LYN-mediated phosphorylation promotes TJP1 deubiquitination via USP8 to drive neovascularization and tumorigenesis in bladder cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article LYN-mediated phosphorylation promotes TJP1 deubiquitination via USP8 to drive neovascularization and tumorigenesis in bladder cancer XINGDING ZHANG, Xue-Qi Liu, ZHAOXIA DONG, Sze-Hoi Chan, Xiao-Yan Sang, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7928736/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract As a highly vascularized tumor, the recurrence and metastasis of bladder cancer (BLCA) are closely related to tumor angiogenesis. We previously identified that TJP1 as an important target in the regulation of BLCA vasculogenesis regulation. However, the molecular mechanisms and related signaling pathways still require characterization. In this study, we reported that the overexpression of deubiquitinase-USP8 obviously increased the expression and stability of TJP1, thereby promoting BLCA neovascularization. Mechanistically, USP8 competitively bound to TJP1, preventing the ubiquitin-mediated degradation of TJP1 by the E3 ligase TRIM21 through the TJP1 K695 site. Furthermore, LYN kinase-mediated phosphorylation of TJP1 played a key role in the ubiquitination regulation by USP8 and TRIM21, improving TJP1 stability. In addition, phosphorylated TJP1 significantly increased binding to TWIST1, thereby increasing the nuclear localization of TJP1/TWIST1 complex and thus promoting transcriptional activation of CCL2, ultimately leading to BLCA vascular remodeling. Moreover, the LYN inhibitor combined with the USP8 inhibitor obviously decreased the lung metastasis of BLCA cells in murine tumor models. In conclusion, our findings shed new light on the function of TJP1 function in BLCA and provide favorable evidence that TJP1 and its upstream molecules might be new targets for BLCA treatment. Biological sciences/Cancer/Tumour angiogenesis Biological sciences/Cell biology/Post-translational modifications/Ubiquitylation Biological sciences/Cell biology/Post-translational modifications/Phosphorylation Bladder cancer TJP1 Ubiquitination Phosphorylation Tumor angiogenesis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Bladder cancer is the most common malignancy of the urinary system and has a high mortality rate and a poor prognosis[ 1 ]. At present, no significantly effective molecular targeted anticancer drugs have been approved for the treatment of this extremely complicated disease[ 2 ]. In developing mammalian embryos, angioblasts differentiate into endothelial cells, which assemble into a reticular vessel, a process called vasculogenesis[ 3 ]. Tumor angiogenesis is a pathophysiological process that involves the formation of new blood vessels in the primary site of the tumor or distant organs. It is a typical hallmark of tumor development and metastasis, which helps the escaped cancer cells to metastasize across the distance by providing sufficient nutrition to the cancer cells to promote the growth and progression of tumors[ 4 ]. Therefore, targeting tumor angiogenesis has long been an alternative approach for cancer therapy. As bladder cancer is a highly vascularized tumor, its recurrence and metastasis are closely related to neovascularization[ 5 ], but the genetic basis of angiogenesis and the signaling pathways involved remain largely uncharacterized. Recently, we and others reported the function of TJP1 in tumor proangiogenesis that occurs mainly by TJP1 regulating the pathway of proangiogenic genes, the expression and transcriptional activity of these genes are directly regulated by TJP1 and ultimately promote tumor angiogenesis[ 6 , 7 ]. However, the way in which TJP1 is regulated in BLCA neovascularization and the specific underlying mechanism have not yet been determined. Although TJP1 has been reported to regulate its own stability by the proteasome pathway, the relevant ubiquitases and specific mechanism in tumor regulation have not been clarified[ 8 ]. Protein ubiquitination is a dynamic posttranslational modification involved in many processes. Ubiquitinases and deubiquitinases dynamically regulate the stability or activity of some key substrate proteins, thus participating in the pathogenesis of various diseases[ 9 ]. In recent years, accumulating evidence has established the fundamental role of ubiquitination regulation in cancer pathogenesis, and has revealed the high therapeutic potential of targeted ubiquitination in multiple cancers[ 10 ]. USP8 belongs to the USP/UBP family of deubiquitinating enzymes, which has been reported to directly or indirectly participate in the deubiquitination of particular substrates to affect the development of multiple cancers[ 11 , 12 ]. Previous studies have also shown that USP8 is continually overexpressed in a wide variety of cancers and that patients with cancers with high USP8 expression have lower overall survival, implying that USP8 is a potential therapeutic target in cancers[ 13 , 14 ]. However, whether USP8 is involved in BLCA angiogenesis by regulating the ubiquitination of targeted substrates has not been reported. Protein kinases play an important role in signal transduction by regulating protein activity through phosphorylation and amplifying signals step by step through a cascade of protein phosphorylation[ 15 ]. It has been shown that extracellular signals strictly regulate the ubiquitination of target proteins whose regulation in many cases depends on protein phosphorylation[ 16 ]. LYN is a Src family kinase (SFK), whose phosphorylation regulation occupies a decisive position in a variety of carcinogenic cell processes, including tumor cell migration, invasion and proliferation[ 17 ]. LYN-mediated tyrosine phosphorylation has been reported to be a prerequisite for the ubiquitination that dampens NLRP3 inflammasome activity[ 18 ]. In addition, LYN interacts with IRF5 to regulate its transcriptional activity by inhibiting the phosphorylation and ubiquitination of IRF5[ 19 ]. Recent findings have indicated that TJP1 has multiple kinase phosphorylation sites[ 20 ], suggesting that phosphorylation of TJP1 may also be involved in the regulation of ubiquitination of TJP1. However, whether phosphorylation of LYN kinase regulates ubiquitination of TJP1 and further influences angiogenesis and metastasis of bladder cancer is not yet known. In the current study, we have unveiled a new pathway that regulates TJP1 ubiquitination and stability that thereby enhances tumor neovascularization and promotes tumorigenesis. Our research identifies USP8 as a key upstream mediator of TJP1 involved in angiogenesis regulation in bladder cancer. USP8 competitively binds to TJP1 with TRIM21, preventing ubiquitination degradation at the K695 site of TJP1 and increasing its stability. Furthermore, we have also found that LYN kinase phosphorylates TJP1 to increase its interaction with USP8. Phosphorylated TJP1 facilitates nuclear entry and binding to TWIST1, thus enhancing the transcriptional regulation of the proangiogenesis gene CCL2, ultimately leading to BLCA progression. Taken together, these results reveal the deeper mechanism of TJP1 in BLCA neovascularization and elucidate the comprehension of the physiological tumor-associated function of the LYN–USP8–TJP1 axis in bladder cancer. Results USP8 promotes tumor angiogenesis in bladder cancer by interacting with TJP1 To enable the proteomic identification of deubiquitination enzymes (DUBs) modified with TJP1, we conducted purification and mass spectrometry analysis to identify TJP1-associated proteins. First, Flag-tagged TJP1 was stably expressed in 293T cells, and endogenous levels of TJP1 were expressed in T24 and 5637 BLCA cells. Whole-cell lysates were prepared and subjected to affinity purification using anti-Flag magnetic beads for exogenous TJP1 and TJP1 antibodies with protein A/G magnetic beads for endogenous TJP1 (Supplementary Fig. 1A). The mass spectrometry analysis revealed the copurification of various DUBs with TJP1, while USP8 prominently interacted with TJP1 in both exogenous and endogenous coprecipitation experiments (Supplementary Fig. 1B-C). Additionally, we also observed a strong pull-down interacting protein with a molecular weight of approximately 128 kDa in the Coomassie staining of the whole cell lysate, consistent with the known molecular weight of USP8[ 21 ]. To further confirm this interaction, we performed coimmunoprecipitation (co-IP) assays by cotransfecting HA-USP8 and Flag-TJP1 plasmids into 293T cells (Fig. 1 A). Likewise, endogenous co-IP and immunofluorescence (IF) assays verified the combination of USP8 and TJP1 in both T24 and 5637 cells (Fig. 1 B-C). To further elucidate the details of the molecular interaction between TJP1 and USP8, we constructed the different domains of TJP1 and identified the interacting domains using deletion segment analysis (Supplementary Fig. 1D). The results showed that the SFB3 mutant acquired stronger binding affinity with USP8, whereas others displayed sharply decreased binding affinity, which indicated that the GUK domain of TJP1 was essential for USP8 binding (Supplementary Fig. 1E). In addition, we found that the TJP1 protein levels were positively correlated with USP8 levels in BLCA tissues (n = 57, Spearman r = 0.3461, p = 0.0084) and for The Cancer Genome Atlas (TCGA) database BLCA data (n = 408, Spearman r = 0.708, p < 0.001) (Fig. 1 D-E). Therefore, these results suggest that TJP1 interacts with USP8 and that USP8 may be a potential regulator of TJP1 stability and its ability to facilitate tumor angiogenesis in bladder cancer. USP8 has been identified as marker of poor prognosis in several types of cancer[ 22 ]. In this study, we discovered that USP8 overexpression was associated with poor overall survival in BLCA patients (Fig. 1 F), implying that USP8 serves as a factor indicating a poor prognosis in BLCA. Our previous research has thoroughly documented that TJP1 is responsible for a protumor angiogenic role in bladder cancer. Thus, we were curious to investigate whether USP8 is involved in the regulation of BLCA angiogenesis. Our data showed significant enrichment in the angiogenic-related gene set in the BLCA patient subgroup with high USP8 expression (Fig. 1 G). Interestingly, the subgroup with high levels of USP8 also exhibited enrichment in TJP1 (Fig. 1 H). To provide additional evidence, neovascularization regulation of USP8 was performed in T24 and 5637 BLCA cells. Similar to TJP1, the USP8-specific inhibitor DUBs-IN-2[ 23 ], significantly suppressed tube formation in EA.hy926 cells cultured with conditioned medium (CM) derived from BLCA cells (Fig. 1 I, Supplementary Fig. 2A). To validate these results, we quantified of the number of meshes and the total segments length in the above results (Fig. 1 I, Supplementary Fig. 2A). Furthermore, a Matrigel plug assay was performed to assess whether USP8 promoted tumor angiogenesis in vivo (Supplementary Fig. 2B). The results showed obvious DUBs-IN-2 suppression of blood vessel development on the surface of the plugs, which also decreased the expression of the endothelial cell marker CD31 (Supplementary Fig. 2C-F). To further confirm whether USP8 plays a critical role in TJP1-regulated BLCA angiogenesis, we re-expressed TJP1 in USP8-silenced T24 and 5637 cells and monitored tumor angiogenesis with endothelial cells cultured using conditioned medium (CM) from the aforementioned cells. The tube formation assays revealed that overexpression of TJP1 restored the inhibition of tumor angiogenesis caused by USP8 knockdown (Fig. 1 J, Supplementary Fig. 2G). In addition, the increase in the number of blood vessels and CD31 expression in plugs containing TJP1-overexpressing cells were significantly eliminated by DUBs-IN-2 injection (Fig. 1 K-L, Supplementary Fig. 2H-I). In other words, inhibition of USP8 blocked the vascular abnormalities induced by TJP1 in BLCA. These successful rescue experiments affirmed that USP8 serves as the key upstream mediator of TJP1 in facilitating tumor angiogenesis and vascular abnormalization in bladder cancer. USP8 removes K48 and K63-linked ubiquitin conjugates from TJP1 to improve its stability Because TJP1 showed a short half-life in our previous study and given the verification of the interaction between TJP1 and USP8, we hypothesized that USP8 regulates TJP1 expression and stability. We first detected TJP1 expression with USP8 interference in BLCA cells. The results indicated that USP8 knockdown effectively decreased TJP1 expression after treatment with either USP8 siRNAs or the USP8 inhibitor DUBs-IN-2[ 11 ] (Fig. 2 A-B), whereas, TJP1 levels were remarkably upregulated upon USP8 overexpression (Fig. 2 C). To further determine the possible regulatory effect of USP8 on TJP1 stability, we utilized cycloheximide (CHX) to inhibit protein synthesis and analyzed the protein half-life of TJP1 in the case of USP8 overexpression or knockdown in T24 and 5637 cells. Notably, overexpression of USP8 led to a prolonged half-life of endogenous TJP1 levels (Fig. 2 D-E), whereas depletion of USP8 resulted in the opposite phenomenon (Fig. 2 F-G). USP8 is a classical deubiquitylase that can remove the ubiquitin chain from its substrate[ 24 ], as USP8 binds to and positively regulates TJP1 protein stability. We hypothesized that USP8 might increase TJP1 stability via deubiquitylation. To date, TJP1 ubiquitination has never been reported in the previous literature. To determine whether USP8 was responsible for TJP1 deubiquitination, we performed an immunoprecipitation assay to detect TJP1 ubiquitination, and the precipitates were detected as smear bands as previously reported[ 25 ]. We found that TJP1 was ubiquitinated after cotransfection with the Ub and TJP1 plasmids in T24 and 5637 cells. Intriguingly, USP8 overexpression removed TJP1 ubiquitination (Fig. 2 H). Conversely, knockdown of USP8 significantly increased the ubiquitination of TJP1 (Fig. 2 I). Therefore, these results suggested that USP8 was the specific deubiquitylase for TJP1, which enhanced the protein stability of TJP1 through deubiquitination. The role of USP8 in stabilizing the substrate through its deubiquitination enzyme activity may depend on which type of ubiquitin chain is removed from the substrate[ 22 ]. USP8 was reported to regulate protein degradation function by antagonizing K48- or K63-linked ubiquitination primarily through deubiquitination enzyme activity[ 26 ]. It has been well determined that the K48- and K63-linked Ub chains mainly target proteasome degradation and lysosome degradation or various signaling pathways, respectively. As shown in Fig. 2 J-K, we found that the proteasome inhibitor MG132 as well as the lysosome inhibitor Baf. A1 dramatically increased TJP1 protein levels. Notably, treatment with MG132 and Baf. A1 also rescued the TJP1 protein levels resulting from USP8 knockdown in T24 and 5637 cells (Fig. 2 L-M), suggesting that USP8 stabilized TJP1 protein expression both through the proteasome and lysosome pathways. To further identify the preferentially targeted Ub linkages conjugated to TJP1 by USP8, we generated a series of HA-tagged Ub mutants that had only one single lysine (K) with all other lysine residues mutated to arginine. K48 and K63 mutants were cotransfected with the Flag-TJP1 plasmid into 293T cells, and the TJP1 degradation pathway was evaluated by immunoprecipitation assay and then subjected to western blotting with an anti-HA antibody to clarify the level of each K-linkage-conjugated TJP1. We found that both the K48 and K63 chains significantly promoted TJP1 ubiquitination, which was consistent with the function of nonmutant Ub (Fig. 2 N). Furthermore, USP8 overexpression preferentially removed TJP1 ubiquitinated at K63 and K48 (Fig. 2 O), indicating that USP8 stabilized the TJP1 protein mainly through K48- and K63-associated lysosomal and proteasome degradation pathways. USP8 accelerates BLCA angiogenesis by deubiquitinating TJP1 at the Lys695 site To confirm the lysine site that is deubiquitinated by USP8, we applied a deep-learning tool, ‘UBiprober’[ 27 ], to predict the ubiquitination sites that might be ubiquitinated by TJP1 and found 17 possible lysine sites (Fig. 3 A). We next sought to identify the specific sites on TJP1 through mass-spectrometric analysis. By cotransfecting 293T cells with Flag-TJP1 and HA-Ub plasmids, Flag-TJP1 was purified, and the lysine residues on TJP1 were modified by ubiquitination. Four ubiquitination sites, K502, K529, K695 and K1709, were identified (Fig. 3 B-C and Supplementary Fig. 3A). To validate the authenticity of the ubiquitination sites, we created individual point mutants where both lysine residues at positions K502, K529, K695 and K1709 were replaced with arginine. These mutants were transfected into 293T cells together with Flag-TJP1 and HA-Ub. The results showed that the TJP1-K695R mutant had a substantial reduction in the overall ubiquitination compared to the wild-type TJP1 (Fig. 3 D). In addition, there was no detectable ubiquitination in the double mutant of where both lysine residues were at position K695 and one of the other three sites (Fig. 3 E), suggesting that K695 was likely the major ubiquitination site on TJP1. Moreover, K695 was also the predicted ubiquitination site. Interestingly, K695 is located in the GUK domain known to be involved in the interaction with USP8. More importantly, we found that USP8 overexpression failed to abolish TJP1 ubiquitination when the K695 site was mutated (Fig. 3 F), indicating that USP8 regulated TJP1 deubiquitination mainly through the K695 site. In addition, we found that USP8 overexpression did not prolong the half-life of TJP1-K695R more than with wild-type TJP1 (Fig. 3 G and Supplementary Fig. 3B). The tube formation assay also showed that the increased vascular formation caused by TJP1 and USP8 was significantly inhibited by TJP1 K695R (Fig. 3 H-I). Meanwhile, K695 mutation also inhibited the transcriptional activation of CCL2 caused by TJP1 and USP8 overexpression (Supplementary Fig. 3C), which was based on our previous finding that TJP1 promoted the transcriptional activation of CCL2 in BLCA. Collectively, these results indicated that USP8 promoted the stability of TJP1 and tumor angiogenesis by deubiquitination TJP1 at the K695 site. TRIM21 competes with USP8 to degrade TJP1 in BLCA cells Notably, ubiquitination is a reversible regulatory process that involves in various kinds of ubiquitin-related enzymes; therefore, the protein ubiquitination catalyzed by deubiquitination enzymes can be reversed by E3 ubiquitin ligases[ 28 ]. As a consequence, a specific E3 ubiquitin ligase may exist that can reverse the deubiquitination of TJP1 by USP8. Interestingly, the TJP1 protein-binding mass spectrometry assay in our previous study revealed that multiple E3 ubiquitin ligases were precipitated (Supplementary Table 1). We found that most of these ligases were members of the TRIM family of proteins, including TRIM25, TRIM27 and TRIM32 (Supplementary Fig. 4A). We further corroborated their interaction with TJP1 by co-IP assays (Supplementary Fig. 4B). Unfortunately, these E3 ubiquitin ligases neither steadily inhibited TJP1 expression nor increased ubiquitin-mediated degradation by the proteasome pathway (Supplementary Fig. 4C-E), indicating that none of them were the specific E3 ubiquitin ligases for TJP1. Gap junction protein Connexin43 and autophagy junction protein SQSTM1/p62 have been reported to be regulated by the dynamic ubiquitination of the deubiquitination enzyme USP8 and the E3 ubiquitin ligase TRIM21[ 26 , 29 – 31 ], suggesting that USP8 and TRIM21 may be a pair of ubiquitination enzymes and deubiquitination enzymes that regulate the ubiquitination of substrates. Notably, although no TRIM21 interaction was detected in TJP1 binding mass spectrometry assay, TRIM21 was shown to interact with Flag-tagged TJP1 in the co-IP assays (Supplementary Fig. 4B). Thus. we hypothesized that TRIM21 might be involved in the ubiquitination of TJP1 together with USP8, thus participating in angiogenesis regulation in bladder cancer. On the basis of these data, the potential role of TRIM21 as an E3 ligase for TJP1 was investigated. We first further verified the endogenous binding of TRIM21 and TJP1 in T24 and 5637 cells (Fig. 4 A). In addition, TRIM21 overexpression significantly reduced the TJP1 protein levels (Fig. 4 B). Moreover, ectopic expression of TRIM21 significantly shortened the protein half-life of TJP1 in T24 and 5637 cells, suggesting that TRIM21 destabilized TJP1 at the posttranslational level (Fig. 4 C). Consistent with this outcome, we found that TRIM21 significantly increased TJP1 ubiquitination degradation (Fig. 4 D), demonstrating that TJP1 was the bona fide substrate of TRIM21 in BLCA cells. Since protein ubiquitination is an instantaneous and dynamic regulatory process, we further explored whether USP8 and TRIM21 competitively bind TJP1 to achieve dynamic ubiquitination regulation of TJP1. Intriguingly, TRIM21 competed with USP8 to bind to TJP1, and vice versa (Fig. 4 E). Consistently, overexpression of TRIM21 restored the inhibition of TJP1 ubiquitination induced by USP8 (Fig. 4 F), indicating that TRIM21 competitively bound to TJP1 and attenuated the effect of USP8 on TJP1 deubiquitination. Because USP8 deubiquitinates TJP1 at the Lys695 site, we next sought to examine whether TRIM21 promoted TJP1 ubiquitination degradation through its K695 site. Notably, the promotion of ubiquitination degradation of TJP1 by TRIM21 was significantly blocked by the K695 mutation of TJP1 (Fig. 4 G), revealing that the ubiquitination function of TRIM21 on TJP1 could indeed be regulated by the K695 site of TJP1, which further indicated the competitive dynamic ubiquitination effect of USP8 and TRIM21 on TJP1. Taken together, these data suggested that, by competing with USP8, TRIM21 bound to and degraded TJP1 in bladder cancer cells. We then explored whether TRIM21 was involved in bladder cancer angiogenesis through TJP1 and thus affected tumor progression. By analyzing the relationship between TRIM21 expression and the overall survival of BLCA patients utilizing data in the TCGA database, we found that higher levels of TRIM21 were associated with higher overall survival in the TCGA database (Supplementary Fig. 4F), illustrating that in contrast to TJP1 and USP8, TRIM21 might play a role as a tumor suppressor in the development of BLCA. Next, we performed a tube formation assay to determine the function of TRIM21 in the regulation of BLCA angiogenesis. Our results demonstrated that overexpression of TRIM21 significantly inhibited the ability of endothelial cells to form vascular-like network structures in T24 and 5637 cells (Fig. 4 H-I), indicating that TRIM21 overexpression inhibited BLCA angiogenesis. Additionally, we have observed that the promotion of tumor angiogenesis induced by silenced TRIM21 expression was obviously blocked by knockdown of TJP1 (Fig. 4 J-K). As a consequence, these results supported the notion that TRIM21 suppressed BLCA angiogenesis largely through accelerating the ubiquitination degradation of TJP1, resulting in limited activation of the proangiogenesis signaling pathway. LYN phosphorylation of TJP1 increases TJP1 stability and nuclear localization. Ubiquitination of target proteins is strictly regulated by extracellular stimuli, which, in many cases, are dependent upon protein phosphorylation[ 32 ]. Importantly, the regulatory steps affected by phosphorylation may involve substrate recognition or actual coupling reactions by ubiquitin-associated enzymes[ 16 ].This prompted us to explore a potential association between the phosphorylation and ubiquitination of TJP1. TJP1 is known to undergo phosphorylation, thus regulating the multivalent interaction of the conserved PDZ-SH3-GUK supra-domain[ 20 ]. Our mass spectrometry analysis revealed that an Src family kinase, LYN, interacted with endogenous TJP1 (Fig. 5 A). Additionally, LYN was coprecipitated with TJP1 from the cell lysates (Fig. 5 B), indicating a specific association between them, which further suggests that TJP1 might be phosphorylated by LYN and might ulteriorly participate in the regulation of its ubiquitination. To test whether TJP1 could be a phosphorylation substrate of LYN kinase, we used a specific phospho-tyrosine antibody to examine the phosphorylation status of TJP1 immunoprecipitated from cells. We found that no tyrosine phosphorylation of TJP1 was detected without transfection with LYN, whereas LYN activation displayed an obvious phosphorylation state (Fig. 5 C). Intriguingly, consistent with LYN inhibition by the Saracatinib inhibitor, depletion of endogenous LYN using targeting siRNAs strikingly suppressed TJP1 tyrosine phosphorylation levels (Fig. 5 C). Saracatinib has been reported to be a specific Src inhibitor that effectively inhibits LYN kinase activity[ 33 ]. In addition, LYN has been reported to have a kinase activation site[ 34 , 35 ]. We constructed LYN mutant, which carrying a phenylalanine substitution at Y397 that impairs the phosphorylation of LYN in its activation loop, thereby blocking its kinase activity. Accordingly, the kinase-inactive LYN mutant attenuated tyrosine phosphorylation of TJP1 (Fig. 5 D). These results suggested that the phosphorylation of TJP1 at tyrosine residues was regulated by LYN. In addition, we also determined the tyrosine phosphorylation status of USP8 mediated by LYN, and the results indicated that neither LYN overexpression nor silenced LYN levels could further alter USP8 tyrosine phosphorylation (Supplementary Fig. 5A). To examine the functional effect of LYN-mediated phosphorylation of TJP1 in regulating TJP1 ubiquitination, we first assessed whether LYN affected the combination of USP8 and TJP1. Interestingly, overexpression of LYN significantly increased the binding of USP8 with TJP1, while LYN knockdown or inhibition its kinase activity obviously suppressed conjugation (Fig. 5 E and Supplementary Fig. 5B). In addition, we performed an immunofluorescence assay and found that the colocalization between USP8 and TJP1 was also visibly restrained by LYN mutations (Fig. 5 F and Supplementary Fig. 5C). The above results suggested that LYN-activated phosphorylation may participate in USP8-dependent deubiquitination of TJP1. In line with this, we found that LYN increased the deubiquitination of USP8 on TJP1, but not of LYN mutants (Fig. 5 G and Supplementary Fig. 5D). Besides, the K695 mutation of TJP1 blocked the LYN-mediated deubiquitination of USP8 on TJP1 (Supplementary Fig. 5E), suggesting that LYN was indeed involved in the regulation of TJP1 ubiquitination through its kinase activity. Since our previous research indicated that USP8 and TRIM21 competitively bound TJP1 and dynamically regulated its ubiquitination, we further examined the effect of LYN phosphorylation on the affinity for TJP1 and TRIM21. Intriguingly, incubation with LYN markedly decreased the binding of TJP1 with TRIM21 (Fig. 5 H). Accordingly, LYN overexpression inhibited the ubiquitination degradation of TJP1 by TRIM21, whereas, TRIM21 blocked the deubiquitination of TJP1 by LYN (Fig. 5 I and Supplementary Fig. 5F). Collectively, these data provide evidence that LYN-mediated phosphorylation promotes TJP1 deubiquitination by specifically enhancing the USP8–TJP1 interaction. The TJP1 phosphorylation state has been previously linked to tight-junction formation, and phosphorylated TJP1 weakens tight junctions and may increase cytoplasmic and nuclear localization[ 36 ]. In the present study, LYN phosphorylated TJP1 in both the cytoplasm and nucleus (Fig. 5 J). Nevertheless, by separating cell components (cytoplasm and nucleus) to observe the distribution of TJP1 in cells, we found that LYN phosphorylation increased the nuclear localization of TJP1 in T24 and 5637 cells, while LYN mutation inhibited TJP1 translocation into the nucleus (Fig. 5 K and Supplementary Fig. 5G). The same results were found by immunofluorescence experiments (Fig. 5 L and Supplementary Fig. 5H), indicating that phosphorylated TJP1 was more likely to enter the nucleus and influence in the development of bladder cancer. Our previous results indicated that TJP1 plays a vital role in TWIST1 transcriptional activation and thus promotes tumor angiogenesis in BLCA[ 6 ]. Therefore, exploring the details of TJP1/TWIST1 complex action might be important in elucidating the profound mechanisms of TJP1 in the regulation of BLCA vasculogenesis. We thus explored whether LYN’s regulation of TJP1 phosphorylation affected the combination and nuclear localization of TJP1 and TWIST1. Co-IP results indicated that phosphorylation of TJP1 significantly increased the cytoplasmic and nuclear binding of TJP1 and TWIST1, while LYN mutants obviously inhibited the colocalization of both (Fig. 5 M). In addition, we performed an immunofluorescence assay and found that the colocalization of TJP1 and TWIST1 was visibly restrained by the LYN mutations (Fig. 5 N and Supplementary Fig. 5I). Accounting for the interaction between TJP1 and TWIST1, these results suggested that LYN modulated the binding of TJP1 and TWIST1 by promoting the phosphorylation of TJP1 to further influence downstream transcriptional activity regulated by TWIST1. As a consequence, we analyzed the transcriptional activity of CCL2 and found that overexpression of LYN further increased TJP1-facilitated TWIST1-induced transcriptional activation of CCL2; accordingly, LYN mutants blocked the above effect caused by LYN overexpression (Supplementary Fig. 5J). In conclusion, our results demonstrated that, phosphorylation of TJP1 by LYN promoted the nuclear localization of TJP1 and increased the interaction between TJP1 and TWIST1. In addition, while TJP1 interacted with TWIST1 in the nucleus, LYN was transported to the nucleus as a complex with TJP1, which further phosphorylated TJP1 and then activated TJP1-induced transcriptional activation of CCL2 through TWIST1. LYN-mediated phosphorylation of TJP1 is involved in tumor angiogenesis in BLCA As mentioned above, LYN phosphorylated TJP1 and increased its interaction with USP8 to increase its stability. In addition, phosphorylated TJP1 promoted the transcriptional activation of CCL2 by TWIST1. Finally, we explored whether LYN's regulation of TJP1 phosphorylation might influence the role of TJP1 in the regulation of angiogenesis in bladder cancer. First, we examined the role of LYN kinase activity in regulating TJP1 expression in bladder cancer. This result indicated that the increased concentration of Saracatinib significantly inhibited TJP1 expression but had little effect on LYN levels (Fig. 6 A). Besides, LYN kinase-inactive mutants blocked the effect of LYN in facilitating TJP1 expression (Fig. 6 B), implying that LYN increased the expression and stability of TJP1 through its kinase activity. We subsequently investigated the role of LYN kinase activity in regulating BLCA angiogenesis in vivo and in vitro . We found that tube formation was obviously decreased when EA.hy926 cells were incubated with CM derived from Saracatinib-treated T24 and 5637 cells (Fig. 6 C and Supplementary Fig. 6A). Additionally, blood vessel formation on the plug surface was greatly suppressed after Saracatinib treatment, accordingly accompanied by a decrease in CD31 staining (Fig. 6 D-E and Supplementary Fig. 6B-D). Unexpectedly, there was also an apparent decrease in the expression of LYN in Saracatinib plugs, suggesting that long-term Saracatinib injection may reduce the protein levels of LYN (Fig. 6 E and Supplementary Fig. 6D). In addition, we found that the decreased vascular formation in EA.hy926 cells cultured with CM derived from Saracatinib-incubated BLCA cells was greatly restored by overexpression of USP8 and TJP1 (Fig. 6 F and Supplementary Fig. 6E). Moreover, LYN further promoted USP8- and TJP1-induced BLCA angiogenesis, while which was blocked by phosphorylated mutants of LYN (Fig. 6 G and Supplementary Fig. 6F). In line with this, we also investigated the effect of LYN kinase activity on CCL2 transcriptional activity based on USP8 and TJP1 transfection. As expected, compared to wild-type LYN, LYN mutants evidently decreased the transcriptional activation of CCL2 (Fig. 6 H). Collectively, these data provide evidence that LYN-mediated phosphorylation promotes TJP1-induced BLCA angiogenesis by specifically enhancing the USP8-TJP1 interaction. Given the evidence that LYN kinase activity regulates neovascularization in bladder cancer, we performed a gene set enrichment analysis (GSEA) analysis to explore the correlation between LYN expression and the BLCA TCGA angiogenic gene set. The results indicated that BLCA patients in the LYN high expression subgroup were obviously enriched in the angiogenic-related gene set (Supplementary Fig. 6G). Moreover, we found that the expression of LYN in BLCA tumors was significantly higher than that in adjacent tissues (Supplementary Fig. 6H). In addition, LYN upregulation was associated with poor overall survival in patients with BLCA (Supplementary Fig. 6H), suggesting that similar to TJP1 and USP8, LYN was also a factor indicating poor prognosis in bladder cancer progression. The LYN-mediated USP8–TJP1 complex could be targeted for treating BLCA The above results suggested that LYN promoted the phosphorylation of TJP1 to increase its interaction with USP8, improving TJP1 expression and stability, and further facilitating the nuclear colocalization of TJP1 and TWIST1. This entire signaling pathway provides multiple possible therapeutic targets for BLCA. Given the important role of tumor angiogenesis in BLCA metastasis, we next investigated the effect of the LYN-mediated USP8–TJP1 complex on tumor metastasis. As shown in Fig. 7 A, transwell assays revealed that both LYN and USP8 inhibitors significantly inhibited the ability of cell migration, while the inhibition of cell migration by Saracatinib combined with DUBs-IN-2 was reversed in cells that overexpressed TJP1, indicating that TJP1 was involved in LYN- and USP8-modified tumor metastasis in the BLCA cells. In addition, we found that both Saracatinib and DUBs-IN-2 significantly inhibited colony formation in T24 and 5637 cells, while overexpressed LYN and USP8 gave the opposite results (Supplementary Fig. 7A-D). Next, we carried out an in vivo metastasis model to further determine the role of LYN and USP8 in BLCA metastasis. Consistent with the in vitro results, the tail vein assay data showed that the Saracatinib combined with DUBs-IN-2 significantly suppressed pulmonary metastasis in mice, as confirmed by HE staining and immunohistochemistry (IHC) staining of Ki67 and as evidenced by the reduced lung colonization compared to either each agent alone or the control (Fig. 7 B-C and Supplementary Fig. 7E). Together, our results suggested that LYN and USP8 inhibition may augment the antitumor efficacy of TJP1 overexpression-induced angiogenesis leading to tumor metastasis in patients with BLCA. On the basis of the above results, we also examined whether LYN, USP8 and TJP1 levels were clinically relevant to bladder cancer. The IHC results indicated that LYN expression was positively correlated with USP8 and TJP1 levels in BLCA patients (Fig. 7 D). The analysis of LYN with USP8 and TJP1 utilizing data from the TCGA database further reinforced the above results (Fig. 7 E). In addition, we divided the BLCA samples from TCGA database into LYN high /USP8 high /TJP1 high and LYN low /USP8 low /TJP1 low group according to the median expression of each of the three genes, the distribution of two groups with clinicopathological parameter in BLCA patients was analyzed. We found that the malignant degree of T category and the N category were positively correlated with the expression of LYN–USP8–TJP1 of BLCA patients, while the distribution of M category and stage category was not distinctly different between the two groups (Fig. 7 F and Supplementary Fig. 7F). More importantly, the survival rate of LYN high /USP8 high /TJP1 high group was significantly lower than that of the group with low expression of all three (Fig. 7 G). Taken together, these results support the targeting of the LYN-mediated USP8–TJP1 complex for antitumor therapy in bladder cancer. Discussion In this study, we uncovered a molecular mechanism involving the reciprocal regulation of TJP1 through phosphorylation and ubiquitination, impacting vasculogenesis and metastasis in bladder cancer. Our research revealed that USP8 plays a crucial role in stabilizing TJP1 expression and promoting BLCA angiogenesis in a TJP1-dependent manner. Mechanistically, USP8 binds to TJP1, preventing ubiquitin-mediated degradation at the TJP1 K695 site. Additionally, USP8 competes with TRIM21 for binding to TJP1, effectively reversing the TRIM21-induced ubiquitination of TJP1. In addition, LYN-mediated phosphorylation of TJP1 alters its function, making it easier to bind to USP8 while inhibiting interaction with TRIM21. This sequential process enhances TJP1 stability, increases its binding to TWIST1, promotes the nuclear localization of the TJP1/TWIST1 complex, and ultimately elevates CCL2 transcription levels. This cascade of events accelerates tumor angiogenesis and metastasis (Fig. 8 ). Our study revealed that USP8 and TRIM21 regulate TJP1 ubiquitination, specifically at the K695 residue within GUK domain of TJP1 (Fig. 3 and Fig. 4 ). These findings underscore the importance of the GUK domain in the posttranslational modification of TJP1 and its involvement in tumor angiogenesis[ 37 ]. Notably, in addition to TJP1, other members of the tight junction protein family, such as TJP2 and TJP3, also feature a GUK domain[ 38 ]. Although our previous experiments confirmed that USP8 is the specific deubiquitinase of TJP1, the interaction between USP8 and TJP2/TJP3 has not been thoroughly studied. Therefore, elucidating the role of USP8 in stabilizing TJP1 expression and further inhibiting the ubiquitination degradation of TJP1 may provide some insights into the posttranslational modification function of TJP2/TJP3 and its participation in the regulation of tumor signaling pathways. In addition, we demonstrated that USP8 inhibites the degradation of TJP1 at the K695 residue, further promoting angiogenesis in BLCA (Fig. 3 D–K and Supplementary Fig. 3B). Notably, the mutation of the K695 residue of TJP1 significantly inhibits the transcriptional activation of the proangiogenic factor CCL2 by TJP1 (Supplementary Fig. 3C). We reported that TJP1 increases CCL2 secretion and promotes the recruitment of tumor-associated macrophages to the tumor microenvironment. Given that abnormal angiogenesis is necessary for tumor metastasis and invasion[ 39 , 40 ], mutating the K695 residue of TJP1 may represent a potential approach to inhibit the tumor microenvironment and distant metastasis of BLCA cells. However, whether mutation of the K695 residue of TJP1 directly regulates tumor cytokine secretion and immune cell recruitment is still worthy of further study. On the basis of our previous studies, we reported that TJP1 has a short half-life in BLCA cells and that its stability is regulated by the ubiquitin‒proteasome pathway. In addition, by studying the posttranslational modification of TJP1, we identified various phosphorylation sites, and multiple relevant protein kinases through LC‒MS/MS analysis (Supplementary Table 2). Over the years, there has been evidence of a variety of links between ubiquitination and phosphorylation, with the ubiquitination of target proteins being tightly regulated by extracellular stimuli, and in many cases, this regulation is dependent on protein phosphorylation[ 18 , 41 ]. Our results indicated that the absence of LYN, which completely abolishes TJP1 tyrosine phosphorylation, also inhibits the binding of TJP1 and USP8 (Fig. 5 C and Supplementary Fig. 5B). Consistent with these findings, inhibition of LYN kinase decreases the combination of TJP1 and USP8, and further reduces TJP1 stability by using LYN kinase mutant plasmid (LYN-Y397F) (Fig. 5 D, E-F and Supplementary Fig. 5C). Although both sites were reported to be LYN kinase inactivation sites, our results indicated that the Y397 mutation completely blocks LYN autophosphorylation,(Fig. 5 D, J). Notably, the phosphorylation of TJP1 by LYN significantly reduces the interaction of TJP1 with TRIM21, thereby inhibiting the ubiquitin-mediated degradation of TJP1 (Fig. 5 H-I and Supplementary Fig. 5F). Consequently, our data collectively indicated that tyrosine phosphorylation of TJP1 significantly increases TJP1 deubiquitination, providing a molecular mechanism through which TJP1 tyrosine phosphorylation increases the stability of TJP1, thereby inhibiting the ubiquitination-mediated degradation of TJP1 and further promoting angiogenesis in BLCA. It is possible that tyrosine phosphorylation of TJP1 facilitates the recognition and recruitment of the deubiquitination enzyme (USP8) to act on the ubiquitination site of TJP1, increasing its stability. This notion is supported by the stronger affinity of phosphorylated TJP1 for USP8 than for TRIM21. While our understanding of the regulation of TJP1 ubiquitination/deubiquitination is relatively advanced, much remains to be explored regarding how TJP1 phosphorylation affects its ubiquitination system. TJP1 is known to undergo tyrosine phosphorylation[ 42 , 43 ], and the tyrosine phosphorylation of ZO proteins has been reported to be linked to tight junction formation. Phosphorylated TJP1 weakens junctional sealing and increases paracellular permeability[ 44 , 45 ]. Studies have shown that TJP1 can accumulate within the cell nucleus and that the nuclear localization of TJP1 is inversely proportional to the degree of cell contact and/or maturity[ 46 , 47 ]. Therefore, we suspect that phosphorylated TJP1 is more likely to enter the nucleus and participate in downstream cell signal transduction regulation. We demonstrated that TJP1 undergoes tyrosine phosphorylated by LYN kinase and that the phosphorylation of TJP1 increases the nuclear localization of TJP1 (Fig. 5 K and Supplementary Fig. 5G). Although we predicted several potential LYN kinase phosphorylation sites for TJP1 (Supplementary Table 3), further investigation is needed to clarify the specific tyrosine residues at which TJP1 is phosphorylated by LYN. Notably, TJP1 contains two lysine-rich stretches of amino acids in the PDZ and GUK domains, which may serve as putative as nuclear localization sequences (NLSs), allowing TJP1 to enter the nucleus and regulate nuclear processes associated with changes in cell transcription status[ 46 ]. Additionally, the nuclear localization of TJP1 suggests its role in transcriptional regulation[ 48 ]. As a consequence, the phosphorylation status of TJP1 and specific sites of TJP1 that are phosphorylated by LYN may affect the function of TJP1 NLS sequences. Alternatively, the phosphorylation of ZO proteins by different kinases may control their specific interactions with other molecules, such as Occludin and Connexin 43[ 49 , 50 ]. Moreover, this phosphorylation could regulate the organization and signal transduction capacity of the scaffold[ 51 ]. Therefore, phosphorylated TJP1 may function as a scaffold to recruit transcription factors or transcription coactivating complexes, a function that could be abrogated by LYN kinase inactivation. In line with these possibilities, we found that LYN-mediated TJP1 phosphorylation significantly increases TWIST1 binding and further facilitates TWIST1-mediated transcriptional activation of CCL2 (Supplementary Fig. 5J). The identification of USP8 and TRIM21 as specific ubiquitin-related enzymes of TJP1, along with LYN as the kinase that regulates TJP1 phosphorylation, not only elucidates the molecular mechanism of TJP1 protein stability but also sheds light on how phosphorylation mediated by TJP1 affects ubiquitination in the regulation of angiogenesis and metastasis in BLCA. These findings concerning the molecular mechanism of TJP1 increase our understanding of how TJP1 regulates tumor angiogenesis and metastasis and provide strong evidence for the potential of TJP1 as a therapeutic target for the treatment of BLCA. Materials and Methods Cell culture and regents T24 (ATCC HTB-4) and 5637 (ATCC HTB-9) human bladder cancer cells were kindly provided by Professor Kang from Sun Yat-sen University Cancer Center, which were cultured in 1640 supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin solution. 293 (ATCC CRL-11268) cells obtained from ATCC were cultured in high-glucose DMEM supplemented with 10% fetal bovine serum. EA.hy926 (ATCC CRL-2922) cells purchased from Conservation Genetics CAS Kunming Cell Bank were cultured in DMEM/F-12 medium (Gibco, 11320033) supplemented with 10% fetal bovine serum. All cell lines were maintained in 5% CO 2 at 37℃ and revalidated before using. Patients The patients admitted to the Fifth Affiliated Hospital of Sun Yat-sen University was described as urothelial carcinoma according to international guidelines. The 57 samples were randomly collected with informed consent, the Ethics Committee of Sun Yat-sen University approved the ethical use of human subjects in this study. Western blot assay Cells were harvested and lysed in RIPA buffer (150 mM NaCl, 50 mM Tris-HCL, pH 7.4, 2 mM EDTA, 1% NP-40, 1% SDS) containing the protease inhibitor cocktail (Roche Diagnostics Deutschland Gmbh, 05892970001), for phosphorylation assay detection, phosphorylation inhibitor (Roche Diagnostics Deutschland Gmbh, 4906845001) was supplemented into RIPA buffer before extracted. The total protein concentration was detected using the Bradford Protein Assay kit (Thermo, 23236) and equivalent protein quantities were subjected to SDS-PAGE then transferred to PVDF membranes (Millipore, ISEQ00010). The membranes were blocked in 5% skim milk (BD Difco, 232100) for 1 hour at room temperature and then probed with the primary antibodies, followed by the corresponding HRP-conjugated anti-mouse/rabbit secondary antibodies. The immunoreactive bands were visualized with the Enhanced chemiluminescence (ECL) detection kit (NCM biotech, P10300). The antibodies were as follows: TJP1 (Abcam, ab216880), USP8 (Abcam, ab228572), LYN (Proteintech, 60211-1-Ig), p-Tyrosine (CST, 9411S), TRIM21 (Proteintech, 12108-1-AP), Anti-rabbit IgG HRP-linked antibody (CST, 7074S), Anti-Mouse IgG HRP-linked antibody (CST, 7076S). The internal control primary antibodies were as follows: β-actin (CST, 4970S) and HSP90 (Proteintech, 663181-Ig). The blot density analysis was performed using ImageJ, the quantitative results were normalized to load control. Immunofluorescence staining T24 and 5637 cells treatment with LYN inhibitor Saracatinib or transfected the indicated LYN mutant plasmids were grown on glass-bottom cell culture dish (NEST, 801010). After 24 hours, cells were fixed with 4% paraformaldehyde (Jetway Biotech, JTW003-500) and subjected to membrane permeabilization, BSA blocking (Sigma, B2064) and antibody incubation overnight. The antibodies were as follows: TJP1 (Abcam, ab216880), USP8 (Abcam, ab228572), LYN (Proteintech, 3C7F2), TWIST1 (Abcam, ab175430), 488-conjugated Goat Anti-Rabbit IgG (Abconal, AS053), 488-conjugated Goat Anti-Mouse IgG (Abconal, AS037), 594-conjugated Goat Anti-Rabbit IgG (Abconal, AS039), 594-conjugated Goat Anti-Mouse IgG (Abconal, AS054). Cell nucleus were stained with DAPI (Invitrogen, 62248) and mounted with antifade mounting medium from Vector Laboratories (H-1000), followed by photographed in confocal microscope (LSM880, ZEISS). Immunoprecipitation (IP) and Ubiquitination assay For immunoprecipitation assay, cells were collected and lysed with RIPA buffer containing the protease inhibitor cocktail. Then the lysates were extracted and incubated with protein A/G magnetic beads (Millipore, LSKMAGAG02) as well as corresponding primary antibodies or with tagged magnetic beads antibodies at 4℃ overnight. The samples were separated by magnetic device and washed at least 8 times with lysis buffer, following by boiling with loading buffer and analyzed by western blotting. The antibodies were as follows: Anti-DDDDK-tag Magnetic Beads (MBL, M185-11R), Anti-HA-tag Magnetic Beads (MBL, M180-11), Anti-V5-tag Magnetic Beads (MBL, M215-11), Anti-MYC-tag Magnetic Beads (MBL, M047-11), anti-Flag (Proteintech, 66008-3-Ig), anti-V5 (CST, D3H8Q), anti-HA (CST, 3724S), anti-MYC (CST, 2272S). For ubiquitination assay, 293T cells was transfected with the relative plasmids in the indicated experiment, the total lysates were extracted with RIPA buffer containing the protease inhibitor cocktail and then boiled in 1% SDS for 10 minutes before incubating with the corresponding antibodies[ 52 ], followed by IP procedures and incubating with indicated antibodies to detect TJP1 ubiquitination. LC-MS/MS analysis For ubiquitination LC-MS/MS analysis assay, duplicate 10 cm dishes of 293T cells were co-transfected with 5 µg Flag-TJP1 and 10 µg HA-Ubiquitin plasmids for 48 hours, followed by treating with 20 µM MG132 (Selleck, S2619) for 8 hours before collecting. Then, cells were collected and lysed with RIPA buffer containing the protease inhibitor cocktail. Flag magnetic beads were incubated in cell lysates at 4℃ overnight, followed by washed with lysis buffer. The ubiquitination analysis and mutation sites analysis were performed by Applied Protein Technology (China). For 293T immunoprecipitation LC-MS/MS analysis assay, duplicate 10cm dishes of 293T cells were transfected with 5µg Flag-TJP1 for 48 hours, followed by IP procedures and incubating with Flag tagged antibodies. For T24 and 5637 immunoprecipitation LC-MS/MS analysis assay, duplicate 10cm dishes of cells were collected by IP procedures and incubating with IgG or TJP1 antibodies, The samples were performed by Applied Protein Technology (China) for detecting TJP1 binding proteins. Tube formation assay Tube formation ability was performed in three-dimensional culturing as previously reported. Briefly, 96-well plate (NEST Biotechnology, 701001) was coated with Matrigel (Corning, 354234) at a volume of 50 µL per well at 37℃ for 1 hour. Then the suspensions of EA.hy926 cells were suspended on Matrigel at a density of 1.5×10 4 per well and incubated for at least 12 hours at 37℃. The tube formation structure was stained by Calcein-AM (BioLegend, 425201) for 30 minutes and then imaged by fluorescence microscope and assessed by angiogenesis analysis module in ImageJ. The meshes and segment lengths were quantified by ImageJ. Matrigel plug assay 60 male mice (6–8 weeks) were randomly divided into 10 groups, 5 mice in each experimental group. The mice were given subcutaneously injection of 200 µL of a 3:1 mixture of Matrigel (Corning, 356231) with 2×10 6 T24 or 5637 cells in medium. After 10–15 days, the Matrigel plugs were harvested, imaged, fixed in formalin and then embedded in paraffin for immunoprecipitation assay. All animal care and experiments were approved by the Animal Ethics Committee of Sun Yat-sen University and performed in conformity with the Animal Care and Use guidelines of Sun Yat-sen University. Immunohistochemistry (IHC) assay and H&E staining The pathological slides were dewaxing and hydration in xylene and alcohol solution from high to low concentration, following by EDTA antigenic repair buffer (pH = 9.0) for high temperature of antigen restore and peroxidase blocking in H 2 O 2 . After this, the sections were blocked with goat serum and then incubated with the primary antibodies at 4℃ overnight. The secondary antibody detection kit (ABsin, abs957) was performed for the immunohistochemical staining and counterstained with hematoxylin then sealed with neutral gum. The antibodies were as follows: TJP1 (Abcam, ab216880), USP8 (Abcam, ab228572), LYN (Proteintech, 60211-1-Ig), CD31 (Arigobio, ARF52748), Ki67 (CST, 9449S). The protein expression each sample scores were evaluated by pathologist according to the degree and area of staining. The degree staining of sections were scored from 0–3 (0, negative; 1, weak staining; 2, moderate staining; 3, strong staining). The degree staining areas of sections were scored from 1–4 (1,≤25%; 2, 26%-50%; 3, 51%-75%; 4, 76%-100%). The score of each sample was calculated by multiplying the score of staining degree and the score of staining intensity. For H&E staining, the pathological slides were dewaxing and hydration in xylene and alcohol solution from high to low concentration, followed by hematoxylin staining and eosin staining, then slides were sealed with neutral gum and observed under microscope. plasmid construction and transfection K48 and K63 plasmids were kindly providing by Prof. Kang (Sun Yat-sen University Cancer Center). The full-length coding sequence of TJP1 (NCBI Gene ID: 7082), USP8 (NCBI Gene ID: 9101), LYN (NCBI Gene ID: 4067) and TRIM21 (NCBI Gene ID: 6737) were obtained from 293T cDNA and amplified by reverse transcription PCR, then cloned into pcDNA3.1(+) vector with different tags. The TJP1 deletion segments were generated based on the full-length TJP1 sequence by deleting the ZU5, ABR, GUK, and SH3 domains with Flag tag, respectively. All constructs were verified by DNA sequencing and western blot. T24, 5637 as well as 293T cells were transiently transfected by Lipofectamine™ 3000 (Invitrogen, L3000015) based on the manufacturer’s instructions. The USP8, LYN, TRIM21 and TJP1 targeting siRNAs and negative control siRNA (siN05815122147) were purchased from RiboBio (Guangzhou, China). The target sequences were as follows: USP8-siRNA1: GCATAAAGGTGAAGTGGCA; USP8-siRNA2: GGAAACAGGAAGAGAGGAT; LYN-siRNA: CTTGAGTGACGATGGAGTA; TRIM21-siRNA: CGCAGAGTTTGTGCAGCAA; TJP1-siRNA: GTAGGAGATTCTTTCTATA; Site directed mutagenesis Site directed mutagenesis was determined on TJP1 protein to replace ubiquitination residues. The four highly conserved lysine (K) amino acid residues (K502, K529, K695, K1709) were identified as the only ubiquitination sites on TJP1 in ubiquitination LC-MS/MS analysis assay. The specific primers were designed where the codon for the sites were replaced with arginine (R) to create 7 mutant TJP1 proteins, four of them carry a single mutant (K502R, K529R, K695R, K1709R), the rest were double mutant plasmids (K502/695R, K529/695R, K1709R/695R). In addition, LYN site directed mutagenesis was determined on LYN protein to replace phosphorylation residues. The highly conserved Tyrosine (Y) amino acid residue (Y397) was identified as phosphorylation sites on LYN. The specific primers were designed where the codon for the sites were replaced with Phenylalanine (F) or Alanine (A). All mutant plasmids were verified by DNA sequencing and western blot. The target sequences were as follows: TJP1-K502R-F: TGACCATATTGGCTCAGAGGAAGAAGGATGTTTATC; TJP1-K502R-R: GATAAACATCCTTCTTCCTCTGAGCCAATATGGTCA; TJP1-K529R-F: CCCATTTTGAATATGAAAGGGAATCTCCCTATGGAC; TJP1-K529R-R: GTCCATAGGGAGATTCCCTTTCATATTCAAAATGGG; TJP1-K695R-F: CGCCTGCATACAATAAGGCAAATCATAGATCAAG; TJP1-K695R-R: CTTGATCTATGATTTGCCTTATTGTATGCAGGCG; TJP1-K1709R-F: ATGGCCTCAAGTTCCTGAGGCCTGTGGAGCTGC; TJP1-K1709R-R: GCAGCTCCACAGGCCTCAGGAACTTGAGGCCAT; LYN-Y397F-F: TTGAAGATAATGAGTTCACAGCAAGGGAAGGTG; LYN-Y397F-R: CACCTTCCCTTGCTGTGAACTCATTATCTTCAA; Cycloheximide (CHX) chase assay The stability of TJP1 was determined by cycloheximide chase assay. In all, T24 and 5637 cells were transfected with USP8 plasmid, USP8 siRNA or TJP1 695R mutant plasmid, respectively, cells were then treated with CHX (Cycloheximide, Selleck, S7418) (40µg/mL) for the 0, 4, 8 and 12 hours and then collected and lysed by western blot assay to detect TJP1 expression. Dual luciferase reporter assay Dual luciferase reporter activity was performed and detected using the dual luciferase reporter assay kit (Promega, E1960). Specifically, the CCL2 promoter is used to drive firefly luciferase activity in pGL3 luciferase vector. pRL-TK plasmid was co- transfected to activate Renilla luciferase. Besides, the corresponding plasmids were transfected into 293T cells, respectively. After 48 hours, cells were collected and lysed, dual luciferase reporter assay kit was used to detect firefly and Renilla luciferase activities and recorded using a microplate reader. Firefly luciferase activity was normalized to Renilla luciferase activity. CCL2 promoter sequence were listed as follows: pGL3-CCL2-F: ATTTCTCTATCGATAGGTACCAGGCATGAGCAGAGGACTGAGA; pGL3-CCL2-R: ACTTAGATCGCAGATCTCGAGGCTGGAGGCGAGAGTGCGAGCT; Transwell assay T24 and 5637 cells were treated with DUBs-IN-2, Saracatinib or double inhibitors in combination for 24 hours, then cells were trypsinized, resuspended in serum-free medium and added to the upper chambers of pore inserts of a transwell. RPMI with 10% FBS were added to the lower chamber and incubated for 24 hours. Migrating cells were counted and quantified by Image J after staining with crystal violet (BBI, 548-62-9, 0.5%) for 20 minutes. Clone formation assay T24 and 5637 cells treatment with USP8/LYN inhibitors or transfected plasmids were seeded into 6-wells at a density of 1×10 3 cells per well. Cells were incubated at 37°C for 10 days, and then colony formation was visualized by staining with crystal violet (BBI, 548-62-9, 0.5%) for 20 minutes, followed by photographed. Nuclear and cytoplasmic extraction assay Nuclear and Cytoplasmic Protein Extraction Kit (78833, Thermo) was used to separate cytoplasm and nuclear protein according to the instruction. In brief, cells were washed with cold PBS for twice and centrifuged 3 minutes at 500g. The cell pellet was then suspended in 200ul of CERⅠ in vortex suspension, followed by incubation on ice for 10 minutes, then 11ul of the CERII was added, swirling for 5 seconds and incubated on ice for 1 minute, centrifuged at 16,000 g for 5 minutes, subsequently. The supernatant portion was transferred into the pre-cooled tube as cytoplasmic extract. The insoluble pellet fractions containing coarse nuclei were swirled in 100ul of NER for 15 seconds, incubating in ice for 40 minutes, and then centrifuged at 16,000 g for 10 minutes. The obtained supernatant formed the nuclear extract, which was used in subsequent western blot experiments. Xenograft animal model 2×10 6 T24 cells were injected into tail vein of each SCID mouse, the 20 mice were then divided into 4 groups on average, followed by treatment with Saline, DUBs-IN-2, Saracatinib or double inhibitors in combination every 3 days. The lungs were excised 60 days post-injection and fixed in formalin for 24 hours and then embedded in paraffin, from which sections were stained with HE by pathologists. All animal experiments were carried out in accordance with the protocol approved by the Institutional Animal Care and Use Committee at the Ethics Committee of Sun Yat-sen University. Statistical analysis Data were analyzed using the GraphPad Prism 8 software. Statistical significance was determined by p -value of p < 0.05. *,0.01 < p < 0.05; **, 0.001 < p < 0.01; ***, p < 0.001. The two-sides Pearson’s relation analysis was performed to determine the correlation between TJP1, USP8 as well as LYN expression. All quantitative data were performed as mean ± standard error of the mean (S.E.M.) or standard deviation (S.D.) from at least three independent experiments. The Student’s t -test was used to compare the difference between two groups and one-way ANOVA for multiple groups. The Kaplan–Meier analysis was performed to state the survival probabilities in BLCA patients. Declarations Declaration of interests The authors declare that they have no conflict of interest. Funding: This study was supported by the National Natural Science Foundation of China (Grant Nos. 32170789, 32100564, 32100563); supported by Guangdong Natural Science Foundation of China (Grant Nos. 2022A1515012252, 2023A1515010550, 2022A1515012286); supported by Shenzhen Key Laboratory for Systems Medicine in Inflammatory Diseases (ZDSYS20220606100803007). Authors’ contributions XL and ZD performed most of the cell experiments and manuscript writing. SC and XS collected the clinical samples, completed the IHC assay and prepared the case report. ZL and FJ performed the animal experiments. SC performed database analysis. LQ reviewed and suggested of the manuscript. XZ and ML conceived and designed the study. All authors read and approved the final manuscript. Acknowledgement We thank Prof. Kang (Sun Yat-sen University Cancer Center) for kindly providing T24 and 5637 bladder cancer cells and the faculty (Fifth Affiliated Hospital of Sun Yat-sen University) for collecting the clinical samples. We thank the Core Facilities for Medical Science, School of Medicine, Shenzhen Campus of Sun Yat-sen University for providing the equipment to obtain experimental data. References D.J. Smith, S. Lunj, A.D. Adamson, S. Nagarajan, T.A.D. Smith, K.J. Reeves, P.J. Hoskin, A. Choudhury, CRISPR-Cas9 potential for identifying novel therapeutic targets in muscle-invasive bladder cancer, Nat Rev Urol, 22 (2025) 55–65. E. Compérat, M.B. Amin, R. Cathomas, A. Choudhury, M. De Santis, A. Kamat, A. Stenzl, H.C. Thoeny, J.A. Witjes, Current best practice for bladder cancer: a narrative review of diagnostics and treatments, Lancet, 400 (2022) 1712–1721. W. Risau, Embryonic angiogenesis factors, Pharmacology & therapeutics, 51 (1991) 371–376. X. Liu, J. Zhang, T. Yi, H. Li, X. Tang, D. Liu, D. Wu, Y. Li, Decoding tumor angiogenesis: pathways, mechanisms, and future directions in anti-cancer strategies, Biomark Res, 13 (2025) 62. K.R. Karpiuk, G. Młynarczyk, J. Matowicka-Karna, B. Darewicz, Emerging Biomarkers in Urological Cancers: Angiogenesis and Damage-Associated Molecular Pattern Signaling, Int J Mol Sci, 26 (2025). X.Q. Liu, X.R. Shao, Y. Liu, Z.X. Dong, S.H. Chan, Y.Y. Shi, S.N. Chen, L. Qi, L. Zhong, Y. Yu, T. Lv, P.F. Yang, L.Y. Li, X.B. Wang, X.D. Zhang, X. Li, W. Zhao, L. Sehgal, M. Li, X.D. Zhang, Tight junction protein 1 promotes vasculature remodeling via regulating USP2/TWIST1 in bladder cancer, Oncogene, 41 (2022) 502–514. J. Lesage, M. Suarez-Carmona, D. Neyrinck-Leglantier, S. Grelet, S. Blacher, W. Hunziker, P. Birembaut, A. Noël, B. Nawrocki-Raby, C. Gilles, M. Polette, Zonula occludens-1/NF-κB/CXCL8: a new regulatory axis for tumor angiogenesis, Faseb j, 31 (2017) 1678–1688. S. Nakamuta, H. Endo, Y. Higashi, A. Kousaka, H. Yamada, M. Yano, H. Kido, Human immunodeficiency virus type 1 gp120-mediated disruption of tight junction proteins by induction of proteasome-mediated degradation of zonula occludens-1 and – 2 in human brain microvascular endothelial cells, J Neurovirol, 14 (2008) 186–195. M.E. Sowa, E.J. Bennett, S.P. Gygi, J.W. Harper, Defining the human deubiquitinating enzyme interaction landscape, Cell, 138 (2009) 389–403. P.E. Cockram, M. Kist, S. Prakash, S.H. Chen, I.E. Wertz, D. Vucic, Ubiquitination in the regulation of inflammatory cell death and cancer, Cell Death Differ, 28 (2021) 591–605. W. Xiong, X. Gao, T. Zhang, B. Jiang, M.M. Hu, X. Bu, Y. Gao, L.Z. Zhang, B.L. Xiao, C. He, Y. Sun, H. Li, J. Shi, X. Xiao, B. Xiang, C. Xie, G. Chen, H. Zhang, W. Wei, G.J. Freeman, H.B. Shu, H. Wang, J. Zhang, USP8 inhibition reshapes an inflamed tumor microenvironment that potentiates the immunotherapy, Nature communications, 13 (2022) 1700. F. Xie, X. Zhou, H. Li, P. Su, S. Liu, R. Li, J. Zou, X. Wei, C. Pan, Z. Zhang, M. Zheng, Z. Liu, X. Meng, H. Ovaa, P. Ten Dijke, F. Zhou, L. Zhang, USP8 promotes cancer progression and extracellular vesicle-mediated CD8 + T cell exhaustion by deubiquitinating the TGF-β receptor TβRII, Embo j, 41 (2022) e108791. H. Yang, X. Zhang, M. Lao, K. Sun, L. He, J. Xu, Y. Duan, Y. Chen, H. Ying, M. Li, C. Guo, Q. Lu, S. Wang, W. Su, T. Liang, X. Bai, Targeting ubiquitin-specific protease 8 sensitizes anti-programmed death-ligand 1 immunotherapy of pancreatic cancer, Cell Death Differ, 30 (2023) 560–575. Z.B. Ke, J.Y. Chen, Y.T. Xue, B. Lin, Q. Huang, X.Y. Huang, D.N. Chen, S.H. Chen, X.J. Ye, Q.S. Zheng, Y. Wei, X.Y. Xue, N. Xu, Mechanical signal modulates prostate cancer immune escape by USP8-mediated ubiquitination-dependent degradation of PD-L1 and MHC-1, Cell Death Dis, 16 (2025) 413. A.V. Leopold, K.G. Chernov, V.V. Verkhusha, Optogenetically controlled protein kinases for regulation of cellular signaling, Chem Soc Rev, 47 (2018) 2454–2484. M. Gao, M. Karin, Regulating the regulators: control of protein ubiquitination and ubiquitin-like modifications by extracellular stimuli, Mol Cell, 19 (2005) 581–593. L. Fattet, H.Y. Jung, M.W. Matsumoto, B.E. Aubol, A. Kumar, J.A. Adams, A.C. Chen, R.L. Sah, A.J. Engler, E.B. Pasquale, J. Yang, Matrix Rigidity Controls Epithelial-Mesenchymal Plasticity and Tumor Metastasis via a Mechanoresponsive EPHA2/LYN Complex, Dev Cell, 54 (2020) 302–316.e307. J. Tang, Y. Xiao, G. Lin, H. Guo, H.X. Deng, S. Tu, W.Y. Langdon, H. Yang, L. Tao, Y. Li, R.M. Pope, N. Gupta, J. Zhang, Tyrosine phosphorylation of NLRP3 by the Src family kinase Lyn suppresses the activity of the NLRP3 inflammasome, Sci Signal, 14 (2021) eabe3410. T. Ban, G.R. Sato, A. Nishiyama, A. Akiyama, M. Takasuna, M. Umehara, S. Suzuki, M. Ichino, S. Matsunaga, A. Kimura, Y. Kimura, H. Yanai, S. Miyashita, J. Kuromitsu, K. Tsukahara, K. Yoshimatsu, I. Endo, T. Yamamoto, H. Hirano, A. Ryo, T. Taniguchi, T. Tamura, Lyn Kinase Suppresses the Transcriptional Activity of IRF5 in the TLR-MyD88 Pathway to Restrain the Development of Autoimmunity, Immunity, 45 (2016) 319–332. O. Beutel, R. Maraspini, K. Pombo-García, C. Martin-Lemaitre, A. Honigmann, Phase Separation of Zonula Occludens Proteins Drives Formation of Tight Junctions, Cell, 179 (2019) 923–936.e911. K. Kakihara, K. Asamizu, K. Moritsugu, M. Kubo, T. Kitaguchi, A. Endo, A. Kidera, M. Ikeguchi, A. Kato, M. Komada, T. Fukushima, Molecular basis of ubiquitin-specific protease 8 autoinhibition by the WW-like domain, Commun Biol, 4 (2021) 1272. M.T. Islam, F. Chen, H. Chen, The oncogenic role of ubiquitin specific peptidase (USP8) and its signaling pathways targeting for cancer therapeutics, Arch Biochem Biophys, 701 (2021) 108811. M. Colombo, S. Vallese, I. Peretto, X. Jacq, J.C. Rain, F. Colland, P. Guedat, Synthesis and biological evaluation of 9-oxo-9H-indeno[1,2-b]pyrazine-2,3-dicarbonitrile analogues as potential inhibitors of deubiquitinating enzymes, ChemMedChem, 5 (2010) 552–558. A. Dufner, K.P. Knobeloch, Ubiquitin-specific protease 8 (USP8/UBPy): a prototypic multidomain deubiquitinating enzyme with pleiotropic functions, Biochem Soc Trans, 47 (2019) 1867–1879. F. Li, Q. Sun, K. Liu, L. Zhang, N. Lin, K. You, M. Liu, N. Kon, F. Tian, Z. Mao, T. Li, T. Tong, J. Qin, W. Gu, D. Li, W. Zhao, OTUD5 cooperates with TRIM25 in transcriptional regulation and tumor progression via deubiquitination activity, Nature communications, 11 (2020) 4184. J. Sun, Q. Hu, H. Peng, C. Peng, L. Zhou, J. Lu, C. Huang, The ubiquitin-specific protease USP8 deubiquitinates and stabilizes Cx43, J Biol Chem, 293 (2018) 8275–8284. X. Chen, J.D. Qiu, S.P. Shi, S.B. Suo, S.Y. Huang, R.P. Liang, Incorporating key position and amino acid residue features to identify general and species-specific Ubiquitin conjugation sites, Bioinformatics, 29 (2013) 1614–1622. D. Popovic, D. Vucic, I. Dikic, Ubiquitination in disease pathogenesis and treatment, Nat Med, 20 (2014) 1242–1253. V.C. Chen, A.R. Kristensen, L.J. Foster, C.C. Naus, Association of connexin43 with E3 ubiquitin ligase TRIM21 reveals a mechanism for gap junction phosphodegron control, J Proteome Res, 11 (2012) 6134–6146. H. Peng, F. Yang, Q. Hu, J. Sun, C. Peng, Y. Zhao, C. Huang, The ubiquitin-specific protease USP8 directly deubiquitinates SQSTM1/p62 to suppress its autophagic activity, Autophagy, 16 (2020) 698–708. J.A. Pan, Y. Sun, Y.P. Jiang, A.J. Bott, N. Jaber, Z. Dou, B. Yang, J.S. Chen, J.M. Catanzaro, C. Du, W.X. Ding, M.T. Diaz-Meco, J. Moscat, K. Ozato, R.Z. Lin, W.X. Zong, TRIM21 Ubiquitylates SQSTM1/p62 and Suppresses Protein Sequestration to Regulate Redox Homeostasis, Mol Cell, 61 (2016) 720–733. D.L. Swaney, P. Beltrao, L. Starita, A. Guo, J. Rush, S. Fields, N.J. Krogan, J. Villén, Global analysis of phosphorylation and ubiquitylation cross-talk in protein degradation, Nat Methods, 10 (2013) 676–682. T.P. Green, M. Fennell, R. Whittaker, J. Curwen, V. Jacobs, J. Allen, A. Logie, J. Hargreaves, D.M. Hickinson, R.W. Wilkinson, P. Elvin, B. Boyer, N. Carragher, P.A. Plé, A. Bermingham, G.A. Holdgate, W.H. Ward, L.F. Hennequin, B.R. Davies, G.F. Costello, Preclinical anticancer activity of the potent, oral Src inhibitor AZD0530, Mol Oncol, 3 (2009) 248–261. G. Tornillo, C. Knowlson, H. Kendrick, J. Cooke, H. Mirza, I. Aurrekoetxea-Rodríguez, M.D.M. Vivanco, N.E. Buckley, A. Grigoriadis, M.J. Smalley, Dual Mechanisms of LYN Kinase Dysregulation Drive Aggressive Behavior in Breast Cancer Cells, Cell Rep, 25 (2018) 3674–3692.e3610. M.Y. Li, T.S. Naik, L.Y.L. Siu, O. Acuto, E. Spooner, P. Wang, X. Yang, Y. Lin, R. Bruzzone, J. Ashour, M.J. Evans, S. Sanyal, Lyn kinase regulates egress of flaviviruses in autophagosome-derived organelles, Nature communications, 11 (2020) 5189. T. Tsukamoto, S.K. Nigam, Role of tyrosine phosphorylation in the reassembly of occludin and other tight junction proteins, Am J Physiol, 276 (1999) F737-750. B.R. Tash, M.C. Bewley, M. Russo, J.M. Keil, K.A. Griffin, J.M. Sundstrom, D.A. Antonetti, F. Tian, J.M. Flanagan, The occludin and ZO-1 complex, defined by small angle X-ray scattering and NMR, has implications for modulating tight junction permeability, Proc Natl Acad Sci U S A, 109 (2012) 10855–10860. A.S. Fanning, J.M. Anderson, Zonula occludens-1 and – 2 are cytosolic scaffolds that regulate the assembly of cellular junctions, Ann N Y Acad Sci, 1165 (2009) 113–120. P. Lorenc, A. Sikorska, S. Molenda, N. Guzniczak, H. Dams-Kozlowska, A. Florczak, Physiological and tumor-associated angiogenesis: Key factors and therapy targeting VEGF/VEGFR pathway, Biomed Pharmacother, 180 (2024) 117585. Y. Xiao, M. Hassani, M.B. Moghaddam, A. Fazilat, M. Ojarudi, M. Valilo, Contribution of tumor microenvironment (TME) to tumor apoptosis, angiogenesis, metastasis, and drug resistance, Med Oncol, 42 (2025) 108. T. Hunter, The age of crosstalk: phosphorylation, ubiquitination, and beyond, Mol Cell, 28 (2007) 730–738. C.M. Van Itallie, M.S. Balda, J.M. Anderson, Epidermal growth factor induces tyrosine phosphorylation and reorganization of the tight junction protein ZO-1 in A431 cells, J Cell Sci, 108 (Pt 4) (1995) 1735–1742. H. Kurihara, J.M. Anderson, M.G. Farquhar, Increased Tyr phosphorylation of ZO-1 during modification of tight junctions between glomerular foot processes, Am J Physiol, 268 (1995) F514-524. J.M. Staddon, K. Herrenknecht, C. Smales, L.L. Rubin, Evidence that tyrosine phosphorylation may increase tight junction permeability, J Cell Sci, 108 (Pt 2) (1995) 609–619. H. Takeda, S. Tsukita, Effects of tyrosine phosphorylation on tight junctions in temperature-sensitive v-src-transfected MDCK cells, Cell Struct Funct, 20 (1995) 387–393. C.J. Gottardi, M. Arpin, A.S. Fanning, D. Louvard, The junction-associated protein, zonula occludens-1, localizes to the nucleus before the maturation and during the remodeling of cell-cell contacts, Proc Natl Acad Sci U S A, 93 (1996) 10779–10784. M.S. Balda, K. Matter, Epithelial cell adhesion and the regulation of gene expression, Trends Cell Biol, 13 (2003) 310–318. M.S. Balda, K. Matter, The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression, Embo j, 19 (2000) 2024–2033. A.F. Thévenin, R.A. Margraf, C.G. Fisher, R.M. Kells-Andrews, M.M. Falk, Phosphorylation regulates connexin43/ZO-1 binding and release, an important step in gap junction turnover, Mol Biol Cell, 28 (2017) 3595–3608. R.K. Rao, S. Basuroy, V.U. Rao, K.J. Karnaky, Jr., A. Gupta, Tyrosine phosphorylation and dissociation of occludin-ZO-1 and E-cadherin-beta-catenin complexes from the cytoskeleton by oxidative stress, Biochem J, 368 (2002) 471–481. L. González-Mariscal, A. Betanzos, A. Avila-Flores, MAGUK proteins: structure and role in the tight junction, Semin Cell Dev Biol, 11 (2000) 315–324. P. Hou, P. Jia, K. Yang, Z. Li, T. Tian, Y. Lin, W. Zeng, F. Xing, Y. Chen, C. Li, Y. Liu, D. Guo, An unconventional role of an ASB family protein in NF-κB activation and inflammatory response during microbial infection and colitis, Proc Natl Acad Sci U S A, 118 (2021). Additional Declarations There is NO conflict of interest to disclose. Supplementary Files Supplementarymaterials2025.docx SUPPLEMENTAL MATERIAL Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7928736","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":540022428,"identity":"1bfe675b-d2b4-41ee-b673-becd31057193","order_by":0,"name":"XINGDING ZHANG","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABJUlEQVRIiWNgGAWjYDACCTDJbMfP3sDAkFAAE2YjrCVZsucAUIsBCVoYN9xIANLEaJGf3fzs4dc2a2aDm68TPzwwYLA3OH/GgOFD2WEG/tkNWLUwzjlmbixzJp1P8nbuZgmgwxI33MgxYJxx7jCDxJ0DWLUwSySYSUtUHGbmu527AaQlweAGjwEzb9thBgOJBKxa2CTSv0lLGBxmbLh5dvOPBKjDmP/i0cIjkWMm+aHiMOOEG7zbQLYwbjiQY8DMiEeLhEROmTTDmXRgIOdus0gwkEiceSOt4GDPuXQeiRvYtcjPSN8m+bPNGhiVZzff/FFhY893/vDGBz/KrOX4Z2DXAg4CHiRbGRQOMDAcADkZp3ogYPyBYm8DPrWjYBSMglEwEgEA6qVdft1rfgUAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-2759-5185","institution":"the School of Medicine of Sun Yat-sen University","correspondingAuthor":true,"prefix":"","firstName":"XINGDING","middleName":"","lastName":"ZHANG","suffix":""},{"id":540022429,"identity":"bfdee6f9-c8c9-4f56-a5f7-bf1f60cfcbb4","order_by":1,"name":"Xue-Qi Liu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Xue-Qi","middleName":"","lastName":"Liu","suffix":""},{"id":540022430,"identity":"81574a25-748f-4ca7-9643-b282c9897181","order_by":2,"name":"ZHAOXIA DONG","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"ZHAOXIA","middleName":"","lastName":"DONG","suffix":""},{"id":540022431,"identity":"113abf77-867c-4284-af09-b96d0b7a7e12","order_by":3,"name":"Sze-Hoi Chan","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Sze-Hoi","middleName":"","lastName":"Chan","suffix":""},{"id":540022432,"identity":"83089146-d77d-497c-a6b2-903017649ba9","order_by":4,"name":"Xiao-Yan Sang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Xiao-Yan","middleName":"","lastName":"Sang","suffix":""},{"id":540022433,"identity":"fd0749d8-e699-4642-b224-8ab059dea168","order_by":5,"name":"Shu-Na Chen","email":"","orcid":"https://orcid.org/0000-0002-0051-0153","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Shu-Na","middleName":"","lastName":"Chen","suffix":""},{"id":540022434,"identity":"c2282c0b-fa98-4cff-9d22-bfd07cae97f9","order_by":6,"name":"ZiXuan Liu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"ZiXuan","middleName":"","lastName":"Liu","suffix":""},{"id":540022435,"identity":"cc3bc2d1-0ac2-4e36-84a3-71cc820c6ddc","order_by":7,"name":"Fei-Er Ju","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Fei-Er","middleName":"","lastName":"Ju","suffix":""},{"id":540022436,"identity":"4bddcae9-c869-44b2-8f11-1b593291b9f7","order_by":8,"name":"Lin Qi","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Lin","middleName":"","lastName":"Qi","suffix":""},{"id":540022437,"identity":"ee056cfe-c985-46ae-bcd2-3786a5742b17","order_by":9,"name":"Miao Li","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Miao","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2025-10-23 05:55:32","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7928736/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7928736/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":95893574,"identity":"3b474110-5593-44d1-b36b-1d5dcd7b66f1","added_by":"auto","created_at":"2025-11-14 06:54:00","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11506475,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/72c336a065f5c1ab7712165f.docx"},{"id":95893572,"identity":"9be9dd13-805c-4f4c-ba62-261b0d571c9c","added_by":"auto","created_at":"2025-11-14 06:54:00","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10668,"visible":true,"origin":"","legend":"","description":"","filename":"ONC202503264.json","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/0d7ec0b2021c0e76923a182c.json"},{"id":95893585,"identity":"70a62964-5102-462c-8244-33e73b660b4e","added_by":"auto","created_at":"2025-11-14 06:54:02","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9038099,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterials2025.docx","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/f3b4d3f5c45253f0d5e0d949.docx"},{"id":95893571,"identity":"49627c7c-eea9-4375-acd4-e301ce4350b6","added_by":"auto","created_at":"2025-11-14 06:54:00","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":197566,"visible":true,"origin":"","legend":"","description":"","filename":"ONC2025032640enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/e70236efb704989d08d15873.xml"},{"id":95893578,"identity":"abd536f6-38c8-46f8-b2a7-a7faabb09d2e","added_by":"auto","created_at":"2025-11-14 06:54:01","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2571096,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/4df010384951ac30adbbbfd4.jpeg"},{"id":95893586,"identity":"3eee0c1a-001f-4eb4-a604-0ac7ede35fb3","added_by":"auto","created_at":"2025-11-14 06:54:02","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1202094,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/17bc388046a330e4bf04e0bb.jpeg"},{"id":95893584,"identity":"469b845d-1c26-453d-99c5-83841e390e47","added_by":"auto","created_at":"2025-11-14 06:54:02","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1372016,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/41ee0513a482a5075e53a53e.jpeg"},{"id":95893564,"identity":"a2a5b3ba-9902-4fcd-9b23-adfbd7a0efea","added_by":"auto","created_at":"2025-11-14 06:53:58","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1288346,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/97cb84e79706b2e216a09559.jpeg"},{"id":95893577,"identity":"8c05626c-b408-4bd7-af8d-8a66de5c5864","added_by":"auto","created_at":"2025-11-14 06:54:01","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7597930,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/2ffb720ee388ea98034f4e03.jpeg"},{"id":96243264,"identity":"9bfeef3c-7d83-4036-9d26-6731c67dabe6","added_by":"auto","created_at":"2025-11-19 07:15:57","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1534682,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/0578981477986a1e97986ead.jpeg"},{"id":95893569,"identity":"a5ac60ab-915a-4bbd-bfc3-d0d47988d081","added_by":"auto","created_at":"2025-11-14 06:54:00","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2490880,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/0ae884e290c7d7db1cba1e3d.jpeg"},{"id":95893589,"identity":"a6559de7-f427-4034-9559-c6d2754fc1f8","added_by":"auto","created_at":"2025-11-14 06:54:02","extension":"jpeg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":599374,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/9669103632dd5b6f8dfe0347.jpeg"},{"id":96242905,"identity":"71b67bb6-83f4-4158-9c5a-cfc98840d8ca","added_by":"auto","created_at":"2025-11-19 07:14:50","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":312150,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/495a7c9dbc719f53a4124a31.png"},{"id":95893594,"identity":"63d3b9d0-f206-478e-962e-3303d025daf3","added_by":"auto","created_at":"2025-11-14 06:54:03","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":202142,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/2c3387ab48493692a2062fdd.png"},{"id":95893562,"identity":"2f1713a4-450d-453d-9a55-56c77a69f69e","added_by":"auto","created_at":"2025-11-14 06:53:57","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":254385,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/ffb4d4bcdab6df196c5dbfcd.png"},{"id":96242736,"identity":"feeeedee-30c3-4794-bb4c-c463b5bca034","added_by":"auto","created_at":"2025-11-19 07:14:11","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":160084,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/9941778ff89da0ccf23fbc3a.png"},{"id":95893559,"identity":"c8dc1125-19ea-43f8-945a-384699c75099","added_by":"auto","created_at":"2025-11-14 06:53:57","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":144893,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/0656606915909bf81e6f783a.png"},{"id":95893573,"identity":"9ff14392-7b37-40ee-bffe-230b7154b2c4","added_by":"auto","created_at":"2025-11-14 06:54:00","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":359837,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/c78cc8e41d96c33f414d6c3e.png"},{"id":95893588,"identity":"ee5e30e8-0353-457b-a424-5d4b424b3e1b","added_by":"auto","created_at":"2025-11-14 06:54:02","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":380082,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/c020383768802efd5009e7d3.png"},{"id":95893580,"identity":"e26526df-a25f-4450-829e-fb148301b09b","added_by":"auto","created_at":"2025-11-14 06:54:01","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":129663,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/c3364488c15d8f3c2bec4443.png"},{"id":95893593,"identity":"21dc08ea-49a0-45b8-9347-43bc1ff411ca","added_by":"auto","created_at":"2025-11-14 06:54:03","extension":"xml","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":193569,"visible":true,"origin":"","legend":"","description":"","filename":"ONC2025032640structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/18374c4851d99ebb364c4703.xml"},{"id":95893563,"identity":"9b67a0e4-08ef-463c-b5a8-529af4b5b6ad","added_by":"auto","created_at":"2025-11-14 06:53:57","extension":"html","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":208880,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/4ad44614e676182097c2ecb9.html"},{"id":95893565,"identity":"fb76f9ce-ee4e-4c20-870a-74d1c39426b3","added_by":"auto","created_at":"2025-11-14 06:53:59","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1448809,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUSP8 correlates with TJP1 to promote BLCA angiogenesis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003e293T cells were co-transfected with HA-USP8 and Flag-TJP1 plasmids, cells were lysed and analyzed by IP assay using Flag magnetic beads followed by immunoblotting with Flag or HA antibody.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B) \u003c/strong\u003eThe co-IP assays were performed by treating with IgG, USP8 or TJP1 antibodies plus protein A/G magnetic beads in T24 and 5637 cells followed by immunoblotting with USP8 or TJP1 antibodies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C) \u003c/strong\u003eIF assay was performed to detect USP8 (green fluorescence) and TJP1 (red fluorescence) colocalization in T24 and 5637 cells, respectively. Photos were imaged by fluorescence microscope. Scale bar = 10 μm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D) \u003c/strong\u003eIHC staining of USP8 and TJP1 in USP8\u003csup\u003eHigh\u003c/sup\u003e and USP8\u003csup\u003eLow\u003c/sup\u003e BLCA patients. Scale bar = 250 μm, insets show magnification for staining detail.\u003cstrong\u003e \u003c/strong\u003eCorrelation between USP8\u003csup\u003eHigh\u003c/sup\u003e and USP8\u003csup\u003eLow\u003c/sup\u003e BLCA patients with TJP1 staining in IHC. R = 0.3461 by Pearson analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(E) \u003c/strong\u003eThe correlation analysis (https://cistrome.shinyapps.io/timer/) between USP8 and TJP1 in BLCA patients from TCGA database.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F) \u003c/strong\u003eKaplan–Meier plots of survival in 400 bladder cancer patients, stratified by protein expression of USP8. Log rank analysis was conducted to determine significance.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(G) \u003c/strong\u003eGSEA analysis for angiogenic-related gene signatures in the clinical BLCA patient database. Plots indicate a significant enrichment of angiogenesis-related genes in BLCA patients with high USP8 expression (FDR q= 0.22, NES=1.19).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(H) \u003c/strong\u003eHeatmap of GSEA analysis for angiogenic-related gene signatures in the clinical BLCA patient database in high and low USP8 expression subgroup. Columns represent probe sets, and rows represent samples treated as indicated. Green, downregulation; red, upregulation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(I) \u003c/strong\u003eEA.hy926 cells cultured with conditioned medium (CM) derived from T24 cells when treating with USP8 inhibitor DUBs-IN-2. Tube formation were stained with Calcein AM (1 μM) for 30 minutes and imaged by fluorescence microscopy. Scale bar = 100 μm.\u003cstrong\u003e \u003c/strong\u003eThe number of meshes and segment lengths were analyzed using ImageJ software. All quantitative data are reported as the mean ± standard error of the mean (SEM) from at least three independent experiments. *,0.01\u0026lt; p \u0026lt; 0.05; **, 0.001\u0026lt; p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(J) \u003c/strong\u003eEA.hy926 cells cultured with conditioned medium (CM) derived from USP8-silenced T24 cells followed by overexpression of TJP1. Tube formation were stained with Calcein AM (1 μM) for 30 minutes and imaged by fluorescence microscopy. Scale bar = 100 μm.\u003cstrong\u003e \u003c/strong\u003eThe number of meshes and segment lengths were analyzed by ImageJ software. All quantitative data are reported as the mean ± standard error of the mean (SEM) from at least three independent experiments. *,0.01\u0026lt; p \u0026lt; 0.05; **, 0.001\u0026lt; p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(K) \u003c/strong\u003eMatrigel plugs were removed from xenograft mice injected with T24 cells that stable overexpressed TJP1, followed by processed for macroscopic images.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(L) \u003c/strong\u003eIHC staining for USP8, CD31 as well as TJP1 in paraffin embedded Matrigel plugs, insets show magnification for staining detail, the scale bar, 250 μm.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/88426a5ee776c598d60d8082.png"},{"id":96242592,"identity":"de78d198-e2ea-4689-9edb-c0f34537665e","added_by":"auto","created_at":"2025-11-19 07:13:32","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1100046,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUSP8 removes K48 and K63-linked ubiquitin conjugates from TJP1.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eTJP1 protein expression was detected in USP8 knockdown T24 and 5637 cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B) \u003c/strong\u003eUSP8 inhibitor DUBs-IN-2 was treated with T24 and 5637 cells to detect TJP1 expression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C) \u003c/strong\u003eTJP1 protein expression was detected in USP8 overexpression T24 and 5637 cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D-E) \u003c/strong\u003eT24 and 5637 cells were transfected with USP8 plasmid and treated with CHX (20 μg/mL) for 4,8 and 12 hours, and the TJP1 expression was detected by western blot.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F-G) \u003c/strong\u003eT24 and 5637 cells were transfected with USP8 siRNA for 24 hours followed by CHX (20 μg/mL) treatment for 4, 8 and 12 hours. USP8 and TJP1 expression was evaluated by western blot.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(H) \u003c/strong\u003eT24 and 5637 cells were co-transfected with HA-Ub, V5-USP8 and Flag-TJP1 plasmids. Cells were lysed, and immunoprecipitated using anti-Flag magnetic beads, and then subjected to immunoblotting with the HA antibody to detect TJP1 ubiquitination.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(I) \u003c/strong\u003eT24 and 5637 cells were co-transfected with HA-Ub, Flag-TJP1 and USP8 siRNA as indicated. Cells were lysed, immunoprecipitated using anti-Flag magnetic beads, then subjected to immunoblotting with the HA antibody to detect TJP1 ubiquitination.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(J-K) \u003c/strong\u003eT24 and 5637 cells were treated with MG132 (20 μM) or Baf. A1 (0.5 μM) for 4, 8 and 12 h. TJP1 expression was detected by western blot.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(L) \u003c/strong\u003eT24 and 5637 cells were transfected with USP8 siRNA and treated with MG132 (20 μM). USP8 and TJP1 expression was assessed by western blot.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(M) \u003c/strong\u003eT24 and 5637 cells were transfected with USP8 siRNA and treated with Baf. A1 (0.5 μM). USP8 and TJP1 expression was assessed by western blot.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(N) \u003c/strong\u003e293T cells were co-transfected with Flag-TJP1, HA-Ub, HA-K48 and HA-K63 plasmids as indicated. Cells were lysed, and immunoprecipitated using anti-Flag magnetic beads, and then subjected to immunoblotting with the HA antibody to detect TJP1 ubiquitination.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(O) \u003c/strong\u003e293T cells were co-transfected with Flag-TJP1, V5-USP8 and HA-Ub, HA-K48 as well as HA-K63 plasmids as indicated. The levels of different K-linked TJP1 ubiquitination in Flag immunoprecipitate upon USP8 overexpression were determined by western blot with anti-HA antibody.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/263c80a932d8f375f5bb40be.png"},{"id":95893582,"identity":"0601518d-1ad3-4325-8af4-e72af25bf221","added_by":"auto","created_at":"2025-11-14 06:54:02","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1494333,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUSP8 deubiquitinates TJP1 at Lys695 site to promote BLCA angiogenesis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eDiagram depicting the predicted ubiquitinated lysine sites on TJP1 by MusiteDeep (http://ubibrowser.ncpsb.org/).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B) \u003c/strong\u003eThe four ubiquitination sites of Flag-TJP1 on K502, K529, K695, K1709 were highlighted and shown on the peptide sequence. Trypsin digestion of ubiquitin conjugates generates a GlyGly (K) tag that was formed at the ubiquitinated lysine residue.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C) \u003c/strong\u003eSchematic diagram of TJP1 protein showing the different domains and indicating the respective location of the four ubiquitination sites.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D) \u003c/strong\u003eTo confirm TJP1 ubiquitination at the specific lysine, both K502, K529, K695 and K1709 were replaced with arginine (R). 293T cells were transfected with the HA-Ub, Flag-TJP1 and the indicated plasmids, cells were lysed, and immunoprecipitated using anti-Flag magnetic beads, and then subjected to immunoblotting with the HA antibody to detect TJP1 ubiquitination.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(E) \u003c/strong\u003e293T cells were transfected with the HA-Ub, Flag-TJP1 and the indicated TJP1 double mutant plasmids, cells were lysed, and immunoprecipitated using anti-Flag magnetic beads, and then subjected to immunoblotting with the HA antibody to detect TJP1 ubiquitination.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F) \u003c/strong\u003e293T cells were transfected with the HA-Ub, Flag-TJP1, V5-USP8 and the indicated TJP1 mutant plasmids, cells were lysed, and immunoprecipitated using anti-Flag magnetic beads, and then subjected to immunoblotting with the HA antibody to detect TJP1 ubiquitination.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(G) \u003c/strong\u003eT24 cells were co-transfected with USP8 plasmid and TJP1 or TJP1-K695R plasmid, then they were treated with CHX (20 μg/mL) for 4,8 and 12 hours, and the TJP1 expression was detected by western blot.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(H-I) \u003c/strong\u003eEA.hy926 cells cultured with conditioned medium (CM) derived from T24 and 5637 cells when transfecting the indicating plasmids. Tube formation was stained with Calcein AM (1 μM) for 30 minutes and imaged by fluorescence microscopy. Scale bar = 100 μm. The number of meshes and segment lengths were analyzed using ImageJ software. All quantitative data are reported as the mean ± standard error of the mean (SEM) from at least three independent experiments. *,0.01\u0026lt; p \u0026lt; 0.05; **, 0.001\u0026lt; p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/ffaa018352ce6140c56fd3e7.png"},{"id":95893567,"identity":"6baca704-c1fd-46ca-af62-0c37ca43c5a7","added_by":"auto","created_at":"2025-11-14 06:54:00","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1117259,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTRIM21 and USP8 reversibility regulates TJP1 ubiquitination and stability.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eThe co-IP assays were performed by treating with IgG, TRIM21 or TJP1 antibodies plus protein A/G magnetic beads in T24 and 5637 cells followed by immunoblotting with USP8 or TJP1 antibodies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B) \u003c/strong\u003eTJP1 protein expression was detected after transfecting TRIM21 in T24 and 5637 cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C) \u003c/strong\u003eT24 and 5637 cells were transfected with TRIM21 plasmid and treated with CHX (20 μg/mL) for 4,8 and 12 hours, the TJP1 expression was detected by western blot.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D) \u003c/strong\u003eT24 and 5637 cells were co-transfected with HA-Ub, V5-TRIM21 and Flag-TJP1 plasmids. Cells were lysed, and immunoprecipitated using anti-Flag magnetic beads, and then subjected to immunoblotting with the HA antibody to detect TJP1 ubiquitination.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(E) \u003c/strong\u003eT24 and 5637 cells were co-transfected with V5-USP8, HA-TRIM21 and Flag-TJP1 plasmids. Cells were lysed, and immunoprecipitated using anti-Flag magnetic beads, and then subjected to western blotting analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F) \u003c/strong\u003eT24 and 5637 cells were co-transfected with HA-Ub, V5-USP8, V5-TRIM21 and Flag-TJP1 plasmids as indicated. Cells were lysed, and immunoprecipitated using anti-Flag magnetic beads, and then subjected to immunoblotting with the HA antibody to detect TJP1 ubiquitination.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(G) \u003c/strong\u003e293T cells were transfected with the HA-Ub, Flag-TJP1, V5-TRIM21 and the indicated TJP1 mutant plasmids, cells were lysed, and immunoprecipitated using anti-Flag magnetic beads, and then subjected to immunoblotting with the HA antibody to detect TJP1 ubiquitination.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(H) \u003c/strong\u003eEA.hy926 cells cultured with conditioned medium (CM) derived from T24 and 5637 cells after overexpressed TRIM21. Tube formation was stained with Calcein AM (1 μM) for 30 minutes and imaged by fluorescence microscopy. Scale bar = 100 μm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(I) \u003c/strong\u003eThe number of meshes and segment lengths were analyzed using ImageJ software. All quantitative data are reported as the mean ± standard error of the mean (SEM) from at least three independent experiments. *,0.01\u0026lt; p \u0026lt; 0.05; **, 0.001\u0026lt; p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(J) \u003c/strong\u003eEA.hy926 cells cultured with conditioned medium (CM) derived from TRIM21-silenced T24 cells followed by TJP1 knockdown. Tube formation was stained with Calcein AM (1 μM) for 30 minutes and imaged by fluorescence microscopy. Scale bar = 100 μm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(K) \u003c/strong\u003eThe number of meshes and segment lengths were analyzed by ImageJ software. All quantitative data are reported as the mean ± standard error of the mean (SEM) from at least three independent experiments. *,0.01\u0026lt; p \u0026lt; 0.05; **, 0.001\u0026lt; p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/5434775309db996b13117338.png"},{"id":95893590,"identity":"0e166d8e-45e1-4062-9316-1703ad023e6d","added_by":"auto","created_at":"2025-11-14 06:54:03","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":976236,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhosphorylation of TJP1 by LYN promotes TJP1 deubiquitination, and TJP1 enters the nucleus with the assistance of TWIST1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eMass spectrometry data of analyzed the peptide of LYN pulled down by TJP1 was as indicated in panel.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B) \u003c/strong\u003e293T cells were co-transfected with Flag-TJP1 and MYC-LYN plasmids, cells were lysed and analyzed by IP assay using Flag magnetic beads followed by immunoblotting with Flag or MYC antibody.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C) \u003c/strong\u003e293T cells were transfected with the indicated plasmids or siRNA as well as LYN inhibitor Saracatinib, cells were lysed, and immunoprecipitated using anti-Flag magnetic beads, and then subjected to immunoblotting with the p-Tyrosine antibody to detect TJP1 phosphorylation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D) \u003c/strong\u003e293T cells were transfected with Flag-TJP1 or the indicated LYN mutant plasmids, cells were lysed, and immunoprecipitated using anti-Flag magnetic beads, and then subjected to immunoblotting with the p-Tyrosine antibody to detect TJP1 phosphorylation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(E) \u003c/strong\u003e293T cells were transfected with indicated plasmids, cells were lysed, and immunoprecipitated using anti-Flag magnetic beads, and then subjected to western blotting analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F)\u003c/strong\u003e IF assay was performed to detect TJP1 (red fluorescence) and USP8 (green fluorescence) in T24 and 5637 cells that transfecting the indicated LYN mutant plasmids. Photos were imaged by confocal microscope. Scale bar = 10 μm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(G) \u003c/strong\u003e293T cells were transfected with the HA-Ub, V5-USP8, Flag-TJP1, MYC-LYN and the indicated LYN mutant plasmids, cells were lysed, and immunoprecipitated using anti-Flag magnetic beads, and then subjected to immunoblotting with the HA antibody to detect TJP1 ubiquitination.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(H) \u003c/strong\u003e293T cells were co-transfected with MYC-LYN, V5-TRIM21 and Flag-TJP1 plasmids. Cells were lysed, and immunoprecipitated using anti-Flag magnetic beads, and then subjected to western blotting analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(I) \u003c/strong\u003e293T cells were transfected with the HA-Ub, V5-TRIM21, MYC-LYN, Flag-TJP1 plasmids, cells were lysed, and immunoprecipitated using anti-Flag magnetic beads, and then subjected to immunoblotting with the HA antibody to detect TJP1 ubiquitination.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(J) \u003c/strong\u003eFlag-TJP1 and the indicated LYN mutant plasmids were co-transfected into 293T cells. Nuclear and cytosolic proteins were immunoprecipitated with anti-Flag antibody and then immunoblotted with p-Tyrosine antibody.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(K)\u003c/strong\u003e T24 cells were transfected with LYN or the indicated LYN mutant plasmids, nuclear and cytosolic lysates were immunoblotted with the indicated antibodies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(L)\u003c/strong\u003e IF assay was performed to detect TJP1 (red fluorescence) and LYN (green fluorescence) in T24 cells that treatment with LYN inhibitor Saracatinib or transfecting the indicated LYN mutant plasmids. Photos were imaged by confocal microscope. Scale bar = 10 μm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(M) \u003c/strong\u003eFlag-TJP1, HA-TWIST1 and the indicated LYN mutant plasmids were co-transfected into 293T cells. Nuclear and cytosolic proteins were immunoprecipitated with anti-Flag antibody and then immunoblotted with the indicated antibodies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(N) \u003c/strong\u003eIF assay was performed to detect TJP1 (red fluorescence) and TWIST1 (green fluorescence) in T24 cells that treatment with LYN inhibitor Saracatinib or transfecting the indicated LYN mutant plasmids. Photos were imaged by confocal microscope. Scale bar = 10 μm.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/bba73387e73ad59157f21b5d.png"},{"id":95893556,"identity":"b1133492-561f-4389-97f3-872f08087433","added_by":"auto","created_at":"2025-11-14 06:53:57","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1637222,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLYN-mediated phosphorylation of TJP1 promotes BLCA angiogenesis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eLYN inhibitor Saracatinib was treated with T24 and 5637 cells to detect TJP1 expression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B) \u003c/strong\u003eT24 and 5637 cells were transfected with LYN or the indicated LYN mutant plasmids, the TJP1 expression was detected by western blot.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C) \u003c/strong\u003eEA.hy926 cells cultured with conditioned medium (CM) derived from T24 cells when treating with LYN inhibitor Saracatinib. Tube formation was stained with Calcein AM (1 μM) for 30 minutes and imaged by fluorescence microscopy. Scale bar = 100 μm.\u003cstrong\u003e \u003c/strong\u003eThe number of meshes and segment lengths were analyzed using ImageJ software. All quantitative data are reported as the mean ± standard error of the mean (SEM) from at least three independent experiments. *,0.01\u0026lt; p \u0026lt; 0.05; **, 0.001\u0026lt; p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D) \u003c/strong\u003eThe xenograft mice were sacrificed in time, the Matrigel plugs were taken out and photograph.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(E) \u003c/strong\u003eIHC staining for LYN and CD31 in paraffin embedded Matrigel plugs, insets show magnification for staining detail, the scale bar, 250 μm. The relative IHC staining index of LYN and CD31 in Matrigel plugs from xenograft mice injected with indicated T24 cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F) \u003c/strong\u003eEA.hy926 cells cultured with conditioned medium (CM) derived from T24 cells when treating with LYN inhibitor Saracatinib, followed by overexpressed TJP1 or USP8. Cells were colored by Calcein AM (1 μM) for 30 min and imaged by fluorescence microscope. Scale bar = 100 μm. The network formation numbers were counted and statistic analyzed by angiogenesis module of Image J. All quantitative data are reported as the mean ± standard error of the mean (SEM) from at least three independent experiments. *,0.01\u0026lt; p \u0026lt; 0.05; **, 0.001\u0026lt; p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(G) \u003c/strong\u003eEA.hy926 cells cultured with conditioned medium (CM) derived from T24 cells that transfected with indicated plasmids. Cells were colored by Calcein AM (1 μM) for 30 min and imaged by fluorescence microscope. Scale bar = 100 μm. Vascular-like network formation numbers were counted and analyzed by angiogenesis module of Image J. All quantitative data are reported as the mean ± standard error of the mean (SEM) from at least three independent experiments. *,0.01\u0026lt; p \u0026lt; 0.05; **, 0.001\u0026lt; p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(H) \u003c/strong\u003e293T cells were co-transfected with the indicated plasmids for 24 hours, the relative activity of the CCL2 promoter was evaluated by dual luciferase reporter assay. All quantitative data are reported as the mean ± standard error of the mean (SEM) from at least three independent experiments. *,0.01\u0026lt; p \u0026lt; 0.05; **, 0.001\u0026lt; p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/f9cd5cf754ba6c1ea6626a98.png"},{"id":95893568,"identity":"ae9c1d3e-aae7-45cc-8e39-570be778c383","added_by":"auto","created_at":"2025-11-14 06:54:00","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1515482,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe LYN–USP8–TJP1 complex could be targeted for BLCA.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eThe migratory properties of T24 and 5637 cells treatment with different inhibitors or indicated plasmid were analyzed by migration assay. Scale bar = 500 μm. Representative quantifications of Transwell migration treatment with different inhibitors or indicated plasmid in BLCA cells. All quantitative data are reported as the mean ± standard error of the mean (SEM) from at least three independent experiments. *,0.01\u0026lt; p \u0026lt; 0.05; **, 0.001\u0026lt; p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B) \u003c/strong\u003eSchematic diagram of tumors established in SCID mice by tail vein injection of T24 cells and treated with Saline, DUBs-IN-2 or Saracatinib every 3 days.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C) \u003c/strong\u003eRepresentative images of lung colonization by T24 cells injected into the tail veins of SCID mice, HE staining representing lung metastasis measured on day 60. Scale bar = 200 μm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D) \u003c/strong\u003eIHC staining of LYN, USP8 and TJP1 in LYN \u003csup\u003eHigh\u003c/sup\u003e, LYN \u003csup\u003eMiddle\u003c/sup\u003e and LYN \u003csup\u003eLow\u003c/sup\u003e BLCA patients. Scale bar = 100 μm, insets show magnification for staining detail. Analysis between LYN expression of BLCA patients with USP8 (p=0.0128) and TJP1 (p=0.0062) staining in IHC results.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(E) \u003c/strong\u003eThe correlation analysis (https://cistrome.shinyapps.io/timer/) between indicated genes in BLCA patients from TCGA database.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F) \u003c/strong\u003eR software was used to download the BLCA expression matrix and clinical data from TCGA. The distribution analysis of clinicopathological parameters in patients with BLCA in samples of three factors all high expression group and three factors all low expression group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(G) \u003c/strong\u003eThe overall survival of three factors all high expression group and three factors all low expression group expressed BLCA patients was analyzed by R software.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/4edd59ad3a03a516351803c1.png"},{"id":95893558,"identity":"acde1145-5e24-4e61-950d-b4154f1f8241","added_by":"auto","created_at":"2025-11-14 06:53:57","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":639393,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eModel diagram framework.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/dcaa338007aeed06bbae58d6.png"},{"id":98435365,"identity":"d00d71f1-341c-4ed7-ae2e-1f1c0a38f4fa","added_by":"auto","created_at":"2025-12-17 16:53:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":11296223,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/beb6794b-92c2-400f-9c5c-96eb139d72e0.pdf"},{"id":95893583,"identity":"fd2bf714-0a97-4445-84a7-4f118b3fa0c1","added_by":"auto","created_at":"2025-11-14 06:54:02","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":9038099,"visible":true,"origin":"","legend":"SUPPLEMENTAL MATERIAL","description":"","filename":"Supplementarymaterials2025.docx","url":"https://assets-eu.researchsquare.com/files/rs-7928736/v1/b643a2f155416abeec9defe4.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.","formattedTitle":"LYN-mediated phosphorylation promotes TJP1 deubiquitination via USP8 to drive neovascularization and tumorigenesis in bladder cancer","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBladder cancer is the most common malignancy of the urinary system and has a high mortality rate and a poor prognosis[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. At present, no significantly effective molecular targeted anticancer drugs have been approved for the treatment of this extremely complicated disease[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. In developing mammalian embryos, angioblasts differentiate into endothelial cells, which assemble into a reticular vessel, a process called vasculogenesis[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Tumor angiogenesis is a pathophysiological process that involves the formation of new blood vessels in the primary site of the tumor or distant organs. It is a typical hallmark of tumor development and metastasis, which helps the escaped cancer cells to metastasize across the distance by providing sufficient nutrition to the cancer cells to promote the growth and progression of tumors[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Therefore, targeting tumor angiogenesis has long been an alternative approach for cancer therapy. As bladder cancer is a highly vascularized tumor, its recurrence and metastasis are closely related to neovascularization[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], but the genetic basis of angiogenesis and the signaling pathways involved remain largely uncharacterized. Recently, we and others reported the function of TJP1 in tumor proangiogenesis that occurs mainly by TJP1 regulating the pathway of proangiogenic genes, the expression and transcriptional activity of these genes are directly regulated by TJP1 and ultimately promote tumor angiogenesis[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. However, the way in which TJP1 is regulated in BLCA neovascularization and the specific underlying mechanism have not yet been determined. Although TJP1 has been reported to regulate its own stability by the proteasome pathway, the relevant ubiquitases and specific mechanism in tumor regulation have not been clarified[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eProtein ubiquitination is a dynamic posttranslational modification involved in many processes. Ubiquitinases and deubiquitinases dynamically regulate the stability or activity of some key substrate proteins, thus participating in the pathogenesis of various diseases[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In recent years, accumulating evidence has established the fundamental role of ubiquitination regulation in cancer pathogenesis, and has revealed the high therapeutic potential of targeted ubiquitination in multiple cancers[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. USP8 belongs to the USP/UBP family of deubiquitinating enzymes, which has been reported to directly or indirectly participate in the deubiquitination of particular substrates to affect the development of multiple cancers[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Previous studies have also shown that USP8 is continually overexpressed in a wide variety of cancers and that patients with cancers with high USP8 expression have lower overall survival, implying that USP8 is a potential therapeutic target in cancers[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. However, whether USP8 is involved in BLCA angiogenesis by regulating the ubiquitination of targeted substrates has not been reported.\u003c/p\u003e\u003cp\u003eProtein kinases play an important role in signal transduction by regulating protein activity through phosphorylation and amplifying signals step by step through a cascade of protein phosphorylation[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. It has been shown that extracellular signals strictly regulate the ubiquitination of target proteins whose regulation in many cases depends on protein phosphorylation[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. LYN is a Src family kinase (SFK), whose phosphorylation regulation occupies a decisive position in a variety of carcinogenic cell processes, including tumor cell migration, invasion and proliferation[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. LYN-mediated tyrosine phosphorylation has been reported to be a prerequisite for the ubiquitination that dampens NLRP3 inflammasome activity[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In addition, LYN interacts with IRF5 to regulate its transcriptional activity by inhibiting the phosphorylation and ubiquitination of IRF5[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Recent findings have indicated that TJP1 has multiple kinase phosphorylation sites[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], suggesting that phosphorylation of TJP1 may also be involved in the regulation of ubiquitination of TJP1. However, whether phosphorylation of LYN kinase regulates ubiquitination of TJP1 and further influences angiogenesis and metastasis of bladder cancer is not yet known.\u003c/p\u003e\u003cp\u003eIn the current study, we have unveiled a new pathway that regulates TJP1 ubiquitination and stability that thereby enhances tumor neovascularization and promotes tumorigenesis. Our research identifies USP8 as a key upstream mediator of TJP1 involved in angiogenesis regulation in bladder cancer. USP8 competitively binds to TJP1 with TRIM21, preventing ubiquitination degradation at the K695 site of TJP1 and increasing its stability. Furthermore, we have also found that LYN kinase phosphorylates TJP1 to increase its interaction with USP8. Phosphorylated TJP1 facilitates nuclear entry and binding to TWIST1, thus enhancing the transcriptional regulation of the proangiogenesis gene CCL2, ultimately leading to BLCA progression. Taken together, these results reveal the deeper mechanism of TJP1 in BLCA neovascularization and elucidate the comprehension of the physiological tumor-associated function of the LYN\u0026ndash;USP8\u0026ndash;TJP1 axis in bladder cancer.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eUSP8 promotes tumor angiogenesis in bladder cancer by interacting with TJP1\u003c/h2\u003e\u003cp\u003eTo enable the proteomic identification of deubiquitination enzymes (DUBs) modified with TJP1, we conducted purification and mass spectrometry analysis to identify TJP1-associated proteins. First, Flag-tagged TJP1 was stably expressed in 293T cells, and endogenous levels of TJP1 were expressed in T24 and 5637 BLCA cells. Whole-cell lysates were prepared and subjected to affinity purification using anti-Flag magnetic beads for exogenous TJP1 and TJP1 antibodies with protein A/G magnetic beads for endogenous TJP1 (Supplementary Fig.\u0026nbsp;1A). The mass spectrometry analysis revealed the copurification of various DUBs with TJP1, while USP8 prominently interacted with TJP1 in both exogenous and endogenous coprecipitation experiments (Supplementary Fig.\u0026nbsp;1B-C). Additionally, we also observed a strong pull-down interacting protein with a molecular weight of approximately 128 kDa in the Coomassie staining of the whole cell lysate, consistent with the known molecular weight of USP8[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. To further confirm this interaction, we performed coimmunoprecipitation (co-IP) assays by cotransfecting HA-USP8 and Flag-TJP1 plasmids into 293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Likewise, endogenous co-IP and immunofluorescence (IF) assays verified the combination of USP8 and TJP1 in both T24 and 5637 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-C). To further elucidate the details of the molecular interaction between TJP1 and USP8, we constructed the different domains of TJP1 and identified the interacting domains using deletion segment analysis (Supplementary Fig.\u0026nbsp;1D). The results showed that the SFB3 mutant acquired stronger binding affinity with USP8, whereas others displayed sharply decreased binding affinity, which indicated that the GUK domain of TJP1 was essential for USP8 binding (Supplementary Fig.\u0026nbsp;1E). In addition, we found that the TJP1 protein levels were positively correlated with USP8 levels in BLCA tissues (n\u0026thinsp;=\u0026thinsp;57, Spearman \u003cem\u003er\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.3461, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0084) and for The Cancer Genome Atlas (TCGA) database BLCA data (n\u0026thinsp;=\u0026thinsp;408, Spearman \u003cem\u003er\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.708, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-E). Therefore, these results suggest that TJP1 interacts with USP8 and that USP8 may be a potential regulator of TJP1 stability and its ability to facilitate tumor angiogenesis in bladder cancer.\u003c/p\u003e\u003cp\u003eUSP8 has been identified as marker of poor prognosis in several types of cancer[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In this study, we discovered that USP8 overexpression was associated with poor overall survival in BLCA patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e1\u003c/span\u003eF), implying that USP8 serves as a factor indicating a poor prognosis in BLCA. Our previous research has thoroughly documented that TJP1 is responsible for a protumor angiogenic role in bladder cancer. Thus, we were curious to investigate whether USP8 is involved in the regulation of BLCA angiogenesis. Our data showed significant enrichment in the angiogenic-related gene set in the BLCA patient subgroup with high USP8 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). Interestingly, the subgroup with high levels of USP8 also exhibited enrichment in TJP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e1\u003c/span\u003eH). To provide additional evidence, neovascularization regulation of USP8 was performed in T24 and 5637 BLCA cells. Similar to TJP1, the USP8-specific inhibitor DUBs-IN-2[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], significantly suppressed tube formation in EA.hy926 cells cultured with conditioned medium (CM) derived from BLCA cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e1\u003c/span\u003eI, Supplementary Fig.\u0026nbsp;2A). To validate these results, we quantified of the number of meshes and the total segments length in the above results (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e1\u003c/span\u003eI, Supplementary Fig.\u0026nbsp;2A). Furthermore, a Matrigel plug assay was performed to assess whether USP8 promoted tumor angiogenesis \u003cem\u003ein vivo\u003c/em\u003e (Supplementary Fig.\u0026nbsp;2B). The results showed obvious DUBs-IN-2 suppression of blood vessel development on the surface of the plugs, which also decreased the expression of the endothelial cell marker CD31 (Supplementary Fig.\u0026nbsp;2C-F).\u003c/p\u003e\u003cp\u003eTo further confirm whether USP8 plays a critical role in TJP1-regulated BLCA angiogenesis, we re-expressed TJP1 in USP8-silenced T24 and 5637 cells and monitored tumor angiogenesis with endothelial cells cultured using conditioned medium (CM) from the aforementioned cells. The tube formation assays revealed that overexpression of TJP1 restored the inhibition of tumor angiogenesis caused by USP8 knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ, Supplementary Fig.\u0026nbsp;2G). In addition, the increase in the number of blood vessels and CD31 expression in plugs containing TJP1-overexpressing cells were significantly eliminated by DUBs-IN-2 injection (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e1\u003c/span\u003eK-L, Supplementary Fig.\u0026nbsp;2H-I). In other words, inhibition of USP8 blocked the vascular abnormalities induced by TJP1 in BLCA. These successful rescue experiments affirmed that USP8 serves as the key upstream mediator of TJP1 in facilitating tumor angiogenesis and vascular abnormalization in bladder cancer.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eUSP8 removes K48 and K63-linked ubiquitin conjugates from TJP1 to improve its stability\u003c/h3\u003e\n\u003cp\u003eBecause TJP1 showed a short half-life in our previous study and given the verification of the interaction between TJP1 and USP8, we hypothesized that USP8 regulates TJP1 expression and stability. We first detected TJP1 expression with USP8 interference in BLCA cells. The results indicated that USP8 knockdown effectively decreased TJP1 expression after treatment with either USP8 siRNAs or the USP8 inhibitor DUBs-IN-2[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-B), whereas, TJP1 levels were remarkably upregulated upon USP8 overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). To further determine the possible regulatory effect of USP8 on TJP1 stability, we utilized cycloheximide (CHX) to inhibit protein synthesis and analyzed the protein half-life of TJP1 in the case of USP8 overexpression or knockdown in T24 and 5637 cells. Notably, overexpression of USP8 led to a prolonged half-life of endogenous TJP1 levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-E), whereas depletion of USP8 resulted in the opposite phenomenon (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e2\u003c/span\u003eF-G). USP8 is a classical deubiquitylase that can remove the ubiquitin chain from its substrate[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], as USP8 binds to and positively regulates TJP1 protein stability. We hypothesized that USP8 might increase TJP1 stability via deubiquitylation. To date, TJP1 ubiquitination has never been reported in the previous literature. To determine whether USP8 was responsible for TJP1 deubiquitination, we performed an immunoprecipitation assay to detect TJP1 ubiquitination, and the precipitates were detected as smear bands as previously reported[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. We found that TJP1 was ubiquitinated after cotransfection with the Ub and TJP1 plasmids in T24 and 5637 cells. Intriguingly, USP8 overexpression removed TJP1 ubiquitination (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). Conversely, knockdown of USP8 significantly increased the ubiquitination of TJP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e2\u003c/span\u003eI). Therefore, these results suggested that USP8 was the specific deubiquitylase for TJP1, which enhanced the protein stability of TJP1 through deubiquitination.\u003c/p\u003e\u003cp\u003eThe role of USP8 in stabilizing the substrate through its deubiquitination enzyme activity may depend on which type of ubiquitin chain is removed from the substrate[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. USP8 was reported to regulate protein degradation function by antagonizing K48- or K63-linked ubiquitination primarily through deubiquitination enzyme activity[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. It has been well determined that the K48- and K63-linked Ub chains mainly target proteasome degradation and lysosome degradation or various signaling pathways, respectively. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ-K, we found that the proteasome inhibitor MG132 as well as the lysosome inhibitor Baf. A1 dramatically increased TJP1 protein levels. Notably, treatment with MG132 and Baf. A1 also rescued the TJP1 protein levels resulting from USP8 knockdown in T24 and 5637 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e2\u003c/span\u003eL-M), suggesting that USP8 stabilized TJP1 protein expression both through the proteasome and lysosome pathways. To further identify the preferentially targeted Ub linkages conjugated to TJP1 by USP8, we generated a series of HA-tagged Ub mutants that had only one single lysine (K) with all other lysine residues mutated to arginine. K48 and K63 mutants were cotransfected with the Flag-TJP1 plasmid into 293T cells, and the TJP1 degradation pathway was evaluated by immunoprecipitation assay and then subjected to western blotting with an anti-HA antibody to clarify the level of each K-linkage-conjugated TJP1. We found that both the K48 and K63 chains significantly promoted TJP1 ubiquitination, which was consistent with the function of nonmutant Ub (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e2\u003c/span\u003eN). Furthermore, USP8 overexpression preferentially removed TJP1 ubiquitinated at K63 and K48 (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e2\u003c/span\u003eO), indicating that USP8 stabilized the TJP1 protein mainly through K48- and K63-associated lysosomal and proteasome degradation pathways.\u003c/p\u003e\n\u003ch3\u003eUSP8 accelerates BLCA angiogenesis by deubiquitinating TJP1 at the Lys695 site\u003c/h3\u003e\n\u003cp\u003eTo confirm the lysine site that is deubiquitinated by USP8, we applied a deep-learning tool, \u0026lsquo;UBiprober\u0026rsquo;[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], to predict the ubiquitination sites that might be ubiquitinated by TJP1 and found 17 possible lysine sites (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). We next sought to identify the specific sites on TJP1 through mass-spectrometric analysis. By cotransfecting 293T cells with Flag-TJP1 and HA-Ub plasmids, Flag-TJP1 was purified, and the lysine residues on TJP1 were modified by ubiquitination. Four ubiquitination sites, K502, K529, K695 and K1709, were identified (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e3\u003c/span\u003eB-C and Supplementary Fig.\u0026nbsp;3A). To validate the authenticity of the ubiquitination sites, we created individual point mutants where both lysine residues at positions K502, K529, K695 and K1709 were replaced with arginine. These mutants were transfected into 293T cells together with Flag-TJP1 and HA-Ub. The results showed that the TJP1-K695R mutant had a substantial reduction in the overall ubiquitination compared to the wild-type TJP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). In addition, there was no detectable ubiquitination in the double mutant of where both lysine residues were at position K695 and one of the other three sites (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e3\u003c/span\u003eE), suggesting that K695 was likely the major ubiquitination site on TJP1. Moreover, K695 was also the predicted ubiquitination site. Interestingly, K695 is located in the GUK domain known to be involved in the interaction with USP8. More importantly, we found that USP8 overexpression failed to abolish TJP1 ubiquitination when the K695 site was mutated (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e3\u003c/span\u003eF), indicating that USP8 regulated TJP1 deubiquitination mainly through the K695 site. In addition, we found that USP8 overexpression did not prolong the half-life of TJP1-K695R more than with wild-type TJP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e3\u003c/span\u003eG and Supplementary Fig.\u0026nbsp;3B). The tube formation assay also showed that the increased vascular formation caused by TJP1 and USP8 was significantly inhibited by TJP1 K695R (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e3\u003c/span\u003eH-I). Meanwhile, K695 mutation also inhibited the transcriptional activation of CCL2 caused by TJP1 and USP8 overexpression (Supplementary Fig.\u0026nbsp;3C), which was based on our previous finding that TJP1 promoted the transcriptional activation of CCL2 in BLCA. Collectively, these results indicated that USP8 promoted the stability of TJP1 and tumor angiogenesis by deubiquitination TJP1 at the K695 site.\u003c/p\u003e\n\u003ch3\u003eTRIM21 competes with USP8 to degrade TJP1 in BLCA cells\u003c/h3\u003e\n\u003cp\u003eNotably, ubiquitination is a reversible regulatory process that involves in various kinds of ubiquitin-related enzymes; therefore, the protein ubiquitination catalyzed by deubiquitination enzymes can be reversed by E3 ubiquitin ligases[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. As a consequence, a specific E3 ubiquitin ligase may exist that can reverse the deubiquitination of TJP1 by USP8. Interestingly, the TJP1 protein-binding mass spectrometry assay in our previous study revealed that multiple E3 ubiquitin ligases were precipitated (Supplementary Table\u0026nbsp;1). We found that most of these ligases were members of the TRIM family of proteins, including TRIM25, TRIM27 and TRIM32 (Supplementary Fig.\u0026nbsp;4A). We further corroborated their interaction with TJP1 by co-IP assays (Supplementary Fig.\u0026nbsp;4B). Unfortunately, these E3 ubiquitin ligases neither steadily inhibited TJP1 expression nor increased ubiquitin-mediated degradation by the proteasome pathway (Supplementary Fig.\u0026nbsp;4C-E), indicating that none of them were the specific E3 ubiquitin ligases for TJP1.\u003c/p\u003e\u003cp\u003eGap junction protein Connexin43 and autophagy junction protein SQSTM1/p62 have been reported to be regulated by the dynamic ubiquitination of the deubiquitination enzyme USP8 and the E3 ubiquitin ligase TRIM21[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan additionalcitationids=\"CR30\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], suggesting that USP8 and TRIM21 may be a pair of ubiquitination enzymes and deubiquitination enzymes that regulate the ubiquitination of substrates. Notably, although no TRIM21 interaction was detected in TJP1 binding mass spectrometry assay, TRIM21 was shown to interact with Flag-tagged TJP1 in the co-IP assays (Supplementary Fig.\u0026nbsp;4B). Thus. we hypothesized that TRIM21 might be involved in the ubiquitination of TJP1 together with USP8, thus participating in angiogenesis regulation in bladder cancer. On the basis of these data, the potential role of TRIM21 as an E3 ligase for TJP1 was investigated. We first further verified the endogenous binding of TRIM21 and TJP1 in T24 and 5637 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). In addition, TRIM21 overexpression significantly reduced the TJP1 protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Moreover, ectopic expression of TRIM21 significantly shortened the protein half-life of TJP1 in T24 and 5637 cells, suggesting that TRIM21 destabilized TJP1 at the posttranslational level (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Consistent with this outcome, we found that TRIM21 significantly increased TJP1 ubiquitination degradation (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e4\u003c/span\u003eD), demonstrating that TJP1 was the bona fide substrate of TRIM21 in BLCA cells. Since protein ubiquitination is an instantaneous and dynamic regulatory process, we further explored whether USP8 and TRIM21 competitively bind TJP1 to achieve dynamic ubiquitination regulation of TJP1. Intriguingly, TRIM21 competed with USP8 to bind to TJP1, and \u003cem\u003evice versa\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Consistently, overexpression of TRIM21 restored the inhibition of TJP1 ubiquitination induced by USP8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e4\u003c/span\u003eF), indicating that TRIM21 competitively bound to TJP1 and attenuated the effect of USP8 on TJP1 deubiquitination. Because USP8 deubiquitinates TJP1 at the Lys695 site, we next sought to examine whether TRIM21 promoted TJP1 ubiquitination degradation through its K695 site. Notably, the promotion of ubiquitination degradation of TJP1 by TRIM21 was significantly blocked by the K695 mutation of TJP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e4\u003c/span\u003eG), revealing that the ubiquitination function of TRIM21 on TJP1 could indeed be regulated by the K695 site of TJP1, which further indicated the competitive dynamic ubiquitination effect of USP8 and TRIM21 on TJP1. Taken together, these data suggested that, by competing with USP8, TRIM21 bound to and degraded TJP1 in bladder cancer cells.\u003c/p\u003e\u003cp\u003eWe then explored whether TRIM21 was involved in bladder cancer angiogenesis through TJP1 and thus affected tumor progression. By analyzing the relationship between TRIM21 expression and the overall survival of BLCA patients utilizing data in the TCGA database, we found that higher levels of TRIM21 were associated with higher overall survival in the TCGA database (Supplementary Fig.\u0026nbsp;4F), illustrating that in contrast to TJP1 and USP8, TRIM21 might play a role as a tumor suppressor in the development of BLCA. Next, we performed a tube formation assay to determine the function of TRIM21 in the regulation of BLCA angiogenesis. Our results demonstrated that overexpression of TRIM21 significantly inhibited the ability of endothelial cells to form vascular-like network structures in T24 and 5637 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e4\u003c/span\u003eH-I), indicating that TRIM21 overexpression inhibited BLCA angiogenesis. Additionally, we have observed that the promotion of tumor angiogenesis induced by silenced TRIM21 expression was obviously blocked by knockdown of TJP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ-K). As a consequence, these results supported the notion that TRIM21 suppressed BLCA angiogenesis largely through accelerating the ubiquitination degradation of TJP1, resulting in limited activation of the proangiogenesis signaling pathway.\u003c/p\u003e\u003cp\u003e\u003cb\u003eLYN phosphorylation of TJP1 increases TJP1 stability and nuclear localization.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eUbiquitination of target proteins is strictly regulated by extracellular stimuli, which, in many cases, are dependent upon protein phosphorylation[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Importantly, the regulatory steps affected by phosphorylation may involve substrate recognition or actual coupling reactions by ubiquitin-associated enzymes[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].This prompted us to explore a potential association between the phosphorylation and ubiquitination of TJP1. TJP1 is known to undergo phosphorylation, thus regulating the multivalent interaction of the conserved PDZ-SH3-GUK supra-domain[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Our mass spectrometry analysis revealed that an Src family kinase, LYN, interacted with endogenous TJP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Additionally, LYN was coprecipitated with TJP1 from the cell lysates (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eB), indicating a specific association between them, which further suggests that TJP1 might be phosphorylated by LYN and might ulteriorly participate in the regulation of its ubiquitination. To test whether TJP1 could be a phosphorylation substrate of LYN kinase, we used a specific phospho-tyrosine antibody to examine the phosphorylation status of TJP1 immunoprecipitated from cells. We found that no tyrosine phosphorylation of TJP1 was detected without transfection with LYN, whereas LYN activation displayed an obvious phosphorylation state (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Intriguingly, consistent with LYN inhibition by the Saracatinib inhibitor, depletion of endogenous LYN using targeting siRNAs strikingly suppressed TJP1 tyrosine phosphorylation levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Saracatinib has been reported to be a specific Src inhibitor that effectively inhibits LYN kinase activity[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In addition, LYN has been reported to have a kinase activation site[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. We constructed LYN mutant, which carrying a phenylalanine substitution at Y397 that impairs the phosphorylation of LYN in its activation loop, thereby blocking its kinase activity. Accordingly, the kinase-inactive LYN mutant attenuated tyrosine phosphorylation of TJP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). These results suggested that the phosphorylation of TJP1 at tyrosine residues was regulated by LYN. In addition, we also determined the tyrosine phosphorylation status of USP8 mediated by LYN, and the results indicated that neither LYN overexpression nor silenced LYN levels could further alter USP8 tyrosine phosphorylation (Supplementary Fig.\u0026nbsp;5A).\u003c/p\u003e\u003cp\u003eTo examine the functional effect of LYN-mediated phosphorylation of TJP1 in regulating TJP1 ubiquitination, we first assessed whether LYN affected the combination of USP8 and TJP1. Interestingly, overexpression of LYN significantly increased the binding of USP8 with TJP1, while LYN knockdown or inhibition its kinase activity obviously suppressed conjugation (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eE and Supplementary Fig.\u0026nbsp;5B). In addition, we performed an immunofluorescence assay and found that the colocalization between USP8 and TJP1 was also visibly restrained by LYN mutations (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eF and Supplementary Fig.\u0026nbsp;5C). The above results suggested that LYN-activated phosphorylation may participate in USP8-dependent deubiquitination of TJP1. In line with this, we found that LYN increased the deubiquitination of USP8 on TJP1, but not of LYN mutants (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eG and Supplementary Fig.\u0026nbsp;5D). Besides, the K695 mutation of TJP1 blocked the LYN-mediated deubiquitination of USP8 on TJP1 (Supplementary Fig.\u0026nbsp;5E), suggesting that LYN was indeed involved in the regulation of TJP1 ubiquitination through its kinase activity. Since our previous research indicated that USP8 and TRIM21 competitively bound TJP1 and dynamically regulated its ubiquitination, we further examined the effect of LYN phosphorylation on the affinity for TJP1 and TRIM21. Intriguingly, incubation with LYN markedly decreased the binding of TJP1 with TRIM21 (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eH). Accordingly, LYN overexpression inhibited the ubiquitination degradation of TJP1 by TRIM21, whereas, TRIM21 blocked the deubiquitination of TJP1 by LYN (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eI and Supplementary Fig.\u0026nbsp;5F). Collectively, these data provide evidence that LYN-mediated phosphorylation promotes TJP1 deubiquitination by specifically enhancing the USP8\u0026ndash;TJP1 interaction.\u003c/p\u003e\u003cp\u003eThe TJP1 phosphorylation state has been previously linked to tight-junction formation, and phosphorylated TJP1 weakens tight junctions and may increase cytoplasmic and nuclear localization[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In the present study, LYN phosphorylated TJP1 in both the cytoplasm and nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ). Nevertheless, by separating cell components (cytoplasm and nucleus) to observe the distribution of TJP1 in cells, we found that LYN phosphorylation increased the nuclear localization of TJP1 in T24 and 5637 cells, while LYN mutation inhibited TJP1 translocation into the nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eK and Supplementary Fig.\u0026nbsp;5G). The same results were found by immunofluorescence experiments (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eL and Supplementary Fig.\u0026nbsp;5H), indicating that phosphorylated TJP1 was more likely to enter the nucleus and influence in the development of bladder cancer. Our previous results indicated that TJP1 plays a vital role in TWIST1 transcriptional activation and thus promotes tumor angiogenesis in BLCA[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Therefore, exploring the details of TJP1/TWIST1 complex action might be important in elucidating the profound mechanisms of TJP1 in the regulation of BLCA vasculogenesis. We thus explored whether LYN\u0026rsquo;s regulation of TJP1 phosphorylation affected the combination and nuclear localization of TJP1 and TWIST1. Co-IP results indicated that phosphorylation of TJP1 significantly increased the cytoplasmic and nuclear binding of TJP1 and TWIST1, while LYN mutants obviously inhibited the colocalization of both (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eM). In addition, we performed an immunofluorescence assay and found that the colocalization of TJP1 and TWIST1 was visibly restrained by the LYN mutations (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eN and Supplementary Fig.\u0026nbsp;5I). Accounting for the interaction between TJP1 and TWIST1, these results suggested that LYN modulated the binding of TJP1 and TWIST1 by promoting the phosphorylation of TJP1 to further influence downstream transcriptional activity regulated by TWIST1. As a consequence, we analyzed the transcriptional activity of CCL2 and found that overexpression of LYN further increased TJP1-facilitated TWIST1-induced transcriptional activation of CCL2; accordingly, LYN mutants blocked the above effect caused by LYN overexpression (Supplementary Fig.\u0026nbsp;5J). In conclusion, our results demonstrated that, phosphorylation of TJP1 by LYN promoted the nuclear localization of TJP1 and increased the interaction between TJP1 and TWIST1. In addition, while TJP1 interacted with TWIST1 in the nucleus, LYN was transported to the nucleus as a complex with TJP1, which further phosphorylated TJP1 and then activated TJP1-induced transcriptional activation of CCL2 through TWIST1.\u003c/p\u003e\n\u003ch3\u003eLYN-mediated phosphorylation of TJP1 is involved in tumor angiogenesis in BLCA\u003c/h3\u003e\n\u003cp\u003eAs mentioned above, LYN phosphorylated TJP1 and increased its interaction with USP8 to increase its stability. In addition, phosphorylated TJP1 promoted the transcriptional activation of CCL2 by TWIST1. Finally, we explored whether LYN's regulation of TJP1 phosphorylation might influence the role of TJP1 in the regulation of angiogenesis in bladder cancer. First, we examined the role of LYN kinase activity in regulating TJP1 expression in bladder cancer. This result indicated that the increased concentration of Saracatinib significantly inhibited TJP1 expression but had little effect on LYN levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig13\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Besides, LYN kinase-inactive mutants blocked the effect of LYN in facilitating TJP1 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig13\" class=\"InternalRef\"\u003e6\u003c/span\u003eB), implying that LYN increased the expression and stability of TJP1 through its kinase activity. We subsequently investigated the role of LYN kinase activity in regulating BLCA angiogenesis \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e. We found that tube formation was obviously decreased when EA.hy926 cells were incubated with CM derived from Saracatinib-treated T24 and 5637 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig13\" class=\"InternalRef\"\u003e6\u003c/span\u003eC and Supplementary Fig.\u0026nbsp;6A). Additionally, blood vessel formation on the plug surface was greatly suppressed after Saracatinib treatment, accordingly accompanied by a decrease in CD31 staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig13\" class=\"InternalRef\"\u003e6\u003c/span\u003eD-E and Supplementary Fig.\u0026nbsp;6B-D). Unexpectedly, there was also an apparent decrease in the expression of LYN in Saracatinib plugs, suggesting that long-term Saracatinib injection may reduce the protein levels of LYN (Fig.\u0026nbsp;\u003cspan refid=\"Fig13\" class=\"InternalRef\"\u003e6\u003c/span\u003eE and Supplementary Fig.\u0026nbsp;6D). In addition, we found that the decreased vascular formation in EA.hy926 cells cultured with CM derived from Saracatinib-incubated BLCA cells was greatly restored by overexpression of USP8 and TJP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig13\" class=\"InternalRef\"\u003e6\u003c/span\u003eF and Supplementary Fig.\u0026nbsp;6E). Moreover, LYN further promoted USP8- and TJP1-induced BLCA angiogenesis, while which was blocked by phosphorylated mutants of LYN (Fig.\u0026nbsp;\u003cspan refid=\"Fig13\" class=\"InternalRef\"\u003e6\u003c/span\u003eG and Supplementary Fig.\u0026nbsp;6F). In line with this, we also investigated the effect of LYN kinase activity on CCL2 transcriptional activity based on USP8 and TJP1 transfection. As expected, compared to wild-type LYN, LYN mutants evidently decreased the transcriptional activation of CCL2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig13\" class=\"InternalRef\"\u003e6\u003c/span\u003eH). Collectively, these data provide evidence that LYN-mediated phosphorylation promotes TJP1-induced BLCA angiogenesis by specifically enhancing the USP8-TJP1 interaction.\u003c/p\u003e\u003cp\u003eGiven the evidence that LYN kinase activity regulates neovascularization in bladder cancer, we performed a gene set enrichment analysis (GSEA) analysis to explore the correlation between LYN expression and the BLCA TCGA angiogenic gene set. The results indicated that BLCA patients in the LYN high expression subgroup were obviously enriched in the angiogenic-related gene set (Supplementary Fig.\u0026nbsp;6G). Moreover, we found that the expression of LYN in BLCA tumors was significantly higher than that in adjacent tissues (Supplementary Fig.\u0026nbsp;6H). In addition, LYN upregulation was associated with poor overall survival in patients with BLCA (Supplementary Fig.\u0026nbsp;6H), suggesting that similar to TJP1 and USP8, LYN was also a factor indicating poor prognosis in bladder cancer progression.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eThe LYN-mediated USP8\u0026ndash;TJP1 complex could be targeted for treating BLCA\u003c/h2\u003e\u003cp\u003eThe above results suggested that LYN promoted the phosphorylation of TJP1 to increase its interaction with USP8, improving TJP1 expression and stability, and further facilitating the nuclear colocalization of TJP1 and TWIST1. This entire signaling pathway provides multiple possible therapeutic targets for BLCA. Given the important role of tumor angiogenesis in BLCA metastasis, we next investigated the effect of the LYN-mediated USP8\u0026ndash;TJP1 complex on tumor metastasis. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, transwell assays revealed that both LYN and USP8 inhibitors significantly inhibited the ability of cell migration, while the inhibition of cell migration by Saracatinib combined with DUBs-IN-2 was reversed in cells that overexpressed TJP1, indicating that TJP1 was involved in LYN- and USP8-modified tumor metastasis in the BLCA cells. In addition, we found that both Saracatinib and DUBs-IN-2 significantly inhibited colony formation in T24 and 5637 cells, while overexpressed LYN and USP8 gave the opposite results (Supplementary Fig.\u0026nbsp;7A-D). Next, we carried out an \u003cem\u003ein vivo\u003c/em\u003e metastasis model to further determine the role of LYN and USP8 in BLCA metastasis. Consistent with the \u003cem\u003ein vitro\u003c/em\u003e results, the tail vein assay data showed that the Saracatinib combined with DUBs-IN-2 significantly suppressed pulmonary metastasis in mice, as confirmed by HE staining and immunohistochemistry (IHC) staining of Ki67 and as evidenced by the reduced lung colonization compared to either each agent alone or the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e7\u003c/span\u003eB-C and Supplementary Fig.\u0026nbsp;7E). Together, our results suggested that LYN and USP8 inhibition may augment the antitumor efficacy of TJP1 overexpression-induced angiogenesis leading to tumor metastasis in patients with BLCA.\u003c/p\u003e\u003cp\u003eOn the basis of the above results, we also examined whether LYN, USP8 and TJP1 levels were clinically relevant to bladder cancer. The IHC results indicated that LYN expression was positively correlated with USP8 and TJP1 levels in BLCA patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e7\u003c/span\u003eD). The analysis of LYN with USP8 and TJP1 utilizing data from the TCGA database further reinforced the above results (Fig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e7\u003c/span\u003eE). In addition, we divided the BLCA samples from TCGA database into LYN\u003csup\u003ehigh\u003c/sup\u003e/USP8\u003csup\u003ehigh\u003c/sup\u003e/TJP1\u003csup\u003ehigh\u003c/sup\u003e and LYN\u003csup\u003elow\u003c/sup\u003e/USP8\u003csup\u003elow\u003c/sup\u003e/TJP1\u003csup\u003elow\u003c/sup\u003e group according to the median expression of each of the three genes, the distribution of two groups with clinicopathological parameter in BLCA patients was analyzed. We found that the malignant degree of T category and the N category were positively correlated with the expression of LYN\u0026ndash;USP8\u0026ndash;TJP1 of BLCA patients, while the distribution of M category and stage category was not distinctly different between the two groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e7\u003c/span\u003eF and Supplementary Fig.\u0026nbsp;7F). More importantly, the survival rate of LYN\u003csup\u003ehigh\u003c/sup\u003e/USP8\u003csup\u003ehigh\u003c/sup\u003e/TJP1\u003csup\u003ehigh\u003c/sup\u003e group was significantly lower than that of the group with low expression of all three (Fig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e7\u003c/span\u003eG). Taken together, these results support the targeting of the LYN-mediated USP8\u0026ndash;TJP1 complex for antitumor therapy in bladder cancer.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we uncovered a molecular mechanism involving the reciprocal regulation of TJP1 through phosphorylation and ubiquitination, impacting vasculogenesis and metastasis in bladder cancer. Our research revealed that USP8 plays a crucial role in stabilizing TJP1 expression and promoting BLCA angiogenesis in a TJP1-dependent manner. Mechanistically, USP8 binds to TJP1, preventing ubiquitin-mediated degradation at the TJP1 K695 site. Additionally, USP8 competes with TRIM21 for binding to TJP1, effectively reversing the TRIM21-induced ubiquitination of TJP1. In addition, LYN-mediated phosphorylation of TJP1 alters its function, making it easier to bind to USP8 while inhibiting interaction with TRIM21. This sequential process enhances TJP1 stability, increases its binding to TWIST1, promotes the nuclear localization of the TJP1/TWIST1 complex, and ultimately elevates CCL2 transcription levels. This cascade of events accelerates tumor angiogenesis and metastasis (Fig.\u0026nbsp;\u003cspan refid=\"Fig15\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eOur study revealed that USP8 and TRIM21 regulate TJP1 ubiquitination, specifically at the K695 residue within GUK domain of TJP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e3\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e4\u003c/span\u003e). These findings underscore the importance of the GUK domain in the posttranslational modification of TJP1 and its involvement in tumor angiogenesis[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Notably, in addition to TJP1, other members of the tight junction protein family, such as TJP2 and TJP3, also feature a GUK domain[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Although our previous experiments confirmed that USP8 is the specific deubiquitinase of TJP1, the interaction between USP8 and TJP2/TJP3 has not been thoroughly studied. Therefore, elucidating the role of USP8 in stabilizing TJP1 expression and further inhibiting the ubiquitination degradation of TJP1 may provide some insights into the posttranslational modification function of TJP2/TJP3 and its participation in the regulation of tumor signaling pathways. In addition, we demonstrated that USP8 inhibites the degradation of TJP1 at the K695 residue, further promoting angiogenesis in BLCA (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e3\u003c/span\u003eD\u0026ndash;K and Supplementary Fig.\u0026nbsp;3B). Notably, the mutation of the K695 residue of TJP1 significantly inhibits the transcriptional activation of the proangiogenic factor CCL2 by TJP1 (Supplementary Fig.\u0026nbsp;3C). We reported that TJP1 increases CCL2 secretion and promotes the recruitment of tumor-associated macrophages to the tumor microenvironment. Given that abnormal angiogenesis is necessary for tumor metastasis and invasion[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], mutating the K695 residue of TJP1 may represent a potential approach to inhibit the tumor microenvironment and distant metastasis of BLCA cells. However, whether mutation of the K695 residue of TJP1 directly regulates tumor cytokine secretion and immune cell recruitment is still worthy of further study.\u003c/p\u003e\u003cp\u003eOn the basis of our previous studies, we reported that TJP1 has a short half-life in BLCA cells and that its stability is regulated by the ubiquitin‒proteasome pathway. In addition, by studying the posttranslational modification of TJP1, we identified various phosphorylation sites, and multiple relevant protein kinases through LC‒MS/MS analysis (Supplementary Table\u0026nbsp;2). Over the years, there has been evidence of a variety of links between ubiquitination and phosphorylation, with the ubiquitination of target proteins being tightly regulated by extracellular stimuli, and in many cases, this regulation is dependent on protein phosphorylation[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Our results indicated that the absence of LYN, which completely abolishes TJP1 tyrosine phosphorylation, also inhibits the binding of TJP1 and USP8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eC and Supplementary Fig.\u0026nbsp;5B). Consistent with these findings, inhibition of LYN kinase decreases the combination of TJP1 and USP8, and further reduces TJP1 stability by using LYN kinase mutant plasmid (LYN-Y397F) (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eD, E-F and Supplementary Fig.\u0026nbsp;5C). Although both sites were reported to be LYN kinase inactivation sites, our results indicated that the Y397 mutation completely blocks LYN autophosphorylation,(Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eD, J). Notably, the phosphorylation of TJP1 by LYN significantly reduces the interaction of TJP1 with TRIM21, thereby inhibiting the ubiquitin-mediated degradation of TJP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eH-I and Supplementary Fig.\u0026nbsp;5F). Consequently, our data collectively indicated that tyrosine phosphorylation of TJP1 significantly increases TJP1 deubiquitination, providing a molecular mechanism through which TJP1 tyrosine phosphorylation increases the stability of TJP1, thereby inhibiting the ubiquitination-mediated degradation of TJP1 and further promoting angiogenesis in BLCA. It is possible that tyrosine phosphorylation of TJP1 facilitates the recognition and recruitment of the deubiquitination enzyme (USP8) to act on the ubiquitination site of TJP1, increasing its stability. This notion is supported by the stronger affinity of phosphorylated TJP1 for USP8 than for TRIM21. While our understanding of the regulation of TJP1 ubiquitination/deubiquitination is relatively advanced, much remains to be explored regarding how TJP1 phosphorylation affects its ubiquitination system.\u003c/p\u003e\u003cp\u003eTJP1 is known to undergo tyrosine phosphorylation[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], and the tyrosine phosphorylation of ZO proteins has been reported to be linked to tight junction formation. Phosphorylated TJP1 weakens junctional sealing and increases paracellular permeability[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Studies have shown that TJP1 can accumulate within the cell nucleus and that the nuclear localization of TJP1 is inversely proportional to the degree of cell contact and/or maturity[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Therefore, we suspect that phosphorylated TJP1 is more likely to enter the nucleus and participate in downstream cell signal transduction regulation. We demonstrated that TJP1 undergoes tyrosine phosphorylated by LYN kinase and that the phosphorylation of TJP1 increases the nuclear localization of TJP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e5\u003c/span\u003eK and Supplementary Fig.\u0026nbsp;5G). Although we predicted several potential LYN kinase phosphorylation sites for TJP1 (Supplementary Table\u0026nbsp;3), further investigation is needed to clarify the specific tyrosine residues at which TJP1 is phosphorylated by LYN. Notably, TJP1 contains two lysine-rich stretches of amino acids in the PDZ and GUK domains, which may serve as putative as nuclear localization sequences (NLSs), allowing TJP1 to enter the nucleus and regulate nuclear processes associated with changes in cell transcription status[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Additionally, the nuclear localization of TJP1 suggests its role in transcriptional regulation[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. As a consequence, the phosphorylation status of TJP1 and specific sites of TJP1 that are phosphorylated by LYN may affect the function of TJP1 NLS sequences. Alternatively, the phosphorylation of ZO proteins by different kinases may control their specific interactions with other molecules, such as Occludin and Connexin 43[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Moreover, this phosphorylation could regulate the organization and signal transduction capacity of the scaffold[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Therefore, phosphorylated TJP1 may function as a scaffold to recruit transcription factors or transcription coactivating complexes, a function that could be abrogated by LYN kinase inactivation. In line with these possibilities, we found that LYN-mediated TJP1 phosphorylation significantly increases TWIST1 binding and further facilitates TWIST1-mediated transcriptional activation of CCL2 (Supplementary Fig.\u0026nbsp;5J).\u003c/p\u003e\u003cp\u003eThe identification of USP8 and TRIM21 as specific ubiquitin-related enzymes of TJP1, along with LYN as the kinase that regulates TJP1 phosphorylation, not only elucidates the molecular mechanism of TJP1 protein stability but also sheds light on how phosphorylation mediated by TJP1 affects ubiquitination in the regulation of angiogenesis and metastasis in BLCA. These findings concerning the molecular mechanism of TJP1 increase our understanding of how TJP1 regulates tumor angiogenesis and metastasis and provide strong evidence for the potential of TJP1 as a therapeutic target for the treatment of BLCA.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eCell culture and regents\u003c/h2\u003e\u003cp\u003eT24 (ATCC HTB-4) and 5637 (ATCC HTB-9) human bladder cancer cells were kindly provided by Professor Kang from Sun Yat-sen University Cancer Center, which were cultured in 1640 supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin solution. 293 (ATCC CRL-11268) cells obtained from ATCC were cultured in high-glucose DMEM supplemented with 10% fetal bovine serum. EA.hy926 (ATCC CRL-2922) cells purchased from Conservation Genetics CAS Kunming Cell Bank were cultured in DMEM/F-12 medium (Gibco, 11320033) supplemented with 10% fetal bovine serum. All cell lines were maintained in 5% CO\u003csub\u003e2\u003c/sub\u003e at 37℃ and revalidated before using.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003ePatients\u003c/h2\u003e\u003cp\u003e The patients admitted to the Fifth Affiliated Hospital of Sun Yat-sen University was described as urothelial carcinoma according to international guidelines. The 57 samples were randomly collected with informed consent, the Ethics Committee of Sun Yat-sen University approved the ethical use of human subjects in this study.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eWestern blot assay\u003c/h2\u003e\u003cp\u003eCells were harvested and lysed in RIPA buffer (150 mM NaCl, 50 mM Tris-HCL, pH 7.4, 2 mM EDTA, 1% NP-40, 1% SDS) containing the protease inhibitor cocktail (Roche Diagnostics Deutschland Gmbh, 05892970001), for phosphorylation assay detection, phosphorylation inhibitor (Roche Diagnostics Deutschland Gmbh, 4906845001) was supplemented into RIPA buffer before extracted. The total protein concentration was detected using the Bradford Protein Assay kit (Thermo, 23236) and equivalent protein quantities were subjected to SDS-PAGE then transferred to PVDF membranes (Millipore, ISEQ00010). The membranes were blocked in 5% skim milk (BD Difco, 232100) for 1 hour at room temperature and then probed with the primary antibodies, followed by the corresponding HRP-conjugated anti-mouse/rabbit secondary antibodies. The immunoreactive bands were visualized with the Enhanced chemiluminescence (ECL) detection kit (NCM biotech, P10300). The antibodies were as follows: TJP1 (Abcam, ab216880), USP8 (Abcam, ab228572), LYN (Proteintech, 60211-1-Ig), p-Tyrosine (CST, 9411S), TRIM21 (Proteintech, 12108-1-AP), Anti-rabbit IgG HRP-linked antibody (CST, 7074S), Anti-Mouse IgG HRP-linked antibody (CST, 7076S). The internal control primary antibodies were as follows: β-actin (CST, 4970S) and HSP90 (Proteintech, 663181-Ig). The blot density analysis was performed using ImageJ, the quantitative results were normalized to load control.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eImmunofluorescence staining\u003c/h2\u003e\u003cp\u003eT24 and 5637 cells treatment with LYN inhibitor Saracatinib or transfected the indicated LYN mutant plasmids were grown on glass-bottom cell culture dish (NEST, 801010). After 24 hours, cells were fixed with 4% paraformaldehyde (Jetway Biotech, JTW003-500) and subjected to membrane permeabilization, BSA blocking (Sigma, B2064) and antibody incubation overnight. The antibodies were as follows: TJP1 (Abcam, ab216880), USP8 (Abcam, ab228572), LYN (Proteintech, 3C7F2), TWIST1 (Abcam, ab175430), 488-conjugated Goat Anti-Rabbit IgG (Abconal, AS053), 488-conjugated Goat Anti-Mouse IgG (Abconal, AS037), 594-conjugated Goat Anti-Rabbit IgG (Abconal, AS039), 594-conjugated Goat Anti-Mouse IgG (Abconal, AS054). Cell nucleus were stained with DAPI (Invitrogen, 62248) and mounted with antifade mounting medium from Vector Laboratories (H-1000), followed by photographed in confocal microscope (LSM880, ZEISS).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eImmunoprecipitation (IP) and Ubiquitination assay\u003c/h2\u003e\u003cp\u003eFor immunoprecipitation assay, cells were collected and lysed with RIPA buffer containing the protease inhibitor cocktail. Then the lysates were extracted and incubated with protein A/G magnetic beads (Millipore, LSKMAGAG02) as well as corresponding primary antibodies or with tagged magnetic beads antibodies at 4℃ overnight. The samples were separated by magnetic device and washed at least 8 times with lysis buffer, following by boiling with loading buffer and analyzed by western blotting. The antibodies were as follows: Anti-DDDDK-tag Magnetic Beads (MBL, M185-11R), Anti-HA-tag Magnetic Beads (MBL, M180-11), Anti-V5-tag Magnetic Beads (MBL, M215-11), Anti-MYC-tag Magnetic Beads (MBL, M047-11), anti-Flag (Proteintech, 66008-3-Ig), anti-V5 (CST, D3H8Q), anti-HA (CST, 3724S), anti-MYC (CST, 2272S).\u003c/p\u003e\u003cp\u003eFor ubiquitination assay, 293T cells was transfected with the relative plasmids in the indicated experiment, the total lysates were extracted with RIPA buffer containing the protease inhibitor cocktail and then boiled in 1% SDS for 10 minutes before incubating with the corresponding antibodies[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e], followed by IP procedures and incubating with indicated antibodies to detect TJP1 ubiquitination.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eLC-MS/MS analysis\u003c/h2\u003e\u003cp\u003eFor ubiquitination LC-MS/MS analysis assay, duplicate 10 cm dishes of 293T cells were co-transfected with 5 \u0026micro;g Flag-TJP1 and 10 \u0026micro;g HA-Ubiquitin plasmids for 48 hours, followed by treating with 20 \u0026micro;M MG132 (Selleck, S2619) for 8 hours before collecting. Then, cells were collected and lysed with RIPA buffer containing the protease inhibitor cocktail. Flag magnetic beads were incubated in cell lysates at 4℃ overnight, followed by washed with lysis buffer. The ubiquitination analysis and mutation sites analysis were performed by Applied Protein Technology (China). For 293T immunoprecipitation LC-MS/MS analysis assay, duplicate 10cm dishes of 293T cells were transfected with 5\u0026micro;g Flag-TJP1 for 48 hours, followed by IP procedures and incubating with Flag tagged antibodies. For T24 and 5637 immunoprecipitation LC-MS/MS analysis assay, duplicate 10cm dishes of cells were collected by IP procedures and incubating with IgG or TJP1 antibodies, The samples were performed by Applied Protein Technology (China) for detecting TJP1 binding proteins.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eTube formation assay\u003c/h2\u003e\u003cp\u003eTube formation ability was performed in three-dimensional culturing as previously reported. Briefly, 96-well plate (NEST Biotechnology, 701001) was coated with Matrigel (Corning, 354234) at a volume of 50 \u0026micro;L per well at 37℃ for 1 hour. Then the suspensions of EA.hy926 cells were suspended on Matrigel at a density of 1.5\u0026times;10\u003csup\u003e4\u003c/sup\u003e per well and incubated for at least 12 hours at 37℃. The tube formation structure was stained by Calcein-AM (BioLegend, 425201) for 30 minutes and then imaged by fluorescence microscope and assessed by angiogenesis analysis module in ImageJ. The meshes and segment lengths were quantified by ImageJ.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eMatrigel plug assay\u003c/h2\u003e\u003cp\u003e60 male mice (6\u0026ndash;8 weeks) were randomly divided into 10 groups, 5 mice in each experimental group. The mice were given subcutaneously injection of 200 \u0026micro;L of a 3:1 mixture of Matrigel (Corning, 356231) with 2\u0026times;10\u003csup\u003e6\u003c/sup\u003e T24 or 5637 cells in medium. After 10\u0026ndash;15 days, the Matrigel plugs were harvested, imaged, fixed in formalin and then embedded in paraffin for immunoprecipitation assay. All animal care and experiments were approved by the Animal Ethics Committee of Sun Yat-sen University and performed in conformity with the Animal Care and Use guidelines of Sun Yat-sen University.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eImmunohistochemistry (IHC) assay and H\u0026amp;E staining\u003c/h2\u003e\u003cp\u003eThe pathological slides were dewaxing and hydration in xylene and alcohol solution from high to low concentration, following by EDTA antigenic repair buffer (pH\u0026thinsp;=\u0026thinsp;9.0) for high temperature of antigen restore and peroxidase blocking in H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. After this, the sections were blocked with goat serum and then incubated with the primary antibodies at 4℃ overnight. The secondary antibody detection kit (ABsin, abs957) was performed for the immunohistochemical staining and counterstained with hematoxylin then sealed with neutral gum. The antibodies were as follows: TJP1 (Abcam, ab216880), USP8 (Abcam, ab228572), LYN (Proteintech, 60211-1-Ig), CD31 (Arigobio, ARF52748), Ki67 (CST, 9449S). The protein expression each sample scores were evaluated by pathologist according to the degree and area of staining. The degree staining of sections were scored from 0\u0026ndash;3 (0, negative; 1, weak staining; 2, moderate staining; 3, strong staining). The degree staining areas of sections were scored from 1\u0026ndash;4 (1,\u0026le;25%; 2, 26%-50%; 3, 51%-75%; 4, 76%-100%). The score of each sample was calculated by multiplying the score of staining degree and the score of staining intensity.\u003c/p\u003e\u003cp\u003eFor H\u0026amp;E staining, the pathological slides were dewaxing and hydration in xylene and alcohol solution from high to low concentration, followed by hematoxylin staining and eosin staining, then slides were sealed with neutral gum and observed under microscope.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eplasmid construction and transfection\u003c/h2\u003e\u003cp\u003eK48 and K63 plasmids were kindly providing by Prof. Kang (Sun Yat-sen University Cancer Center). The full-length coding sequence of TJP1 (NCBI Gene ID: 7082), USP8 (NCBI Gene ID: 9101), LYN (NCBI Gene ID: 4067) and TRIM21 (NCBI Gene ID: 6737) were obtained from 293T cDNA and amplified by reverse transcription PCR, then cloned into pcDNA3.1(+) vector with different tags. The TJP1 deletion segments were generated based on the full-length TJP1 sequence by deleting the ZU5, ABR, GUK, and SH3 domains with Flag tag, respectively. All constructs were verified by DNA sequencing and western blot. T24, 5637 as well as 293T cells were transiently transfected by Lipofectamine\u0026trade; 3000 (Invitrogen, L3000015) based on the manufacturer\u0026rsquo;s instructions. The USP8, LYN, TRIM21 and TJP1 targeting siRNAs and negative control siRNA (siN05815122147) were purchased from RiboBio (Guangzhou, China). The target sequences were as follows:\u003c/p\u003e\u003cp\u003eUSP8-siRNA1: GCATAAAGGTGAAGTGGCA;\u003c/p\u003e\u003cp\u003eUSP8-siRNA2: GGAAACAGGAAGAGAGGAT;\u003c/p\u003e\u003cp\u003eLYN-siRNA: CTTGAGTGACGATGGAGTA;\u003c/p\u003e\u003cp\u003eTRIM21-siRNA: CGCAGAGTTTGTGCAGCAA;\u003c/p\u003e\u003cp\u003eTJP1-siRNA: GTAGGAGATTCTTTCTATA;\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eSite directed mutagenesis\u003c/h2\u003e\u003cp\u003eSite directed mutagenesis was determined on TJP1 protein to replace ubiquitination residues. The four highly conserved lysine (K) amino acid residues (K502, K529, K695, K1709) were identified as the only ubiquitination sites on TJP1 in ubiquitination LC-MS/MS analysis assay. The specific primers were designed where the codon for the sites were replaced with arginine (R) to create 7 mutant TJP1 proteins, four of them carry a single mutant (K502R, K529R, K695R, K1709R), the rest were double mutant plasmids (K502/695R, K529/695R, K1709R/695R). In addition, LYN site directed mutagenesis was determined on LYN protein to replace phosphorylation residues. The highly conserved Tyrosine (Y) amino acid residue (Y397) was identified as phosphorylation sites on LYN. The specific primers were designed where the codon for the sites were replaced with Phenylalanine (F) or Alanine (A). All mutant plasmids were verified by DNA sequencing and western blot. The target sequences were as follows:\u003c/p\u003e\u003cp\u003eTJP1-K502R-F: TGACCATATTGGCTCAGAGGAAGAAGGATGTTTATC;\u003c/p\u003e\u003cp\u003eTJP1-K502R-R: GATAAACATCCTTCTTCCTCTGAGCCAATATGGTCA;\u003c/p\u003e\u003cp\u003eTJP1-K529R-F: CCCATTTTGAATATGAAAGGGAATCTCCCTATGGAC;\u003c/p\u003e\u003cp\u003eTJP1-K529R-R: GTCCATAGGGAGATTCCCTTTCATATTCAAAATGGG;\u003c/p\u003e\u003cp\u003eTJP1-K695R-F: CGCCTGCATACAATAAGGCAAATCATAGATCAAG;\u003c/p\u003e\u003cp\u003eTJP1-K695R-R: CTTGATCTATGATTTGCCTTATTGTATGCAGGCG;\u003c/p\u003e\u003cp\u003eTJP1-K1709R-F: ATGGCCTCAAGTTCCTGAGGCCTGTGGAGCTGC;\u003c/p\u003e\u003cp\u003eTJP1-K1709R-R: GCAGCTCCACAGGCCTCAGGAACTTGAGGCCAT;\u003c/p\u003e\u003cp\u003eLYN-Y397F-F: TTGAAGATAATGAGTTCACAGCAAGGGAAGGTG;\u003c/p\u003e\u003cp\u003eLYN-Y397F-R: CACCTTCCCTTGCTGTGAACTCATTATCTTCAA;\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eCycloheximide (CHX) chase assay\u003c/h2\u003e\u003cp\u003eThe stability of TJP1 was determined by cycloheximide chase assay. In all, T24 and 5637 cells were transfected with USP8 plasmid, USP8 siRNA or TJP1 695R mutant plasmid, respectively, cells were then treated with CHX (Cycloheximide, Selleck, S7418) (40\u0026micro;g/mL) for the 0, 4, 8 and 12 hours and then collected and lysed by western blot assay to detect TJP1 expression.\u003c/p\u003e\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\u003ch2\u003eDual luciferase reporter assay\u003c/h2\u003e\u003cp\u003eDual luciferase reporter activity was performed and detected using the dual luciferase reporter assay kit (Promega, E1960). Specifically, the CCL2 promoter is used to drive firefly luciferase activity in pGL3 luciferase vector. pRL-TK plasmid was co- transfected to activate Renilla luciferase. Besides, the corresponding plasmids were transfected into 293T cells, respectively. After 48 hours, cells were collected and lysed, dual luciferase reporter assay kit was used to detect firefly and Renilla luciferase activities and recorded using a microplate reader. Firefly luciferase activity was normalized to Renilla luciferase activity. CCL2 promoter sequence were listed as follows:\u003c/p\u003e\u003cp\u003epGL3-CCL2-F: ATTTCTCTATCGATAGGTACCAGGCATGAGCAGAGGACTGAGA;\u003c/p\u003e\u003cp\u003epGL3-CCL2-R: ACTTAGATCGCAGATCTCGAGGCTGGAGGCGAGAGTGCGAGCT;\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003eTranswell assay\u003c/h2\u003e\u003cp\u003eT24 and 5637 cells were treated with DUBs-IN-2, Saracatinib or double inhibitors in combination for 24 hours, then cells were trypsinized, resuspended in serum-free medium and added to the upper chambers of pore inserts of a transwell. RPMI with 10% FBS were added to the lower chamber and incubated for 24 hours. Migrating cells were counted and quantified by Image J after staining with crystal violet (BBI, 548-62-9, 0.5%) for 20 minutes.\u003c/p\u003e\u003cdiv id=\"Sec25\" class=\"Section3\"\u003e\u003ch2\u003eClone formation assay\u003c/h2\u003e\u003cp\u003eT24 and 5637 cells treatment with USP8/LYN inhibitors or transfected plasmids were seeded into 6-wells at a density of 1\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells per well. Cells were incubated at 37\u0026deg;C for 10 days, and then colony formation was visualized by staining with crystal violet (BBI, 548-62-9, 0.5%) for 20 minutes, followed by photographed.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec26\" class=\"Section3\"\u003e\u003ch2\u003eNuclear and cytoplasmic extraction assay\u003c/h2\u003e\u003cp\u003eNuclear and Cytoplasmic Protein Extraction Kit (78833, Thermo) was used to separate cytoplasm and nuclear protein according to the instruction. In brief, cells were washed with cold PBS for twice and centrifuged 3 minutes at 500g. The cell pellet was then suspended in 200ul of CERⅠ in vortex suspension, followed by incubation on ice for 10 minutes, then 11ul of the CERII was added, swirling for 5 seconds and incubated on ice for 1 minute, centrifuged at 16,000 g for 5 minutes, subsequently. The supernatant portion was transferred into the pre-cooled tube as cytoplasmic extract. The insoluble pellet fractions containing coarse nuclei were swirled in 100ul of NER for 15 seconds, incubating in ice for 40 minutes, and then centrifuged at 16,000 g for 10 minutes. The obtained supernatant formed the nuclear extract, which was used in subsequent western blot experiments.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec27\" class=\"Section3\"\u003e\u003ch2\u003eXenograft animal model\u003c/h2\u003e\u003cp\u003e2\u0026times;10\u003csup\u003e6\u003c/sup\u003e T24 cells were injected into tail vein of each SCID mouse, the 20 mice were then divided into 4 groups on average, followed by treatment with Saline, DUBs-IN-2, Saracatinib or double inhibitors in combination every 3 days. The lungs were excised 60 days post-injection and fixed in formalin for 24 hours and then embedded in paraffin, from which sections were stained with HE by pathologists. All animal experiments were carried out in accordance with the protocol approved by the Institutional Animal Care and Use Committee at the Ethics Committee of Sun Yat-sen University.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eData were analyzed using the GraphPad Prism 8 software. Statistical significance was determined by \u003cem\u003ep\u003c/em\u003e-value of \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05. *,0.01\u0026thinsp;\u0026lt;\u0026thinsp;\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; **, 0.001\u0026thinsp;\u0026lt;\u0026thinsp;\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01; ***, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001. The two-sides Pearson\u0026rsquo;s relation analysis was performed to determine the correlation between TJP1, USP8 as well as LYN expression. All quantitative data were performed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (S.E.M.) or standard deviation (S.D.) from at least three independent experiments. The Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test was used to compare the difference between two groups and one-way ANOVA for multiple groups. The Kaplan\u0026ndash;Meier analysis was performed to state the survival probabilities in BLCA patients.\u003c/p\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eDeclaration of interests\u003c/h2\u003e\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding:\u003c/h2\u003e\u003cp\u003eThis study was supported by the National Natural Science Foundation of China (Grant Nos. 32170789, 32100564, 32100563); supported by Guangdong Natural Science Foundation of China (Grant Nos. 2022A1515012252, 2023A1515010550, 2022A1515012286); supported by Shenzhen Key Laboratory for Systems Medicine in Inflammatory Diseases (ZDSYS20220606100803007).\u003c/p\u003e\u003ch2\u003eAuthors\u0026rsquo; contributions\u003c/h2\u003e\u003cp\u003eXL and ZD performed most of the cell experiments and manuscript writing. SC and XS collected the clinical samples, completed the IHC assay and prepared the case report. ZL and FJ performed the animal experiments. SC performed database analysis. LQ reviewed and suggested of the manuscript. XZ and ML conceived and designed the study. All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe thank Prof. Kang (Sun Yat-sen University Cancer Center) for kindly providing T24 and 5637 bladder cancer cells and the faculty (Fifth Affiliated Hospital of Sun Yat-sen University) for collecting the clinical samples. We thank the Core Facilities for Medical Science, School of Medicine, Shenzhen Campus of Sun Yat-sen University for providing the equipment to obtain experimental data.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eD.J. Smith, S. Lunj, A.D. Adamson, S. Nagarajan, T.A.D. Smith, K.J. Reeves, P.J. Hoskin, A. Choudhury, CRISPR-Cas9 potential for identifying novel therapeutic targets in muscle-invasive bladder cancer, Nat Rev Urol, 22 (2025) 55\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eE. Comp\u0026eacute;rat, M.B. Amin, R. Cathomas, A. Choudhury, M. De Santis, A. Kamat, A. Stenzl, H.C. Thoeny, J.A. Witjes, Current best practice for bladder cancer: a narrative review of diagnostics and treatments, Lancet, 400 (2022) 1712\u0026ndash;1721.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eW. Risau, Embryonic angiogenesis factors, Pharmacology \u0026amp; therapeutics, 51 (1991) 371\u0026ndash;376.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eX. Liu, J. Zhang, T. Yi, H. Li, X. Tang, D. Liu, D. Wu, Y. Li, Decoding tumor angiogenesis: pathways, mechanisms, and future directions in anti-cancer strategies, Biomark Res, 13 (2025) 62.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eK.R. Karpiuk, G. Młynarczyk, J. Matowicka-Karna, B. Darewicz, Emerging Biomarkers in Urological Cancers: Angiogenesis and Damage-Associated Molecular Pattern Signaling, Int J Mol Sci, 26 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eX.Q. Liu, X.R. Shao, Y. Liu, Z.X. Dong, S.H. Chan, Y.Y. Shi, S.N. Chen, L. Qi, L. Zhong, Y. Yu, T. Lv, P.F. Yang, L.Y. Li, X.B. Wang, X.D. Zhang, X. Li, W. Zhao, L. Sehgal, M. Li, X.D. Zhang, Tight junction protein 1 promotes vasculature remodeling via regulating USP2/TWIST1 in bladder cancer, Oncogene, 41 (2022) 502\u0026ndash;514.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJ. Lesage, M. Suarez-Carmona, D. Neyrinck-Leglantier, S. Grelet, S. Blacher, W. Hunziker, P. Birembaut, A. No\u0026euml;l, B. Nawrocki-Raby, C. Gilles, M. Polette, Zonula occludens-1/NF-κB/CXCL8: a new regulatory axis for tumor angiogenesis, Faseb j, 31 (2017) 1678\u0026ndash;1688.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eS. Nakamuta, H. Endo, Y. Higashi, A. Kousaka, H. Yamada, M. Yano, H. Kido, Human immunodeficiency virus type 1 gp120-mediated disruption of tight junction proteins by induction of proteasome-mediated degradation of zonula occludens-1 and \u0026ndash;\u0026thinsp;2 in human brain microvascular endothelial cells, J Neurovirol, 14 (2008) 186\u0026ndash;195.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM.E. Sowa, E.J. Bennett, S.P. Gygi, J.W. Harper, Defining the human deubiquitinating enzyme interaction landscape, Cell, 138 (2009) 389\u0026ndash;403.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eP.E. Cockram, M. Kist, S. Prakash, S.H. Chen, I.E. Wertz, D. Vucic, Ubiquitination in the regulation of inflammatory cell death and cancer, Cell Death Differ, 28 (2021) 591\u0026ndash;605.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eW. Xiong, X. Gao, T. Zhang, B. Jiang, M.M. Hu, X. Bu, Y. Gao, L.Z. Zhang, B.L. Xiao, C. He, Y. Sun, H. Li, J. Shi, X. Xiao, B. Xiang, C. Xie, G. Chen, H. Zhang, W. Wei, G.J. Freeman, H.B. Shu, H. Wang, J. Zhang, USP8 inhibition reshapes an inflamed tumor microenvironment that potentiates the immunotherapy, Nature communications, 13 (2022) 1700.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eF. Xie, X. Zhou, H. Li, P. Su, S. Liu, R. Li, J. Zou, X. Wei, C. Pan, Z. Zhang, M. Zheng, Z. Liu, X. Meng, H. Ovaa, P. Ten Dijke, F. Zhou, L. Zhang, USP8 promotes cancer progression and extracellular vesicle-mediated CD8\u0026thinsp;+\u0026thinsp;T cell exhaustion by deubiquitinating the TGF-β receptor TβRII, Embo j, 41 (2022) e108791.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eH. Yang, X. Zhang, M. Lao, K. Sun, L. He, J. Xu, Y. Duan, Y. Chen, H. Ying, M. Li, C. Guo, Q. Lu, S. Wang, W. Su, T. Liang, X. Bai, Targeting ubiquitin-specific protease 8 sensitizes anti-programmed death-ligand 1 immunotherapy of pancreatic cancer, Cell Death Differ, 30 (2023) 560\u0026ndash;575.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZ.B. Ke, J.Y. Chen, Y.T. Xue, B. Lin, Q. Huang, X.Y. Huang, D.N. Chen, S.H. Chen, X.J. Ye, Q.S. Zheng, Y. Wei, X.Y. Xue, N. Xu, Mechanical signal modulates prostate cancer immune escape by USP8-mediated ubiquitination-dependent degradation of PD-L1 and MHC-1, Cell Death Dis, 16 (2025) 413.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eA.V. Leopold, K.G. Chernov, V.V. Verkhusha, Optogenetically controlled protein kinases for regulation of cellular signaling, Chem Soc Rev, 47 (2018) 2454\u0026ndash;2484.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM. Gao, M. Karin, Regulating the regulators: control of protein ubiquitination and ubiquitin-like modifications by extracellular stimuli, Mol Cell, 19 (2005) 581\u0026ndash;593.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eL. Fattet, H.Y. Jung, M.W. Matsumoto, B.E. Aubol, A. Kumar, J.A. Adams, A.C. Chen, R.L. Sah, A.J. Engler, E.B. Pasquale, J. Yang, Matrix Rigidity Controls Epithelial-Mesenchymal Plasticity and Tumor Metastasis via a Mechanoresponsive EPHA2/LYN Complex, Dev Cell, 54 (2020) 302\u0026ndash;316.e307.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJ. Tang, Y. Xiao, G. Lin, H. Guo, H.X. Deng, S. Tu, W.Y. Langdon, H. Yang, L. Tao, Y. Li, R.M. Pope, N. Gupta, J. Zhang, Tyrosine phosphorylation of NLRP3 by the Src family kinase Lyn suppresses the activity of the NLRP3 inflammasome, Sci Signal, 14 (2021) eabe3410.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eT. Ban, G.R. Sato, A. Nishiyama, A. Akiyama, M. Takasuna, M. Umehara, S. Suzuki, M. Ichino, S. Matsunaga, A. Kimura, Y. Kimura, H. Yanai, S. Miyashita, J. Kuromitsu, K. Tsukahara, K. Yoshimatsu, I. Endo, T. Yamamoto, H. Hirano, A. Ryo, T. Taniguchi, T. Tamura, Lyn Kinase Suppresses the Transcriptional Activity of IRF5 in the TLR-MyD88 Pathway to Restrain the Development of Autoimmunity, Immunity, 45 (2016) 319\u0026ndash;332.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eO. Beutel, R. Maraspini, K. Pombo-Garc\u0026iacute;a, C. Martin-Lemaitre, A. Honigmann, Phase Separation of Zonula Occludens Proteins Drives Formation of Tight Junctions, Cell, 179 (2019) 923\u0026ndash;936.e911.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eK. Kakihara, K. Asamizu, K. Moritsugu, M. Kubo, T. Kitaguchi, A. Endo, A. Kidera, M. Ikeguchi, A. Kato, M. Komada, T. Fukushima, Molecular basis of ubiquitin-specific protease 8 autoinhibition by the WW-like domain, Commun Biol, 4 (2021) 1272.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM.T. Islam, F. Chen, H. Chen, The oncogenic role of ubiquitin specific peptidase (USP8) and its signaling pathways targeting for cancer therapeutics, Arch Biochem Biophys, 701 (2021) 108811.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM. Colombo, S. Vallese, I. Peretto, X. Jacq, J.C. Rain, F. Colland, P. Guedat, Synthesis and biological evaluation of 9-oxo-9H-indeno[1,2-b]pyrazine-2,3-dicarbonitrile analogues as potential inhibitors of deubiquitinating enzymes, ChemMedChem, 5 (2010) 552\u0026ndash;558.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eA. Dufner, K.P. Knobeloch, Ubiquitin-specific protease 8 (USP8/UBPy): a prototypic multidomain deubiquitinating enzyme with pleiotropic functions, Biochem Soc Trans, 47 (2019) 1867\u0026ndash;1879.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eF. Li, Q. Sun, K. Liu, L. Zhang, N. Lin, K. You, M. Liu, N. Kon, F. Tian, Z. Mao, T. Li, T. Tong, J. Qin, W. Gu, D. Li, W. Zhao, OTUD5 cooperates with TRIM25 in transcriptional regulation and tumor progression via deubiquitination activity, Nature communications, 11 (2020) 4184.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJ. Sun, Q. Hu, H. Peng, C. Peng, L. Zhou, J. Lu, C. Huang, The ubiquitin-specific protease USP8 deubiquitinates and stabilizes Cx43, J Biol Chem, 293 (2018) 8275\u0026ndash;8284.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eX. Chen, J.D. Qiu, S.P. Shi, S.B. Suo, S.Y. Huang, R.P. Liang, Incorporating key position and amino acid residue features to identify general and species-specific Ubiquitin conjugation sites, Bioinformatics, 29 (2013) 1614\u0026ndash;1622.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eD. Popovic, D. Vucic, I. Dikic, Ubiquitination in disease pathogenesis and treatment, Nat Med, 20 (2014) 1242\u0026ndash;1253.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eV.C. Chen, A.R. Kristensen, L.J. Foster, C.C. Naus, Association of connexin43 with E3 ubiquitin ligase TRIM21 reveals a mechanism for gap junction phosphodegron control, J Proteome Res, 11 (2012) 6134\u0026ndash;6146.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eH. Peng, F. Yang, Q. Hu, J. Sun, C. Peng, Y. Zhao, C. Huang, The ubiquitin-specific protease USP8 directly deubiquitinates SQSTM1/p62 to suppress its autophagic activity, Autophagy, 16 (2020) 698\u0026ndash;708.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJ.A. Pan, Y. Sun, Y.P. Jiang, A.J. Bott, N. Jaber, Z. Dou, B. Yang, J.S. Chen, J.M. Catanzaro, C. Du, W.X. Ding, M.T. Diaz-Meco, J. Moscat, K. Ozato, R.Z. Lin, W.X. Zong, TRIM21 Ubiquitylates SQSTM1/p62 and Suppresses Protein Sequestration to Regulate Redox Homeostasis, Mol Cell, 61 (2016) 720\u0026ndash;733.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eD.L. Swaney, P. Beltrao, L. Starita, A. Guo, J. Rush, S. Fields, N.J. Krogan, J. Vill\u0026eacute;n, Global analysis of phosphorylation and ubiquitylation cross-talk in protein degradation, Nat Methods, 10 (2013) 676\u0026ndash;682.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eT.P. Green, M. Fennell, R. Whittaker, J. Curwen, V. Jacobs, J. Allen, A. Logie, J. Hargreaves, D.M. Hickinson, R.W. Wilkinson, P. Elvin, B. Boyer, N. Carragher, P.A. Pl\u0026eacute;, A. Bermingham, G.A. Holdgate, W.H. Ward, L.F. Hennequin, B.R. Davies, G.F. Costello, Preclinical anticancer activity of the potent, oral Src inhibitor AZD0530, Mol Oncol, 3 (2009) 248\u0026ndash;261.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eG. Tornillo, C. Knowlson, H. Kendrick, J. Cooke, H. Mirza, I. Aurrekoetxea-Rodr\u0026iacute;guez, M.D.M. Vivanco, N.E. Buckley, A. Grigoriadis, M.J. Smalley, Dual Mechanisms of LYN Kinase Dysregulation Drive Aggressive Behavior in Breast Cancer Cells, Cell Rep, 25 (2018) 3674\u0026ndash;3692.e3610.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM.Y. Li, T.S. Naik, L.Y.L. Siu, O. Acuto, E. Spooner, P. Wang, X. Yang, Y. Lin, R. Bruzzone, J. Ashour, M.J. Evans, S. Sanyal, Lyn kinase regulates egress of flaviviruses in autophagosome-derived organelles, Nature communications, 11 (2020) 5189.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eT. Tsukamoto, S.K. Nigam, Role of tyrosine phosphorylation in the reassembly of occludin and other tight junction proteins, Am J Physiol, 276 (1999) F737-750.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eB.R. Tash, M.C. Bewley, M. Russo, J.M. Keil, K.A. Griffin, J.M. Sundstrom, D.A. Antonetti, F. Tian, J.M. Flanagan, The occludin and ZO-1 complex, defined by small angle X-ray scattering and NMR, has implications for modulating tight junction permeability, Proc Natl Acad Sci U S A, 109 (2012) 10855\u0026ndash;10860.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eA.S. Fanning, J.M. Anderson, Zonula occludens-1 and \u0026ndash;\u0026thinsp;2 are cytosolic scaffolds that regulate the assembly of cellular junctions, Ann N Y Acad Sci, 1165 (2009) 113\u0026ndash;120.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eP. Lorenc, A. Sikorska, S. Molenda, N. Guzniczak, H. Dams-Kozlowska, A. Florczak, Physiological and tumor-associated angiogenesis: Key factors and therapy targeting VEGF/VEGFR pathway, Biomed Pharmacother, 180 (2024) 117585.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eY. Xiao, M. Hassani, M.B. Moghaddam, A. Fazilat, M. Ojarudi, M. Valilo, Contribution of tumor microenvironment (TME) to tumor apoptosis, angiogenesis, metastasis, and drug resistance, Med Oncol, 42 (2025) 108.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eT. Hunter, The age of crosstalk: phosphorylation, ubiquitination, and beyond, Mol Cell, 28 (2007) 730\u0026ndash;738.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eC.M. Van Itallie, M.S. Balda, J.M. Anderson, Epidermal growth factor induces tyrosine phosphorylation and reorganization of the tight junction protein ZO-1 in A431 cells, J Cell Sci, 108 (Pt 4) (1995) 1735\u0026ndash;1742.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eH. Kurihara, J.M. Anderson, M.G. Farquhar, Increased Tyr phosphorylation of ZO-1 during modification of tight junctions between glomerular foot processes, Am J Physiol, 268 (1995) F514-524.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJ.M. Staddon, K. Herrenknecht, C. Smales, L.L. Rubin, Evidence that tyrosine phosphorylation may increase tight junction permeability, J Cell Sci, 108 (Pt 2) (1995) 609\u0026ndash;619.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eH. Takeda, S. Tsukita, Effects of tyrosine phosphorylation on tight junctions in temperature-sensitive v-src-transfected MDCK cells, Cell Struct Funct, 20 (1995) 387\u0026ndash;393.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eC.J. Gottardi, M. Arpin, A.S. Fanning, D. Louvard, The junction-associated protein, zonula occludens-1, localizes to the nucleus before the maturation and during the remodeling of cell-cell contacts, Proc Natl Acad Sci U S A, 93 (1996) 10779\u0026ndash;10784.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM.S. Balda, K. Matter, Epithelial cell adhesion and the regulation of gene expression, Trends Cell Biol, 13 (2003) 310\u0026ndash;318.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM.S. Balda, K. Matter, The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression, Embo j, 19 (2000) 2024\u0026ndash;2033.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eA.F. Th\u0026eacute;venin, R.A. Margraf, C.G. Fisher, R.M. Kells-Andrews, M.M. Falk, Phosphorylation regulates connexin43/ZO-1 binding and release, an important step in gap junction turnover, Mol Biol Cell, 28 (2017) 3595\u0026ndash;3608.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eR.K. Rao, S. Basuroy, V.U. Rao, K.J. Karnaky, Jr., A. Gupta, Tyrosine phosphorylation and dissociation of occludin-ZO-1 and E-cadherin-beta-catenin complexes from the cytoskeleton by oxidative stress, Biochem J, 368 (2002) 471\u0026ndash;481.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eL. Gonz\u0026aacute;lez-Mariscal, A. Betanzos, A. Avila-Flores, MAGUK proteins: structure and role in the tight junction, Semin Cell Dev Biol, 11 (2000) 315\u0026ndash;324.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eP. Hou, P. Jia, K. Yang, Z. Li, T. Tian, Y. Lin, W. Zeng, F. Xing, Y. Chen, C. Li, Y. Liu, D. Guo, An unconventional role of an ASB family protein in NF-κB activation and inflammatory response during microbial infection and colitis, Proc Natl Acad Sci U S A, 118 (2021).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Bladder cancer, TJP1, Ubiquitination, Phosphorylation, Tumor angiogenesis","lastPublishedDoi":"10.21203/rs.3.rs-7928736/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7928736/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAs a highly vascularized tumor, the recurrence and metastasis of bladder cancer (BLCA) are closely related to tumor angiogenesis. We previously identified that TJP1 as an important target in the regulation of BLCA vasculogenesis regulation. However, the molecular mechanisms and related signaling pathways still require characterization. In this study, we reported that the overexpression of deubiquitinase-USP8 obviously increased the expression and stability of TJP1, thereby promoting BLCA neovascularization. Mechanistically, USP8 competitively bound to TJP1, preventing the ubiquitin-mediated degradation of TJP1 by the E3 ligase TRIM21 through the TJP1 K695 site. Furthermore, LYN kinase-mediated phosphorylation of TJP1 played a key role in the ubiquitination regulation by USP8 and TRIM21, improving TJP1 stability. In addition, phosphorylated TJP1 significantly increased binding to TWIST1, thereby increasing the nuclear localization of TJP1/TWIST1 complex and thus promoting transcriptional activation of CCL2, ultimately leading to BLCA vascular remodeling. Moreover, the LYN inhibitor combined with the USP8 inhibitor obviously decreased the lung metastasis of BLCA cells in murine tumor models. In conclusion, our findings shed new light on the function of TJP1 function in BLCA and provide favorable evidence that TJP1 and its upstream molecules might be new targets for BLCA treatment.\u003c/p\u003e","manuscriptTitle":"LYN-mediated phosphorylation promotes TJP1 deubiquitination via USP8 to drive neovascularization and tumorigenesis in bladder cancer","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-14 06:53:44","doi":"10.21203/rs.3.rs-7928736/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"73850601-8617-465b-a337-a1655f99306c","owner":[],"postedDate":"November 14th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":57443438,"name":"Biological sciences/Cancer/Tumour angiogenesis"},{"id":57443439,"name":"Biological sciences/Cell biology/Post-translational modifications/Ubiquitylation"},{"id":57443440,"name":"Biological sciences/Cell biology/Post-translational modifications/Phosphorylation"}],"tags":[],"updatedAt":"2025-12-16T10:16:44+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-14 06:53:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7928736","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7928736","identity":"rs-7928736","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.