Molecular and clinical characterization of two independent Chinese families with protein C deficiency | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular and clinical characterization of two independent Chinese families with protein C deficiency Mengzhen Wen, Yifan Lu, Haixiao Xie, Langyi Qin, Longying Ye, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4372666/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Dec, 2024 Read the published version in Annals of Hematology → Version 1 posted 10 You are reading this latest preprint version Abstract This study aims to preliminarily investigate the clinical characterization and molecular pathogenic basis of hereditary protein C (PC) deficiency in two independent Chinese families. The PC activity (PC:A) was tested using the chromogenic substrate, and PC antigen (PC:Ag) was detected via enzyme-linked immunosorbent assay (ELISA). To identify the mutation sites, nine exons of the PROC gene were amplified by PCR, and the products were directly sequenced. The conservation and pathogenicity of the mutations, as well as changes in the spatial structure of PC proteins before and after mutations, were analyzed using ClustalX-2.1-win, online bioinformatics software, and PyMOL., The function of the mutant proteins was detected using the calibrated automated thrombogram (CAT). Proband A and B, aged 39 and 63 respectively, are both diagnosed with deep vein thrombosis (DVT) in both lower limbs and pulmonary embolism (PE). Two missense mutations, p.Arg440Cys and p.Trp444Arg, were identified in the probands. Bioinformatics and protein modeling analyses revealed that the two mutations probably affected the normal function of PC. The thrombin generation assay revealed impaired thrombin generation capacity in both probands, with proband B showing more severe impairment. These two mutations may be the causes of reduced PC in two independent Chinese families. Notably, this is the first reported instance of the p.Trp444Arg mutation. Protein C deficiency Novel mutation Bioinformatics Thrombin Generation Assay Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Plasma protein C (PC), a vitamin K-dependent single-chain glycoprotein, is mainly synthesized by the hepatocytes and released into circulating plasma in the form of inactive zymogen [ 1 ]. PC can be activated by the thrombin-thrombomodulin complex, which cleaves the activation peptide containing 12 amino acid residues between Arg12 and Leu13 of the heavy chain. Activated PC (APC) primarily exerts its anticoagulant function by degrading coagulation factor Va and coagulation factor VIIIa in the presence of Ca 2+ , phospholipids, and protein S [ 2 ]. The PC protein is encoded by the PROC gene, which is located on chromosome 2q13-q14. The purification and characterization of PC were first carried out by Stenflo in 1976 [ 3 – 4 ]. Hereditary PC deficiency(PCD) is predominantly an autosomal dominant genetic disease caused by a mutation in the PROC gene, which consists of 9 exons and covers more than 11 kb of genomic DNA [ 5 ]. The specific type and location of the mutation within the PROC gene can influence the severity of PC deficiency and the associated clinical manifestations observed in affected individuals. Most cases of PCD are caused by heterozygous mutations at a single locus of the PROC gene. However, severe PC deficiency resulting from homozygous or compound heterozygous mutations is rare [ 6 ]. The prevalence of heterozygous PCD has been estimated to be approximately 0.5% of the population. It is associated with adult-onset venous thromboembolism (VTE) when other genetic or acquired risk factors for VTE are present [ 7 ]. Based on the phenotypes of PCD, it can be divided into type-I and type-II. Type I PCD, the most common form, is characterized by a simultaneous decrease in both PC:Ag and PC:A. Type II PCD is characterized by normal PC antigen concentration but reduced PC:A [ 8 ]. By investigating families with inherited PCD, genetic counseling can be provided to prevent and diagnose thrombosis and embolism within these families accurately. This study reports two missense mutations in p.Arg440Cys and p.Trp444Arg in two independent Chinese families with PCD and preliminarily investigates their possible molecular pathogenic mechanisms. Materials and Methods Patients Family A Proband A was a 39-year-old Chinese female who was admitted to the hospital due to “Swelling and pain in the left lower limb for a month and labored breathing for ten days”. Meanwhile, She had been bedridden for more than a month. Bilateral lower extremity Doppler ultrasound revealed thrombosis of the left common femoral vein, superficial femoral vein, popliteal vein, and external iliac vein. The computed tomography angiography (CTA) of the pulmonary artery showed multiple emboli in both pulmonary artery branches. Proband A received subcutaneous Nadroparin Calcium (6150AxaIU qd) for three consecutive days and oral rivaroxaban 15 mg bid for 15 days. She was discharged after a second CTA scan showed improved thrombus and put on rivaroxaban 20 mg once a day for three months and then adjusted to long-term rivaroxaban 10 mg once a day. A total of 6 individuals from 3 generations of this family were recruited in this study (Fig. 1 a). The proband's parents were not consanguineous. No other family members had a similar medical history, and no abnormalities in their liver or kidney function panels. Proband B was a 63-year-old male who was presented to the hospital because of shortness of breath for ten days after an event. The CTA suggested multiple emboli in the right pulmonary artery, left lower pulmonary artery, and some branches. Bilateral lower extremity Doppler ultrasound findings showed left lower extremity deep vein thrombosis, as did proband A. In addition, he has smoked for 40 years without quitting. He was treated with low molecular heparin calcium 8200AxaIU bid for eight consecutive days. However, the left lower extremity deep vein thrombosis was not significantly relieved. Then, the treatment was switched to oral rivaroxaban 15 mg bid till the thromboembolic symptoms improved. He was discharged from the hospital with similar treatment to proband A and has had no further thrombosis until now. In total, nine members of his family, spanning four generations, were examined (Fig. 1 b). His parents died of natural causes, and there were no other liver or kidney diseases in this family. No other family members had a similar medical history, and no abnormalities in their liver or kidney function panels. A control group of 100 healthy individuals, comprising 45 females and 55 males aged between 22 and 56 years old, underwent routine medical check-ups to establish the standard reference ranges for laboratory coagulation phenotypic markers. The individuals in the control group had no liver or kidney function abnormalities and had no underlying diseases. Methods Plasma Coagulation Tests Blood samples were collected into anticoagulant tubes containing 0.109 mol/L trisodium citrate and then centrifuged at 3000 rpm for 10 minutes. The platelet-poor plasma was tested for coagulation markers and thrombin production; DNA extraction was performed on the lower layer with blood cells. Plasma PC:A and antithrombin activity (AT:A) were detected by the chromogenic substrate method, D-dimer was measured by the immunoturbidimetric method, and protein S activity (PS:A) was determined by the clotting method. All these parameters were tested using the matching reagents on the STAGO-STAR fully automated coagulation analyzer (Diagnostica Stago, Asnieres-sur-Seine, France). The enzyme-linked immunosorbent assay (ELISA) method was used to detect PC:Ag (Enzyme Research Laboratories, South Bend, IN, USA). PROC Genetic Analysis Genomic DNA was extracted from peripheral blood using a DNA blood extraction kit (Tiangen Biotech, Beijing, China) following the provided instructions. The polymerase chain reaction (PCR) was performed to amplify all eight exons and exon-intron boundaries of the entire PROC coding region using the Applied Biosystems Thermal Cycler 2720 (ABI thermocycler 2720, California, USA). According to the human PROC sequence (GenBank AF378903.2), eight primer pairs were designed to amplify all the exons and their flanking regions of the PROC gene. The PCR products were directly sequenced by Sunsoon BIO-Technology Corporation (Shanghai, China) after purification. Following mutation site identification, amplifying all exons and flanking sequences of the PROC gene in the family members was performed to determine the corresponding mutation site. All PCR primers are listed in Table 1 . Table 1 List of PCR primers Primer Forward sequence Reverse sequence Exon 1 GCTGAGCTAGGACCAGGAGTC CAAAGGGACCTGAGACTGTGG Exon 2 TGCTTTCTAGGCAGGCAGTGT GGAGGGAGCTTTAGGAGGTCA Exon 3 CATCTCAGAGCAAGGCTTCGT CTCCTAAGAGGGCCTCAGCAT Exon 4–6 GGAGTGATGGGACTGGAAGGA CGTGATTCCTGGGCGATGTA Exon 7 AGGGAACCCAGGAAAGTG CTCCAGCCCATACCAAGC Exon 8 AGGGAACCCAGGAAAGTG CTCCAGCCCATACCAAGC Exon 9a ATGCCCATATGACCAGGGAAC GGGAGTGGAGAGGTGAAGGTC Exon 9b GGGCTCCTTCACAACTACGG GTCAAGCCTCACCTTCAGCA Conservation and Bioinformatics Analysis The multiple sequence alignment software ClustalX-2.1 (Science Foundation Ireland, Dublin, Ireland) was used to study the conservation level of amino acid mutation sites in humans and five other homologous species, including Pan troglodyte, Macaca mulatt, Canis lupus, Bos taurus, and Xenopus tropicalis ( http://www.ncbi.nlm.nih.gov/homologen ). Online bioinformatic tools, Mutation Taster, Polyphen-2, PROVEAN, and FATHMM, were used to predict the pathogenicity of mutations. PyMOLWin-2.3 was used (Schrodinger, New York, USA) to construct protein structure models before and after mutation and analyze the changes and impacts of mutations on the spatial structure of the protein. The PC crystal structure data was obtained from Uniprot ( https://www.uniprot.org/ ). Thrombin Generation Assay The calibrated automated thrombin (CAT) generation assay was used to detect the generation of thrombin. Using the FluoCa assay kit and 20µL PPP-Reagent medium provided by Stago, coagulation was initiated using one pmol/L Tissue Factor (TF). Parameters including lag time (min), peak height (Peak, nmol/L), time to peak (ttPeak, min), and endogenous thrombin potential (ETP, nmol/L*min) were recorded for normal plasma and subject plasma samples with and without soluble Thrombomodulin (sTM) over a monitoring period of 60 minutes. All samples were set with three replicates. Results Coagulation laboratory data Probands A and B both showed a synchronous decline in PC:A and PC:Ag, with values of 40% and 39%, and 55% and 53% respectively and were classified as type Ⅰ PCD. Proband A's father and brother also showed different levels of decline in PC:A and PC:Ag. Similarly, Proband B's daughter and grandson also showed varying degrees of decrease in PC:A and PC:Ag, approximately 50% of the normal reference range. Other coagulation parameters showed no significant abnormalities in both probands and their families. The details are shown in Table 2 . Table 2 ༎ Phenotypes and genotypes of two hereditary protein C deficiency families Patient D-D(mg/L) PS:A(%) AT:A(%) PC:A(%) PC:Ag(%) Mutation Family A Ⅰ 1 0.38 93 109 113 109 Wild-type Ⅰ 2 0.24 91 102 48 50 Arg440Cys Ⅱ 1 0.21 92 103 51 56 Arg440Cys Proband A 0.18 89 106 55 53 Arg440Cys Ⅱ 3 0.32 82 111 102 105 Wild-type Ⅲ 1 0.33 83 108 98 95 Wild-type Family B Proband B 0.27 92 98 40 39 Trp444Arg Ⅱ 2 0.24 93 103 98 102 Wild-type Ⅲ 1 0.24 89 114 94 97 Wild-type Ⅲ 2 0.25 91 99 49 50 Trp444Arg Ⅲ 3 0.31 85 105 95 101 Wild-type Ⅳ 1 0.26 90 108 43 42 Trp444Arg Ⅳ 2 0.28 87 113 99 109 Wild-type Normal range 0 ~ 5 65 ~ 135 98 ~ 118 70 ~ 130 70 ~ 140 - PROC Gene Analysis Genetic analysis of the proband A revealed a heterozygous point mutation c.1313C > T in exon 9 of the PROC gene, resulting in p.Arg440Cys. Her brother, daughter, and nephew also had the same heterozygous mutation at this site, while other family members were wild-type. Proband B exhibited a heterozygous point mutation, c.1330T > C, in exon 9 of the PROC gene, resulting in a substitution of tryptophan (Trp) with arginine (Arg) at codon 444 (p.Trp444Arg). His daughter and grandson carried the same heterozygous point mutation, while other family members were wild-type (Fig. 2 ). This is the first report of the p.Trp444Arg mutation. The p.Trp444Arg missense mutation is absent in gnomAD( https://www.genome.gov/27528684/1000-genomes-projec ), HGMD( https://www.hgmd.cf.ac.uk/ac/all.php ), and PubMed( https://pubmed.ncbi.nlm.nih.gov/ ), indicating it is not a polymorphism. Conservation and Pathogenicity Analysis Homologous sequence alignment results manifested that Arg440 and Trp444 were conserved among the six homologous species (Fig. 3 ). As shown in Table 3 , according to the PROVEAN, p.Arg440Cys was ‘Deleterious’, and the p.Trp444Arg was ‘Damaging’. Mutation Taster, FATHMM, and PolyPhen-2 online bioinformatics software predicted that the two missense mutations were ‘Disease causing’, ‘DAMAGING’, and ‘PROBABLY DAMAGING’. Table 3 ༎The analysis of four online bioinformatics software Gene type Mutation taster FATHMM PolyPhen-2 PROVEAN Arg440Cys Disease causing DAMAGING PROBABLY DAMAGING Deleterious Trp444Arg Disease causing DAMAGING PROBABLY DAMAGING Damaging Protein Model Analysis Using PyMOL software, protein modeling analysis of PC revealed that the substitution of Arg440 with Cys440 could lead to the loss of three hydrogen bonds between Arg440 and Glu383, resulting in a shorter chain. Similarly, the substitution of Trp444 with Arg444 caused the disappearance of the aromatic ring structure of Trp444 and resulted in a shorter Trp444 side chain. Both substitutions could induce changes in the spatial structure of the PC protein (Fig. 4 ). Thrombin Generation Assay Probands A and B exhibited significantly increased endogenous thrombin potentials and peak heights compared to the normal controls. Furthermore, compared to the addition of soluble thrombomodulin (sTM) in normal plasma, the inhibitory effect of sTM-mediated plasma on thrombin generation is decreased in Probands A and B, accompanied by significant increases in endogenous thrombin generation potentials (Fig. 5 ). Discussion PC consists of two polypeptide chains of multi-structural domain glycoproteins, and the light chain of PC contains a γ-carboxyglutamic acid (Gla) structural domain and two EGF structural domains. The heavy chain comprises the activating peptide and the trypsin-like serine protease structural domain [ 9 ]. The Gla structural domain at the N-terminus is the region that binds Ca 2+ , and it contributes to APC and PS binding [ 10 ]. Acidic residues within the activation peptide protect against proteolysis by endogenous proteases [ 11 ]. The C-terminal trypsin-like serine protease structural domain is the active region of PC [ 10 ]. In our study, we found two mutations of the PROC gene, including p.Arg440Cys and p.Trp444Arg.The heterozygous state of two mutations showed simultaneous reductions in PC:A and PC:Ag levels, which can be classified as type Ⅰ hereditary PC deficiency. Simultaneously, impaired anticoagulant function was observed in the two probands by thrombin generation curve, and the PC-deficient probands were tested by supplementation with exogenous sTM, which revealed that PC-deficient patients had a significantly reduced inhibitory capacity for thrombin generation. The results of this assay indicated that plasma APC activity was significantly reduced in the probands. Therefore, we believe that the missense mutations of c.1313C > T and c.1330T > C caused the decrease of PC:A and PC:Ag. The two sites being examined in our study are situated within the trypsin-like serine protease structural domain and contain the catalytic triad responsible for the proteolysis of APC substrates. Additionally, this domain encompasses substrate binding regions, where APC substrates must bind before being cleaved. Mutations occurring within this domain are likely to directly impact the catalytic efficiency and the binding of substrates to the protease. Conservation analysis revealed that Arg440 and Trp444 are highly conserved throughout biological evolution, indicating that these amino acid residues are irreplaceable for PC proteins. By constructing a structural model of the PC protein, it was found that the loss of the hydrogen bond between Arg440 and Glu383 is likely to cause a change in the electrostatic attraction between the mutant residue and the surrounding amino acid residues. Additionally, the mutated Cys440 contains a disulfide bond that can connect two amino acid residues, thereby enhancing the stability of the protein's spatial structure. Trp444 is located in the alpha-helical region facing hydrophobic residues and is stabilized by hydrogen bonding with His448 and Tyr441. Huang et al. [ 12 ] found through their studies on various protein structures that the folding kinetics of proteins are significantly correlated with the hydrophobic properties of residues. As the number of hydrophobic amino acid residues increases, the folding rate of proteins decreases. In addition, amino acids with aromatic side chains may also act as inhibitors of protein folding reactions. Therefore, when the polar amino acid Arg replaces the non-polar amino acid Trp, the aromatic ring structure disappears, and the side chain becomes longer. This substitution can potentially affect the stability of the secondary structure of the PC as well as its protein folding. It has been found that the secretion of PC is dependent on the carboxy-terminal region located after the 28 amino acid loop (positions 398 to 426) [ 13 ]. As a result, both the p.Arg440Cys and the p.Trp444Arg mutation exhibit unstable expression and low secretion rates of PC. This may be the reason for the decrease of PC:Ag in p.Arg440Cys and p.Trp444Arg heterozygotes. So far, 396 mutations have been identified in the world according to the HGMD, with the majority being missense or nonsense mutations [ 14 ]. Heterozygous individuals typically have around 50% of normal PC levels and are usually asymptomatic before adulthood [ 15 ]. Among them, patients with monohybrid have a significantly increased risk of thrombosis when exposed to prothrombotic factors such as smoking, pregnancy, obesity, trauma, and prolonged immobilization. The two probands in this study are heterozygous carriers of mutations in the PROC gene. The lower limb vein thrombosis in proband A may be associated with the p.Arg440Cys mutation and prolonged immobilization. Proband B experienced severe DVT and pulmonary embolism despite having a long history of smoking. The thrombotic events in this proband may be attributed to the combined effects of the p.Trp444Arg heterozygous missense mutation, long-term smoking, accidental falls, and advanced age as prothrombotic factors. Long-term anticoagulant therapy is required for both patients, with regular monitoring of anticoagulation levels and timely adjustment of medication dosage to prevent thrombosis while minimizing the risk of bleeding. In conclusion, this study describes two mutations (p.Arg440Cys and p.Trp444Arg) in the PROC gene from two independent Chinese families. These two pathogenic mutations were responsible for the PC defect observed in both pedigrees. The possible molecular pathogenic mechanisms were preliminarily explored, which contributed to enriching the mutation database for hereditary PC deficiency. However, further in vitro experiments are needed to validate specific pathogenic mechanisms. Declarations Acknowledgments: We are grateful to the patients and their family members for their cooperation. Ethics approval and consent to participate: Our study was approved by the First Affiliated Hospital Ethics Committee of Wenzhou Medical University (China)(KY2022-R193). Consent for publication : The participant has consented to the submission of the artical to the journal. Competing Interests: The authors have no conflicts of interest to disclose. Author contributions: Lihong Yang researched literature and conceived the study. Yifan Lu and Langyi Qin involved in protocol development. Mingshan Wang gained the ethical approval and patient recruitment. Haixiao Xie conducted data analysis. Ke Zhang and Longyin Ye conducted experiments. Mengzhen Wen wrote the first draft of the manuscript. All authors reviewed and edited the manuscript and approved the final version of the manuscript. Funding: Wenzhou Basic Medical and Health Science and Technology Project (Y20210111); Key Laboratory of Clinical Laboratory Diagnosis and Translational Research of Zhejiang Province (2022E10022). Availability of data and materials: The data supporting this study's conclusions are available from the corresponding author upon request. For further inquiries, please get in touch with the corresponding author directly. References Yue Y, Liu S, Han X et al (2019) Pathogenic variants of PROC gene caused type I activity deficiency in a familial Chinese venous thrombosis. J Cell Mol Med 23(10):7099–7104. https://doi:10.1111/jcmm.14563 Wu YT, Yue F, Wang M et al (2014) Hereditary protein C deficiency caused by compound heterozygous mutants in two independent Chinese families. Pathol (Phila) 46(7):630–635. https://doi:10.1097/PAT.0000000000000165 Stenflo J (1976) A new vitamin K-dependent protein. Purification from bovine plasma and preliminary characterization. J Biol Chem 251(2):355–363 Dinarvand P, Moser KA (2019) Protein C Deficiency. Arch Pathol Lab Med 143(10):1281–1285. https://doi.10.5858/arpa.2017-0403-RS Xu Q, Wang M, Jin Y et al (2021) Two heterozygous mutations associated with type I protein C deficiency in two Chinese independent families. Blood Coagul Fibrinolysis 32(8):596–602. https://doi.10.1097/MBC.0000000000001065 Bulato C, Campello E, Gavasso S et al (2018) Peculiar laboratory phenotype/ genotype relationship due to compound inherited protein C defects in a child with severe venous thromboembolism. Hämostaseologie 38(01):33–38. https://doi.10.5482/HAMO-17-03-0013 Dahlbäck B (2020) Advances in Understanding Mechanisms of Thrombophilic Disorders. Hämostaseologie 40(01):12–21. https://doi.org/10.1055/s-0040-1701612 Majid Z, Tahir F, Ahmed J et al (2020) Protein C Deficiency as a Risk Factor for Stroke in Young Adults: A Review. Cureus 12(3):e7472 https://doi.10.7759/cureus.74 Yamashita A, Zhang YQ, Sanner MF et al (2020) C-terminal residues of activated protein C light chain contribute to its anticoagulant and cytoprotective activities. J Thromb Haemost 18(5): 1141–1153 https://doi.10.1111/jth.14756 Wildhagen KC, Lutgens E, Loubele ST et al (2011) The structure-function relationship of activated protein C: Lessons from natural and engineered mutations. Thromb Haemost 106(12): 1034–1045. https://doi.10.1160/TH11-08-0522 Stojanovski BM, Pelc LA, Enrico DC (2020) Role of the activation peptide in the mechanism of protein C activation. Sci Rep 10(1):11079. https://www.jbc.org/cgi/doi/ 10.1074/jbc.RA120.014789 Huang JT, Xing DJ, Huang W (2012) Relationship between protein folding kinetics and amino acid properties. Amino Acids 43(2):P67–572. https: //doi.10.1007/s00726-011-1189-3 Yamamoto K, Matsushita T, Sugiura I et al (1992) Homozygous protein C deficiency: identification of a novel missense mutation that causes impaired secretion of the mutant protein C. J Lab Clin Med 119(6):682–689 Winther-Larsen A, Kjaergaard AD, Larsen OH et al (2020) Protein C deficiency; PROC gene variants in a Danish population. Thromb Res 185:153–159. https://doi.org/10.1016/j.thromres.2019.11.027 Fisher CL, Greengard JS, Griffin JH (1994) Models of the serine protease domain of the human antithrombotic plasma factor activated protein C and its zymogen. Protein Science 3:588–599. https://doi.10.1002/pro.5560030407 Additional Declarations No competing interests reported. Supplementary Files Table1.docx Table2.docx Table3.docx Cite Share Download PDF Status: Published Journal Publication published 26 Dec, 2024 Read the published version in Annals of Hematology → Version 1 posted Editorial decision: Revision requested 09 Nov, 2024 Reviews received at journal 08 Nov, 2024 Reviewers agreed at journal 29 Oct, 2024 Reviews received at journal 15 Aug, 2024 Reviewers agreed at journal 26 Jul, 2024 Reviewers agreed at journal 28 Jun, 2024 Reviewers invited by journal 10 Jun, 2024 Submission checks completed at journal 22 May, 2024 Editor assigned by journal 22 May, 2024 First submitted to journal 05 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4372666","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":309082015,"identity":"1cd69a89-741c-4f4b-8e33-bb3ad8a94a49","order_by":0,"name":"Mengzhen Wen","email":"","orcid":"","institution":"the First Affiliated Hospital of Wenzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Mengzhen","middleName":"","lastName":"Wen","suffix":""},{"id":309082016,"identity":"65f3ef29-217f-4eec-b093-c6721dd444b0","order_by":1,"name":"Yifan Lu","email":"","orcid":"","institution":"the First Affiliated Hospital of Wenzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yifan","middleName":"","lastName":"Lu","suffix":""},{"id":309082017,"identity":"1a0f8641-5f4e-40bb-80ae-5fae647853c4","order_by":2,"name":"Haixiao Xie","email":"","orcid":"","institution":"the First Affiliated Hospital of Wenzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Haixiao","middleName":"","lastName":"Xie","suffix":""},{"id":309082018,"identity":"29c2a54d-c2e1-4321-b493-81f46889c1e4","order_by":3,"name":"Langyi Qin","email":"","orcid":"","institution":"the First Affiliated Hospital of Wenzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Langyi","middleName":"","lastName":"Qin","suffix":""},{"id":309082019,"identity":"03a5faa6-b23e-4b47-b28c-baffa228d208","order_by":4,"name":"Longying Ye","email":"","orcid":"","institution":"the First Affiliated Hospital of Wenzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Longying","middleName":"","lastName":"Ye","suffix":""},{"id":309082020,"identity":"754a54a6-b633-4215-8af6-f031b702e73a","order_by":5,"name":"Ke Zhang","email":"","orcid":"","institution":"the First Affiliated Hospital of Wenzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ke","middleName":"","lastName":"Zhang","suffix":""},{"id":309082021,"identity":"d46f568e-5db2-48a9-b8a3-12a4be4acfe2","order_by":6,"name":"Mingshan Wang","email":"","orcid":"","institution":"the First Affiliated Hospital of Wenzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Mingshan","middleName":"","lastName":"Wang","suffix":""},{"id":309082022,"identity":"2543b492-7cec-4527-ac21-9ea2cc94b224","order_by":7,"name":"Lihong Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAApklEQVRIiWNgGAWjYDACdh7GBwkVEnLyxGth5mE2eHDGwtiwgQQtbJIP2yoSGQ4Qq8PgMO8xicR5EgmMDcwPH90gTgtfskXiNok8dgY2Y+Mc4rTwGN4AailmbOBhkyZWi4FE4hyJxIYDJGgxAqonRYvkYR5jg4RjEsaGzcT6he94j+HDHzV1cvLszQ8fE6VF4QCMxUyMchCQbyBW5SgYBaNgFIxcAAAfhS3iIJkzkQAAAABJRU5ErkJggg==","orcid":"","institution":"the First Affiliated Hospital of Wenzhou Medical University","correspondingAuthor":true,"prefix":"","firstName":"Lihong","middleName":"","lastName":"Yang","suffix":""}],"badges":[],"createdAt":"2024-05-05 17:38:38","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4372666/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4372666/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00277-024-06156-2","type":"published","date":"2024-12-26T15:57:20+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":57685926,"identity":"40388e8b-795c-4e05-ba95-5815160766c4","added_by":"auto","created_at":"2024-06-04 09:59:08","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":52143,"visible":true,"origin":"","legend":"\u003cp\u003eThe pedigree chart of the protein C deficiency.\u003c/p\u003e","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4372666/v1/1b92df0df14cd545a8f8ca7c.jpg"},{"id":57685929,"identity":"d1692438-5817-4e5a-b147-f22c26679796","added_by":"auto","created_at":"2024-06-04 09:59:08","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":285367,"visible":true,"origin":"","legend":"\u003cp\u003eSequence diagrams of PROC: p.Arg440Cys and p.Trp444Arg. ①The sequencing of heterozygous c.1313C\u0026gt;T.②The wild type of c.1313C\u0026gt;T.③The sequencing of heterozygous c.1330T\u0026gt;C.④The wild type of c.1330T\u0026gt;C.\u003c/p\u003e","description":"","filename":"Fig.2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4372666/v1/36c956de5ff1b612bab3b614.jpg"},{"id":57685930,"identity":"3052ae4f-7e69-4f3d-aaa7-a65934fbbe93","added_by":"auto","created_at":"2024-06-04 09:59:08","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":250377,"visible":true,"origin":"","legend":"\u003cp\u003eConservative analysis diagrams. The targeted amino acid was indicated with an arrow.\u003c/p\u003e","description":"","filename":"Fig.3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4372666/v1/78fb20805b24fb9713ddce98.jpg"},{"id":57685932,"identity":"285342d9-e7d9-4951-ad4b-f33a729b87f6","added_by":"auto","created_at":"2024-06-04 09:59:08","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":195353,"visible":true,"origin":"","legend":"\u003cp\u003eThe model analysis of PC.(4A) p.Arg440Cys wild type; (4B) p.Arg440Cys mutant type; (4C) p.Trp444Arg wild type; (4D) p.Trp444Arg mutant type.\u003c/p\u003e","description":"","filename":"Fig.4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4372666/v1/2b8a54ba6c5c1c90d755dc49.jpg"},{"id":57685933,"identity":"0563ddcd-6b35-482c-95bc-955a3edd6363","added_by":"auto","created_at":"2024-06-04 09:59:08","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":118622,"visible":true,"origin":"","legend":"\u003cp\u003eThe graph of Thrombin Generation Assay of families A and B.\u003c/p\u003e","description":"","filename":"Fig.5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4372666/v1/671709b7758f0f97d4027288.jpg"},{"id":72640539,"identity":"a15459a3-8dc9-4503-b8fb-03a36a43676a","added_by":"auto","created_at":"2024-12-30 16:06:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1424396,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4372666/v1/6a7df28c-5930-4bcc-9d19-f0271a90b496.pdf"},{"id":57685934,"identity":"5745dc1b-1204-44ff-ac2c-4e786a8eaf85","added_by":"auto","created_at":"2024-06-04 09:59:09","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":11868,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-4372666/v1/7c441e8ffd98c89c25e00471.docx"},{"id":57685931,"identity":"9473a546-574d-4acf-9577-d5df40dfb80b","added_by":"auto","created_at":"2024-06-04 09:59:08","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":12888,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.docx","url":"https://assets-eu.researchsquare.com/files/rs-4372666/v1/2c3d77fb2ed825d5f8004323.docx"},{"id":57685928,"identity":"11107c31-5655-4bdd-8858-9d811fe18a0c","added_by":"auto","created_at":"2024-06-04 09:59:08","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":11305,"visible":true,"origin":"","legend":"","description":"","filename":"Table3.docx","url":"https://assets-eu.researchsquare.com/files/rs-4372666/v1/a22710ed002394b0ca618e59.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Molecular and clinical characterization of two independent Chinese families with protein C deficiency","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePlasma protein C (PC), a vitamin K-dependent single-chain glycoprotein, is mainly synthesized by the hepatocytes and released into circulating plasma in the form of inactive zymogen [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. PC can be activated by the thrombin-thrombomodulin complex, which cleaves the activation peptide containing 12 amino acid residues between Arg12 and Leu13 of the heavy chain. Activated PC (APC) primarily exerts its anticoagulant function by degrading coagulation factor Va and coagulation factor VIIIa in the presence of Ca\u003csup\u003e2+\u003c/sup\u003e, phospholipids, and protein S [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The PC protein is encoded by the PROC gene, which is located on chromosome 2q13-q14. The purification and characterization of PC were first carried out by Stenflo in 1976 [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHereditary PC deficiency(PCD) is predominantly an autosomal dominant genetic disease caused by a mutation in the \u003cem\u003ePROC\u003c/em\u003e gene, which consists of 9 exons and covers more than 11 kb of genomic DNA [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The specific type and location of the mutation within the \u003cem\u003ePROC\u003c/em\u003e gene can influence the severity of PC deficiency and the associated clinical manifestations observed in affected individuals. Most cases of PCD are caused by heterozygous mutations at a single locus of the \u003cem\u003ePROC\u003c/em\u003e gene. However, severe PC deficiency resulting from homozygous or compound heterozygous mutations is rare [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The prevalence of heterozygous PCD has been estimated to be approximately 0.5% of the population. It is associated with adult-onset venous thromboembolism (VTE) when other genetic or acquired risk factors for VTE are present [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Based on the phenotypes of PCD, it can be divided into type-I and type-II. Type I PCD, the most common form, is characterized by a simultaneous decrease in both PC:Ag and PC:A. Type II PCD is characterized by normal PC antigen concentration but reduced PC:A [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. By investigating families with inherited PCD, genetic counseling can be provided to prevent and diagnose thrombosis and embolism within these families accurately.\u003c/p\u003e \u003cp\u003eThis study reports two missense mutations in p.Arg440Cys and p.Trp444Arg in two independent Chinese families with PCD and preliminarily investigates their possible molecular pathogenic mechanisms.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePatients\u003c/h2\u003e \u003cp\u003eFamily A\u003c/p\u003e \u003cp\u003eProband A was a 39-year-old Chinese female who was admitted to the hospital due to \u0026ldquo;Swelling and pain in the left lower limb for a month and labored breathing for ten days\u0026rdquo;. Meanwhile, She had been bedridden for more than a month. Bilateral lower extremity Doppler ultrasound revealed thrombosis of the left common femoral vein, superficial femoral vein, popliteal vein, and external iliac vein. The computed tomography angiography (CTA) of the pulmonary artery showed multiple emboli in both pulmonary artery branches. Proband A received subcutaneous Nadroparin Calcium (6150AxaIU qd) for three consecutive days and oral rivaroxaban 15 mg bid for 15 days. She was discharged after a second CTA scan showed improved thrombus and put on rivaroxaban 20 mg once a day for three months and then adjusted to long-term rivaroxaban 10 mg once a day. A total of 6 individuals from 3 generations of this family were recruited in this study (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). The proband's parents were not consanguineous. No other family members had a similar medical history, and no abnormalities in their liver or kidney function panels.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eProband B was a 63-year-old male who was presented to the hospital because of shortness of breath for ten days after an event. The CTA suggested multiple emboli in the right pulmonary artery, left lower pulmonary artery, and some branches. Bilateral lower extremity Doppler ultrasound findings showed left lower extremity deep vein thrombosis, as did proband A. In addition, he has smoked for 40 years without quitting. He was treated with low molecular heparin calcium 8200AxaIU bid for eight consecutive days. However, the left lower extremity deep vein thrombosis was not significantly relieved. Then, the treatment was switched to oral rivaroxaban 15 mg bid till the thromboembolic symptoms improved. He was discharged from the hospital with similar treatment to proband A and has had no further thrombosis until now. In total, nine members of his family, spanning four generations, were examined (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). His parents died of natural causes, and there were no other liver or kidney diseases in this family.\u003c/p\u003e \u003cp\u003eNo other family members had a similar medical history, and no abnormalities in their liver or kidney function panels. A control group of 100 healthy individuals, comprising 45 females and 55 males aged between 22 and 56 years old, underwent routine medical check-ups to establish the standard reference ranges for laboratory coagulation phenotypic markers. The individuals in the control group had no liver or kidney function abnormalities and had no underlying diseases.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eMethods\u003c/h2\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003ePlasma Coagulation Tests\u003c/h2\u003e \u003cp\u003eBlood samples were collected into anticoagulant tubes containing 0.109 mol/L trisodium citrate and then centrifuged at 3000 rpm for 10 minutes. The platelet-poor plasma was tested for coagulation markers and thrombin production; DNA extraction was performed on the lower layer with blood cells. Plasma PC:A and antithrombin activity (AT:A) were detected by the chromogenic substrate method, D-dimer was measured by the immunoturbidimetric method, and protein S activity (PS:A) was determined by the clotting method. All these parameters were tested using the matching reagents on the STAGO-STAR fully automated coagulation analyzer (Diagnostica Stago, Asnieres-sur-Seine, France). The enzyme-linked immunosorbent assay (ELISA) method was used to detect PC:Ag (Enzyme Research Laboratories, South Bend, IN, USA).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003ePROC Genetic Analysis\u003c/h2\u003e \u003cp\u003eGenomic DNA was extracted from peripheral blood using a DNA blood extraction kit (Tiangen Biotech, Beijing, China) following the provided instructions. The polymerase chain reaction (PCR) was performed to amplify all eight exons and exon-intron boundaries of the entire \u003cem\u003ePROC\u003c/em\u003e coding region using the Applied Biosystems Thermal Cycler 2720 (ABI thermocycler 2720, California, USA). According to the human \u003cem\u003ePROC\u003c/em\u003e sequence (GenBank AF378903.2), eight primer pairs were designed to amplify all the exons and their flanking regions of the \u003cem\u003ePROC\u003c/em\u003e gene. The PCR products were directly sequenced by Sunsoon BIO-Technology Corporation (Shanghai, China) after purification. Following mutation site identification, amplifying all exons and flanking sequences of the PROC gene in the family members was performed to determine the corresponding mutation site. All PCR primers are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of PCR primers\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse sequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExon 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTGAGCTAGGACCAGGAGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAAAGGGACCTGAGACTGTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExon 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCTTTCTAGGCAGGCAGTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGGGAGCTTTAGGAGGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExon 3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATCTCAGAGCAAGGCTTCGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCTAAGAGGGCCTCAGCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExon 4\u0026ndash;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAGTGATGGGACTGGAAGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGTGATTCCTGGGCGATGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExon 7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGGAACCCAGGAAAGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCAGCCCATACCAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExon 8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGGAACCCAGGAAAGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCAGCCCATACCAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExon 9a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGCCCATATGACCAGGGAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGAGTGGAGAGGTGAAGGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExon 9b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGCTCCTTCACAACTACGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCAAGCCTCACCTTCAGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eConservation and Bioinformatics Analysis\u003c/h2\u003e \u003cp\u003eThe multiple sequence alignment software ClustalX-2.1 (Science Foundation Ireland, Dublin, Ireland) was used to study the conservation level of amino acid mutation sites in humans and five other homologous species, including \u003cem\u003ePan troglodyte, Macaca mulatt, Canis lupus, Bos taurus, and Xenopus tropicalis\u003c/em\u003e (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov/homologen\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/homologen\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Online bioinformatic tools, Mutation Taster, Polyphen-2, PROVEAN, and FATHMM, were used to predict the pathogenicity of mutations. PyMOLWin-2.3 was used (Schrodinger, New York, USA) to construct protein structure models before and after mutation and analyze the changes and impacts of mutations on the spatial structure of the protein. The PC crystal structure data was obtained from Uniprot (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.uniprot.org/\u003c/span\u003e\u003cspan address=\"https://www.uniprot.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eThrombin Generation Assay\u003c/h2\u003e \u003cp\u003eThe calibrated automated thrombin (CAT) generation assay was used to detect the generation of thrombin. Using the FluoCa assay kit and 20\u0026micro;L PPP-Reagent medium provided by Stago, coagulation was initiated using one pmol/L Tissue Factor (TF). Parameters including lag time (min), peak height (Peak, nmol/L), time to peak (ttPeak, min), and endogenous thrombin potential (ETP, nmol/L*min) were recorded for normal plasma and subject plasma samples with and without soluble Thrombomodulin (sTM) over a monitoring period of 60 minutes. All samples were set with three replicates.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eCoagulation laboratory data\u003c/h2\u003e \u003cp\u003eProbands A and B both showed a synchronous decline in PC:A and PC:Ag, with values of 40% and 39%, and 55% and 53% respectively and were classified as type Ⅰ PCD. Proband A's father and brother also showed different levels of decline in PC:A and PC:Ag. Similarly, Proband B's daughter and grandson also showed varying degrees of decrease in PC:A and PC:Ag, approximately 50% of the normal reference range. Other coagulation parameters showed no significant abnormalities in both probands and their families. The details are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e༎ Phenotypes and genotypes of two hereditary protein C deficiency families\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePatient\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eD-D(mg/L)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePS:A(%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAT:A(%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePC:A(%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePC:Ag(%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eMutation\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003eFamily A\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eⅠ\u003csub\u003e1\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e109\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e113\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e109\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eWild-type\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eⅠ\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e102\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eArg440Cys\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eⅡ\u003csub\u003e1\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e103\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eArg440Cys\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProband A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e106\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eArg440Cys\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eⅡ\u003csub\u003e3\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e111\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e102\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e105\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eWild-type\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eⅢ\u003csub\u003e1\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e108\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eWild-type\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003eFamily B\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProband B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTrp444Arg\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eⅡ\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e103\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e102\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eWild-type\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eⅢ\u003csub\u003e1\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e114\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eWild-type\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eⅢ\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTrp444Arg\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eⅢ\u003csub\u003e3\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e105\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e101\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eWild-type\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eⅣ\u003csub\u003e1\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e108\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTrp444Arg\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eⅣ\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e113\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e109\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eWild-type\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNormal range\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u0026thinsp;~\u0026thinsp;5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e65\u0026thinsp;~\u0026thinsp;135\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e98\u0026thinsp;~\u0026thinsp;118\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e70\u0026thinsp;~\u0026thinsp;130\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e70\u0026thinsp;~\u0026thinsp;140\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePROC\u003c/b\u003e \u003cb\u003eGene Analysis\u003c/b\u003e\u003c/p\u003e \u003cp\u003eGenetic analysis of the proband A revealed a heterozygous point mutation c.1313C\u0026thinsp;\u0026gt;\u0026thinsp;T in exon 9 of the PROC gene, resulting in p.Arg440Cys. Her brother, daughter, and nephew also had the same heterozygous mutation at this site, while other family members were wild-type. Proband B exhibited a heterozygous point mutation, c.1330T\u0026thinsp;\u0026gt;\u0026thinsp;C, in exon 9 of the \u003cem\u003ePROC\u003c/em\u003e gene, resulting in a substitution of tryptophan (Trp) with arginine (Arg) at codon 444 (p.Trp444Arg). His daughter and grandson carried the same heterozygous point mutation, while other family members were wild-type (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). This is the first report of the p.Trp444Arg mutation. The p.Trp444Arg missense mutation is absent in gnomAD(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.genome.gov/27528684/1000-genomes-projec\u003c/span\u003e\u003cspan address=\"https://www.genome.gov/27528684/1000-genomes-projec\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), HGMD(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.hgmd.cf.ac.uk/ac/all.php\u003c/span\u003e\u003cspan address=\"https://www.hgmd.cf.ac.uk/ac/all.php\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and PubMed(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubmed.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://pubmed.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), indicating it is not a polymorphism.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eConservation and Pathogenicity Analysis\u003c/h2\u003e \u003cp\u003eHomologous sequence alignment results manifested that Arg440 and Trp444 were conserved among the six homologous species (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). As shown in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, according to the PROVEAN, p.Arg440Cys was \u0026lsquo;Deleterious\u0026rsquo;, and the p.Trp444Arg was \u0026lsquo;Damaging\u0026rsquo;. Mutation Taster, FATHMM, and PolyPhen-2 online bioinformatics software predicted that the two missense mutations were \u0026lsquo;Disease causing\u0026rsquo;, \u0026lsquo;DAMAGING\u0026rsquo;, and \u0026lsquo;PROBABLY DAMAGING\u0026rsquo;.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e༎The analysis of four online bioinformatics software\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene type\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMutation taster\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFATHMM\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePolyPhen-2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePROVEAN\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eArg440Cys\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDisease causing\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDAMAGING\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePROBABLY DAMAGING\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDeleterious\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTrp444Arg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDisease causing\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDAMAGING\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePROBABLY DAMAGING\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDamaging\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eProtein Model Analysis\u003c/h2\u003e \u003cp\u003eUsing PyMOL software, protein modeling analysis of PC revealed that the substitution of Arg440 with Cys440 could lead to the loss of three hydrogen bonds between Arg440 and Glu383, resulting in a shorter chain. Similarly, the substitution of Trp444 with Arg444 caused the disappearance of the aromatic ring structure of Trp444 and resulted in a shorter Trp444 side chain. Both substitutions could induce changes in the spatial structure of the PC protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eThrombin Generation Assay\u003c/h2\u003e \u003cp\u003eProbands A and B exhibited significantly increased endogenous thrombin potentials and peak heights compared to the normal controls. Furthermore, compared to the addition of soluble thrombomodulin (sTM) in normal plasma, the inhibitory effect of sTM-mediated plasma on thrombin generation is decreased in Probands A and B, accompanied by significant increases in endogenous thrombin generation potentials (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003ePC consists of two polypeptide chains of multi-structural domain glycoproteins, and the light chain of PC contains a γ-carboxyglutamic acid (Gla) structural domain and two EGF structural domains. The heavy chain comprises the activating peptide and the trypsin-like serine protease structural domain [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The Gla structural domain at the N-terminus is the region that binds Ca\u003csup\u003e2+\u003c/sup\u003e, and it contributes to APC and PS binding [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Acidic residues within the activation peptide protect against proteolysis by endogenous proteases [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The C-terminal trypsin-like serine protease structural domain is the active region of PC [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn our study, we found two mutations of the \u003cem\u003ePROC\u003c/em\u003e gene, including p.Arg440Cys and p.Trp444Arg.The heterozygous state of two mutations showed simultaneous reductions in PC:A and PC:Ag levels, which can be classified as type Ⅰ hereditary PC deficiency. Simultaneously, impaired anticoagulant function was observed in the two probands by thrombin generation curve, and the PC-deficient probands were tested by supplementation with exogenous sTM, which revealed that PC-deficient patients had a significantly reduced inhibitory capacity for thrombin generation. The results of this assay indicated that plasma APC activity was significantly reduced in the probands. Therefore, we believe that the missense mutations of c.1313C\u0026thinsp;\u0026gt;\u0026thinsp;T and c.1330T\u0026thinsp;\u0026gt;\u0026thinsp;C caused the decrease of PC:A and PC:Ag. The two sites being examined in our study are situated within the trypsin-like serine protease structural domain and contain the catalytic triad responsible for the proteolysis of APC substrates. Additionally, this domain encompasses substrate binding regions, where APC substrates must bind before being cleaved. Mutations occurring within this domain are likely to directly impact the catalytic efficiency and the binding of substrates to the protease. Conservation analysis revealed that Arg440 and Trp444 are highly conserved throughout biological evolution, indicating that these amino acid residues are irreplaceable for PC proteins. By constructing a structural model of the PC protein, it was found that the loss of the hydrogen bond between Arg440 and Glu383 is likely to cause a change in the electrostatic attraction between the mutant residue and the surrounding amino acid residues. Additionally, the mutated Cys440 contains a disulfide bond that can connect two amino acid residues, thereby enhancing the stability of the protein's spatial structure.\u003c/p\u003e \u003cp\u003eTrp444 is located in the alpha-helical region facing hydrophobic residues and is stabilized by hydrogen bonding with His448 and Tyr441. Huang et al. [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] found through their studies on various protein structures that the folding kinetics of proteins are significantly correlated with the hydrophobic properties of residues. As the number of hydrophobic amino acid residues increases, the folding rate of proteins decreases. In addition, amino acids with aromatic side chains may also act as inhibitors of protein folding reactions. Therefore, when the polar amino acid Arg replaces the non-polar amino acid Trp, the aromatic ring structure disappears, and the side chain becomes longer. This substitution can potentially affect the stability of the secondary structure of the PC as well as its protein folding. It has been found that the secretion of PC is dependent on the carboxy-terminal region located after the 28 amino acid loop (positions 398 to 426) [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. As a result, both the p.Arg440Cys and the p.Trp444Arg mutation exhibit unstable expression and low secretion rates of PC. This may be the reason for the decrease of PC:Ag in p.Arg440Cys and p.Trp444Arg heterozygotes.\u003c/p\u003e \u003cp\u003eSo far, 396 mutations have been identified in the world according to the HGMD, with the majority being missense or nonsense mutations [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Heterozygous individuals typically have around 50% of normal PC levels and are usually asymptomatic before adulthood [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Among them, patients with monohybrid have a significantly increased risk of thrombosis when exposed to prothrombotic factors such as smoking, pregnancy, obesity, trauma, and prolonged immobilization. The two probands in this study are heterozygous carriers of mutations in the \u003cem\u003ePROC\u003c/em\u003e gene. The lower limb vein thrombosis in proband A may be associated with the p.Arg440Cys mutation and prolonged immobilization. Proband B experienced severe DVT and pulmonary embolism despite having a long history of smoking. The thrombotic events in this proband may be attributed to the combined effects of the p.Trp444Arg heterozygous missense mutation, long-term smoking, accidental falls, and advanced age as prothrombotic factors. Long-term anticoagulant therapy is required for both patients, with regular monitoring of anticoagulation levels and timely adjustment of medication dosage to prevent thrombosis while minimizing the risk of bleeding.\u003c/p\u003e \u003cp\u003eIn conclusion, this study describes two mutations (p.Arg440Cys and p.Trp444Arg) in the \u003cem\u003ePROC\u003c/em\u003e gene from two independent Chinese families. These two pathogenic mutations were responsible for the PC defect observed in both pedigrees. The possible molecular pathogenic mechanisms were preliminarily explored, which contributed to enriching the mutation database for hereditary PC deficiency. However, further \u003cem\u003ein vitro\u003c/em\u003e experiments are needed to validate specific pathogenic mechanisms.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e We are grateful to the patients and their family members for their cooperation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate:\u0026nbsp;\u003c/strong\u003eOur study was approved by the First Affiliated Hospital Ethics Committee of Wenzhou Medical University (China)(KY2022-R193).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003eThe participant has consented to the submission of the artical to the journal.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests:\u003c/strong\u003eThe authors have no conflicts of interest to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions:\u0026nbsp;\u003c/strong\u003eLihong Yang researched literature and conceived the study.\u0026nbsp;Yifan Lu and\u0026nbsp;Langyi Qin\u0026nbsp;involved in protocol development. Mingshan Wang gained the ethical approval and patient recruitment. Haixiao Xie\u0026nbsp;conducted data analysis.\u0026nbsp;Ke Zhang and Longyin Ye\u0026nbsp;conducted\u0026nbsp;experiments.\u0026nbsp;Mengzhen Wen\u0026nbsp;wrote the first draft of the manuscript. All authors reviewed and edited the manuscript and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e Wenzhou Basic Medical and Health Science and Technology Project (Y20210111); Key Laboratory of Clinical Laboratory Diagnosis and Translational Research of Zhejiang Province (2022E10022).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials:\u003c/strong\u003eThe data supporting this study\u0026apos;s conclusions are available from the corresponding author upon request. \u0026nbsp;For further inquiries, please get in touch with the corresponding author directly.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eYue Y, Liu S, Han X et al (2019) Pathogenic variants of PROC gene caused type I activity deficiency in a familial Chinese venous thrombosis. J Cell Mol Med 23(10):7099\u0026ndash;7104. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1111/jcmm.14563\u003c/span\u003e\u003cspan address=\"https://doi:10.1111/jcmm.14563\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu YT, Yue F, Wang M et al (2014) Hereditary protein C deficiency caused by compound heterozygous mutants in two independent Chinese families. Pathol (Phila) 46(7):630\u0026ndash;635. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1097/PAT.0000000000000165\u003c/span\u003e\u003cspan address=\"https://doi:10.1097/PAT.0000000000000165\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStenflo J (1976) A new vitamin K-dependent protein. Purification from bovine plasma and preliminary characterization. J Biol Chem 251(2):355\u0026ndash;363\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDinarvand P, Moser KA (2019) Protein C Deficiency. Arch Pathol Lab Med 143(10):1281\u0026ndash;1285. https://doi.10.5858/arpa.2017-0403-RS\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu Q, Wang M, Jin Y et al (2021) Two heterozygous mutations associated with type I protein C deficiency in two Chinese independent families. Blood Coagul Fibrinolysis 32(8):596\u0026ndash;602. https://doi.10.1097/MBC.0000000000001065\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBulato C, Campello E, Gavasso S et al (2018) Peculiar laboratory phenotype/ genotype relationship due to compound inherited protein C defects in a child with severe venous thromboembolism. H\u0026auml;mostaseologie 38(01):33\u0026ndash;38. https://doi.10.5482/HAMO-17-03-0013\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDahlb\u0026auml;ck B (2020) Advances in Understanding Mechanisms of Thrombophilic Disorders. H\u0026auml;mostaseologie 40(01):12\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1055/s-0040-1701612\u003c/span\u003e\u003cspan address=\"10.1055/s-0040-1701612\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMajid Z, Tahir F, Ahmed J et al (2020) Protein C Deficiency as a Risk Factor for Stroke in Young Adults: A Review. Cureus 12(3):e7472 https://doi.10.7759/cureus.74\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamashita A, Zhang YQ, Sanner MF et al (2020) C-terminal residues of activated protein C light chain contribute to its anticoagulant and cytoprotective activities. J Thromb Haemost 18(5): 1141\u0026ndash;1153 https://doi.10.1111/jth.14756\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWildhagen KC, Lutgens E, Loubele ST et al (2011) The structure-function relationship of activated protein C: Lessons from natural and engineered mutations. Thromb Haemost 106(12): 1034\u0026ndash;1045. https://doi.10.1160/TH11-08-0522\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStojanovski BM, Pelc LA, Enrico DC (2020) Role of the activation peptide in the mechanism of protein C activation. Sci Rep 10(1):11079. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.jbc.org/cgi/doi/\u003c/span\u003e\u003cspan address=\"https://www.jbc.org/cgi/doi/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.RA120.014789\u003c/span\u003e\u003cspan address=\"10.1074/jbc.RA120.014789\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang JT, Xing DJ, Huang W (2012) Relationship between protein folding kinetics and amino acid properties. Amino Acids 43(2):P67\u0026ndash;572. https: //doi.10.1007/s00726-011-1189-3\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamamoto K, Matsushita T, Sugiura I et al (1992) Homozygous protein C deficiency: identification of a novel missense mutation that causes impaired secretion of the mutant protein C. J Lab Clin Med 119(6):682\u0026ndash;689\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWinther-Larsen A, Kjaergaard AD, Larsen OH et al (2020) Protein C deficiency; PROC gene variants in a Danish population. Thromb Res 185:153\u0026ndash;159. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.thromres.2019.11.027\u003c/span\u003e\u003cspan address=\"10.1016/j.thromres.2019.11.027\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFisher CL, Greengard JS, Griffin JH (1994) Models of the serine protease domain of the human antithrombotic plasma factor activated protein C and its zymogen. Protein Science 3:588\u0026ndash;599. https://doi.10.1002/pro.5560030407\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"annals-of-hematology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"aohe","sideBox":"Learn more about [Annals of Hematology](http://link.springer.com/journal/277)","snPcode":"277","submissionUrl":"https://submission.nature.com/new-submission/277/3","title":"Annals of Hematology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Protein C deficiency, Novel mutation, Bioinformatics, Thrombin Generation Assay","lastPublishedDoi":"10.21203/rs.3.rs-4372666/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4372666/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study aims to preliminarily investigate the clinical characterization and molecular pathogenic basis of hereditary protein C (PC) deficiency in two independent Chinese families. The PC activity (PC:A) was tested using the chromogenic substrate, and PC antigen (PC:Ag) was detected via enzyme-linked immunosorbent assay (ELISA). To identify the mutation sites, nine exons of the \u003cem\u003ePROC\u003c/em\u003egene were amplified by PCR, and the products were directly sequenced. The conservation and pathogenicity of the mutations, as well as changes in the spatial structure of PC proteins before and after mutations, were analyzed using ClustalX-2.1-win, online bioinformatics software, and PyMOL., The function of the mutant proteins was detected using the calibrated automated thrombogram (CAT). Proband A and B, aged 39 and 63 respectively, are both diagnosed with deep vein thrombosis (DVT) in both lower limbs and pulmonary embolism (PE). Two missense mutations, p.Arg440Cys and p.Trp444Arg, were identified in the probands. Bioinformatics and protein modeling analyses revealed that the two mutations probably affected the normal function of PC. The thrombin generation assay revealed impaired thrombin generation capacity in both probands, with proband B showing more severe impairment. These two mutations may be the causes of reduced PC in two independent Chinese families. Notably, this is the first reported instance of the p.Trp444Arg mutation.\u003c/p\u003e","manuscriptTitle":"Molecular and clinical characterization of two independent Chinese families with protein C deficiency","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-04 09:59:03","doi":"10.21203/rs.3.rs-4372666/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-11-09T22:31:28+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-08T06:08:49+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"71801979419274422701888622461550884576","date":"2024-10-30T00:32:56+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-08-15T04:35:10+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"259035777525725233060102335235867358148","date":"2024-07-26T09:32:11+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"54110313214519862255956330891350809491","date":"2024-06-28T06:35:10+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-06-10T09:10:21+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-05-22T06:10:52+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-05-22T06:10:52+00:00","index":"","fulltext":""},{"type":"submitted","content":"Annals of Hematology","date":"2024-05-05T17:36:48+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"annals-of-hematology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"aohe","sideBox":"Learn more about [Annals of Hematology](http://link.springer.com/journal/277)","snPcode":"277","submissionUrl":"https://submission.nature.com/new-submission/277/3","title":"Annals of Hematology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"6e9e0d01-5988-441b-8952-7d09c0b3676c","owner":[],"postedDate":"June 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-12-30T16:00:36+00:00","versionOfRecord":{"articleIdentity":"rs-4372666","link":"https://doi.org/10.1007/s00277-024-06156-2","journal":{"identity":"annals-of-hematology","isVorOnly":false,"title":"Annals of Hematology"},"publishedOn":"2024-12-26 15:57:20","publishedOnDateReadable":"December 26th, 2024"},"versionCreatedAt":"2024-06-04 09:59:03","video":"","vorDoi":"10.1007/s00277-024-06156-2","vorDoiUrl":"https://doi.org/10.1007/s00277-024-06156-2","workflowStages":[]},"version":"v1","identity":"rs-4372666","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4372666","identity":"rs-4372666","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.