospital and Research Institute, Kelambakkam, Tamil Nadu (IHEC – II/0177/22/dated 4.4.2022). Consent for publication Not applicable Competing Interest The authors have no conflicts of interest related to this study. Author's Contribution The research investigations were created by SR. The experiments were carried out by VN. The manuscript was written by VN, and it was revised and severely by SR. The final version for submission was read and approved by both authors. Funding The corresponding author is grateful for financial support from the Department of Biotechnology (DBT), Ministry of Science and Technology, Government of India (Grant no. BT/PR15676/AAQ/03/794/2016). Availability of Data and Materials The datasets used analyzed during the current study are available from the corresponding author on reasonable request. Acknowledgement The gamma irradiation assistance from Dr. Puspalata from WSCD, IGCAR, Kalpakkam and the NMR facilities from SAIF, IIT Madras are warmly acknowledged by the authors. References Astani, A., Reichling, J., & Schnitzler, P. (2010). Comparative study on the antiviral activity of selected monoterpenes derived from essential oils. Phytotherapy Research , 24 (5), 673–679. https://doi.org/10.1002/PTR.2955 Boroumand, H., Badie, F., Mazaheri, S., Seyedi, Z. S., Nahand, J. S., Nejati, M., Baghi, H. B., Abbasi-Kolli, M., Badehnoosh, B., Ghandali, M., Hamblin, M. R., & Mirzaei, H. (2021). Chitosan-based nanoparticles against viral infections. Frontiersin.OrgH Boroumand, F Badie, S Mazaheri, ZS Seyedi, JS Nahand, M Nejati, HB BaghiFrontiers in Cellular and Infection Microbiology, 2021•frontiersin.Org , 11 , 643953. https://doi.org/10.3389/FCIMB.2021.643953/FULL Caputo, H., Straub, J., Reviews, M. G.-C. S., & 2019, undefined. (2013). Design, synthesis, and biomedical applications of synthetic sulphated polysaccharides. Pubs.Rsc.OrgHE Caputo, JE Straub, MW GrinstaffChemical Society Reviews, 2019•pubs.Rsc.Org , 00 , 1–3. https://doi.org/10.1039/x0xx00000x Cheung, R., Ng, T., Wong, J., drugs, W. C.-M., & 2015, undefined. (2015). Chitosan: an update on potential biomedical and pharmaceutical applications. Mdpi.ComRCF Cheung, TB Ng, JH Wong, WY ChanMarine Drugs, 2015•mdpi.Com , 13 , 5156–5186. https://doi.org/10.3390/md13085156 Chung, K. H., Othman, Z., & Lee, J. S. (2015). Gamma irradiation of corn starches with different amylose-to-amylopectin ratio. Springer , 52 (10), 6218–6229. https://doi.org/10.1007/S13197-014-1700-4 Crute, J. J., Tsurumi, T., Zhu, L., Weller, S. K., Olivo, P. D., Challberg, M. D., Mocarski, E. S., & Lehman, I. R. (1989). Herpes simplex virus 1 helicase-primase: a complex of three herpes-encoded gene products. Pnas.OrgJJ Crute, T TsURUMI, LA Zhu, SK Weller, PD Olivo, MD Challberg, ES Mocarski, IR LehmanProceedings of the National Academy of Sciences, 1989•pnas.Org , 86 (7), 2186–2189. https://doi.org/10.1073/PNAS.86.7.2186 Cunha, L., & Grenha, A. (2016). Sulfated seaweed polysaccharides as multifunctional materials in drug delivery applications. In Marine Drugs (Vol. 14, Issue 3). https://doi.org/10.3390/md14030042 Davood, A., Nematollahi, A. R., Iman, M., & Shafiee, A. (2009). Synthesis and docking studies of new 1, 4-dihydropyridines containing 4-(5)-chloro-2-ethyl-5-(4)-imidazolyl substituent as novel calcium channel agonist. SpringerA Davood, A Nematollahi, M Iman, A ShafieeArchives of Pharmacal Research, 2009•Springer , 32 (4), 481–487. https://doi.org/10.1007/S12272-009-1401-0 De Borba Gurpilhares, D., Paes Cinelli, L., Kato Simas, N., Pessoa, A. D., & Durães Sette, L. (2018). Marine prebiotics: Polysaccharides and oligosaccharides obtained by using microbial enzymes. ElsevierD de Borba Gurpilhares, LP Cinelli, NK Simas, A Pessoa Jr, LD SetteFood Chemistry, 2019•Elsevier . https://doi.org/10.1016/j.foodchem.2018.12.023 Dhahri, M., Sioud, S., Dridi, R., Hassine, M., Boughattas, N. A., Almulhim, F., Al Talla, Z., Jaremko, M., & Emwas, A. H. M. (2020). Extraction, Characterization, and Anticoagulant Activity of a Sulfated Polysaccharide from Bursatella leachii Viscera. ACS PublicationsM Dhahri, S Sioud, R Dridi, M Hassine, NA Boughattas, F Almulhim, Z Al Talla, M JaremkoACS Omega, 2020•ACS Publications , 5 (24), 14786–14795. https://doi.org/10.1021/ACSOMEGA.0C01724 Di Martino, A., Sittinger, M., & Risbud, M. V. (2005). Chitosan: a versatile biopolymer for orthopaedic tissue-engineering. Biomaterials , 26 (30), 5983–5990. Dolin, R., Gill, F. A., & Nahmias, A. J. (1975). Genital herpes simplex virus type 1 infection—variability in modes of spread. Journal of the American Venereal Disease Association , 2 (2), 13–16. https://journals.lww.com/stdjournal/abstract/1975/12000/genital_herpes_simplex_virus_type_1.3.aspx Drozd, N. N., Logvinova, Y. S., Shagdarova, B. T., Il’ina, A. V., & Varlamov, V. P. (2019). Analysis of the Action of Quaternized Chitosans with Different Molecular Weight on Anticoagulant Activity of Heparins In Vitro. SpringerNN Drozd, YS Logvinova, BT Shagdarova, AV Il’ina, VP VarlamovBulletin of Experimental Biology and Medicine, 2019•Springer , 167 (2), 279–283. https://doi.org/10.1007/S10517-019-04509-W Everett, R. D. (2000). ICP0, a regulator of herpes simplex virus during lytic and latent infection. Bioessays , 22 (8), 761–770. Gilbert, M., Li, X., Petric, M., Krajden, M., Isaac-Renton, J. L., Ogilvie, G., & Rekart, M. L. (2011). Using centralized laboratory data to monitor trends in herpes simplex virus type 1 and 2 infection in British Columbia and the changing etiology of genital herpes. SpringerM Gilbert, X Li, M Petric, M Krajden, JL Isaac-Renton, G Ogilvie, ML RekartCanadian Journal of Public Health, 2011•Springer , 102 (3), 225–229. https://doi.org/10.1007/BF03404902 Gillis, P., Okagaki, L., virology, S. R.-J. of, & 2009, undefined. (2009). Herpes simplex virus type 1 ICP27 induces p38 mitogen-activated protein kinase signaling and apoptosis in HeLa cells. Journals.Asm.OrgPA Gillis, LH Okagaki, SA RiceJournal of Virology, 2009•journals.Asm.Org , 83 (4), 1767–1777. https://doi.org/10.1128/JVI.01944-08 Gomathy, V., Manigandan, V., Vignesh, N., Thabitha, A., & Saravanan, R. (2021). Evaluation of antibacterial, teratogenicity and antibiofilm effect of sulfated chitosans extracted from marine waste against microorganism. Journals.Sagepub.ComV Gomathy, V Manigandan, N Vignesh, A Thabitha, R SaravananJournal of Bioactive and Compatible Polymers, 2021•journals.Sagepub.Com , 36 (3), 249–258. https://doi.org/10.1177/08839115211014225 Hamroush, A., & Welch, J. (2014). Herpes Simplex epithelial keratitis associated with daily disposable contact lens wear. Contact Lens and Anterior Eye , 37 (3), 228–229. https://doi.org/10.1016/J.CLAE.2013.11.007 Huang, Q., Hou, J., Yang, P., Yan, J., Yu, X., Zhuo, Y., He, S., & Xu, F. (2019). Antiviral activity of mitoxantrone dihydrochloride against human herpes simplex virus mediated by suppression of the viral immediate early genes. SpringerQ Huang, J Hou, P Yang, J Yan, X Yu, Y Zhuo, S He, F XuBMC Microbiology, 2019•Springer , 19 (1). https://doi.org/10.1186/S12866-019-1639-8 James, C., Harfouche, M., Welton, N. J., Turner, K. M. E., Abu-Raddad, L. J., Gottlieb, S. L., & Looker, K. J. (2020). Herpes simplex virus: Global infection prevalence and incidence estimates, 2016. Bulletin of the World Health Organization , 98 (5), 315–329. https://doi.org/10.2471/BLT.19.237149 Jayalakshmi, P. (2012). Studies on morphometry, biochemical composition, collagen, chitin and chitosan derivatives from Sepia pharonis (Ehrenberg, 1831) from Pudhucerry Coast . Ph. D., Thesis, Annamalai University. Jiao, G., Yu, G., Zhang, J., & Ewart, H. S. (2011). Chemical structures and bioactivities of sulfated polysaccharides from marine algae. Marine Drugs , 9 (2), 196–233. https://doi.org/10.3390/md9020196 Jin, F., Zhuo, C., He, Z., Wang, H., Liu, W., Zhang, R., & Wang, Y. (2015). Anti-herpes simplex virus activity of polysaccharides from Eucheuma gelatinae. Springer , 31 (3), 453–460. https://doi.org/10.1007/S11274-015-1798-1 Kang, H. K., Seo, C. H., & Park, Y. (2015). The effects of marine carbohydrates and glycosylated compounds on human health. In International Journal of Molecular Sciences (Vol. 16, Issue 3, pp. 6018–6056). https://doi.org/10.3390/ijms16036018 Liaqat, F., & Eltem, R. (2018). Chitooligosaccharides and their biological activities: A comprehensive review. In Carbohydrate Polymers (Vol. 184, pp. 243–259). https://doi.org/10.1016/j.carbpol.2017.12.067 Lopatin, S. A., Ilyin, M. M., Pustobaev, V. N., Bezchetnikova, Z. A., Varlamov, V. P., & Davankov, V. A. (1995). Mass-spectrometric analysis of N-acetylchitooligosaccharides prepared through enzymatic hydrolysis of chitosan. Analytical Biochemistry , 227 (2), 285–288. https://doi.org/10.1006/abio.1995.1282 Maia, L. F., Gonzaga, T. A., Carvalho, R. G., Leite, C. M., Lobo-Hajdu, G., Aguiar, J. A. K., Edwards, H. G. M., & de Oliveira, L. F. C. (2016). Monitoring of sulfated polysaccharide content in marine sponges by Raman spectroscopy. Vibrational Spectroscopy , 87 , 149–156. https://doi.org/10.1016/j.vibspec.2016.10.002 Mustafa, A., Cadar, E., & Sîrbu, R. (2020). Pharmaceutical uses of chitosan in the medical field. European Journal of Medicine and Natural Sciences , 3 (2), 31–36. Ngo, D. H., & Kim, S. K. (2014). Antioxidant effects of chitin, chitosan, and their derivatives. In Advances in Food and Nutrition Research (Vol. 73, pp. 15–31). https://doi.org/10.1016/B978-0-12-800268-1.00002-0 Patel, S. (2012). Therapeutic importance of sulfated polysaccharides from seaweeds: updating the recent findings. 3 Biotech , 2 (3), 171–185. Pourianfar, H. R., Poh, C. L., Fecondo, J., & Grollo, L. (2012). In vitro evaluation of the antiviral activity of heparan sulfate mimetic compounds against Enterovirus 71. Virus Research , 169 (1), 22–29. https://doi.org/10.1016/j.virusres.2012.06.025 Rabinstein, A. A. (2017). Herpes virus encephalitis in adults: current knowledge and old myths. Neurologic Clinics , 35 (4), 695–705. Ramachandran, S., Narasimman, V., & Rajesh, P. (2022). Low molecular weight sulfated chitosan isolation, characterization and anti-tuberculosis activity derived from Sepioteuthis lessoniana. International Journal of Biological Macromolecules , 206 , 29–39. https://doi.org/10.1016/j.ijbiomac.2022.02.121 Ramasamy, P., Subhapradha, N., Thinesh, T., Selvin, J., Selvan, K. M., Shanmugam, V., & Shanmugam, A. (2017). Characterization of bioactive chitosan and sulfated chitosan from Doryteuthis singhalensis (Ortmann, 1891). International Journal of Biological Macromolecules , 99 , 682–691. https://doi.org/10.1016/j.ijbiomac.2017.03.041 Schnitzler, P., Schneider, S., Stintzing, F. C., Carle, R., & Reichling, J. (2008). Efficacy of an aqueous Pelargonium sidoides extract against herpesvirus. Phytomedicine , 15 (12), 1108–1116. https://doi.org/10.1016/j.phymed.2008.06.009 Spear, P., virology, R. L.-J. of, & 2003, undefined. (2003). Herpesvirus entry: an update. Journals.Asm.OrgPG Spear, R LongneckerJournal of Virology, 2003•journals.Asm.Org , 77 (19), 10179–10185. https://doi.org/10.1128/JVI.77.19.10179-10185.2003 Subhapradha, N., Ramasamy, P., Shanmugam, V., Madeswaran, P., Srinivasan, A., & Shanmugam, A. (2013). Physicochemical characterisation of β-chitosan from Sepioteuthis lessoniana gladius. Food Chemistry , 141 (2), 907–913. https://doi.org/10.1016/j.foodchem.2013.03.098 Suwan, J., Zhang, Z., Li, B., Vongchan, P., Meepowpan, P., Zhang, F., Mousa, S. A., Mousa, S., Premanode, B., Kongtawelert, P., & Linhardt, R. J. (2009). Sulfonation of papain-treated chitosan and its mechanism for anticoagulant activity. Carbohydrate Research , 344 (10), 1190–1196. https://doi.org/10.1016/j.carres.2009.04.016 Szymańska, E., drugs, K. W.-M., & 2015, undefined. (2015). Stability of chitosan—a challenge for pharmaceutical and biomedical applications. Mdpi.ComE Szymańska, K WinnickaMarine Drugs, 2015•mdpi.Com , 13 , 1819–1846. https://doi.org/10.3390/md13041819 Vairamani, S., Subhapradha, N., Ramasamy, P., Raveendran, S., Srinivasan, A., & Shanmugam, A. (2013). Physicochemical characteristics and antioxidant efficacy of chitosan from the internal shell of spineless cuttlefish Sepiella inermis. Taylor & Francis , 43 (7), 696–716. https://doi.org/10.1080/10826068.2013.773339 Wardani, G., & Sudjarwo, S. A. (2018). In vitro antibacterial activity of chitosan nanoparticles against Mycobacterium tuberculosis. Pharmacognosy Journal , 10 (1). Watson, R. J., & Clements, J. B. (1980). A herpes simplex virus type 1 function continuously required for early and late virus RNA synthesis. Nature , 285 (5763), 329–330. https://doi.org/10.1038/285329a0 Weller, S. K., & Coen, D. M. (2012). Herpes simplex viruses: Mechanisms of DNA replication. Cold Spring Harbor Perspectives in Biology , 4 (9). https://doi.org/10.1101/cshperspect.a013011 Xing, R., Liu, S., Yu, H., Zhang, Q., Li, Z., & Li, P. (2004). Preparation of low-molecular-weight and high-sulfate-content chitosans under microwave radiation and their potential antioxidant activity in vitro. Carbohydrate Research , 339 (15), 2515–2519. https://doi.org/10.1016/j.carres.2004.08.013 Yadu Nath, V., Raghvendra Kumar, M., Aswathy, V., Parvathy, P., Sunija, S., Neelakandan, M., Nitheesha, S., & Vishnu, K. (2017). Chitosan as promising materials for biomedical application: review. Res. Dev. Mater. Sci , 2 , 2576–8840. Zhang, K., Helm, J., Peschel, D., Gruner, M., Groth, T., & Fischer, S. (2010). NMR and FT Raman characterisation of regioselectively sulfated chitosan regarding the distribution of sulfate groups and the degree of substitution. Polymer , 51 (21), 4698–4705. https://doi.org/10.1016/j.polymer.2010.08.034 Patent Saravanan R, Vignesh N, Kumar Ebenezer K (2024) A process for extraction of low molecular weight sulfated chitosan from cephalopod waste Patent 5,24,634, 13 March.2024. Supplementary Files LMWSCH.HSV.Suplementaryfile.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6715411","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":468375127,"identity":"6a886a02-0605-4268-b0c0-130d9ecc5d78","order_by":0,"name":"Vignesh Narasimman","email":"","orcid":"","institution":"Chettinad Academy of Research and Education: Chettinad Hospital and Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Vignesh","middleName":"","lastName":"Narasimman","suffix":""},{"id":468375128,"identity":"36961f66-ba5f-44c1-afc1-33c379bec8bc","order_by":1,"name":"Saravanan Ramachandran","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzElEQVRIiWNgGAWjYFAD9gYGZhK18BwgWYtEApFa5NvPPvxcwHAn31zyjeHnggobBv727gS8WgzOpBtLz2B4Zrlzdg6QcSaNQeLM2Q34tTCkMUjzMBw2MLidYyDN23aYwUAiF78W+f5nzL/BWm6eMf5NlBaGG2lsEFtu8JgRZ4vBjWds1jwMzwwse9LKrHnOpPEQ9It8fxrzbR6GOwbm7Ic33+apsJHjb+8l4DAQYPx3ABgOHAYgNg9h5RAA0sL+gFjVo2AUjIJRMMIAAJwUQKMyDTwsAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-8708-9807","institution":"Chettinad Academy of Research and Education: Chettinad Hospital and Research Institute","correspondingAuthor":true,"prefix":"","firstName":"Saravanan","middleName":"","lastName":"Ramachandran","suffix":""}],"badges":[],"createdAt":"2025-05-21 10:17:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6715411/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6715411/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":84337813,"identity":"1e2debb9-5368-47ed-ba93-f1483be47ef5","added_by":"auto","created_at":"2025-06-10 18:02:38","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":255358,"visible":true,"origin":"","legend":"\u003cp\u003eThe taxonomy of\u003cem\u003e L. duvauceli\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/d51d1235885fbd6a3f8885ac.png"},{"id":84337512,"identity":"958bc8ff-1862-40cc-951f-305c96f0a215","added_by":"auto","created_at":"2025-06-10 17:54:38","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":25666,"visible":true,"origin":"","legend":"\u003cp\u003eElemental analysis of GIR-SCH\u003c/p\u003e","description":"","filename":"image2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/70a10a7a1307e59e780a926e.jpeg"},{"id":84337514,"identity":"b24cdda0-6b3b-49a1-b529-06c71cda2390","added_by":"auto","created_at":"2025-06-10 17:54:38","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":106166,"visible":true,"origin":"","legend":"\u003cp\u003eFT-IR spectrum of standard CH and LMW-SCH from \u003cem\u003eL. duvauceli\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/765160438f74e274f414562c.png"},{"id":84337820,"identity":"b1007007-f6e7-46fb-b774-11a966785222","added_by":"auto","created_at":"2025-06-10 18:02:38","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":28959,"visible":true,"origin":"","legend":"\u003cp\u003e\u003csup\u003e1\u003c/sup\u003eH-NMR spectrum of SC LMW-SCH from \u003cem\u003eL. duvauceli\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/cbecf94339776525bf717211.png"},{"id":84337516,"identity":"52be1722-0047-48ce-a5c0-0eed8b77204b","added_by":"auto","created_at":"2025-06-10 17:54:38","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":67697,"visible":true,"origin":"","legend":"\u003cp\u003e\u003csup\u003e13\u003c/sup\u003eC-NMR spectrum of SC LMW-SCH from \u003cem\u003eL. duvauceli\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/38f999b9de51fa5169103750.png"},{"id":84337523,"identity":"7094b2e8-f9c2-422c-8fed-17c029b4a771","added_by":"auto","created_at":"2025-06-10 17:54:38","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":161176,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(A-B) \u003c/strong\u003eCOSY, 2D-HSQC spectrums of LMW-SCH from \u003cem\u003eL. duvauceli\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/30015b5155951011a74543cc.png"},{"id":84337816,"identity":"810048a4-6f9e-4916-b973-aee5b21f60ee","added_by":"auto","created_at":"2025-06-10 18:02:38","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":61548,"visible":true,"origin":"","legend":"\u003cp\u003eMALDI-TOF/MS of LMW-SCH from \u003cem\u003eL. duvauceli\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/be4e82558e78fe395538d132.png"},{"id":84337520,"identity":"62943863-fa23-4fe2-a678-f0bac82a1622","added_by":"auto","created_at":"2025-06-10 17:54:38","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":101247,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Crystal structure of the HSV glycoprotein D bound to the cellular receptor hvea/hvem, (B) sulfated chitosan, crystal structure of the 2GIY (C), 2F5U (D) \u003cbr\u003e\n\u0026amp; 5MHJ(E).\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/b1914c39022e6fb9fcea8431.png"},{"id":84337525,"identity":"ba2cad8f-c75e-4d3f-b733-6f0ef5e80c16","added_by":"auto","created_at":"2025-06-10 17:54:38","extension":"jpeg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":133362,"visible":true,"origin":"","legend":"\u003cp\u003eDocking analysis of LMW-SCH bind with 2GIY protein\u003c/p\u003e","description":"","filename":"image9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/35a831dce6dbb91e40bdc809.jpeg"},{"id":84337814,"identity":"cc3740c3-b11a-4fa9-97c8-cc51033b5902","added_by":"auto","created_at":"2025-06-10 18:02:38","extension":"jpeg","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":100410,"visible":true,"origin":"","legend":"\u003cp\u003eDocking analysis of LMW-SCH bind with 1JMA protein\u003c/p\u003e","description":"","filename":"image10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/f59fbd1f5177a053fae2c46c.jpeg"},{"id":84338923,"identity":"8f4ffa9a-a1b7-4754-81ab-354d5d56dcbd","added_by":"auto","created_at":"2025-06-10 18:10:38","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":127835,"visible":true,"origin":"","legend":"\u003cp\u003eDocking analysis of LMW-SCH bind with 5MHJ protein\u003c/p\u003e","description":"","filename":"image11.png","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/55cc14ad2328c762d6c046ad.png"},{"id":84337547,"identity":"6e6a4d5d-0ea5-44a0-951b-1d12bce503b5","added_by":"auto","created_at":"2025-06-10 17:54:38","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":132360,"visible":true,"origin":"","legend":"\u003cp\u003eDocking analysis of LMW-SCH bind with 5MHJ protein\u003c/p\u003e","description":"","filename":"image12.png","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/dfcfe74e7f23dc6d8c2cef3b.png"},{"id":84337818,"identity":"a3187626-5fed-4674-b83f-19a5447fd49f","added_by":"auto","created_at":"2025-06-10 18:02:38","extension":"png","order_by":13,"title":"Figure 13","display":"","copyAsset":false,"role":"figure","size":37539,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(A\u0026amp;B) \u003c/strong\u003eAPTT \u0026amp; PT activities of LMW-SCH\u003c/p\u003e","description":"","filename":"image13.png","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/0c43d931e0ae44ccf24df1e1.png"},{"id":84340780,"identity":"29800017-8a40-473b-b3f6-5344a8018a33","added_by":"auto","created_at":"2025-06-10 18:26:38","extension":"png","order_by":14,"title":"Figure 14","display":"","copyAsset":false,"role":"figure","size":131761,"visible":true,"origin":"","legend":"\u003cp\u003eT Cytotoxicity and morphological change of HSV-1 infected vero cells were treated with LMW-SCH from squid waste [*\u003csup\u003e\u0026amp;\u003c/sup\u003e**P\u0026lt;0.05; ***P\u0026lt;0.001]\u003c/p\u003e","description":"","filename":"image14.png","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/5a059d8d9bd9c000b1f9dc55.png"},{"id":84337824,"identity":"46b58964-5dc7-4cdf-a1f4-7b5ac965bb2d","added_by":"auto","created_at":"2025-06-10 18:02:38","extension":"png","order_by":15,"title":"Figure 15","display":"","copyAsset":false,"role":"figure","size":15539,"visible":true,"origin":"","legend":"\u003cp\u003ePlague assay of LMW-SCH against HSV-1\u003c/p\u003e\n\u003cp\u003e[*\u003csup\u003e\u0026amp;\u003c/sup\u003e**P\u0026lt;0.05; ***P\u0026lt;0.001; ns- not significant]\u003c/p\u003e","description":"","filename":"image15.png","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/f5761b50b3ad5543109bece0.png"},{"id":84338926,"identity":"f6b75de4-ed8f-41c2-9b9f-e657b64aae21","added_by":"auto","created_at":"2025-06-10 18:10:38","extension":"png","order_by":16,"title":"Figure 16","display":"","copyAsset":false,"role":"figure","size":39669,"visible":true,"origin":"","legend":"\u003cp\u003eInhibition pattern of HSV-1 infection by addition of LMW-SCH.\u003c/p\u003e","description":"","filename":"image16.png","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/e60cb733ed0e9eed1a35ec39.png"},{"id":84338928,"identity":"579f6893-1374-4a68-91a1-d1b486cced29","added_by":"auto","created_at":"2025-06-10 18:10:38","extension":"png","order_by":17,"title":"Figure 17","display":"","copyAsset":false,"role":"figure","size":10549,"visible":true,"origin":"","legend":"\u003cp\u003eq RT-PCR gene expression of viral protein\u003c/p\u003e","description":"","filename":"image17.png","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/58b1069ba49baaf50094b4c8.png"},{"id":84337550,"identity":"28da6f8f-c3c1-4b4b-a000-1dad5dbe07f8","added_by":"auto","created_at":"2025-06-10 17:54:38","extension":"png","order_by":18,"title":"Figure 18","display":"","copyAsset":false,"role":"figure","size":70935,"visible":true,"origin":"","legend":"\u003cp\u003eWestern blot analysis\u003c/p\u003e","description":"","filename":"image18.png","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/0df69c6df1de3ca2dd3f5ac8.png"},{"id":88384856,"identity":"a1d4eeac-a30a-4ffe-8db8-198f728c3e4f","added_by":"auto","created_at":"2025-08-06 02:37:39","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2754361,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/ec130f6e-bce7-4851-9f73-562db6b73dc6.pdf"},{"id":84340781,"identity":"e2e429d5-f7f1-44b5-962d-4627fa9d5e7f","added_by":"auto","created_at":"2025-06-10 18:26:38","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":187846,"visible":true,"origin":"","legend":"","description":"","filename":"LMWSCH.HSV.Suplementaryfile.docx","url":"https://assets-eu.researchsquare.com/files/rs-6715411/v1/f4101ac3f85748e098a8a6fc.docx"}],"financialInterests":"","formattedTitle":"In vitro anticoagulant and antiviral properties of low molecular weight sulfated chitosan from Loligo duvauceli against herpes simplex virus","fulltext":[{"header":"1. INTRODUCTION","content":"\u003cp\u003eThe herpes simplex virus (HSV) is a significant human pathogen that causes a variety of clinical manifestations, including lesions of the lips and tongue, keratitis, and encephalitis (Dolin et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e1975\u003c/span\u003e; Gilbert et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Hamroush \u0026amp; Welch, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Rabinstein, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). According to recent estimates, approximately 3.75\u0026nbsp;billion people globally (66.6% of individuals aged 0\u0026ndash;49 years) are infected with HSV-1, while about 491.5\u0026nbsp;million people (13.2% of the population aged 15\u0026ndash;49 years) are living with HSV-2 infection. The prevalence of these infections varies significantly by age, sex, and geographical region, with HSV-2 being more prevalent among women and in the WHO African Region (James et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). After initial infection, HSV often remains dormant in sensory neurons for the host's lifetime, with the potential for reactivation leading to recurrent diseases. HSV is classified into two serotypes: type 1 (HSV-1) and type 2 (HSV-2). HSV-1 is primarily responsible for oral herpes labialis, commonly known as cold sores, and can also cause genital herpes. The viral particles consist of a double-stranded DNA molecule and an icosahedral capsid, both surrounded by an amorphous tegument and an envelope containing specific antiviral glycoproteins (Huang et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThese viral proteins are crucial for the replication process of HSV. Key proteins involved in viral DNA synthesis include UL5, UL8, UL30, UL42, and UL52 (Crute et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e1989\u003c/span\u003e; Weller \u0026amp; Coen, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2012\u003c/span\u003e)\u003csup\u003e,\u003c/sup\u003e which participate in helicase activity and DNA polymerase function. Additionally, ICP8 binds to single-stranded DNA and recruits other replication factors for efficient DNA replication. The DNA polymerase is composed of the UL30 and UL42 subunits, while the helicase-primase complex consists of the UL5, UL8, and UL52 subunits. HSV gene expression occurs in a sequential manner, divided into three phases: immediate early (IE), early, and late. The immediate early phase includes five critical genes: ICP0, ICP4, ICP22, ICP27, and ICP47. The importance of these IE genes in early gene expression, necessary for viral DNA replication, is underscored by findings that demonstrate the profound impact of deleting either ICP4 or ICP27 on the regulation of early and late viral genes (Everett, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Watson \u0026amp; Clements, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e1980\u003c/span\u003e). Consequently, inhibiting these crucial IE genes significantly impedes viral replication. Current antiviral treatments, such as acyclovir, a widely used nucleoside analogue, specifically target viral DNA polymerase and DNA elongation by undergoing phosphorylation from both viral and cellular kinases. Other antiviral agents, including penciclovir and foscarnet, operate similarly. However, the emergence of drug-resistant HSV strains due to these treatments highlights the urgent need for novel and effective anti-HSV medications (Huang et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this context, chitosan (CH), a linear cationic carbohydrate derived from chitin, presents a promising alternative. CH, or poly-α-(1,4)-2-amino-2-deoxy-β-D-glucan, is a hydrophilic polymer known for its non-toxic, non-allergenic, biocompatible, and biodegradable properties. The degree of deacetylation (DDA) is a critical parameter that differentiates chitin from CH, quantifying the amount of free amino groups present. CH can undergo modifications through both physiological and chemical reactions, resulting in derivatives with distinct properties and applications. While chemical methods for depolymerizing chitin and CH can yield limited products and require harsh conditions, enzymatic processes face challenges due to high costs and limited accessibility. CH and its derivatives, particularly those derived from marine sources, exhibit a wide range of biological activities (Boroumand et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Cheung et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Mustafa et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Ngo \u0026amp; Kim, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Szymańska et al., 2015; Wardani \u0026amp; Sudjarwo, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Yadu Nath et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Notably, the chemical modification of CH enhances its solubility and expands its biomedical applications. This study highlights the anticoagulant and antiviral properties of low molecular weight sulfated chitosan (LMW-SCH) derived from the gladius of \u003cem\u003eL. duvauceli\u003c/em\u003e (IP No. 524634), suggesting its potential as a novel therapeutic agent against HSV.\u003c/p\u003e"},{"header":"2. RESULTS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003e2.1. Purification and Gamma- irradiation of SCH\u003c/h2\u003e\n \u003cp\u003eThe 150 g of raw gladius from \u003cem\u003eL. duvauceli\u003c/em\u003e yielded50 g of chitin. Upon deacetylating the chitin, 22 g of CH was produced. It was estimated that the gladius had 10 g of net yield of purified LMW-SCH \u003cstrong\u003e[\u003c/strong\u003eFig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e\u003cstrong\u003e].\u003c/strong\u003e Purified SCH samples from squid (\u003cem\u003eL. duvauceli\u003c/em\u003e) were irradiated in a Gamma Chamber 5000 (Nordion International Co. Ltd, ON, Ottawa, Canada) for 3 hr at 4 k Gy and a set dose rate of 100Gy/s from a \u003csup\u003e60\u003c/sup\u003eCo source. The irradiator was calibrated using a Fricke dosimeter.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003e2.2. Elemental analysis of LMW-SCH\u003c/h2\u003e\n \u003cp\u003eThe elemental composition of LMW-SCH was analysed and found to consist of carbon (41.4%), hydrogen (6.09%), nitrogen (4.85%), and sulphate (20.2%) \u003cstrong\u003e[\u003c/strong\u003eFig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e\u003cstrong\u003e]\u003c/strong\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003e2.3. FT-IR spectroscopy of LMW-SCH\u003c/h2\u003e\n \u003cp\u003eFT-IR spectra of LMW-SCH purified from squid of \u003cem\u003eL. duvauceli\u003c/em\u003e was obtained and compared with that of standard CH represented in the \u003cstrong\u003e[\u003c/strong\u003eFig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e\u003cstrong\u003e]\u003c/strong\u003e. The frequency appeared at 3394 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e confirms the O-H stretching. The C-H stretch was observed within the region of 2952.47-2728.02 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, indicating the presence of alkane and aldehyde functional groups. The peak recognized at 1458.66 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e signifies the N-H bend of primary amine and CO (amide). Also, moderate transmittance peak at 1371.56 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e indicated the CH\u003csub\u003e3\u003c/sub\u003e (amide). The peak at 1250.36 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e authorizes the existence of asymmetrical S\u0026thinsp;=\u0026thinsp;O vibration signal and COS stretching confirm the sulfation of LMWSC. C-N stretch peak was acquired at 1149 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, it represents the amines of NGlc and NGlcAc.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003e2.4. NMR spectroscopy of LMW-SCH\u003c/h2\u003e\n \u003cp\u003eThe LMW-SCH\u0026rsquo;s \u003csup\u003e1\u003c/sup\u003eH-NMR spectra were shown in \u003cstrong\u003e[\u003c/strong\u003eFig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e\u003cstrong\u003e]\u003c/strong\u003e. The signal exhibited the anomeric hydrogen signal (H1) at =\u0026thinsp;4.63 ppm. The distinctive peak for the non-anomeric ring hydrogen (H2-H6) was represented by the broad signals that were seen in the region between =\u0026thinsp;2.9\u0026ndash;3.8 ppm. At \u0026delta;\u0026thinsp;=\u0026thinsp;1.8 ppm, the N-acetyl methyl hydrogen signals (CH\u003csub\u003e3\u003c/sub\u003e) became visible. The ring carbon signals were confirmed in the range between \u0026delta;\u0026thinsp;=\u0026thinsp;55 ˗100 ppm for the\u003c/p\u003e\n \u003cp\u003e\u003csup\u003e13\u003c/sup\u003eC-NMR spectra of LMW-SCH. The -CO signal emerged at \u0026delta;\u0026thinsp;=\u0026thinsp;171.63 ppm and N-acetyl CH\u003csub\u003e3\u003c/sub\u003e at \u0026delta;\u0026thinsp;=\u0026thinsp;23.34 ppm \u003cstrong\u003e[\u003c/strong\u003eFig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e\u003cstrong\u003e]\u003c/strong\u003e. The COSY spectrum may potentially be used to identify the assignment of each directly coupled proton (H1, H2, H3, H4, H5, and H6) in the glycopyranose moiety, as shown in Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA. The HSQC spectrum was used to prepare an association between C1-H1, C2-H2, C3-H3, C4-H4, C5-H5, and C6-H6, as represented in Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e \u003cstrong\u003e(A-B)\u003c/strong\u003e. The task of assigning of \u003csup\u003e13\u003c/sup\u003eC chemical shifts from C-1 to C-6 was also completed. The HSQC spectrum could also be used to determine the chemical shift reassignment of the methyl CH\u003csub\u003e3\u003c/sub\u003e of the N-acetyl molecule. The DDA of the LMW-SCH has been determined to be 82.92%.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003e2.5. MALDI-TOF/ MS of LMW-SCH\u003c/h2\u003e\n \u003cp\u003eThe purified LMM-SCH of \u003cem\u003eL. duvauceli\u003c/em\u003e has a molecular weight of 813.339 Da and includes NAcGlc at the reducing ends. This structure enables straightforward fragmentation and subsequent polymerization. When squid-derived chitooligosaccharides are dissolved in water, they exhibit moderately intense quasi-molecular [M\u0026thinsp;+\u0026thinsp;Na]\u003csup\u003e+\u003c/sup\u003e ions and less intense [M\u0026thinsp;+\u0026thinsp;K]\u003csup\u003e+\u003c/sup\u003e ions during MS analysis. The identification and characterization of primary products, such as NGlc2, NGlc3-NGlcAc1, NGlc4-NGlcAc1, NGlc5-GlcNAc1, and NGlc8-GlcNAc2, were achieved using MALDI-TOF/MS \u003cstrong\u003e[\u003c/strong\u003eFig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e\u003cstrong\u003e]\u003c/strong\u003e. It is worth noting that ionisation is compatible with both homopolymerization and heteropolymerization of NGlc and NAcGlc, which occur due to the equal cleavage of the LMW-SCH.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003e2.6. \u003cem\u003eIn silico\u003c/em\u003e prediction of LMW-SCH with HSV protein\u003c/h2\u003e\n \u003cp\u003eThe linking of the LMW-SCH molecule to the HSV glycoprotein envelope proteins D and E. The Avogadro software generates the ligand structure. Supercomputer-supported molecular techniques were used to identify the binding sites of the receptors, and the Discovery studio was utilized to optimize their crystal structures \u003cstrong\u003e[\u003c/strong\u003eFig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e\u003cstrong\u003e]\u003c/strong\u003e. Using AutoDock, the docking between the sulfated CH and the HSV glycoprotein receptors gD and gE was finished; the results are displayed in \u003cstrong\u003e[\u003c/strong\u003eFigs. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e, \u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003e, \u003cspan class=\"InternalRef\"\u003e11\u003c/span\u003e \u0026amp; \u003cspan class=\"InternalRef\"\u003e12\u003c/span\u003e\u003cstrong\u003e]\u003c/strong\u003e, and Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e summarises the molecular binding properties. The molecular docking analysis revealed that the compound LMW-SCH exhibited varying binding affinities across the four target proteins. Among these, LMW-SCH showed the strongest binding with the 2F5U protein, demonstrated by the most binding energy of -4.41 Kcal/mol and the formation of ten hydrogen bonds involving residues such as GLY225, GLN226, and ARG227. This interaction also corresponded to a lower reference RMSDA value (7.166), suggesting better structural alignment. Conversely, the weakest interaction was observed with 1JMA, with a binding energy of -2.41 Kcal/mol and a higher inhibition constant of 17.09 mM, despite forming six hydrogen bonds. These results suggest that LMW-SCH may have higher affinity and specificity toward 2F5U, making it a potential target for further structural and functional studies.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eBinding properties of HSV glycoprotein receptors\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"7\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eProtein\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCompound\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eBinding energy (Kcal/mol)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReference RMSDA\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eInhibition constant (mM)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eNo. of H\u003csub\u003e2\u003c/sub\u003e bonds\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eResidues involved in H\u003csub\u003e2\u003c/sub\u003e bond\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2GIY\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSCH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e-3.18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e56.037\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eVel 224, Met 226, Trp 370, Glu 227\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1JMA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSCH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e-2.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e93.404\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e17.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eArg 110, Glu 174, Asp 175, Asn 178, Leu 152, Ser 151\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5MHJ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSCH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e-2.42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e15.80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e16.81\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eASP384, ALA385, GLU 386, ARG 460\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2F5U\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSCH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e-4.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e7.166\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e589.73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGLY225, GLN226, ARG227, ALA301, GLY304, GLU370, ASP371, THR373, ASN 365, His364\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n \u003ch2\u003e2.7. Anticoagulant Activity of LMW-SCH\u003c/h2\u003e\n \u003cp\u003eThe anticoagulant activity of LMW-SCH from \u003cem\u003eL. duvauceli\u003c/em\u003e, was investigated \u003cem\u003ein vitro\u003c/em\u003e by the APTT and PT tests. LMW-SCH affected human plasma coagulation. Despite the fact that LMW-SCH anticoagulant activities were weaker than those of heparin, APTT and PT were significantly (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) prolonged by using LMW-SCH at concentrations of 5, 10, 15, 20, 25 \u0026micro;l/ml and higher. The anticoagulant activity of LMW-SCH was found to be 1.93 IU/mg for PT and 6.96 IU/mg for APTT, which is lower than the standard heparin activity of approximately 200 IU/mg. This comparison highlights the relative efficacy of LMW-SCH in comparison to heparin. APTT prolongation indicates that the intrinsic and/or commonplace pathways have been inhibited, whereas PT prolongation indicates that SCH can also inhibit the extrinsic coagulation pathway. All measurements were taken in triplicate \u003cstrong\u003e[\u003c/strong\u003eFig. \u003cspan class=\"InternalRef\"\u003e13\u003c/span\u003e\u003cstrong\u003e]\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003eThe 2F5U protein represents a segment of the HSV pUL25 protein and plays a pivotal role in maintaining the integrity of the viral capsid and facilitating DNA packaging. It is a component of the capsid-associated tegument complex and engages in interactions with other key structural proteins, including VP5 and VP26. These interactions are essential for the accurate assembly and stability of the capsid, ensuring the successful encapsulation of the viral genome during replication.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003e2.8. Cytotoxicity Assay of LMW-SCH\u003c/h2\u003e\n \u003cp\u003e\u003cem\u003eIn vitro\u003c/em\u003e cell viability study was used to assess the cytotoxic effects of LMW-SCH from \u003cem\u003eL. duvauceli\u003c/em\u003e. The cytotoxicity of LMW-SCH against the HSV vero cells was evaluated using the MTT test. Vero cells were exposed to various doses of the compounds (25\u0026ndash;200 \u0026micro;g/mL) for 48 hr, and the CC\u003csub\u003e50\u003c/sub\u003e values of cell viability were determined using an ELISA plate reader. The result shows that, in comparison to control and standard (Acycovir-PC), cells exposed to LMW-SCH demonstrated significant cell damage. Additionally, morphological changes such cell rounding, shrinkage, and lack of adherence to the surface were brought on by increasing the dose \u003cstrong\u003e[\u003c/strong\u003eFig. \u003cspan class=\"InternalRef\"\u003e14\u003c/span\u003e\u003cstrong\u003e]\u003c/strong\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e2.9. Plague assay of LMW-SCH against HSV-1\u003c/h2\u003e\n \u003cp\u003eHSV-1 was serially diluted in media until it reached 100 PFU (plaque forming unit) in 100 \u0026micro;l, then the viral suspension was introduced to Vero cells and cultured for 1 h at 37\u0026deg;C with the LMW-SCH from \u003cem\u003eL. duvauceli\u003c/em\u003e, found to have a plaque-inhibitory effect against HSV-1. The cells were then exposed upto 200 \u0026micro;g/ml concentrations of LMW-SCH in DMEM media. The standard anti-viral drug used was acyclovir, which was utilized at a concentration of 20 \u0026micro;M. After three days, the plaques were seen using crystal violet staining. The results indicate that LMW-SCH (100 \u0026micro;g/ml) exhibited a significant (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e) antiviral effect against HSV-1, reducing plaque formation when compared to acyclovir (20 \u0026micro;M), thereby providing a clearer context for its efficacy. According to the findings,\u003cem\u003eL. duvauceli\u003c/em\u003e (55%) and LMW-SCH (100 \u0026micro;g/ml) had an antiviral impact and reduced plaque formation when compared to acyclovir (positive control-PC) therapy at a concentration of 20 \u0026micro;M \u003cstrong\u003e[Fig.\u0026nbsp;15]\u003c/strong\u003e. Dose-response assays were conducted to determine the CC\u003csub\u003e50\u003c/sub\u003e, EC\u003csub\u003e50\u003c/sub\u003e, and SI\u0026thinsp;=\u0026thinsp;CC\u003csub\u003e50\u003c/sub\u003e/EC\u003csub\u003e50\u003c/sub\u003e for LMW-SCH and PC. LMW-SCH exhibited a CC\u003csub\u003e50\u003c/sub\u003e of 100 \u0026micro;g/mL and an EC\u003csub\u003e50\u003c/sub\u003e of 200 \u0026micro;g/ml, yielding an SI of 0.5, while PC showed a selectivity index of 20. The results of each experiment were presented as \u0026plusmn;\u0026thinsp;mean standard deviation after being repeated three times.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003e2.10. Time-dependent inhibition\u003c/h2\u003e\n \u003cp\u003eLMW-SCH was added to the cultured cells at various times throughout the incubation process to assess its antiviral effectiveness against HSV-1. Each 24 well plate used in the experiment received 100 PFUs of the virus (HSV-1) for inoculation. In addition to being administered immediately after infection, the compounds were also added at 0, 3, 6, 12 and 24 hr later host pathogen interaction (HPI). \u003cem\u003eL. duvauceli\u003c/em\u003e, LMW-SCH (100 \u0026micro;g/ml) inhibited more than 20 PFU/ml, the results were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation after each experiment was carried out three times.When the host cells were pre-treated with polysaccharides prior to infection, the tested drug candidates and acyclovir showed no effect on viral infection \u003cstrong\u003e[\u003c/strong\u003eFig. \u003cspan class=\"InternalRef\"\u003e16\u003c/span\u003e\u003cstrong\u003e]\u003c/strong\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003e2.11. Analysis of viral protein expression\u003c/h2\u003e\n \u003cdiv class=\"BlockQuote\"\u003e\n \u003cp\u003eTo ascertain the effect of LMW-SCH on HSV-1 gene expression, total RNA was extracted from the treated cells and subjected to RT-qPCR using particular primers as outlined in the protocols. ICP4, UL13, UL52, and UL30 are genes involved in the replication of the HSV-1 virus. In order to ascertain the compound\u0026rsquo;s effectiveness in the HSV replication cycle, the gene expression levels were assessed using the normalised reference gene \u0026beta;-actin and the 2-∆∆Ct method for the relative quantification RT‐qPCR. We discovered that LMW-SCH also reduced the transcription levels of these genes \u003cstrong\u003e[\u003c/strong\u003eFig. \u003cspan class=\"InternalRef\"\u003e17\u003c/span\u003e\u003cstrong\u003e]\u003c/strong\u003e. The immediate early genes ICP4, UL13, UL52, and UL30, all of which are necessary for the expression of early and late viral genes\u0026mdash;had their transcription levels dramatically decreased by LMW-SCH. These findings imply that LMW-SCH suppresses immediate early gene expression, which in turn prevents HSV-1 reproduction.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003e2.12. Western blot analysis\u003c/h2\u003e\n \u003cp\u003eThe anti-apoptotic protein expression was studied in control and experimental groups by western blot analysis. The cells were treated for 24 hr with 100 \u0026micro;g/ml doses of LMW-SCH in the range of the EC\u003csub\u003e50\u003c/sub\u003e value whereas the control samples contained DMSO. The expression of the four viral proteins (ICP4, UL13, UL52, and UL30) was reduced after treatment with LMW-SCH at a dose of 100 \u0026micro;g/ml. SDS-PAGE was used to separate total cellular proteins from lysed samples. TINA imaging analysis software (version 2.10, Raytest, Straubenhardt, Germany) was used to calculate the optical densitometry of western Blot band intensity relative to the housekeeping gene \u0026beta;-actin (Fig. \u003cspan class=\"InternalRef\"\u003e18\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3. DISCUSSION","content":"\u003cp\u003eMarine organisms are a rich source of potentially bioactive chemicals with a wide range of biological functions as well as structurally diverse, unique chemical structures. Recently, there has been a great deal of interest in the bioactivity of naturally occurring bioactive chemicals that come from the marine environment. The most prevalent forms of polysaccharides are chitin and CH, which are derived from a variety of marine living organisms. Polysaccharides play an important role in living organisms, supplying energy to the cell and protecting the cell structure (De Borba Gurpilhares et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Potential medical applications exist for the polysaccharides that are produced by marine bacteria and fungi or derived from marine plants and animal life. Examples of marine polysaccharides include agar, fucan, glucan, laminarin, carrageenan, glycosaminoglycans, cellulose, chitin, CH, and alginic acid; they possess anti-oxidative, immunostimulatory, anticoagulant, antibacterial, antiviral, and antitumor properties (Kang et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Patel, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eChitin and CH are naturally biodegradable and biocompatible biopolymers, hence they have extensive applications in biomedical, food, agricultural, and chemical industries. The potential applications of CH in the sectors of agriculture, food, and health are limited by its high molecular weight, which causes poor solubility at neutral pH and high-viscosity water solutions. However, considering they are harmless and biocompatible, water-soluble CH oligosaccharides and their derivatives can circumvent most of these limitations (Liaqat \u0026amp; Eltem, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Moreover, chemical modification of CH further enhances and opens different ways to utilize CH and sulfated CH (Jiao et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Xing et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2004\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eLMW-SCH isolated from squid has various biological activities like antioxidant, anticancer, anticoagulant, anti-hyperlipidaemic, antiviral, and antitumor activities. Sulfated polysaccharides are able to interact with various molecules and receptors\u0026mdash;differentiation, cell development, cell-cell recognition, cell adhesion, and cell-cell interaction (Maia et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The activity depends on several structural parameters like glycosidic linkages, conformation, molecular weight, and degree of sulfation (Caputo et al., 2013; Cunha \u0026amp; Grenha, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). They can be synthesized by attaching a sulfate and saccharide hydroxyl group. An important direction of sulfated modification becomes a structural modification of polysaccharides. The substitution group such as hydroxyl, carboxyl, or amino-terminal groups with sulfate groups is used to synthesize sulfated polysaccharides. The sulfate group plays an important role in bioactivities.\u003c/p\u003e \u003cp\u003eThe goal of the current work was to extract the LMW-SCH from the gladius of\u003cem\u003eL. duvauceli\u003c/em\u003e, characterize it structurally, and investigate its physiochemical characteristics. The variations in seasonality, species, and geographic location were factors contributing to the disparity in the yield of LMW-SCH isolated from cephalopod waste. The yield of CH recovered from the cuttlebone of several cuttlefish species reflects the inherent characteristics of the mollusk, even though the variation is not very great. The elemental composition result was comparable to the findings of a previously published study by Vairamani et al. (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) on the cuttlebone of CH, with carbon (41.4%), hydrogen (6.09%), nitrogen (4.85%), and sulfate (20.2%), respectively. The FT-IR spectrum showed the occurrence of sulfo groups at 810 and 1240 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e corresponding to COS and S\u0026thinsp;=\u0026thinsp;O stretches, which can be correlated to the peaks attained in the LMW-SCH. The bands corresponded to 580 ˗ 625 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e (SO\u003csub\u003e2\u003c/sub\u003e) and 1060 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e (SO\u003csub\u003e2\u003c/sub\u003e) attributed to the sulfo groups. The identified functional groups present in the LMW-SCH show fine concurrence with the outer shell of \u003cem\u003eD. scortum\u003c/em\u003e, with peaks agreeing to C\u0026thinsp;=\u0026thinsp;O stretches, NH, OH, and sulfo groups (Subhapradha et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Suwan et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe outcomes are similar to that obtained by Zhang et al. (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) who had reported the sulfation by the presence of IR peaks at 580, 610, 1014, and 1170 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e for the sulfated CH with a DS\u003csub\u003eS\u003c/sub\u003e of 0.86. The comprehensive evaluation of LMW-SCH using 1D and 2D-NMR signals is in perfect concordance with earlier findings. The sulfation signal found in the current analysis of the HSQC spectrum was consistent. Based on the Di Martino et al. (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2005\u003c/span\u003e) report, source of CH and preparation process, DD may vary from 30\u0026ndash;90%. In the present study, DD of the LMW-SCH was predicted from the NMR chemical comparable to the study of Zhang et al. (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Because of the differences in molecular mass and molecular weight distribution, polysaccharides have distinct physicochemical, rheological, and biological properties. LMW-SCH chito-oligosaccharides (COS) showed significant anti-inflammatory activity compared to medium and high molecular weight sulphated COS. Lopatin et al. (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e1995\u003c/span\u003e) have demonstrated that the hydrolysis of COS with acetic acid at reducing ends of sulphated COS displayed a subunit range between 447 to 1478 m/z. The tendency of the SCH to divide into NGlc and NGlcAc based on the hydrolysis induced by the acidic atmosphere and degree of DA. The present study suggest that extracted and structurally characterized LMW-SCH exhibits considerable yield, higher degree of deacetylation with lower molecular weight than the commercial CH.\u003c/p\u003e \u003cp\u003eGlycoproteins are the key molecular targets for HSV. The HSV infection begins with the effective adherence of glycoprotein-D (gD) viral envelope to the cell surface receptor. These glycoproteins are soluble, truncated ectodomains of the herpesvirus cell receptor input mediator A (HveA). Glycoproteins D have a possible restriction of the local receptor called the gD receptor. The gD receptor binds to 6-O-sulfate CH. The structures reveal a V-shaped immunoglobulin (Ig) crease in the middle of the gD, which is surrounded by massive N- and C-terminal extensions and is clearly associated with cell attachment atoms. The adaptability of the N-terminal bar, the receptor adhering portion of gD, indicates that a conformational shift with a restriction can be a component of the viral entrance mechanism. The mutation in glycoprotein D (glD) is unable to infect the host by penetrating the host cell membrane (Spear et al., 2003).\u003c/p\u003e \u003cp\u003eThe anticoagulant capacity of SCH synthesised from \u003cem\u003eD. scortum\u003c/em\u003e was reported to be 6.45 IU/mg and 1.73 IU/mg, respectively (Drozd et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Subhapradha et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Furthermore, the APTT and PT activities of SCH in \u003cem\u003eS. pharaonis\u003c/em\u003e were slightly higher than the previously stated values of 6.96 and 1.93 IU/mg, respectively (Jayalakshmi, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Similarly, the anticoagulant efficacy of SCH obtained from the squid \u003cem\u003eD. singhalensis\u003c/em\u003e was revealed as 6.91 IU/mg (APTT) and 1.85 IU/mg (PT), as demonstrated by our previous research (Ramasamy et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The current study results showed the anticoagulant activity of LMW-SCH from \u003cem\u003eL. duvauceli\u003c/em\u003e, was investigated APTT and PT were significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) extended at higher concentrations. \u003cem\u003eIn vitro\u003c/em\u003e cell viability study result shows that, in comparison to control and standard, cells exposed to LMW-SCH demonstrated prevented cell damage, morphological changes such cell rounding, shrinkage, and lack of adherence to the surface were brought on by increasing the dose. When the medications were administered to HSV-1 24 hr before infection, there was a significant decrease in the development of plaque in LMW-SCH. Infectivity was decreased by more than 90% at the highest non-cytotoxic concentrations of the examined polysaccharides. When acyclovir was administered during the replication period, it exhibited the strongest anti-viral activity, with a 98.6% reduction of viral replication. These findings indicated that, as had been previously demonstrated for plant-derived extracts and isolated compounds, the anti-HSV-1 activity of these macromolecules was directly achieved by interfering with virion envelope structures or hiding viral structures that are required for adsorption or entry into host cells (Astani et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Schnitzler et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). LMW-SCH showed a CC\u003csub\u003e50\u003c/sub\u003e of 100 \u0026micro;g/mL and an EC\u003csub\u003e50\u003c/sub\u003e of 200 \u0026micro;g/mL, resulting in an SI of 0.5. ACV exhibited a CC\u003csub\u003e50\u003c/sub\u003eof approximately 200 \u0026micro;M and an EC\u003csub\u003e50\u003c/sub\u003eof around 2 \u0026micro;M (SI\u0026thinsp;\u0026asymp;\u0026thinsp;100) as reported in the previous studies (Jin et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Pourianfar et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), while our findings using 20 \u0026micro;M ACV showed an SI of approximately 20.\u003c/p\u003e \u003cp\u003eThe present study found that LMW-SCH inhibits the transcription of ICP4, UL13, UL52, and UL30, essential for viral DNA synthesis, compared to β-actin. Additionally, LMW-SCH reduces the transcription of the immediate early gene ICP47. These findings suggest that LMW-SCH disrupts viral protein synthesis by interfering with the transcription of immediate early genes. It was discovered that concurrent treatment with LMW-SCH at a concentration of 100 \u0026micro;g/ml decreased the expression of the four viral proteins. Meanwhile, it was demonstrated that the chemical treatment entirely stifled the expression of the HSV-1 viral proteins.HSV-1 causes tissue lesions and cellular damage by infecting the epithelium and starting lytic replication. Cellular RNA polymerase II transcribes HSV-1 genes in a highly controlled cascade with the help of cellular transcription factors. ICP0 and ICP4 are among the immediate early genes that are crucial for starting viral transcription as soon as the viral genome enters the host nucleus. Early genes, which are controlled by the immediate early genes, start to express 2 to 8 hr after infection. Early genes provide products that aid in the reproduction of viruses, whereas late genes typically produce structural proteins (Gillis et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). For viral DNA replication, HSV-1 genes including UL5, UL8, UL9, UL42, and UL52 are necessary. Huang et al. (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) discovered that mitoxantrone dihydrochloride (MD) also reduced the transcription levels of several genes. ICP0, ICP22, ICP27, and ICP47 are immediate early genes that are also necessary for the development of late and early viral gene products. These genes had their transcription levels decreased by MD. Similarly, recent research has shown that LMW-SCH suppresses immediate early gene expression to prevent HSV-1 multiplication.\u003c/p\u003e \u003cp\u003eA probable mechanism for the observed anti-HSV-1 activity of LMW-SCH from gladius rivets the inhibition of viral gene transcription. Particularly, we hypothesize that LMW-SCH interrupts the function of key HSV-1 transcriptional regulators, especially ICP4, which is crucial for the temporal cascade of viral gene expression. This interference may occur through direct interaction with ICP4, or indirectly via modulation of host cell signalling pathways that impact viral transcription. The present findings align with Huang et al.\u003csup\u003e6\u003c/sup\u003e, and Boroumand et al. (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) they also described the HSV-1 infects sensory neurons during the latent phase and remains dormant in the nucleus until reactivation. Upon reactivation, HSV-1 triggers lytic replication, leading to cellular damage and tissue lesions, with transcription factors facilitating the viral gene expression cascade. To investigate this, the anti-HSV activity of LMW-SCH should be assessed using chromatin immunoprecipitation (ChIP) and reporter assays to evaluate its impact on ICP4 binding to viral promoters. These experiments will elucidate the molecular mechanisms by which LMW-SCH potentially inhibits HSV-1 gene expression at the transcriptional level.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eLimitation of the work\u003c/strong\u003e \u003cp\u003eLMW-SCH, a CH derivative from gladius, presents a unique antiviral mechanism that may target viral gene expression through transcriptional repression or epigenetic modulation. However, further studies are needed to determine HSV-1 RNA content, transfection and immunofluorescent techniques are required to confirm the specific mechanism of LMW-SCH against HSV-1.\u003c/p\u003e \u003c/p\u003e"},{"header":"4. CONCLUSION","content":"\u003cp\u003eThe study focused on the purification, freeze-drying, and modification of CH into low LMW-SCH derived from \u003cem\u003eL. duvauceli\u003c/em\u003e. The purified LMW-SCH demonstrated increased anticoagulant activity at higher concentrations. \u003cem\u003eIn vitro\u003c/em\u003e experiments, including plaque reduction, cytotoxicity, and time-dependent inhibition assays, revealed that LMW-SCH exhibits significant resistance to HSV-1, with a CC\u003csub\u003e50\u003c/sub\u003e value of 100 \u0026micro;g/ml, EC50 value of 200 \u0026micro;g/ml and SI\u0026thinsp;=\u0026thinsp;0.5. Gene and protein expression studies indicate that LMW-SCH effectively suppresses HSV-1 infection \u003cem\u003ein vitro\u003c/em\u003e. While the findings suggest that LMW-SCH could be a valuable resource from cephalopods for the development of antiviral treatments against HSV-1, it is important to note that no \u003cem\u003ein vivo\u003c/em\u003e studies have been conducted to confirm its clinical relevance. Additionally, the investigation regarding LMW-SCH having the \u0026ldquo;highest inhibitory effect\u0026rdquo; is deceptive, as it has not been compared to other antiviral agents in a standardized manner. Further studies are required to assess HSV-1 RNA content, and transfection along with immunofluorescent techniques is necessary to confirm the specific mechanism of LMW-SCH against HSV-1.\u003c/p\u003e"},{"header":"5. MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e5.1. Sample collection\u003c/h2\u003e \u003cp\u003eThe samples (\u003cem\u003eL. duvauceli\u003c/em\u003e), which contained squid gladius, were acquired at the Nagapattinam landing center located on the southeast coast of Tamil Nadu, India (Latitude 10.7607\u0026deg; N, Longitude 79.8500\u0026deg; E). The material was properly conserved, purified, dried naturally, and then converted into powder. The gladius powder was subsequently used for the extraction of chitin and CH.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e5.2. Extraction, purification and of SCH\u003c/h2\u003e \u003cp\u003eThe gladius powder was demineralized at room temperature (RT) in 1% HCl for 36 hr after deproteinization in 0.5 N NaOH for 16 hrs. After that, 50% NaOH deacetylated the isolated chitin for 2\u0026ndash;3 hr, producing CH. Dichlorosulfonic acid sulfation and 4 hr of RT agitation followed. After filtering and purifying with an Amberlite IRA 900 column (Anionic-exchange resin), the mixture was dialyzed with a low molecular-weight dialysis membrane (2 kDa cut-off, Himedia, India) for 48 hr in PBS (pH 7.2), lyophilized as SCH, and stored at room temperature (Gomathy et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e5.3. Gamma- irradiation of SCH\u003c/h2\u003e \u003cp\u003e2 g of SCH was irradiated at 4 kGy/h in glass vials in the Gamma Chamber 5000. The radiation exposure levels for the samples ranged from 100 kGy to 140 kGy. The dosimetry rate was calibrated using Fricke dosimeters, and the exact exposure time was recorded to ensure accurate dosing (Chung et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). LMW-SCH was selected for further study.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e5.4. Elemental analysis of SCH\u003c/h2\u003e \u003cp\u003eThe elements such as carbon, hydrogen, nitrogen and sulfate contents of purified SCH\u0026rsquo;s were analyzed using an elemental analyzer CHN/O system (Perkin-Elmer\u0026rsquo;s Series II 2400, USA) (Chung et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e5.5. FT-IR spectroscopy of LMW-SCH\u003c/h2\u003e \u003cp\u003eThe purified compound was determined using an FT-IR spectrophotometer (Bruker alpha, 1800, USA) in the frequency range of 4000 to 500 cm\u003csup\u003e-1\u003c/sup\u003e. 50 mg of the lyophilized, purified LMW-SCH was pressed into a disc of 1 mm using KBr pellet and impregnated to the sample slot and studied for FT-IR absorbance (Gomathy et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The resultant spectrum was interpreted for the presence of functional groups with reference FT-IR absorption peak values in the NIST database\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e5.6. NMR spectroscopy of LMW-SCH\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e5.7. MALDI- TOF/MS\u003c/h2\u003e \u003cp\u003eThe molecular weights of extracted SCH were also determined (UltrafleXtreme, Bruker Daltonics, Germany). MALDI-TOF/MS was used to conduct reflection-based investigations at 20 kV. An emission of 330 nm nitrogen 45 laser at 50 Hz powers the mass spectrometer. The sample was a 1:1 (v/v) matrix consisting extracted SCH (-cyano-4-hydroxycinnamic acid), and the external control was nonspecific CH (Ramachandran et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e5.8. Molecular docking analysis of LMW- SCH\u003c/h2\u003e \u003cp\u003eThe structure of LMW-SCH was drawn using the Avogadro software. The crystal structure of glycoprotein D and glycoprotein E [Protein Data Bank (PDB) code 1JMA, 2GIY, 5MHJ and 2F5U (Davood et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) of HSV has been used in this study.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003e5.9. Anticoagulant activity\u003c/h2\u003e \u003cp\u003eThe anticoagulant activities of the synthesised polysaccharide LMW-SCH were determined using in vitro coagulation assays APTT and PT at concentrations ranging from 0.5 mg/ml. As a reference, sodium heparin (25,000 UI/5 ml) was used, and the evaluation was performed on the star analyzer. All blood suspensions were incubated for 30 min at 80 rpm at 37\u0026deg;C. By centrifuging at 2500 g for 15 min at 14\u0026deg;C, platelet-poor plasma (PPP) was obtained in compliance with the protocol for citrated plasma preparation for hemostaseological evaluation in preparation for ensuing coagulation tests (IHEC \u0026ndash; II/0177/22/dated 4.4.2022).\u003c/p\u003e \u003cp\u003e \u003cb\u003ea. Activated partial thromboplastin time (APTT) assay\u003c/b\u003e \u003c/p\u003e \u003cp\u003e10 \u0026micro;l of LMW-SCH was combined with 90 \u0026micro;l of normal human plasma at 37\u0026deg;C for 3 min. After adding 100 ml of APTTT reagent and letting it sit at 37\u0026deg;C for 1 min, 20 mM CaCl\u003csub\u003e2\u003c/sub\u003e was added. The clotting time was recorded (Dhahri et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eb. Prothrombin time (PT) assay\u003c/b\u003e \u003c/p\u003e \u003cp\u003ePT experiments were conducted by Dhahri et al (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) combining 90 \u0026micro;l of citrated normal human plasma with 10 \u0026micro;l of LMW-SCH and incubating the mixture for 3 min at a temperature of 37\u0026deg;C. Following pre-incubation (10 min) at 37\u0026deg;C, 200 \u0026micro;l of PT test reagent was added, and the clotting time was recorded.\u003c/p\u003e \u003cp\u003e \u003cb\u003ec. Cytotoxicity assay\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe Vero cells from the kidney cell of African green monkey (King\u0026rsquo;s Institute, Guindy, Chennai) were propagated in EMEM medium containing Earle's salts, 10% heat-inactivated NBCS, 100 \u0026micro;g/ml streptomycin, 100 IU/ml penicillin, and 5 \u0026micro;g/ml amphotericin B in the presence of Earle\u0026rsquo;s salts. A humidified atmosphere with 5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C was used to incubate vero cells, which were sub-cultured two times each week. LMW-SCH were dissolved in water at 500 \u0026micro;g/ml, sterilised using a Millipore membrane filter (0.22 \u0026micro;m), and stored at -80\u0026ordm;C until use. The cytotoxicity of LMW-SCH in Vero cells was measured using MTT assays. Vero cells in 96-well plates in 100 \u0026micro;l growth medium were cultivated overnight and exposed to various LMW-SCH concentrations for 48 hr. Acyclovir (20 \u0026micro;M) was used as a Positive control (PC). The CC\u003csub\u003e50\u003c/sub\u003e value was calculated, and the selectivity index (SI) was determined to assess the safety of LMW-SCH (Jin et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003ed. Plague assay\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe infected vero cells were spun down at 13000 x g for 5 min after frozen and thawed 3 times. The supernatant was collected and treated to infect the cells for 12 hr. Then, the viral plaque formations were counted with the inverted microscope from the 2% of crystal violet solution-stained vero cells (Huang et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).Controls included DMSO and untreated virus controls. The SI was calculated using the formula: SI\u0026thinsp;=\u0026thinsp;CC\u003csub\u003e50\u003c/sub\u003e / EC\u003csub\u003e50\u003c/sub\u003e, where CC\u003csub\u003e50\u003c/sub\u003e represents the concentration of the compound that causes 50% cytotoxicity in host cells, and EC\u003csub\u003e50\u003c/sub\u003e denotes the concentration required to achieve 50% inhibition of viral replication (Jin et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Pourianfar et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003ee. Time of addition assay\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCells treated with10 \u0026micro;l of HSV-1 suspension 1 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e were maintained with LMW-SCH for identifying the viral infection stage. The antiviral effect of LMW-SCH was calculated at different times of infection. The tested plates were maintained at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e for 24 hr and the fresh media containing D-glucosamine (300 mM) was replaced with plates and placed in incubation for 48 hr. The cells were collected after incubation with the monolayers treated to freeze-thaw cycles. The time of addition was examined to measure the effect of LMW-SCH on ELISA plate reader (Pourianfar et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003ef. RT-qPCR gene expression\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe total RNA from Vero cells were isolated based on Qiagen RNeasy mini kit. NanoDrop 2000c spectrophotometers (Thermo Fisher Scientific, USA) quantified RNA concentration. The cDNA was synthesized using the QuantiTect Reverse Transcription kit (Qiagen, Germany). The qRT-PCR used extracted RNA, antioxidant gene primers (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e (ICP4, UL13, UL52, and UL30), and β-actin as an internal housekeeping gene. The qRT-PCR used the KAPA SYBR FAST one-step quantitative RT-PCR kit. Real-time cycling settings were initial activation (94\u0026deg;C, 5 min) and 40 cycling (denaturation-94℃ for 30 sec; annealing-60℃ for 20 sec and final extension-72℃ for 1 min). The ABI 7500 Fast RT- PCR System set up the experiment and recorded the threshold cycle value (Ct). β-actin expression was used for normalization to obtain the 2\u0026thinsp;\u0026minus;\u0026thinsp;ΔCT values and fold change calculation.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe designed HSV-1 gene primers sequences\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCCATTGAGCACGGTATTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATACATGGCAGGGGTGTTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eICP4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGTGATGAAGGAGCTGCTGTTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGATCACGCGGCTGCTGTACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUL13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACGTCATACGCCAGGCCGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGCTGTCGCCGGACTTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUL52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTCCGACCGTGAATTCATTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGGGGTCCTGGGTCGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUL30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATCACCGACCCGGAGAGGGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGCCAGGCGCTTGTTGGTGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003e\u003cb\u003eg. Western blot analysis\u003c/b\u003e\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eCentrifugation was performed for 1 min at 2000 rpm in order to extract the cellular pellet. The extracted pellet was then again suspended in a lysis solution (pH 7.4) that contained the following ingredients: a full protease inhibitor set, 20 mM Tris\u0026ndash;HCl, 150 mM NaCl, 1% Triton X\u0026ndash;100, 10% glycerol, 1 mM Na\u003csub\u003e3\u003c/sub\u003ePO4, 0.1 mM PMSF, and 25 mM β-glycerol-phosphate (Roche).After being re-suspended, the cell pellet was lysed on ice for 20 min and vortexed for 20 sec. Centrifuge cell lysates for 20 min at 13,000 rpm at 4\u0026deg;C. Western blot analysis was performed on the liquid part that was collected. An appropriate antibody was used to identify the proteins (Huang et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). While the control contained DMSO, the cells were treated for 24 hr with a 200 \u0026micro;g/ml dosage of LMW-SCH from gladius within the range of the EC\u003csub\u003e50\u003c/sub\u003e value.\u003c/p\u003e \u003cp\u003e \u003cb\u003eh. Statistical analyses\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe mean SD of duplicates is used to illustrate the costs of cell survival. All of the tests were carried out at least three times with the same results. ANOVA were used to assess significance (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e\u0026amp; \u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e) (GraphPad Prism software).\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003eThe current study was done after approval from Institutional Human Ethical Committee of Chettinad Hospital and Research Institute, Kelambakkam, Tamil Nadu (IHEC – II/0177/22/dated 4.4.2022).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting\u003c/strong\u003e \u003cstrong\u003eInterest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflicts of interest related to this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor's Contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe research investigations were created by SR. The experiments were carried out by VN. The manuscript was written by VN, and it was revised and severely by SR. The final version for submission was read and approved by both authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe corresponding author is grateful for financial support from the Department of Biotechnology (DBT), Ministry of Science and Technology, Government of India (Grant no. BT/PR15676/AAQ/03/794/2016).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of Data and Materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe gamma irradiation assistance from Dr. Puspalata from WSCD, IGCAR, Kalpakkam and the NMR facilities from SAIF, IIT Madras are warmly acknowledged by the authors.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAstani, A., Reichling, J., \u0026amp; Schnitzler, P. (2010). Comparative study on the antiviral activity of selected monoterpenes derived from essential oils. \u003cem\u003ePhytotherapy Research\u003c/em\u003e, \u003cem\u003e24\u003c/em\u003e(5), 673\u0026ndash;679. https://doi.org/10.1002/PTR.2955\u003c/li\u003e\n \u003cli\u003eBoroumand, H., Badie, F., Mazaheri, S., Seyedi, Z. S., Nahand, J. S., Nejati, M., Baghi, H. B., Abbasi-Kolli, M., Badehnoosh, B., Ghandali, M., Hamblin, M. R., \u0026amp; Mirzaei, H. (2021). Chitosan-based nanoparticles against viral infections. \u003cem\u003eFrontiersin.OrgH Boroumand, F Badie, S Mazaheri, ZS Seyedi, JS Nahand, M Nejati, HB BaghiFrontiers in Cellular and Infection Microbiology, 2021\u0026bull;frontiersin.Org\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e, 643953. https://doi.org/10.3389/FCIMB.2021.643953/FULL\u003c/li\u003e\n \u003cli\u003eCaputo, H., Straub, J., Reviews, M. G.-C. S., \u0026amp; 2019, \u0026nbsp;undefined. (2013). Design, synthesis, and biomedical applications of synthetic sulphated polysaccharides. \u003cem\u003ePubs.Rsc.OrgHE Caputo, JE Straub, MW GrinstaffChemical Society Reviews, 2019\u0026bull;pubs.Rsc.Org\u003c/em\u003e, \u003cem\u003e00\u003c/em\u003e, 1\u0026ndash;3. https://doi.org/10.1039/x0xx00000x\u003c/li\u003e\n \u003cli\u003eCheung, R., Ng, T., Wong, J., drugs, W. C.-M., \u0026amp; 2015, \u0026nbsp;undefined. (2015). Chitosan: an update on potential biomedical and pharmaceutical applications. \u003cem\u003eMdpi.ComRCF Cheung, TB Ng, JH Wong, WY ChanMarine Drugs, 2015\u0026bull;mdpi.Com\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e, 5156\u0026ndash;5186. https://doi.org/10.3390/md13085156\u003c/li\u003e\n \u003cli\u003eChung, K. H., Othman, Z., \u0026amp; Lee, J. S. (2015). Gamma irradiation of corn starches with different amylose-to-amylopectin ratio. \u003cem\u003eSpringer\u003c/em\u003e, \u003cem\u003e52\u003c/em\u003e(10), 6218\u0026ndash;6229. https://doi.org/10.1007/S13197-014-1700-4\u003c/li\u003e\n \u003cli\u003eCrute, J. J., Tsurumi, T., Zhu, L., Weller, S. K., Olivo, P. D., Challberg, M. D., Mocarski, E. S., \u0026amp; Lehman, I. R. (1989). Herpes simplex virus 1 helicase-primase: a complex of three herpes-encoded gene products. \u003cem\u003ePnas.OrgJJ Crute, T TsURUMI, LA Zhu, SK Weller, PD Olivo, MD Challberg, ES Mocarski, IR LehmanProceedings of the National Academy of Sciences, 1989\u0026bull;pnas.Org\u003c/em\u003e, \u003cem\u003e86\u003c/em\u003e(7), 2186\u0026ndash;2189. https://doi.org/10.1073/PNAS.86.7.2186\u003c/li\u003e\n \u003cli\u003eCunha, L., \u0026amp; Grenha, A. (2016). Sulfated seaweed polysaccharides as multifunctional materials in drug delivery applications. In \u003cem\u003eMarine Drugs\u003c/em\u003e (Vol. 14, Issue 3). https://doi.org/10.3390/md14030042\u003c/li\u003e\n \u003cli\u003eDavood, A., Nematollahi, A. R., Iman, M., \u0026amp; Shafiee, A. (2009). Synthesis and docking studies of new 1, 4-dihydropyridines containing 4-(5)-chloro-2-ethyl-5-(4)-imidazolyl substituent as novel calcium channel agonist. \u003cem\u003eSpringerA Davood, A Nematollahi, M Iman, A ShafieeArchives of Pharmacal Research, 2009\u0026bull;Springer\u003c/em\u003e, \u003cem\u003e32\u003c/em\u003e(4), 481\u0026ndash;487. https://doi.org/10.1007/S12272-009-1401-0\u003c/li\u003e\n \u003cli\u003eDe Borba Gurpilhares, D., Paes Cinelli, L., Kato Simas, N., Pessoa, A. D., \u0026amp; Dur\u0026atilde;es Sette, L. (2018). Marine prebiotics: Polysaccharides and oligosaccharides obtained by using microbial enzymes. \u003cem\u003eElsevierD de Borba Gurpilhares, LP Cinelli, NK Simas, A Pessoa Jr, LD SetteFood Chemistry, 2019\u0026bull;Elsevier\u003c/em\u003e. https://doi.org/10.1016/j.foodchem.2018.12.023\u003c/li\u003e\n \u003cli\u003eDhahri, M., Sioud, S., Dridi, R., Hassine, M., Boughattas, N. A., Almulhim, F., Al Talla, Z., Jaremko, M., \u0026amp; Emwas, A. H. M. (2020). Extraction, Characterization, and Anticoagulant Activity of a Sulfated Polysaccharide from Bursatella leachii Viscera. \u003cem\u003eACS PublicationsM Dhahri, S Sioud, R Dridi, M Hassine, NA Boughattas, F Almulhim, Z Al Talla, M JaremkoACS Omega, 2020\u0026bull;ACS Publications\u003c/em\u003e, \u003cem\u003e5\u003c/em\u003e(24), 14786\u0026ndash;14795. https://doi.org/10.1021/ACSOMEGA.0C01724\u003c/li\u003e\n \u003cli\u003eDi Martino, A., Sittinger, M., \u0026amp; Risbud, M. V. (2005). Chitosan: a versatile biopolymer for orthopaedic tissue-engineering. \u003cem\u003eBiomaterials\u003c/em\u003e, \u003cem\u003e26\u003c/em\u003e(30), 5983\u0026ndash;5990.\u003c/li\u003e\n \u003cli\u003eDolin, R., Gill, F. A., \u0026amp; Nahmias, A. J. (1975). Genital herpes simplex virus type 1 infection\u0026mdash;variability in modes of spread. \u003cem\u003eJournal of the American Venereal Disease Association\u003c/em\u003e, \u003cem\u003e2\u003c/em\u003e(2), 13\u0026ndash;16. https://journals.lww.com/stdjournal/abstract/1975/12000/genital_herpes_simplex_virus_type_1.3.aspx\u003c/li\u003e\n \u003cli\u003eDrozd, N. N., Logvinova, Y. S., Shagdarova, B. T., Il\u0026rsquo;ina, A. V., \u0026amp; Varlamov, V. P. (2019). Analysis of the Action of Quaternized Chitosans with Different Molecular Weight on Anticoagulant Activity of Heparins In Vitro. \u003cem\u003eSpringerNN Drozd, YS Logvinova, BT Shagdarova, AV Il\u0026rsquo;ina, VP VarlamovBulletin of Experimental Biology and Medicine, 2019\u0026bull;Springer\u003c/em\u003e, \u003cem\u003e167\u003c/em\u003e(2), 279\u0026ndash;283. https://doi.org/10.1007/S10517-019-04509-W\u003c/li\u003e\n \u003cli\u003eEverett, R. D. (2000). ICP0, a regulator of herpes simplex virus during lytic and latent infection. \u003cem\u003eBioessays\u003c/em\u003e, \u003cem\u003e22\u003c/em\u003e(8), 761\u0026ndash;770.\u003c/li\u003e\n \u003cli\u003eGilbert, M., Li, X., Petric, M., Krajden, M., Isaac-Renton, J. L., Ogilvie, G., \u0026amp; Rekart, M. L. (2011). Using centralized laboratory data to monitor trends in herpes simplex virus type 1 and 2 infection in British Columbia and the changing etiology of genital herpes. \u003cem\u003eSpringerM Gilbert, X Li, M Petric, M Krajden, JL Isaac-Renton, G Ogilvie, ML RekartCanadian Journal of Public Health, 2011\u0026bull;Springer\u003c/em\u003e, \u003cem\u003e102\u003c/em\u003e(3), 225\u0026ndash;229. https://doi.org/10.1007/BF03404902\u003c/li\u003e\n \u003cli\u003eGillis, P., Okagaki, L., virology, S. R.-J. of, \u0026amp; 2009, \u0026nbsp;undefined. (2009). Herpes simplex virus type 1 ICP27 induces p38 mitogen-activated protein kinase signaling and apoptosis in HeLa cells. \u003cem\u003eJournals.Asm.OrgPA Gillis, LH Okagaki, SA RiceJournal of Virology, 2009\u0026bull;journals.Asm.Org\u003c/em\u003e, \u003cem\u003e83\u003c/em\u003e(4), 1767\u0026ndash;1777. https://doi.org/10.1128/JVI.01944-08\u003c/li\u003e\n \u003cli\u003eGomathy, V., Manigandan, V., Vignesh, N., Thabitha, A., \u0026amp; Saravanan, R. (2021). Evaluation of antibacterial, teratogenicity and antibiofilm effect of sulfated chitosans extracted from marine waste against microorganism. \u003cem\u003eJournals.Sagepub.ComV Gomathy, V Manigandan, N Vignesh, A Thabitha, R SaravananJournal of Bioactive and Compatible Polymers, 2021\u0026bull;journals.Sagepub.Com\u003c/em\u003e, \u003cem\u003e36\u003c/em\u003e(3), 249\u0026ndash;258. https://doi.org/10.1177/08839115211014225\u003c/li\u003e\n \u003cli\u003eHamroush, A., \u0026amp; Welch, J. (2014). Herpes Simplex epithelial keratitis associated with daily disposable contact lens wear. \u003cem\u003eContact Lens and Anterior Eye\u003c/em\u003e, \u003cem\u003e37\u003c/em\u003e(3), 228\u0026ndash;229. https://doi.org/10.1016/J.CLAE.2013.11.007\u003c/li\u003e\n \u003cli\u003eHuang, Q., Hou, J., Yang, P., Yan, J., Yu, X., Zhuo, Y., He, S., \u0026amp; Xu, F. (2019). Antiviral activity of mitoxantrone dihydrochloride against human herpes simplex virus mediated by suppression of the viral immediate early genes. \u003cem\u003eSpringerQ Huang, J Hou, P Yang, J Yan, X Yu, Y Zhuo, S He, F XuBMC Microbiology, 2019\u0026bull;Springer\u003c/em\u003e, \u003cem\u003e19\u003c/em\u003e(1). https://doi.org/10.1186/S12866-019-1639-8\u003c/li\u003e\n \u003cli\u003eJames, C., Harfouche, M., Welton, N. J., Turner, K. M. E., Abu-Raddad, L. J., Gottlieb, S. L., \u0026amp; Looker, K. J. (2020). Herpes simplex virus: Global infection prevalence and incidence estimates, 2016. \u003cem\u003eBulletin of the World Health Organization\u003c/em\u003e, \u003cem\u003e98\u003c/em\u003e(5), 315\u0026ndash;329. https://doi.org/10.2471/BLT.19.237149\u003c/li\u003e\n \u003cli\u003eJayalakshmi, P. (2012). \u003cem\u003eStudies on morphometry, biochemical composition, collagen, chitin and chitosan derivatives from Sepia pharonis (Ehrenberg, 1831) from Pudhucerry Coast\u003c/em\u003e. Ph. D., Thesis, Annamalai University.\u003c/li\u003e\n \u003cli\u003eJiao, G., Yu, G., Zhang, J., \u0026amp; Ewart, H. S. (2011). Chemical structures and bioactivities of sulfated polysaccharides from marine algae. \u003cem\u003eMarine Drugs\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(2), 196\u0026ndash;233. https://doi.org/10.3390/md9020196\u003c/li\u003e\n \u003cli\u003eJin, F., Zhuo, C., He, Z., Wang, H., Liu, W., Zhang, R., \u0026amp; Wang, Y. (2015). Anti-herpes simplex virus activity of polysaccharides from Eucheuma gelatinae. \u003cem\u003eSpringer\u003c/em\u003e, \u003cem\u003e31\u003c/em\u003e(3), 453\u0026ndash;460. https://doi.org/10.1007/S11274-015-1798-1\u003c/li\u003e\n \u003cli\u003eKang, H. K., Seo, C. H., \u0026amp; Park, Y. (2015). The effects of marine carbohydrates and glycosylated compounds on human health. In \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e (Vol. 16, Issue 3, pp. 6018\u0026ndash;6056). https://doi.org/10.3390/ijms16036018\u003c/li\u003e\n \u003cli\u003eLiaqat, F., \u0026amp; Eltem, R. (2018). Chitooligosaccharides and their biological activities: A comprehensive review. In \u003cem\u003eCarbohydrate Polymers\u003c/em\u003e (Vol. 184, pp. 243\u0026ndash;259). https://doi.org/10.1016/j.carbpol.2017.12.067\u003c/li\u003e\n \u003cli\u003eLopatin, S. A., Ilyin, M. M., Pustobaev, V. N., Bezchetnikova, Z. A., Varlamov, V. P., \u0026amp; Davankov, V. A. (1995). Mass-spectrometric analysis of N-acetylchitooligosaccharides prepared through enzymatic hydrolysis of chitosan. \u003cem\u003eAnalytical Biochemistry\u003c/em\u003e, \u003cem\u003e227\u003c/em\u003e(2), 285\u0026ndash;288. https://doi.org/10.1006/abio.1995.1282\u003c/li\u003e\n \u003cli\u003eMaia, L. F., Gonzaga, T. A., Carvalho, R. G., Leite, C. M., Lobo-Hajdu, G., Aguiar, J. A. K., Edwards, H. G. M., \u0026amp; de Oliveira, L. F. C. (2016). Monitoring of sulfated polysaccharide content in marine sponges by Raman spectroscopy. \u003cem\u003eVibrational Spectroscopy\u003c/em\u003e, \u003cem\u003e87\u003c/em\u003e, 149\u0026ndash;156. https://doi.org/10.1016/j.vibspec.2016.10.002\u003c/li\u003e\n \u003cli\u003eMustafa, A., Cadar, E., \u0026amp; S\u0026icirc;rbu, R. (2020). Pharmaceutical uses of chitosan in the medical field. \u003cem\u003eEuropean Journal of Medicine and Natural Sciences\u003c/em\u003e, \u003cem\u003e3\u003c/em\u003e(2), 31\u0026ndash;36.\u003c/li\u003e\n \u003cli\u003eNgo, D. H., \u0026amp; Kim, S. K. (2014). Antioxidant effects of chitin, chitosan, and their derivatives. In \u003cem\u003eAdvances in Food and Nutrition Research\u003c/em\u003e (Vol. 73, pp. 15\u0026ndash;31). https://doi.org/10.1016/B978-0-12-800268-1.00002-0\u003c/li\u003e\n \u003cli\u003ePatel, S. (2012). Therapeutic importance of sulfated polysaccharides from seaweeds: updating the recent findings. \u003cem\u003e3 Biotech\u003c/em\u003e, \u003cem\u003e2\u003c/em\u003e(3), 171\u0026ndash;185.\u003c/li\u003e\n \u003cli\u003ePourianfar, H. R., Poh, C. L., Fecondo, J., \u0026amp; Grollo, L. (2012). In vitro evaluation of the antiviral activity of heparan sulfate mimetic compounds against Enterovirus 71. \u003cem\u003eVirus Research\u003c/em\u003e, \u003cem\u003e169\u003c/em\u003e(1), 22\u0026ndash;29. https://doi.org/10.1016/j.virusres.2012.06.025\u003c/li\u003e\n \u003cli\u003eRabinstein, A. A. (2017). Herpes virus encephalitis in adults: current knowledge and old myths. \u003cem\u003eNeurologic Clinics\u003c/em\u003e, \u003cem\u003e35\u003c/em\u003e(4), 695\u0026ndash;705.\u003c/li\u003e\n \u003cli\u003eRamachandran, S., Narasimman, V., \u0026amp; Rajesh, P. (2022). Low molecular weight sulfated chitosan isolation, characterization and anti-tuberculosis activity derived from Sepioteuthis lessoniana. \u003cem\u003eInternational Journal of Biological Macromolecules\u003c/em\u003e, \u003cem\u003e206\u003c/em\u003e, 29\u0026ndash;39. https://doi.org/10.1016/j.ijbiomac.2022.02.121\u003c/li\u003e\n \u003cli\u003eRamasamy, P., Subhapradha, N., Thinesh, T., Selvin, J., Selvan, K. M., Shanmugam, V., \u0026amp; Shanmugam, A. (2017). Characterization of bioactive chitosan and sulfated chitosan from Doryteuthis singhalensis (Ortmann, 1891). \u003cem\u003eInternational Journal of Biological Macromolecules\u003c/em\u003e, \u003cem\u003e99\u003c/em\u003e, 682\u0026ndash;691. https://doi.org/10.1016/j.ijbiomac.2017.03.041\u003c/li\u003e\n \u003cli\u003eSchnitzler, P., Schneider, S., Stintzing, F. C., Carle, R., \u0026amp; Reichling, J. (2008). Efficacy of an aqueous Pelargonium sidoides extract against herpesvirus. \u003cem\u003ePhytomedicine\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(12), 1108\u0026ndash;1116. https://doi.org/10.1016/j.phymed.2008.06.009\u003c/li\u003e\n \u003cli\u003eSpear, P., virology, R. L.-J. of, \u0026amp; 2003, \u0026nbsp;undefined. (2003). Herpesvirus entry: an update. \u003cem\u003eJournals.Asm.OrgPG Spear, R LongneckerJournal of Virology, 2003\u0026bull;journals.Asm.Org\u003c/em\u003e, \u003cem\u003e77\u003c/em\u003e(19), 10179\u0026ndash;10185. https://doi.org/10.1128/JVI.77.19.10179-10185.2003\u003c/li\u003e\n \u003cli\u003eSubhapradha, N., Ramasamy, P., Shanmugam, V., Madeswaran, P., Srinivasan, A., \u0026amp; Shanmugam, A. (2013). Physicochemical characterisation of \u0026beta;-chitosan from Sepioteuthis lessoniana gladius. \u003cem\u003eFood Chemistry\u003c/em\u003e, \u003cem\u003e141\u003c/em\u003e(2), 907\u0026ndash;913. https://doi.org/10.1016/j.foodchem.2013.03.098\u003c/li\u003e\n \u003cli\u003eSuwan, J., Zhang, Z., Li, B., Vongchan, P., Meepowpan, P., Zhang, F., Mousa, S. A., Mousa, S., Premanode, B., Kongtawelert, P., \u0026amp; Linhardt, R. J. (2009). Sulfonation of papain-treated chitosan and its mechanism for anticoagulant activity. \u003cem\u003eCarbohydrate Research\u003c/em\u003e, \u003cem\u003e344\u003c/em\u003e(10), 1190\u0026ndash;1196. https://doi.org/10.1016/j.carres.2009.04.016\u003c/li\u003e\n \u003cli\u003eSzymańska, E., drugs, K. W.-M., \u0026amp; 2015, \u0026nbsp;undefined. (2015). Stability of chitosan\u0026mdash;a challenge for pharmaceutical and biomedical applications. \u003cem\u003eMdpi.ComE Szymańska, K WinnickaMarine Drugs, 2015\u0026bull;mdpi.Com\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e, 1819\u0026ndash;1846. https://doi.org/10.3390/md13041819\u003c/li\u003e\n \u003cli\u003eVairamani, S., Subhapradha, N., Ramasamy, P., Raveendran, S., Srinivasan, A., \u0026amp; Shanmugam, A. (2013). Physicochemical characteristics and antioxidant efficacy of chitosan from the internal shell of spineless cuttlefish Sepiella inermis. \u003cem\u003eTaylor \u0026amp; Francis\u003c/em\u003e, \u003cem\u003e43\u003c/em\u003e(7), 696\u0026ndash;716. https://doi.org/10.1080/10826068.2013.773339\u003c/li\u003e\n \u003cli\u003eWardani, G., \u0026amp; Sudjarwo, S. A. (2018). In vitro antibacterial activity of chitosan nanoparticles against Mycobacterium tuberculosis. \u003cem\u003ePharmacognosy Journal\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(1).\u003c/li\u003e\n \u003cli\u003eWatson, R. J., \u0026amp; Clements, J. B. (1980). A herpes simplex virus type 1 function continuously required for early and late virus RNA synthesis. \u003cem\u003eNature\u003c/em\u003e, \u003cem\u003e285\u003c/em\u003e(5763), 329\u0026ndash;330. https://doi.org/10.1038/285329a0\u003c/li\u003e\n \u003cli\u003eWeller, S. K., \u0026amp; Coen, D. M. (2012). Herpes simplex viruses: Mechanisms of DNA replication. \u003cem\u003eCold Spring Harbor Perspectives in Biology\u003c/em\u003e, \u003cem\u003e4\u003c/em\u003e(9). https://doi.org/10.1101/cshperspect.a013011\u003c/li\u003e\n \u003cli\u003eXing, R., Liu, S., Yu, H., Zhang, Q., Li, Z., \u0026amp; Li, P. (2004). Preparation of low-molecular-weight and high-sulfate-content chitosans under microwave radiation and their potential antioxidant activity in vitro. \u003cem\u003eCarbohydrate Research\u003c/em\u003e, \u003cem\u003e339\u003c/em\u003e(15), 2515\u0026ndash;2519. https://doi.org/10.1016/j.carres.2004.08.013\u003c/li\u003e\n \u003cli\u003eYadu Nath, V., Raghvendra Kumar, M., Aswathy, V., Parvathy, P., Sunija, S., Neelakandan, M., Nitheesha, S., \u0026amp; Vishnu, K. (2017). Chitosan as promising materials for biomedical application: review. \u003cem\u003eRes. Dev. Mater. Sci\u003c/em\u003e, \u003cem\u003e2\u003c/em\u003e, 2576\u0026ndash;8840.\u003c/li\u003e\n \u003cli\u003eZhang, K., Helm, J., Peschel, D., Gruner, M., Groth, T., \u0026amp; Fischer, S. (2010). NMR and FT Raman characterisation of regioselectively sulfated chitosan regarding the distribution of sulfate groups and the degree of substitution. \u003cem\u003ePolymer\u003c/em\u003e, \u003cem\u003e51\u003c/em\u003e(21), 4698\u0026ndash;4705. https://doi.org/10.1016/j.polymer.2010.08.034\u003c/li\u003e\u003cbr/\u003e\u003cp\u003ePatent\u003c/p\u003e\u003cli\u003eSaravanan R, Vignesh N, Kumar Ebenezer K (2024) A process for extraction of low molecular weight sulfated chitosan from cephalopod waste Patent 5,24,634, 13 March.2024.\u003c/li\u003e\u003c/ol\u003e\n"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"LMW-SCH, NMR, MALDI-TOF, HSV-1, Anticoagulant, Antiviral activity","lastPublishedDoi":"10.21203/rs.3.rs-6715411/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6715411/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cb\u003eBackground\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThis research investigates the anticoagulant and antiviral properties of chitosan (CH), a non-toxic marine polymer derived from squid waste. Chitin was extracted from the gladius of \u003cem\u003eL. duvauceli\u003c/em\u003e and subsequently converted into CH. Following purification and freeze-drying, sulfated chitosan (SCH) was produced. To create low-molecular-weight sulfated chitosan (LMW-SCH), SCH was exposed to 100 Gy of gamma irradiation (GIR).\u003c/p\u003e\u003cp\u003e\u003cb\u003eResults\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe structural characteristics and molecular weight of LMW-SCH were analyzed using FT-IR, NMR, and MALDI-TOF/MS, which confirmed the transformation and reduction in molecular weight. In terms of anticoagulant activity, LMW-SCH exhibited prothrombin time (PT) and activated partial thromboplastin time (APTT) values of 1.93 IU/mg and 6.96 IU/mg, respectively, indicating its potential as an anticoagulant agent, although these values should be compared to standard heparin. The antiviral efficacy of LMW-SCH was assessed against herpes simplex virus type 1 (HSV-1) in vitro, revealing a CC\u003csub\u003e50\u003c/sub\u003e of 100 \u0026micro;g/ml, EC\u003csub\u003e50\u003c/sub\u003e value of 200 \u0026micro;g/ml and SI\u0026thinsp;=\u0026thinsp;0.5 in DMEM medium. Notably, LMW-SCH demonstrated a significant reduction in HSV-1 gene expression, suggesting a potential mechanism of action that warrants further investigation.\u003c/p\u003e\u003cp\u003e\u003cb\u003eConclusions\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThis study highlights the impact of GIR on the molecular weight and subsequent antiviral effectiveness of LMW-SCH, providing a foundation for future research into its therapeutic applications against HSV-1.\u003c/p\u003e","manuscriptTitle":"In vitro anticoagulant and antiviral properties of low molecular weight sulfated chitosan from Loligo duvauceli against herpes simplex virus","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-10 17:54:33","doi":"10.21203/rs.3.rs-6715411/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f48cf8c0-d268-4a60-9963-a680444cc6b7","owner":[],"postedDate":"June 10th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-08-06T02:29:30+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-10 17:54:33","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6715411","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6715411","identity":"rs-6715411","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00