Glucose transporter 1 deficiency impairs glucose homeostasis, cell proliferation, and morphology in human embryonic kidney cells 293 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Glucose transporter 1 deficiency impairs glucose homeostasis, cell proliferation, and morphology in human embryonic kidney cells 293 Yash Mehta, Abraham Jacob Al-Ahmad This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7546700/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 25 Mar, 2026 Read the published version in Cell and Tissue Research → Version 1 posted 9 You are reading this latest preprint version Abstract Glucose represents a major source of energy for mammalian cells. In such cells, glucose uptake is facilitated by the presence of various glucose transporters (GLUTs). Amongst the different GLUT isoforms expressed in mammalian cells, GLUT1 is a major isoform expressed during development, but becomes restricted to a select number of cell types in adult cells, which includes red blood cells, brain microvascular endothelial cells, or astrocytes. GLUT1-deficiency syndrome (GLUT1DS) is an autosomal dominant neurological disease characterized by reduced cerebral glucose and lactate uptake in patients. We previously documented the impact of GLUT1DS on the glucose uptake and homeostasis in human pluripotent stem cell-derived brain microvascular endothelial cells and astrocytes. Although such cells showed similarities in terms of impaired glucose uptake, we also noticed differences in their metabolic adaptation to such impairment. This study aims to assess the impact of GLUT1DS on non-cerebral cells by investigating the impact of impaired GLUT1 in GLUT1-deficient human embryonic kidney cells (GLUT1DS-HEK293). Our results suggest that GLUT1DS-HEK293 cells were viable but displayed altered cell doubling and cell morphology, reduced glucose uptake and consumption (with no apparent compensation by other GLUT isoforms), while accompanied by a severe reduction in cell glycolytic activity and a marked deficit in ATP production. Taken together, our study demonstrates that the impairment of GLUT1 activity in human cells shares common phenotypic outcomes between various cell types but also displays unique cellular responses when it comes to metabolic adaptation to energy deficit, partially explaining the impact on tissues in GLUT1DS patients. Glucose HEK293 glycolysis GLUT1 Deficiency Syndrome Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Glucose represents a major source of energy for mammalian cells. Due to its nature, the entrance of glucose inside mammalian cells is dependent on the presence of cognate glucose transporters on the cell surface. In mammals, two types of glucose transporters have been identified: the sodium-dependent glucose transporters (SGLTs) and sodium-independent facilitated glucose transporters (GLUTs) (Deng and Yan, 2016 , Mueckler and Thorens, 2013 , Navale and Paranjape, 2016 ). GLUTs (encoded by SLC2A genes in humans) are found as 14 different isoforms in humans (Holman, 2020 ). Although their primary substrate is glucose, such isoforms may also transport other hexoses, including fructose (GLUT1, GLUT2, GLUT3, GLUT5, GLUT7, GLUT8 and GLUT10), galactose (GLUT1, GLUT2, GLUT3, GLUT8 and GLUT10), mannose (GLUT1, GLUT2, GLUT3 and GLUT8) or xylose (GLUT3). However, amongst these GLUTs, GLUT1 (and accessory GLUT3) displays the GLUT isoform with the highest affinity towards glucose. GLUT1 expression is predominant in human embryonic stem cells during development, while its expression in adult tissues appears more restricted and is highly expressed in the placenta and endometrium, skin, bone marrow, GI tract, and the brain. Glucose supply to the brain is crucial for its energetic homeostasis, yet it is highly tributary on the presence of a functional GLUT1 at the blood-brain barrier (BBB, a component of the neurovascular unit), resulting in a rate-limiting factor that can have a deleterious effect on the brain homeostasis if such transporter is impaired (Bak, et al., 2006 , Dienel, 2019 , Koepsell, 2020 , Vannucci, et al., 1998 ). GLUT1 Deficiency Syndrome (GLUT1DS) is an autosomal dominant brain metabolic disorder (Seidner, et al., 1998 ) characterized by the presence of mutations in the SLC2A1 gene (Gras, et al., 2014 , Kolic, et al., 2021 , Leen, et al., 2010 , Mauri, et al., 2022 , Varesio, et al., 2019 ). Approximately 90% of GLUT1DS cases result from a de novo heterozygous mutation in the SLC2A1 gene, while the remaining 10% of cases are inherited from a parent (Pearson, et al., 2013 , Zhang, et al., 2025 ). GLUT1DS patients commonly display early onset of epilepsy, movement disorder, and intellectual disability, which display a spectrum in the phenotype depending on the type of mutations harbored by patients. We previously demonstrated that the presence of a mutated GLUT1 transporter at the BBB, has a significant detrimental effect on glucose uptake and glycolytic activity in brain microvascular endothelial cells (Pervaiz, et al., 2022 ) and astrocytes (Pervaiz, et al., 2025 ) (two cell types belonging to the BBB) in vitro. Yet, these cells displayed notable differences in terms of maintaining their energetic homeostasis despite having GLUT1 as their main GLUT isoform, raising the need to understand the rationale behind such differences. In this study, we investigated the impact of GLUT1 impairment on glucose homeostasis and metabolism in a non-BBB cell type, using the human embryonic kidney cell HEK293 (Simmons, 1990 ), by generating a GLUT1DS model of such a cell type. In such cells, GLUT1 represents the most prevalent high-affinity GLUT isoform (Kahlig, et al., 2024 ), making it convenient to address how an impaired GLUT1 impacts glucose metabolism and homeostasis in a non-cerebral cell type. Materials and Methods Cell culture The wild-type HEK293 (WT, E0 clone) (RRID: CVCL_0045) and the GLUT1DS-HEK293 clone (GLUT1DS, E11 clone) were purchased from Ubigene Biosciences (Austin, Texas). These cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco™, ThermoFisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum (FBS, Gibco™, ThermoFisher) and 1% antibiotic-antimycotic solution (100X, Gibco™, ThermoFisher). Gene editing A deletion of 101 base pairs (bp) was identified in the exon 3 region of the SLC2A1 gene in GLUT1DS-HEK293 clone. The cells' genotype was confirmed by Ubigene Biosciences (Austin, Texas) to be a complete knockout of both alleles through Sanger sequencing. Quantitative real-time PCR Cells were washed twice with ice-cold PBS, and total RNA from both clones was extracted using the Direct-zol RNA Miniprep Plus Kit (Zymo Research, Irvine, CA, United States) according to the manufacturer’s protocol. RNA concentration and quality were determined using a Nanodrop® 2000 spectrophotometer (ThermoFisher Scientific, Waltham, MA). Complementary DNA (cDNA) was synthesized from 1µg of RNA using Maxima® first-strand cDNA synthesis kit (ThermoFisher Scientific, Waltham, MA) in accordance with the manufacturer’s protocol. Quantitative PCR (qPCR) reactions were performed using the Bio-Rad CFX96 real-time PCR system (Bio-Rad Laboratories, Hercules, CA). Powertrack® SYBR green master mix (ThermoFisher Scientific, Waltham, MA) was utilized to measure mRNA expression levels using primers (see Table 1 ) The PCR program included an initial step at 95°C for 2 min followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. In each run, templates were assayed in triplicate, and the run was repeated at least three times. Table 1 Specific primer sequence Gene Primer Sequence SLC2A1 Forward 5' CATGGGCTTCTCGAAACTGG Reverse 5' GTACACACCGATGAAGCG SLC2A2 Forward 5' TACATTGCGGACTTCTGTGG Reverse 5' AGACTTTCCTTTGGTTTCTGG SLC2A3 Forward 5' CAGCGAGACCCAGAGATG Reverse 5' TTGGAAAGAGCCGATTGTAG SLC2A4 Forward 5' CTGGGCCTCACAGTGCTAC Reverse 5' GTCAGGGCGCTTCAGACTCTT ACTB Forward 5' CTCTTCCAGCCTTCCTTCCTG Reverse 5' CAGCACTGTGTTGGCGTACAG Western blot analysis Western blot analysis Cells were subjected to two washes with ice-cold phosphate-buffered saline (PBS), followed by homogenization with RIPA buffer (ThermoFisher Scientific, Waltham, MA). The resulting lysates were centrifuged at 13000 g for 12 mins at 4° C to remove insoluble debris, and the supernatant was used for protein quantification using the Pierce™ BCA protein assay kit (ThermoFisher Scientific, Waltham, MA). Samples were prepared for SDS-polyacrylamide gel electrophoresis (PAGE) by mixing with 2x SDS loading buffer (Bio Rad Laboratories, Hercules, CA) and β-mercaptoethanol (Sigma-Aldrich, Burlington, MA), and heating at 95°C for 5 minutes. Equal amounts of protein (5 µg/lane) were loaded onto a 10% SDS-PAGE gel and transferred to a polyvinylidene fluoride (PVDF) membrane. Following membrane transfer, blocking was conducted for 2 h in Tris-buffered saline (TBS, Bio-Rad Laboratories, Hercules, CA) containing 0.1% Tween-20 (Sigma-Aldrich, Burlington, MA) and 5% non-fat dry milk. The membranes were then incubated with appropriate primary antibodies: GLUT1 (SA0377 clone, RRID: AB_2809254, 1:2000, ThermoFisher Scientific) and β-actin (BA3R Clone, RRID: AB_2617163, 1:500, ThermoFisher Scientific, Waltham, MA) for 2 h at 4°C, followed by incubation with goat anti-rabbit (RRID: AB_2536530, 1:5000, ThermoFisher Scientific, Waltham, MA) or goat anti-mouse (RRID: AB_2536527, 1:2000 ThermoFisher Scientific, Waltham, MA) HRP-conjugated antibodies. Protein bands were visualized using the Super Signal WestPico Plus ECL (ThermoFisher Scientific, Waltham, MA) and blots were quantified using ImageJ (NIH). Flow cytometry Cells were collected and washed using ice-cold PBS containing 1% Bovine Serum Albumin (BSA, Sigma-Aldrich, Burlington, MA) at 1200 rpm for 5 minutes. Cells were fixed and later permeabilized using FIX & PERM™ Cell Permeabilization Kit (ThermoFisher Scientific, Waltham, MA) according to the manufacturer’s instructions. Cells were then incubated overnight in the presence of primary antibodies against GLUT1 C-Terminal (SA0377 clone, RRID: AB_2809254, 1:100, ThermoFisher Scientific), GLUT1 N-Terminal (RRID: AB_2302087, 1:100, ThermoFisher Scientific), GLUT2 (2V2U2 clone, RRID: AB_2849067, 1:100, ThermoFisher Scientific), GLUT3 (RRID: AB_2191428, 1:100, ThermoFisher Scientific), and GLUT4 (RRID: AB_11153908, 1:100, ThermoFisher Scientific) and IgG isotype controls at the same concentrations. Cells were washed with ice-cold PBS containing 1% BSA and incubated with Alexa Fluor© 488 conjugated goat anti-rabbit (RRID: AB_2925776, 1:200, ThermoFisher Scientific) for 1 hour at room temperature. At least 10,000 events were acquired for each sample using a FACSVerse system (BD Biosciences, San Jose, CA). Relative expression was obtained by subtracting the geometric mean fluorescence index (MFI) from samples versus the MFI from the IgG isotype control. To determine 2-( N -(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) uptake, cells were first washed with ice-cold PBS. 1 x 10 6 cells were incubated with 100 µM 2-NBDG in glucose-free DMEM (Gibco™, ThermoFisher Scientific, Waltham, MA) at 37° C. The Same number of cells were also incubated in glucose-free DMEM without 2-NBDG as a negative control. Cells were then washed with ice-cold PBS at 1200 rpm for 5 minutes and finally resuspended in ice-cold PBS. The fluorescence of samples and negative control was analyzed using a FACSVerse flow cytometer at an excitation wavelength of 488 nm and a 530/30 nm emission collector bandpass filter. Relative MFI was obtained by subtracting the geometric mean fluorescence index (MFI) from samples versus the MFI from the negative control. Immunocytochemistry Cells were washed with ice-cold PBS and fixed with 4% paraformaldehyde (PFA, Electron Microscopy Sciences, Hatfield, PA, USA). The cells were subsequently blocked with PBS containing 10% goat serum (ThermoFisher Scientific, Waltham, MA) (PBSG) supplemented with 0.1% Tween 20 (Sigma-Aldrich, Burlington, MA) at room temperature for 20 minutes. Following blocking, cells were incubated overnight with primary antibodies targeting GLUT1 C-Terminal (SA0377 clone, RRID: AB_2809254, 1:100, ThermoFisher Scientific), GLUT1 N-Terminal (RRID: AB_2302087, 1:100, ThermoFisher Scientific), GLUT2 (2V2U2 clone, RRID: AB_2849067, 1:100, ThermoFisher Scientific), GLUT3 (RRID: AB_2191428, 1:100, ThermoFisher Scientific), and GLUT4 (RRID: AB_11153908, 1:100, ThermoFisher Scientific)at 4° C. The cells were washed with ice cold PBS and incubated for 1 hour with Alexa Fluor© 488 conjugated goat anti-rabbit (RRID: AB_2925776, 1:200, ThermoFisher Scientific) at room temperature. For visualization, nuclei were counterstained with DAPI (ThermoFisher Scientific, Waltham, MA). The cells were imaged using a Leica Stellaris 8 Falcon STED Super-resolution confocal microscope at 100x magnification, and images were acquired using Leica Application Suite X. 14 C-labeled glucose uptake assays On the day of the experiment, cell culture medium was replaced with fresh medium supplemented with 14 C-D-Glucose (0.4 µCi/ml, PerkinElmer, Waltham, MA) and incubated for 1 hour at 37° C. After incubation, cells were washed with ice-cold PBS and homogenized with 100 µl RIPA buffer. A 90 µl aliquot of cell lysate was mixed with 3 ml of ScintiSafe® Econo F Cocktail (ThermoFisher Scientific, Waltham, MA) to measure radioactivity in the cells. Radioactivity was quantified using a Backman-Coulter LS6500 (Beckman Coulter, Bria, CA). For protein quantitation, 5 µl of the remaining cell lysate was analyzed using Pierce™ BCA protein assay kit with Synergy H1 microplate reader (Bio-Tek, Winooski, VT) at 562 nm. Glucose uptake was normalized to total protein and expressed as µg glucose/mg total protein. Extracellular Glucose and L-Lactate Quantitation Cells were seeded at a density of 1*10 6 cells/well in a 6-well plate and cultured in DMEM medium containing 1g/L D-glucose for 24 hours. Following the incubation, cell culture media were collected to observe extracellular D-glucose and L-lactate levels. D-glucose levels were assessed using Amplex® Red Glucose/Glucose Oxidase Assay Kit (Life Technologies, Carlsbad, CA). At the same time, L-lactate concentrations were determined using PicoProbe™ Lactate Fluorometric Assay Kit (BioVision, Milpitas, CA), according to the manufacturer’s protocol. Absorbance was measured at 560 nm for D-glucose and 570 nm for L-lactate quantitation using a Synergy H1 microplate reader (Bio-Tek, Winooski, VT). D-glucose and L-lactose concentrations in the extracellular medium were normalized to total protein and reported as mM/µg protein and nM/µg protein, respectively. Seahorse extracellular flux analyzer Glycolytic flux was evaluated using a Seahorse© XFe24 cell flux analyzer (Agilent Technologies, Santa Clara, CA). Cells were seeded in XFe cell culture microplates (Agilent Technologies, Santa Clara, CA) at a density of 6*10 4 cells/well. One hour prior to the experiment, cells were incubated with an assay medium comprising XF Base Medium, supplemented with 2 mM L-glutamine (pH adjusted to 7.4) in a CO 2− free incubator. Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using a Seahorse© XFe24 flux analyzer according to the manufacturer’s protocol. The ECAR and OCR measurements were initiated without the addition of glucose or pyruvate in the glycolytic stress test medium. After 20 minutes of incubation, 10 mM D-glucose was introduced into the chamber, followed by the addition of 1 µM oligomycin at 40 minutes, and 100 mM 2-deoxy-D-glucose (2-DG) at the 60-minute mark. The seahorse© wave software which is equipped with XF glycolytic stress test report generator was used to calculate glycolytic flux parameters generated during the assay. Following the experiment, cells were lysed with RIPA buffer and protein content was quantified using a BCA assay. ECAR and OCR values were normalized to the protein concentration of each well. Mitochondrial functions were evaluated using a Seahorse© XFe24 cell flux analyzer in conjunction with XF cell mito stress test kit (Agilent Technologies, Santa Clara, CA). Cells were incubated with an assay medium comprising XF Base Medium, supplemented with 1 mM pyruvate, 2 mM L-glutamine, and 10 mM glucose (pH adjusted to 7.4) in a CO 2− free incubator. OCR and ECAR were measured using a Seahorse© XFe24 flux analyzer according to the manufacturer’s protocol. 1.5 µM Oligomycin, 0.5 µM carbonyl cyanide p-trifluoromethoxy phenylhydrazone (FCCP), and 0.5 µM rotenone/antimycin A solutions were prepared, and standard mix/wait/measure cycles were applied. The seahorse© wave software, which is equipped with the XF Mitostress© test report generator, was used to calculate the mitochondrial respiration parameters generated during the assay. Following the experiment, cells were lysed with RIPA buffer, and protein content was quantified using a BCA assay. ECAR and OCR values were normalized to the protein concentration of each well. ATP rate assay was performed using a Seahorse© XFe24 cell flux analyzer coupled with XF real-time ATP rate assay kit (Agilent Technologies, Santa Clara, CA). One hour before the experiment, cells were incubated with an assay medium comprising XF Base Medium, supplemented with 1 mM pyruvate, 2 mM L-glutamine, and 10 mM glucose (pH adjusted to 7.4) in a CO 2− free incubator. OCR and ECAR were measured using a Seahorse© XFe24 flux analyzer according to the manufacturer’s protocol. 1.5 µM Oligomycin and 0.5 µM rotenone/antimycin A solutions were prepared, and standard mix/wait/measure cycles were applied. The Seahorse Wave© software, which is equipped with an XF real-time ATP rate assay report generator was used to calculate parameters generated during the assay. Following the experiment, cells were lysed with RIPA buffer, and protein content was quantified using a BCA assay. ECAR and OCR values were normalized to the protein concentration of each well. Glucose 6 phosphate dehydrogenase activity (G6PD) assay Cells were seeded at a density of 2*10 6 cells/well in a 6-well plate and cultured in DMEM medium containing 1g/L D-glucose for 48 hours. Following the incubation, cells were lysed with RIPA buffer, and protein content was quantified using a BCA assay. To measure G6PD activity, the G6PD Activity Assay Kit (Novus Biologicals, Centennial, CO) was used according to the manufacturer’s protocol. Absorbance at 450 nm, corresponding to the formation of orange formazan, was recorded using a Synergy H1 microplate reader (BioTek, Winooski, VT). Formazan generated in the reaction system is proportional to the activity of the G6PD enzyme in the sample. The activity of the G6PD enzyme was reported as U/L per µg of total protein. Live cell imaging Cells were seeded at a density of 5*10 3 cells/well in a 6-well plate. Imaging was performed using a LiveCyte kinetic cytometer (Phasefocus, Sheffield, UK) equipped with ptychographic quantitative phase imaging (QPI). Morphological and behavioral analysis of individual cells was carried out every 18 mins over a 72-hour period at 10x magnification, with 4 fields of view per well. The imaging chamber was maintained at 37° C with 5% CO 2 throughout the experiment. Mitochondrial staining Cells were seeded at 1*10 4 cells/well in a 6-well plate and incubated with 1 mL of 500 nM MitoSOX™ Red and 1 mL of 1 µM MitoSOX™ Green (ThermoFisher Scientific, Waltham, MA) for 30 minutes at 37° C and 5% CO 2 . Cells were then washed 3-times with PBS. Live cell imaging was performed for cells stained with MitoSOX™ Red using a Leica Stellaris 8 Falcon STED Super-resolution confocal microscope at 100x magnification using the Leica Application Suite X, whereas at least 10,000 events were acquired for each sample that underwent MitoSOX™ Green fluorogenic dye using a FACSVerse system (BD Biosciences, San Jose, CA). Relative MFI was obtained by subtracting the geometric mean fluorescence index (MFI) from stained samples from the MFI from the unstained samples. Statistical analysis Data are represented as mean ± SD from a minimum of three independent biological replicates. Comparisons between wild-type and GLUT1DS cells were performed using a two-tailed Student’s t-test. All statistical analysis was carried out using Prism 10.0 software (GraphPad Software, La Jolla, CA) was used to perform statistical analysis. A p -value less than ( p < 0.05) was considered to indicate statistical significance. Results Generation of the GLUT1DS clone Our first step was to generate a HEK293 clone as a model for GLUT1DS (GLUT1DS) to assess the impact of GLUT1 deficiency on non-cerebral cells. In our iPSC model of GLUT1DS (Pervaiz, Mehta and Al-Ahmad, 2025 , Pervaiz, Zahra, Mikelis and Al-Ahmad, 2022 ), we generated GLUT1DS clones with frameshift mutations resulting in the introduction of a STOP codon within their 4th transmembrane domain. To our surprise, such clones were showing a reduced, but not a complete, reduction in glucose uptake. Such observation let us speculate that the 4th transmembrane domain (which plays an important role in the glucose transport through the pore) may be essential in the maintenance of a residual activity of the glucose transporter. For the generation of this clone, we aimed to introduce the STOP codon before such domain, by inserting a whole deletion of 101 nucleotides (543_644del, Fig. 1 A), which resulted in the introduction of a frameshift mutation resulting in the introduction of two nonsense mutations after Val108 ( of a STOP codon by the amino-acid 110 (Fig. 1 B). Using the UniProtKB/Swiss-Prot database and the X-ray crystal structure of human GLUT1 (Deng, et al., 2014 ), we assessed the impact of such a mutation on the expected outcome on GLUT1 conformation (Fig. 1 C). Based on such a crystallographic structure, we can anticipate that our GLUT1DS clone will result in a truncated protein product with a mostly complete 3rd transmembrane domain, with a truncation occurring before the 4th transmembrane domain. Validation of the GLUT1DS HEK293 clone Next, we validated the truncation of the full-length GLUT1 from the GLUT1DS HEK293 clone (Fig. 2 ). Firstly, changes in SLC2A1 mRNA were assessed by qPCR using primers targeting exon sequences outside and inside the deleted region (Fig. 2 A). Interestingly, SLC2A1 mRNA levels were reduced (a ~ 35% decrease) in the GLUT1DS clone compared to its wild-type (WT). Such a decrease was comparable to values reported in iPSC-derived GLUT1DS astrocyte-like (iAstros) and brain endothelial cell-like cells (iBMECs). We also confirmed that the deletion of the sequence in the SLC2A1 gene in the GLUT1DS clone was total, as we reported no amplification of mRNA products containing the excised sequence. To confirm the absence of full-length GLUT1 protein products, we performed experiments using immunofluorescence and Western blots (Fig. 2 B&C). Using antibodies raised against two distinct epitopes (one targeting the C-terminal intracellular domain of the full-length GLUT1, the second targeting the N-terminal region), we observed the absence of immunopositivity in the GLUT1DS clone (Fig. 2 B) for the C-terminal epitope. On the other hand, there were unremarkable differences between wild-type and the GLUT1DS clone when stained against the N-terminal region. As a confirmatory step, a semi-quantitative analysis by Western blot (Fig. 2 C) showed the absence of an immunoreactive band at 55kDa (expected GLUT1 apparent molecular weight), consistent with our iPSC-derived GLUT1DS-iAstros and iBMECs (Pervaiz, Mehta and Al-Ahmad, 2025 , Pervaiz, Zahra, Mikelis and Al-Ahmad, 2022 ). Finally, we confirmed the absence of a full-length GLUT1 + population in our GLUT1DS clone by flow cytometry (Fig. 2 D&E). As expected, no GLUT1 + population was detected in the GLUT1DS clone using the same antibody targeting GLUT1 in its C-terminal region, while no differences in terms of GLUT1 + population and GLUT1 expression were observed between the wild-type and GLUT1DS clone when the antibody targeting the N-terminal region was used. Taken together, our data suggest that the GLUT1DS clone is homogeneous with the majority of the cell population harboring a truncated GLUT1 protein product, validating our mutant construct as a cellular model for GLUT1DS. GLUT1DS clone displays hypometabolism, reduced glucose uptake, glucose usage, and L-lactate production Following the validation of our model, we investigated the impact of GLUT1 truncation in HEK293 cells by assessing changes in glucose uptake and metabolism in general (Fig. 3 ). Firstly, we assessed changes in overall cell metabolism using the MTS assay (Fig. 3 A) GLUT1DS clone showed over a 50% decrease in cell metabolic activity compared to their control clone (43.89±2.05 versus 100±9.77% respectively), indicative of a hypometabolism in such clone compared to its parental control. To better understand how such hypometabolism was linked to changes in glucose metabolism, we performed a series of experiments assessing glucose uptake in HEK293 cells (Fig. 3 B&C). Notably, when compared to the undifferentiated iPSC line (iPS(IMR90)-c4) used to generate the GLUT1DS clones, the net glucose uptake (using 14 C-D-glucose, Fig. 3 B) in wild-type HEK293 cells (WT) was much lower, with an average value of 39.14±0.97 µg/mg protein (versus 249.7±61.44 µg/mg protein). GLUT1DS clone showed a further reduction in glucose uptake by about 30% compared to wild-type, with a value of 26.83±1.38 µg/mg. A similar outcome was observed when 2-NBDG (Fig. 4 C) was used, as we reported an average value of 20064±2429 RFU in wild-type, with an average value of 11158±423.5 RFU in the GLUT1DS clone. In complement to changes in glucose uptake, we investigated changes in the extracellular glucose and L-lactate concentrations as proxies of glucose metabolism in those cells, by measuring concentrations following incubation in fresh medium (5.5mM glucose) for 24 hours (Fig. 3 D&E). Wild-type HEK293 showed a noticeable glucose consumption over this period of time, with an average of 1.67±0.03 mM/µg protein. Such concentration was in par with concentrations measured in iAstros conditioned medium (Pervaiz, Mehta and Al-Ahmad, 2025 ), but also suggests that HEK293 cells are less metabolically active when normalized to the initial glucose concentration in the medium (~ 25mM). On the other hand, the GLUT1DS clone barely consumed glucose, as the average concentration measured was 4.99±0.29 mM/µg protein. Furthermore, differences in extracellular L-lactate levels were more subtle, with a lower extracellular L-lactate level in conditioned medium from the GLUT1DS clone compared to wild-type (183.7±12.84 nM and 219.5±17.95 nM, respectively). In conclusion, the GLUT1DS clone showed impaired glucose uptake compared to its parental wild-type clone, as impaired uptake was accompanied by a drastic reduction in glucose consumption and a reduced L-lactate production. Glucose uptake in GLUT1DS-HEK is unlikely driven by compensation from other GLUTs As GLUT1 is considered the predominant GLUT isoform expressed at the blood-brain barrier in both astrocytes and brain microvascular endothelial cells (Asano, et al., 1991 , Cornford, et al., 1994 , Maher, et al., 1993 ), we speculated that the residual glucose uptake activity measured in our GLUT1DS model was indicative of a reduced, but still functional, GLUT1 transporter activity in such cells. However, Pistek and colleagues (Pistek, et al., 2023 ), documented the expression of several GLUT isoforms in HEK293 cells. HEK293 cells express a variety of GLUT isoforms at mRNA levels. However, SLC2A1 is reported as the most abundant SLC2 isoform (followed by SLC2A8 and SLC2A3 in terms of abundance), and at least 5-fold higher expression amongst the different Class I (glucose-selective GLUTs, in contrast to the other GLUTs capable of transporting both glucose and fructose), such as SLC2A2 , SLC2A3 , and SLC2A4 . Therefore, we investigated changes in Class I GLUT isoforms in our HEK-GLUT1DS clone at mRNA and protein levels to rule out any compensation by other GLUT isoforms (Fig. 4 ). Notably, we reported a significant decrease in SLC2A1 and SLC2A4 at the mRNA level in the HEK-GLUT1DS clone compared to its wild-type control (Fig. 4 A), while we noted a significant increase in SLC2A3 . To confirm that such changes at mRNA levels were accompanied by changes at protein levels, we performed immunocytochemistry and flow cytometry experiments (Fig. 4 B&C). With the exception of GLUT1, other Class I GLUT isoforms (GLUT2, GLUT3, and GLUT4) showed no noticeable qualitative differences in immunoreactivity between wild-type and the HEK-GLUT1DS clone. Such unremarkable differences were further confirmed by flow cytometry (Fig. 4 C) Except GLUT1 (in which no fluorescence was detected over the IgG isotype control), no differences in GLUT expression were reported between wild-type and HEK-GLUT1DS clone. In conclusion, our data suggests that the reduced glucose uptake in our HEK-GLUT1DS clone was unlikely compensated by changes in protein expression of other Class I GLUT isoforms. GLUT1DS clone impaired glucose metabolism is accompanied by a glycolysis collapse and mitochondrial distress To better understand the impact of GLUT1 truncation (and its reduced cellular glucose uptake and metabolism) on HEK293 glucose metabolism profile, we performed a series of experiments assessing changes in glycolysis and mitochondrial respiration, using the Seahorse© cell flux analyzer (Fig. 5 ). A preliminary analysis of the cell energetic profile under basal conditions (Fig. 5 A) suggests that HEK293 cells harbor an energetic profile marked by a mixture of both glycolysis and mitochondrial respiration (oxidative phosphorylation), marked by a high extracellular acidification rate (ECAR) and oxygen consumption rate (OCR). However, our GLUT1DS clone showed a “quiescent” phenotype, marked by low ECAR and OCR values. Next, we assessed changes in glycolysis (Fig. 5 B&C). The GLUT1DS clone responded to glycolytic stimulus (Fig. 5 B) was blunted and failed to compensate following blockade of mitochondrial activity with oligomycin treatment. A more detailed analysis of several glycolytic parameters (Fig. 5 C) showed a complete collapse of glycolysis in the GLUT1DS clone. To better understand if our GLUT1DS clone compensated its energy need by compensating with mitochondrial respiration, we performed a series of experiments using the Mitostress© kit (Fig. 5 D&E). GLUT1DS cells showed a 50% reduction in the basal respiration (BASAL) compared to their wild-type (WT) counterpart, as well as their ATP production (ATP). The highest decrease reported for the maximal mitochondrial respiration (MAX) with an 85% decrease in values observed in the GLUT1DS clone compared to wild-type, as well as a virtually zero spare capacity (CAP). Surprisingly, we noted no difference when it comes to proton leak (LEAK) and non-mitochondrial oxygen consumption (NONMITO). This impaired mitochondrial activity in GLUT1DS was further confirmed by the observation of reduced radical oxygen species (ROS) production in GLUT1DS cells compared to WT (Fig. 5 F) using MitoSOX, as we noted a 50% decrease. Finally, we determined the impact of such impaired energetic metabolism on the ATP production, using the ATP rate assay (Fig. 5 G). Notably, HEK293 heavily relies on glycolysis (~ 75% total ATP) to fulfill its energy needs. GLUT1DS showed a 60% decrease in total ATP production compared to their wild-type, although the ratio between glycolytic (glycoATP) versus non-glycolytic (mitoATP) remained about the same. To understand how glucose is utilized upon entering the GLUT1Ds clone, we performed a glucose-6-phosphate dehydrogenase (G6PD) activity assay (Fig. 5 H). GLUT1DS showed a significant increase in G6PD activity compared to wild-type, with an increase of ~ 23% (36.08±0.82 U/L/µg protein versus 46.65±1.07 U/L/µg protein). To summarize, our data indicate that the GLUT1 truncation has a significant effect on HEK293 energy metabolism, with a critical effect on glucose metabolism by impacting both glycolysis and oxidative phosphorylation while enhancing the reliance on the pentose phosphate pathway (PPP). GLUT1DS-HEK293 clone has decreased cell growth and impaired cell morphology Finally, we assessed changes in HEK293 phenotype by assessing changes in cell morphology and proliferation, using the LiveCyte® live cell imaging system (Fig. 6 ). No differences in gross morphology was observed between wild-type and GLUT1DS HEK293 cells (Fig. 6 A). However, a more detailed morphological analysis obtained from a 72-hour recording using the LiveCyte® (Fig. 6 B) indicates that GLUT1DS doubling time was increased by 40% (47.58±2.63 versus 33.46± hours) compared to wild-type, with similar outcomes when accounting for dry mass doubling time. GLUT1DS also displayed a 26% increase (3.20 ± 0.05 versus 2.53 ± 0.12 µm) in cell thickness and a 13% increase (0.50 ± 0.003 versus 0.44 ± 0.012 µm) in cell sphericity. On the other hand, GLUT1DS cells showed a 15% decrease (5.20±0.07 versus 6.15±0.05nm/sec) in instantaneous velocity (Fig. 3 D) compared to wild-type. In conclusion, these results suggest that GLUT1DS show subtle but significant alterations in their morphology and motility, which suggests a sign of cellular distress. Discussion Glucose constitutes the major source of energy for mammalian cells, with certain organs and tissues, such as the central nervous system (CNS), highly dependent on its steady supply. The cellular entry of glucose inside the CNS is solely facilitated by the glucose transporter 1 (GLUT1) isoform, a GLUT isoform highly expressed at the blood-brain barrier (BBB). Impairment of GLUT1 activity at the BBB is well-documented to be associated with GLUT1 Deficiency Syndrome (GLUT1DS, an autosomal dominant disease associated with mutations in the SLC2A1 gene). In our previous studies (Pervaiz, Mehta and Al-Ahmad, 2025 , Pervaiz, Zahra, Mikelis and Al-Ahmad, 2022 ), we have developed an in vitro model of GLUT1DS using human induced pluripotent stem cells (iPSCs) that were differentiated into astrocyte-like (iAstros) and brain endothelial cell-like (iBMECs) cells. Although these cells shared a similar phenotype when it came to differentiation and reduced glucose uptake, they also displayed notable differences in terms of energetic profile, in particular when it comes to glycolysis and mitochondrial respiration. Furthermore, the presence of a residual, but significant, glucose uptake in those cells either undifferentiated or differentiated raised the question about the ability of GLUT1 to function solely with four transmembrane domains. The goal of this study was a continuation of such previous studies performed by our group and to provide the impact of GLUT1 truncation in HEK293 cells, a non-cerebral cell type that is also a versatile model for transfection and protein expression studies (Simmons, 1990 ). Interestingly, the GLUT1DS HEK293 clone displayed a 40% decrease in SLC2A1 gene expression at the mRNA level (using a primer targeting the exon 5) compared to its parental wild-type clone. Although a similar observation was done in our GLUT1DS-iAstros and GLUT1DS-iBMECs (Pervaiz, Mehta and Al-Ahmad, 2025 , Pervaiz, Zahra, Mikelis and Al-Ahmad, 2022 ), the extent of such a decrease was much less than the decrease (~ 90% decrease) observed in our differentiated cells. A possible explanation to such difference could be explained by the nature of astrocytes and brain endothelial cells, in which GLUT1 is the most prominent GLUT isoform expressed by these cell types, about 10-fold higher than HEK293 cells (Mehta, et al., 2025 ). We cannot exclude that epigenetic differences may occur between cell types when it comes to GLUT1 expression at mRNA and/or protein levels, which may impact on its own gene regulation. The other interesting aspect noticed in our study is the actual reduction in glucose uptake between the wild-type and the GLUT1DS clone. We reported a 40% decrease in our GLUT1DS HEK293 clone, which is aligning with the values reported in our iAstros and iBMECs (~ 50% decrease). This allows to speculate that the presence of a 4th transmembrane domain may not be necessary for the maintenance of a residual activity as our GLUT1DS HEK clone (which lacks such 4th transmembrane domain) showed no aggravation in glucose uptake. However, we cannot exclude that some compensatory mechanisms involving other GLUT isoforms (including Class II and Class III isoforms) maybe tempering such observation. Therefore, providing an absolute quantification (e.g. using an LC-MS analytical approach) of GLUT isoforms expression in HEK293 cells (and by extension to any cell types) would help distinguish such subtleties by addressing the presence or the absence of compensation between GLUTs. Interestingly, we also noted notable differences in normalized glucose uptake between the radiolabelled 14 C-D-glucose and its fluorescent counterpart the 2-NBDG, with the latter showing a more accentuated decrease in the GLUT1DS clone. We cannot exclude differences inherent to the data normalization; however we are also possibly observing differences in affinity of GLUT1 towards these two markers as reported by Hamilton and colleagues on L929 fibroblasts (Hamilton, et al., 2021 ). Finally, the major finding in this study is the complete collapse in glycolysis (and in a lesser extent in mitochondrial respiration) in the GLUT1DS HEK293 cells. Such cells showed lower ECAR values under resting conditions compared to their wild-type. More importantly, these cells failed to increase their ECAR value following the addition of glucose in the incubation medium and failed to direct their ATP production exclusively through glycolysis when incubated in the presence of oligomycin. Such impairment was visible in the calculated glycolytic parameters obtained from such experiments, in which E11 cells showed a complete collapse of such value. By contrast, although the glycolysis was impaired in our GLUT1DS-iBMECs (Pervaiz, Zahra, Mikelis and Al-Ahmad, 2022 ), it never reached such intensity. The complete shutdown of glycolysis was accompanied by the subsequent adoption of the pentose phosphate pathway (PPP) in the GLUT1DS clone. This metabolic shift is evidenced by the increased G6PD activity, suggesting that the GLUT1DS clone may rely on the PPP to counter the glucose deprivation-mediated oxidative stress. Studies have shown that inhibiting glycolysis can redirect metabolic flux toward the oxidative branch of the pentose phosphate pathway (oxPPP), particularly under oxidative stress conditions (Britt, et al., 2022 , Stincone, et al., 2015 ). Furthermore, the upregulation of the PPP is supported by the observed reduction in mitochondrial ROS production in GLUT1DS cells. As the PPP serves as a major source of cytosolic NADPH, this shift likely helps in mitigating oxidative damage and supporting bioenergetic needs. These findings highlight the metabolic plasticity of HEK293 cells in response to GLUT1 deficiency and suggest a critical role for the PPP in maintaining redox balance under conditions of impaired glucose uptake. Further research is required to fully elucidate the regulatory mechanisms governing this shift and its broader implications for cellular energy metabolism. This differential behavior between GLUT1DS-iBMECs (which maintains a partial or almost full-length 4th transmembrane domain) and GLUT1DS-HEK293 cells (which lacks completely such 4th transmembrane domain) further suggests the importance of such domain in the maintenance of residual activity, as such domain plays an important function in the glucose transport activity (Deng, Xu, Sun, Wu, Yan, Hu and Yan, 2014, Kapoor, et al., 2016 ). In addition, our findings suggest that the use of the cell flux analyzer (such as used in the Seahorse® glycolytic stress test) may be an adequate surrogate marker to assess the impact of genetic alteration of GLUT1 on the effective impact on glucose metabolism. Our next goal is to perform rescue experiments by transfecting our GLUT1DS-HEK293 cells with plasmids encoding for a full-length wild-type GLUT1 and documenting changes in glycolysis. In conclusion, this study provides a characterization and validation of a GLUT1DS-HEK293 platform that lacks a functional GLUT1 transporter and exhibits impaired glucose metabolism, providing a potential screening platform for genotype-phenotype association studies focusing on GLUT1, which eventually will provide a potent tool to better understand how documented mutations associated with GLUT1DS impact the activity of GLUT1 transporter. Declarations Acknowledgments and funding The authors would like to acknowledge the Jerry H. Hodge School of Pharmacy (JHH-SOP) Office of Sciences for granting access to their confocal and flow cytometry core facilities. This study was funded by a JHH-SOP Office of Sciences seed grant to AJA. Ethics approval and consent to participate. Not applicable. Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Competing Interests The authors have no competing interests to disclose. Authors’ contributions AJA designed the study, performed the data analysis, and wrote the manuscript. YM performed the experiments, collected and processed the results, and contributed to the data analysis and manuscript writing References Asano T, Katagiri H, Takata K, Lin JL, Ishihara H, Inukai K, Tsukuda K, Kikuchi M, Hirano H, Yazaki Y, et al. (1991) The role of N-glycosylation of GLUT1 for glucose transport activity. J Biol Chem 266:24632-24636 Bak LK, Schousboe A, Sonnewald U, Waagepetersen HS (2006) Glucose is necessary to maintain neurotransmitter homeostasis during synaptic activity in cultured glutamatergic neurons. J Cereb Blood Flow Metab 26:1285-1297 Britt EC, Lika J, Giese MA, Schoen TJ, Seim GL, Huang Z, Lee PY, Huttenlocher A, Fan J (2022) Switching to the cyclic pentose phosphate pathway powers the oxidative burst in activated neutrophils. Nature metabolism 4:389-403 Cornford EM, Hyman S, Swartz BE (1994) The human brain GLUT1 glucose transporter: ultrastructural localization to the blood-brain barrier endothelia. J Cereb Blood Flow Metab 14:106-112 Deng D, Xu C, Sun P, Wu J, Yan C, Hu M, Yan N (2014) Crystal structure of the human glucose transporter GLUT1. Nature 510:121-125 Deng D, Yan N (2016) GLUT, SGLT, and SWEET: Structural and mechanistic investigations of the glucose transporters. Protein Sci 25:546-558 Dienel GA (2019) Brain Glucose Metabolism: Integration of Energetics with Function. Physiol Rev 99:949-1045 Gras D, Roze E, Caillet S, Meneret A, Doummar D, Billette de Villemeur T, Vidailhet M, Mochel F (2014) GLUT1 deficiency syndrome: an update. Rev Neurol (Paris) 170:91-99 Hamilton KE, Bouwer MF, Louters LL, Looyenga BD (2021) Cellular binding and uptake of fluorescent glucose analogs 2-NBDG and 6-NBDG occurs independent of membrane glucose transporters. Biochimie 190:1-11 Holman GD (2020) Structure, function and regulation of mammalian glucose transporters of the SLC2 family. Pflugers Arch 472:1155-1175 Kahlig CI, Moser S, Micutkova L, Grillari J, Kraus B, Hernandez Bort JA (2024) Enhancement of rAAV titers via inhibition of the interferon signaling cascade in transfected HEK293 suspension cultures. Biotechnol J 19:e2300672 Kapoor K, Finer-Moore JS, Pedersen BP, Caboni L, Waight A, Hillig RC, Bringmann P, Heisler I, Muller T, Siebeneicher H, Stroud RM (2016) Mechanism of inhibition of human glucose transporter GLUT1 is conserved between cytochalasin B and phenylalanine amides. Proceedings of the National Academy of Sciences of the United States of America 113:4711-4716 Koepsell H (2020) Glucose transporters in brain in health and disease. Pflugers Arch 472:1299-1343 Kolic I, Radic Nisevic J, Vlasic Cicvaric I, Butorac Ahel I, Lah Tomulic K, Segulja S, Baraba Dekanic K, Serifi S, Ovuka A, Prpic I (2021) GLUT1 Deficiency Syndrome—Early Treatment Maintains Cognitive Development?(Literature Review and Case Report). Genes 12:1379 Leen WG, Klepper J, Verbeek MM, Leferink M, Hofste T, van Engelen BG, Wevers RA, Arthur T, Bahi-Buisson N, Ballhausen D, Bekhof J, van Bogaert P, Carrilho I, Chabrol B, Champion MP, Coldwell J, Clayton P, Donner E, Evangeliou A, Ebinger F, Farrell K, Forsyth RJ, de Goede CG, Gross S, Grunewald S, Holthausen H, Jayawant S, Lachlan K, Laugel V, Leppig K, Lim MJ, Mancini G, Marina AD, Martorell L, McMenamin J, Meuwissen ME, Mundy H, Nilsson NO, Panzer A, Poll-The BT, Rauscher C, Rouselle CM, Sandvig I, Scheffner T, Sheridan E, Simpson N, Sykora P, Tomlinson R, Trounce J, Webb D, Weschke B, Scheffer H, Willemsen MA (2010) Glucose transporter-1 deficiency syndrome: the expanding clinical and genetic spectrum of a treatable disorder. Brain 133:655-670 Maher F, Vannucci SJ, Simpson IA (1993) Glucose transporter isoforms in brain: absence of GLUT3 from the blood-brain barrier. J Cereb Blood Flow Metab 13:342-345 Mauri A, Duse A, Palm G, Previtali R, Bova SM, Olivotto S, Benedetti S, Coscia F, Veggiotti P, Cereda C (2022) Molecular Genetics of GLUT1DS Italian Pediatric Cohort: 10 Novel Disease-Related Variants and Structural Analysis. Int J Mol Sci 23: Mehta Y, Patel D, Pervaiz I, Bickel U, Al-Ahmad AJ (2025) Targeted proteomics for absolute quantification of glucose transporter 1 in mammalian brain cells using liquid chromatography-mass spectrometry. Journal of Chromatography Open 7:100198 Mueckler M, Thorens B (2013) The SLC2 (GLUT) family of membrane transporters. Molecular aspects of medicine 34:121-138 Navale AM, Paranjape AN (2016) Glucose transporters: physiological and pathological roles. Biophys Rev 8:5-9 Pearson TS, Akman C, Hinton VJ, Engelstad K, De Vivo DC (2013) Phenotypic spectrum of glucose transporter type 1 deficiency syndrome (Glut1 DS). Current neurology and neuroscience reports 13:1-9 Pervaiz I, Mehta Y, Al-Ahmad AJ (2025) Glucose Transporter 1 Deficiency Impairs Glucose Metabolism and Barrier Induction in Human Induced Pluripotent Stem Cell-Derived Astrocytes. J Cell Physiol 240:e31523 Pervaiz I, Zahra FT, Mikelis CM, Al-Ahmad AJ (2022) An in vitro model of glucose transporter 1 deficiency syndrome at the blood-brain barrier using induced pluripotent stem cells. J Neurochem 162:483-500 Pistek M, Kahlig CI, Hackl M, Unterthurner S, Kraus B, Grabherr R, Grillari J, Hernandez Bort JA (2023) Comprehensive mRNA-sequencing-based characterization of three HEK-293 cell lines during an rAAV production process for gene therapy applications. Biotechnol J 18:e2200513 Seidner G, Alvarez MG, Yeh JI, O'Driscoll KR, Klepper J, Stump TS, Wang D, Spinner NB, Birnbaum MJ, De Vivo DC (1998) GLUT-1 deficiency syndrome caused by haploinsufficiency of the blood-brain barrier hexose carrier. Nat Genet 18:188-191 Simmons NL (1990) A cultured human renal epithelioid cell line responsive to vasoactive intestinal peptide. Exp Physiol 75:309-319 Stincone A, Prigione A, Cramer T, Wamelink MM, Campbell K, Cheung E, Olin‐Sandoval V, Grüning NM, Krüger A, Tauqeer Alam M (2015) The return of metabolism: biochemistry and physiology of the pentose phosphate pathway. Biological Reviews 90:927-963 Vannucci SJ, Clark RR, Koehler-Stec E, Li K, Smith CB, Davies P, Maher F, Simpson IA (1998) Glucose transporter expression in brain: relationship to cerebral glucose utilization. Dev Neurosci 20:369-379 Varesio C, Pasca L, Parravicini S, Zanaboni MP, Ballante E, Masnada S, Ferraris C, Bertoli S, Tagliabue A, Veggiotti P, De Giorgis V (2019) Quality of Life in Chronic Ketogenic Diet Treatment: The GLUT1DS Population Perspective. Nutrients 11: Zhang M-J, Wu D, Yu L-F, Li H, Sun D, Liang J-M, Lu X-P, Luo R, Guo Q-H, Jin R-F (2025) Diagnosis and treatment recommendations for glucose transporter 1 deficiency syndrome. World Journal of Pediatrics 1-10 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 25 Mar, 2026 Read the published version in Cell and Tissue Research → Version 1 posted Editorial decision: Revision requested 07 Oct, 2025 Reviews received at journal 06 Oct, 2025 Reviews received at journal 24 Sep, 2025 Reviewers agreed at journal 19 Sep, 2025 Reviewers agreed at journal 15 Sep, 2025 Reviewers invited by journal 12 Sep, 2025 Editor assigned by journal 08 Sep, 2025 Submission checks completed at journal 08 Sep, 2025 First submitted to journal 05 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7546700","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":516948160,"identity":"f95c7944-5a42-4d27-8789-5cff9f9b7202","order_by":0,"name":"Yash Mehta","email":"","orcid":"","institution":"Texas Tech University Health Sciences Center - Jerry H. Hodge School of Pharmacy","correspondingAuthor":false,"prefix":"","firstName":"Yash","middleName":"","lastName":"Mehta","suffix":""},{"id":516948161,"identity":"41026b36-c45e-4b17-ae9d-59acb3ba1300","order_by":1,"name":"Abraham Jacob Al-Ahmad","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABEUlEQVRIie3PsWrDMBCA4QsCZ5HQ6iLivIKDR4P7KjUCTxncuYUEAurS1mtMX8IQ0JxikJc+gEGBkqVTh0KgS0yImqabStKtg/7pOPh0CMDl+o/5AOgw9L+HXgE/G7g6QdCRlAL9lVTqBKFPD+tNfiuBzqC3uR4ng8VroVjeJUD749B6ZNVEbK40+DUgVkoeSYU8VgoOF/fvVgJtBgx7GqCmH4xIlB4ImS4hbO1Xhm2GtninYWiubImcpAthCO6WcPkLCdvMvCk0hDWYQdZp5X0Rz1zx7WS0Ul5MHjUeGRIT2URzxaOYCI79l7fcRgItkMafOgiaKdJE3gyK2fNa4y4J6B2vrN8/hs/YuFwul+vs9kPLVyWrpE67AAAAAElFTkSuQmCC","orcid":"","institution":"Texas Tech University Health Sciences Center - Jerry H. Hodge School of Pharmacy","correspondingAuthor":true,"prefix":"","firstName":"Abraham","middleName":"Jacob","lastName":"Al-Ahmad","suffix":""}],"badges":[],"createdAt":"2025-09-05 19:08:05","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7546700/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7546700/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00441-026-04061-w","type":"published","date":"2026-03-25T16:12:08+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":91932220,"identity":"b9e9d805-a149-442a-8b2b-ba6548e01333","added_by":"auto","created_at":"2025-09-23 02:33:58","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3470921,"visible":true,"origin":"","legend":"","description":"","filename":"CTRGLUT1DSHEKR0Figs.docx","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/73cdf92549fc2540391c967d.docx"},{"id":91932198,"identity":"ac80f184-4f58-4397-8f1d-f22097e9e704","added_by":"auto","created_at":"2025-09-23 02:33:58","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4879,"visible":true,"origin":"","legend":"","description":"","filename":"35b3a23b443d4f3f8724cdd8388d945c.json","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/0e7aea96c29063602d4b8085.json"},{"id":91936483,"identity":"110102d1-b72b-40ee-9ee2-d9be8a1079c6","added_by":"auto","created_at":"2025-09-23 02:49:58","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":119987,"visible":true,"origin":"","legend":"","description":"","filename":"35b3a23b443d4f3f8724cdd8388d945c1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/2397185ec794a491f8e9a024.xml"},{"id":91932206,"identity":"cebcf532-7ff0-4c22-9ed2-6d3293f492d1","added_by":"auto","created_at":"2025-09-23 02:33:58","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":773544,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/b360298a6aa9624ec8aae356.png"},{"id":91934966,"identity":"a891a6a7-8e78-4d9c-95d1-2966a3c7c6a5","added_by":"auto","created_at":"2025-09-23 02:41:58","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":620965,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/272bcb689eeb92743c8681b6.png"},{"id":91934970,"identity":"5124a3ac-388f-42f8-905c-0bb0b9143581","added_by":"auto","created_at":"2025-09-23 02:41:58","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":241991,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/e568dce413f9fbb2e0a29397.png"},{"id":91932204,"identity":"21a65937-2a17-45e8-ab94-ab25055848b2","added_by":"auto","created_at":"2025-09-23 02:33:58","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":534305,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/1918f66c0dac8bdd5f530588.png"},{"id":91932216,"identity":"83f2b126-2fe2-4d89-964c-16c0fdfbd63a","added_by":"auto","created_at":"2025-09-23 02:33:58","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":532115,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/c751773100df7471828395e6.png"},{"id":91934973,"identity":"2c523cdd-f304-4198-8a25-efebaddd6fcc","added_by":"auto","created_at":"2025-09-23 02:41:58","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":651462,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/a8fa995ec993c584b0e6ef64.png"},{"id":91936484,"identity":"cdfce023-2f94-46f7-80f3-b97617c8075b","added_by":"auto","created_at":"2025-09-23 02:49:58","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":148902,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/34221acddfa697a9793c7923.png"},{"id":91937522,"identity":"fc1eb827-fe14-4ce7-a42a-ed3ff352957a","added_by":"auto","created_at":"2025-09-23 02:57:58","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":128423,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/9cb69110aa85439dbc42aa2a.png"},{"id":91937520,"identity":"300c1085-ba87-4b01-85df-cda649f5b2aa","added_by":"auto","created_at":"2025-09-23 02:57:58","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":58356,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/20e1f4b262f5566a764b58fc.png"},{"id":91932219,"identity":"d2468771-13c4-42a7-9ce2-e5b626e64686","added_by":"auto","created_at":"2025-09-23 02:33:58","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":105692,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/fcd540343d09fdd677b6c22e.png"},{"id":91932209,"identity":"f97845a5-ca10-4a06-a67e-5dc7957966cf","added_by":"auto","created_at":"2025-09-23 02:33:58","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":104161,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/cc8ef11dad2a76222cf3a2ed.png"},{"id":91932213,"identity":"bb16aa58-b551-4649-98c8-e8007bb889fb","added_by":"auto","created_at":"2025-09-23 02:33:58","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":373732,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/ae820f02d0d01ed4577a8ad6.png"},{"id":91932217,"identity":"98e66eda-0490-464a-b70a-ba6b435006f0","added_by":"auto","created_at":"2025-09-23 02:33:58","extension":"xml","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":116625,"visible":true,"origin":"","legend":"","description":"","filename":"35b3a23b443d4f3f8724cdd8388d945c1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/823840c22887937356485eed.xml"},{"id":91932215,"identity":"fbbbe346-57e2-4cc5-a51d-ffcf68f8e836","added_by":"auto","created_at":"2025-09-23 02:33:58","extension":"html","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":125333,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/7d5b60d3b9e275faf2e2d5d0.html"},{"id":91932197,"identity":"2719c06e-a5b9-456a-8b76-6108ff79f077","added_by":"auto","created_at":"2025-09-23 02:33:58","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":773544,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGeneration of the GLUT1DS-HEK293\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Comparative gene sequences in the \u003cem\u003eSLC2A1\u003c/em\u003e gene between wild-type (E0) and GLUT1DS (E11) HEK293 clone. Highlighted in bold is the nucleotide sequence present in the E0 clone that was excised in the E11 clone. The initial start codon in the first \u003cem\u003eSLC2A1\u003c/em\u003e exon is underlined. (B) Expected protein sequence based on the \u003cem\u003eSLC2A1\u003c/em\u003e sequence, inclusive of the 3\u003csup\u003erd\u003c/sup\u003e transmembrane domain (highlighted in blue) up to the 2\u003csup\u003end\u003c/sup\u003e extracellular loop. Note the presence of a missense mutation for two amino acids (highlighted in yellow) prior to the STOP codon. (C) Representative \u003cem\u003ein silico\u003c/em\u003e model of truncated GLUT1 protein product (111 amino acids) generated using SwissProt based on the predicted amino acid sequence. Crystalized human GLUT1 structure (PDB:4PYP.1.A) was used as a template.TM1, TM2, and TM3 indicates 1\u003csup\u003est\u003c/sup\u003e, 2\u003csup\u003end\u003c/sup\u003e, and 3\u003csup\u003erd\u003c/sup\u003e transmembrane domains.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/97a86fb3b6abb08cf6fd0e49.png"},{"id":91934964,"identity":"c1077a91-509e-4825-9eee-632b972855b2","added_by":"auto","created_at":"2025-09-23 02:41:58","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":620965,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGLUT1DS HEK293 cells display a truncated GLUT1 transporter.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Quantitative real-time PCR analysis of \u003cem\u003eSLC2A1\u003c/em\u003e mRNA expression in the GLUT1DS clone using two sets of primers (left panel: primers targeting exon 5, right panel: primers targeting the excised sequence). Gene expression levels were normalized to β-actin and presented as relative quantities. Notably, no \u003cem\u003eSLC2A1\u003c/em\u003e mRNA transcripts targeting the excised sequence were detected in the GLUT1DS clone. N = 3/ group. *** denotes p \u0026lt; 0.001. (B) Representative micrograph images of GLUT1 in wild-type (WT) and GLUT1DS HEK293 monolayers, using antibodies targeting either the C-terminal or N-terminal domains of the full-length GLUT1 protein. Note the absence of immunofluorescence in the GLUT1DS clone compared to wild-type (WT) when incubated with an antibody targeting the C-terminal domain of the full-length GLUT1 protein, while GLUT1 was detected in both clones when incubated in presence of a GLUT1 antibody raised against the N-terminal region. Scale bar = 10 μm. (C) Representative GLUT1 immunoblots in WT and GLUT1DS cell lysates, using the antibody targeting the C-terminal domain of the full-length protein. 5mg/lane, β-actin was used as a loading control. Note the absence of bands for GLUT1 at the expected migration region (~55kDa), indicative of successful truncation. Representative flow cytometry histograms using GLUT1 antibodies targeting the C-terminal (D) or N-terminal (E) region of the full-length protein. IgG isotype-matched antibody (gray) were used as a negative control. Note the absence of the shift in peak in the GLUT1DS clone, indicating the absence of the C-terminal region of the full-length GLUT1 protein product. Relative geometric mean fluorescence intensity was obtained by subtracting the geometric mean of the fluorescence intensity of each sample from the geometric mean of the fluorescence intensity of the IgG isotype-matched control (N = 7/group, **** denotes \u003cem\u003eP\u0026lt;0.0001\u003c/em\u003e versus WT clone).\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/94fe26cbc57989e04d21cf4a.png"},{"id":91932200,"identity":"acffaad4-ebd3-4a75-8c4d-c029d32c013c","added_by":"auto","created_at":"2025-09-23 02:33:58","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":241991,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGLUT1DS HEK293 cells are hypometabolic, have impaired glucose uptake and reduced glucose consumption and L-lactate production.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) MTS-based assay to assess cell metabolic activity. Note the decrease in the overall cell metabolic activity in the GLUT1DS clone, compared to its wild-type counterpart (N = 10/group, **** denotes \u003cem\u003eP\u0026lt;0.0001\u003c/em\u003e versus WT). (B) \u003csup\u003e14\u003c/sup\u003e[C]-D-Glucose uptake in WT and GLUT1DS HEK293 cells. The amount of glucose uptaken by cells were normalized against the total cellular protein concentration (N = 10/group, **** denotes \u003cem\u003eP\u0026lt;0.0001\u003c/em\u003e versus WT). (C) Uptake of fluorescent glucose analog 2-NBDG. Note the decrease in 2-NBDG MFI in the GLUT1DS clone versus WT (N = 3/group, ** denotes \u003cem\u003eP\u0026lt;0.01\u003c/em\u003e versus WT). (D) Extracellular glucose concentration from WT and GLUT1DS HEK293 conditioned medium. Conditioned medium were collected from a 24 hour incubation period. The amount of glucose is normalized against the total protein content in conditioned medium. Note the increase in the glucose concentration in the conditioned medium in GLUT1DS compared to WT (N = 9/group, **** denotes p\u0026lt;0.0001 versus WT). (E) Extracellular lactate concentrations in conditioned medium. The amount of lactate is normalized to the total protein content in conditioned medium (N = 9/group, *** denotes p\u0026lt;0.001 versus WT).\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/393a7d187043c016b24f98ea.png"},{"id":91932202,"identity":"9f111f57-7c6b-4cac-b5d5-87f569dd42d3","added_by":"auto","created_at":"2025-09-23 02:33:58","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":534305,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGLUT1 truncation did not lead to compensation by other Class I GLUTs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Quantitative RT-qPCR analysis comparing mRNA expression of Class I glucose transporters (\u003cem\u003eSLC2A1, SLC2A2, SLC2A3, and SLC2A4) \u003c/em\u003ein WT and GLUT1DS clones (N = 3/ group. * denotes \u003cem\u003eP\u0026lt;0.05\u003c/em\u003e vs WT). (B) Representative micrograph images of GLUT1 (C-terminal), GLUT2, GLUT3, and GLUT4 immunoreactivity in WT and GLUT1DS clones. Scale bar = 10 μm. (C) Representative flow cytometry histograms using GLUT1 (C-terminal), GLUT2, GLUT3, and GLUT4 antibodies and their relative geometric mean fluorescence intensity (MFI) for GLUT1 (C-terminal), GLUT2, GLUT3, and GLUT4 proteins obtained from flow cytometry (* denotes \u003cem\u003eP\u0026lt;0.05\u003c/em\u003e versus WT).\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/f4a39f52e741e3dc05eea3a3.png"},{"id":91936486,"identity":"29e9ff71-5f31-401c-892c-fa8beb934ac4","added_by":"auto","created_at":"2025-09-23 02:49:58","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":532115,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGLUT1DS HEK293 cells display catastrophic glycolysis and mitochondrial respiration activity.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Energy phenotypic profile of GLUT1DS-HEK293 cells under resting conditions. Note the mixed (high ECAR, high OCR) metabolic profile of the WT clone and the quiescent (low ECAR, low OCR) metabolic profile of the GLUT1DS clone. (B) Representative ECAR levels in WT and GLUT1DS HEK293 cells during glycolytic flux assay. Note the absence of changes in ECAR following the different treatments, including the addition of glucose, oligomycin, and 2-deoxyglucose in the GLUT1DS clone. (C) Representative glycolytic parameters of GLUT1DS HEK293 cells extrapolated from the glycolytic flux assay from (B). Note the complete collapse of the key glycolytic parameters, including the glycolysis, the glycolytic capacity (CAPACITY), the glycolytic reserve (RESERVE), and the non-glycolytic acidification rate (NGA) in the GLUT1DS clone (N = 10/group, *** and **** denote \u003cem\u003eP\u0026lt;0.001\u003c/em\u003e and \u003cem\u003eP\u0026lt;0.0001\u003c/em\u003e versus WT respectively). (D) Representative OCR levels in GLUT1DS HEK293 cells. Note the absence of an increased OCR following FCCP treatment in GLUT1DS clone. (E) Representative mitochondrial parameters of GLUT1DS HEK293 cells extrapolated from Mito stress assay. Note the severe impairment of major mitochondrial respiration features such as basal respiration (BASAL), ATP-production coupled respiration (ATP), maximal mitochondrial respiration (MAX) or capacity (CAP), while no evidence of proton leak (LEAK) or non-mitochondrial acidification rate (NON-MITO) in the GLUT1DS clone (N = 10/group, **** denotes \u003cem\u003eP\u0026lt;0.0001\u003c/em\u003e versus WT).\u003cbr\u003e\n(F) Representative immunofluorescence images of live cells incubated with MitoSOX\u003csup\u003eTM\u003c/sup\u003e Red. Cells were counterstained with DAPI for live cell imaging. Scale bar = 10 µm. Relative MFI obtained with MitoSOX\u003csup\u003eTM\u003c/sup\u003e Green staining using FACS (N=6/group, **** denotes \u003cem\u003eP\u0026lt;0.0001\u003c/em\u003e vs WT). (G) Representative total ATP production and contribution of the glycolytic and mitochondrial respiration to ATP production in GLUT1DS HEK293 cells. Note the decrease in total ATP production in the GLUT1DS clone (N =10 and for WT and GLUT1DS clones, respectively; **** denotes \u003cem\u003eP\u0026lt;0.0001\u003c/em\u003e vs WT in glycolytic ATP production rate, and \u003csup\u003e####\u003c/sup\u003e denotes \u003cem\u003eP\u0026lt;0.0001\u003c/em\u003e vs WT mito ATP production rate). (H) Representative glucose-6-phosphate dehydrogenase (G6PD) activity in WT and GLUT1DS HEK293 cells. Note the increase in G6PD activity in the GLUT1DS clone (N = 8/group, **** denoted \u003cem\u003eP\u0026lt;0.001\u003c/em\u003e versus WT)\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/d5d4b2a77f5cc71b9ac04112.png"},{"id":91937521,"identity":"d3f6cd57-97b3-4593-91b8-460fdf044ab2","added_by":"auto","created_at":"2025-09-23 02:57:58","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":651462,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGLUT1DS-HEK293 clone is viable, but has increased cell doubling time, cell thickness, and decreased velocity.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Representative brightfield micrograph images of WT and GLUT1DS-HEK293 (E11) clones. Scale bar = 200 µm. (B) Comparison of morphological features recorded with LiveCyte® imaging on WT and GLUT1DS cells grown for 72 hours, including doubling times, cellular thickness, sphericity, and instantaneous velocity (N=6/group, **** denotes p\u0026lt;0.0001 vs WT).\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/b462a47f4211343821acb4f8.png"},{"id":105754967,"identity":"c66e72a0-c555-4bcc-8eb8-7efdabf1b6e3","added_by":"auto","created_at":"2026-03-30 16:23:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4435819,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7546700/v1/c6c62097-a41a-4f09-9fac-4fc6dee637dd.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Glucose transporter 1 deficiency impairs glucose homeostasis, cell proliferation, and morphology in human embryonic kidney cells 293","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGlucose represents a major source of energy for mammalian cells. Due to its nature, the entrance of glucose inside mammalian cells is dependent on the presence of cognate glucose transporters on the cell surface. In mammals, two types of glucose transporters have been identified: the sodium-dependent glucose transporters (SGLTs) and sodium-independent facilitated glucose transporters (GLUTs) (Deng and Yan, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2016\u003c/span\u003e, Mueckler and Thorens, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2013\u003c/span\u003e, Navale and Paranjape, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eGLUTs (encoded by \u003cem\u003eSLC2A\u003c/em\u003e genes in humans) are found as 14 different isoforms in humans (Holman, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Although their primary substrate is glucose, such isoforms may also transport other hexoses, including fructose (GLUT1, GLUT2, GLUT3, GLUT5, GLUT7, GLUT8 and GLUT10), galactose (GLUT1, GLUT2, GLUT3, GLUT8 and GLUT10), mannose (GLUT1, GLUT2, GLUT3 and GLUT8) or xylose (GLUT3). However, amongst these GLUTs, GLUT1 (and accessory GLUT3) displays the GLUT isoform with the highest affinity towards glucose.\u003c/p\u003e\u003cp\u003eGLUT1 expression is predominant in human embryonic stem cells during development, while its expression in adult tissues appears more restricted and is highly expressed in the placenta and endometrium, skin, bone marrow, GI tract, and the brain.\u003c/p\u003e\u003cp\u003eGlucose supply to the brain is crucial for its energetic homeostasis, yet it is highly tributary on the presence of a functional GLUT1 at the blood-brain barrier (BBB, a component of the neurovascular unit), resulting in a rate-limiting factor that can have a deleterious effect on the brain homeostasis if such transporter is impaired (Bak, et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2006\u003c/span\u003e, Dienel, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Koepsell, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Vannucci, et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1998\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eGLUT1 Deficiency Syndrome (GLUT1DS) is an autosomal dominant brain metabolic disorder (Seidner, et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1998\u003c/span\u003e) characterized by the presence of mutations in the \u003cem\u003eSLC2A1\u003c/em\u003e gene (Gras, et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2014\u003c/span\u003e, Kolic, et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Leen, et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2010\u003c/span\u003e, Mauri, et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, Varesio, et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Approximately 90% of GLUT1DS cases result from a \u003cem\u003ede novo\u003c/em\u003e heterozygous mutation in the \u003cem\u003eSLC2A1\u003c/em\u003e gene, while the remaining 10% of cases are inherited from a parent (Pearson, et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2013\u003c/span\u003e, Zhang, et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). GLUT1DS patients commonly display early onset of epilepsy, movement disorder, and intellectual disability, which display a spectrum in the phenotype depending on the type of mutations harbored by patients.\u003c/p\u003e\u003cp\u003eWe previously demonstrated that the presence of a mutated GLUT1 transporter at the BBB, has a significant detrimental effect on glucose uptake and glycolytic activity in brain microvascular endothelial cells (Pervaiz, et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) and astrocytes (Pervaiz, et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2025\u003c/span\u003e) (two cell types belonging to the BBB) \u003cem\u003ein vitro.\u003c/em\u003e\u003c/p\u003e\u003cp\u003eYet, these cells displayed notable differences in terms of maintaining their energetic homeostasis despite having GLUT1 as their main GLUT isoform, raising the need to understand the rationale behind such differences.\u003c/p\u003e\u003cp\u003eIn this study, we investigated the impact of GLUT1 impairment on glucose homeostasis and metabolism in a non-BBB cell type, using the human embryonic kidney cell HEK293 (Simmons, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e1990\u003c/span\u003e), by generating a GLUT1DS model of such a cell type. In such cells, GLUT1 represents the most prevalent high-affinity GLUT isoform (Kahlig, et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), making it convenient to address how an impaired GLUT1 impacts glucose metabolism and homeostasis in a non-cerebral cell type.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eCell culture\u003c/h2\u003e\u003cp\u003eThe wild-type HEK293 (WT, E0 clone) (RRID: CVCL_0045) and the GLUT1DS-HEK293 clone (GLUT1DS, E11 clone) were purchased from Ubigene Biosciences (Austin, Texas). These cells were cultured in Dulbecco\u0026rsquo;s Modified Eagle\u0026rsquo;s Medium (DMEM, Gibco\u0026trade;, ThermoFisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum (FBS, Gibco\u0026trade;, ThermoFisher) and 1% antibiotic-antimycotic solution (100X, Gibco\u0026trade;, ThermoFisher).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eGene editing\u003c/h3\u003e\n\u003cp\u003eA deletion of 101 base pairs (bp) was identified in the exon 3 region of the \u003cem\u003eSLC2A1\u003c/em\u003e gene in GLUT1DS-HEK293 clone. The cells' genotype was confirmed by Ubigene Biosciences (Austin, Texas) to be a complete knockout of both alleles through Sanger sequencing.\u003c/p\u003e\n\u003ch3\u003eQuantitative real-time PCR\u003c/h3\u003e\n\u003cp\u003eCells were washed twice with ice-cold PBS, and total RNA from both clones was extracted using the Direct-zol RNA Miniprep Plus Kit (Zymo Research, Irvine, CA, United States) according to the manufacturer\u0026rsquo;s protocol. RNA concentration and quality were determined using a Nanodrop\u0026reg; 2000 spectrophotometer (ThermoFisher Scientific, Waltham, MA). Complementary DNA (cDNA) was synthesized from 1\u0026micro;g of RNA using Maxima\u0026reg; first-strand cDNA synthesis kit (ThermoFisher Scientific, Waltham, MA) in accordance with the manufacturer\u0026rsquo;s protocol. Quantitative PCR (qPCR) reactions were performed using the Bio-Rad CFX96 real-time PCR system (Bio-Rad Laboratories, Hercules, CA). Powertrack\u0026reg; SYBR green master mix (ThermoFisher Scientific, Waltham, MA) was utilized to measure mRNA expression levels using primers (see Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) The PCR program included an initial step at 95\u0026deg;C for 2 min followed by 40 cycles of 95\u0026deg;C for 15 sec and 60\u0026deg;C for 1 min. In each run, templates were assayed in triplicate, and the run was repeated at least three times.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eSpecific primer sequence\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSequence\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSLC2A1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5' CATGGGCTTCTCGAAACTGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5' GTACACACCGATGAAGCG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSLC2A2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5' TACATTGCGGACTTCTGTGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5' AGACTTTCCTTTGGTTTCTGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSLC2A3\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5' CAGCGAGACCCAGAGATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5' TTGGAAAGAGCCGATTGTAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSLC2A4\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5' CTGGGCCTCACAGTGCTAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5' GTCAGGGCGCTTCAGACTCTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eACTB\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5' CTCTTCCAGCCTTCCTTCCTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5' CAGCACTGTGTTGGCGTACAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003eWestern blot analysis\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eWestern blot analysis\u003c/div\u003e\u003cp\u003eCells were subjected to two washes with ice-cold phosphate-buffered saline (PBS), followed by homogenization with RIPA buffer (ThermoFisher Scientific, Waltham, MA). The resulting lysates were centrifuged at 13000 g for 12 mins at 4\u0026deg; C to remove insoluble debris, and the supernatant was used for protein quantification using the Pierce\u0026trade; BCA protein assay kit (ThermoFisher Scientific, Waltham, MA). Samples were prepared for SDS-polyacrylamide gel electrophoresis (PAGE) by mixing with 2x SDS loading buffer (Bio Rad Laboratories, Hercules, CA) and β-mercaptoethanol (Sigma-Aldrich, Burlington, MA), and heating at 95\u0026deg;C for 5 minutes. Equal amounts of protein (5 \u0026micro;g/lane) were loaded onto a 10% SDS-PAGE gel and transferred to a polyvinylidene fluoride (PVDF) membrane. Following membrane transfer, blocking was conducted for 2 h in Tris-buffered saline (TBS, Bio-Rad Laboratories, Hercules, CA) containing 0.1% Tween-20 (Sigma-Aldrich, Burlington, MA) and 5% non-fat dry milk. The membranes were then incubated with appropriate primary antibodies: GLUT1 (SA0377 clone, RRID: AB_2809254, 1:2000, ThermoFisher Scientific) and β-actin (BA3R Clone, RRID: AB_2617163, 1:500, ThermoFisher Scientific, Waltham, MA) for 2 h at 4\u0026deg;C, followed by incubation with goat anti-rabbit (RRID: AB_2536530, 1:5000, ThermoFisher Scientific, Waltham, MA) or goat anti-mouse (RRID: AB_2536527, 1:2000 ThermoFisher Scientific, Waltham, MA) HRP-conjugated antibodies. Protein bands were visualized using the Super Signal WestPico Plus ECL (ThermoFisher Scientific, Waltham, MA) and blots were quantified using ImageJ (NIH).\u003c/p\u003e\n\u003ch3\u003eFlow cytometry\u003c/h3\u003e\n\u003cp\u003eCells were collected and washed using ice-cold PBS containing 1% Bovine Serum Albumin (BSA, Sigma-Aldrich, Burlington, MA) at 1200 rpm for 5 minutes. Cells were fixed and later permeabilized using FIX \u0026amp; PERM\u0026trade; Cell Permeabilization Kit (ThermoFisher Scientific, Waltham, MA) according to the manufacturer\u0026rsquo;s instructions. Cells were then incubated overnight in the presence of primary antibodies against GLUT1 C-Terminal (SA0377 clone, RRID: AB_2809254, 1:100, ThermoFisher Scientific), GLUT1 N-Terminal (RRID: AB_2302087, 1:100, ThermoFisher Scientific), GLUT2 (2V2U2 clone, RRID: AB_2849067, 1:100, ThermoFisher Scientific), GLUT3 (RRID: AB_2191428, 1:100, ThermoFisher Scientific), and GLUT4 (RRID: AB_11153908, 1:100, ThermoFisher Scientific) and IgG isotype controls at the same concentrations. Cells were washed with ice-cold PBS containing 1% BSA and incubated with Alexa Fluor\u0026copy; 488 conjugated goat anti-rabbit (RRID: AB_2925776, 1:200, ThermoFisher Scientific) for 1 hour at room temperature. At least 10,000 events were acquired for each sample using a FACSVerse system (BD Biosciences, San Jose, CA). Relative expression was obtained by subtracting the geometric mean fluorescence index (MFI) from samples versus the MFI from the IgG isotype control.\u003c/p\u003e\u003cp\u003eTo determine 2-(\u003cem\u003eN\u003c/em\u003e-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) uptake, cells were first washed with ice-cold PBS. 1 x 10\u003csup\u003e6\u003c/sup\u003e cells were incubated with 100 \u0026micro;M 2-NBDG in glucose-free DMEM (Gibco\u0026trade;, ThermoFisher Scientific, Waltham, MA) at 37\u0026deg; C. The Same number of cells were also incubated in glucose-free DMEM without 2-NBDG as a negative control. Cells were then washed with ice-cold PBS at 1200 rpm for 5 minutes and finally resuspended in ice-cold PBS. The fluorescence of samples and negative control was analyzed using a FACSVerse flow cytometer at an excitation wavelength of 488 nm and a 530/30 nm emission collector bandpass filter. Relative MFI was obtained by subtracting the geometric mean fluorescence index (MFI) from samples versus the MFI from the negative control.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eImmunocytochemistry\u003c/h2\u003e\u003cp\u003eCells were washed with ice-cold PBS and fixed with 4% paraformaldehyde (PFA, Electron Microscopy Sciences, Hatfield, PA, USA). The cells were subsequently blocked with PBS containing 10% goat serum (ThermoFisher Scientific, Waltham, MA) (PBSG) supplemented with 0.1% Tween 20 (Sigma-Aldrich, Burlington, MA) at room temperature for 20 minutes. Following blocking, cells were incubated overnight with primary antibodies targeting GLUT1 C-Terminal (SA0377 clone, RRID: AB_2809254, 1:100, ThermoFisher Scientific), GLUT1 N-Terminal (RRID: AB_2302087, 1:100, ThermoFisher Scientific), GLUT2 (2V2U2 clone, RRID: AB_2849067, 1:100, ThermoFisher Scientific), GLUT3 (RRID: AB_2191428, 1:100, ThermoFisher Scientific), and GLUT4 (RRID: AB_11153908, 1:100, ThermoFisher Scientific)at 4\u0026deg; C. The cells were washed with ice cold PBS and incubated for 1 hour with Alexa Fluor\u0026copy; 488 conjugated goat anti-rabbit (RRID: AB_2925776, 1:200, ThermoFisher Scientific) at room temperature. For visualization, nuclei were counterstained with DAPI (ThermoFisher Scientific, Waltham, MA). The cells were imaged using a Leica Stellaris 8 Falcon STED Super-resolution confocal microscope at 100x magnification, and images were acquired using Leica Application Suite X.\u003c/p\u003e\u003cp\u003e\u003csup\u003e\u003cem\u003e14\u003c/em\u003e\u003c/sup\u003e \u003cem\u003eC-labeled glucose uptake assays\u003c/em\u003e\u003c/p\u003e\u003cp\u003eOn the day of the experiment, cell culture medium was replaced with fresh medium supplemented with \u003csup\u003e14\u003c/sup\u003eC-D-Glucose (0.4 \u0026micro;Ci/ml, PerkinElmer, Waltham, MA) and incubated for 1 hour at 37\u0026deg; C. After incubation, cells were washed with ice-cold PBS and homogenized with 100 \u0026micro;l RIPA buffer. A 90 \u0026micro;l aliquot of cell lysate was mixed with 3 ml of ScintiSafe\u0026reg; Econo F Cocktail (ThermoFisher Scientific, Waltham, MA) to measure radioactivity in the cells. Radioactivity was quantified using a Backman-Coulter LS6500 (Beckman Coulter, Bria, CA). For protein quantitation, 5 \u0026micro;l of the remaining cell lysate was analyzed using Pierce\u0026trade; BCA protein assay kit with Synergy H1 microplate reader (Bio-Tek, Winooski, VT) at 562 nm. Glucose uptake was normalized to total protein and expressed as \u0026micro;g glucose/mg total protein.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eExtracellular Glucose and L-Lactate Quantitation\u003c/h3\u003e\n\u003cp\u003eCells were seeded at a density of 1*10\u003csup\u003e6\u003c/sup\u003e cells/well in a 6-well plate and cultured in DMEM medium containing 1g/L D-glucose for 24 hours. Following the incubation, cell culture media were collected to observe extracellular D-glucose and L-lactate levels. D-glucose levels were assessed using Amplex\u0026reg; Red Glucose/Glucose Oxidase Assay Kit (Life Technologies, Carlsbad, CA). At the same time, L-lactate concentrations were determined using PicoProbe\u0026trade; Lactate Fluorometric Assay Kit (BioVision, Milpitas, CA), according to the manufacturer\u0026rsquo;s protocol. Absorbance was measured at 560 nm for D-glucose and 570 nm for L-lactate quantitation using a Synergy H1 microplate reader (Bio-Tek, Winooski, VT). D-glucose and L-lactose concentrations in the extracellular medium were normalized to total protein and reported as mM/\u0026micro;g protein and nM/\u0026micro;g protein, respectively.\u003c/p\u003e\n\u003ch3\u003eSeahorse extracellular flux analyzer\u003c/h3\u003e\n\u003cp\u003eGlycolytic flux was evaluated using a Seahorse\u0026copy; XFe24 cell flux analyzer (Agilent Technologies, Santa Clara, CA). Cells were seeded in XFe cell culture microplates (Agilent Technologies, Santa Clara, CA) at a density of 6*10\u003csup\u003e4\u003c/sup\u003e cells/well. One hour prior to the experiment, cells were incubated with an assay medium comprising XF Base Medium, supplemented with 2 mM L-glutamine (pH adjusted to 7.4) in a CO\u003csub\u003e2\u0026minus;\u003c/sub\u003efree incubator. Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using a Seahorse\u0026copy; XFe24 flux analyzer according to the manufacturer\u0026rsquo;s protocol. The ECAR and OCR measurements were initiated without the addition of glucose or pyruvate in the glycolytic stress test medium. After 20 minutes of incubation, 10 mM D-glucose was introduced into the chamber, followed by the addition of 1 \u0026micro;M oligomycin at 40 minutes, and 100 mM 2-deoxy-D-glucose (2-DG) at the 60-minute mark. The seahorse\u0026copy; wave software which is equipped with XF glycolytic stress test report generator was used to calculate glycolytic flux parameters generated during the assay. Following the experiment, cells were lysed with RIPA buffer and protein content was quantified using a BCA assay. ECAR and OCR values were normalized to the protein concentration of each well.\u003c/p\u003e\u003cp\u003eMitochondrial functions were evaluated using a Seahorse\u0026copy; XFe24 cell flux analyzer in conjunction with XF cell mito stress test kit (Agilent Technologies, Santa Clara, CA). Cells were incubated with an assay medium comprising XF Base Medium, supplemented with 1 mM pyruvate, 2 mM L-glutamine, and 10 mM glucose (pH adjusted to 7.4) in a CO\u003csub\u003e2\u0026minus;\u003c/sub\u003efree incubator. OCR and ECAR were measured using a Seahorse\u0026copy; XFe24 flux analyzer according to the manufacturer\u0026rsquo;s protocol. 1.5 \u0026micro;M Oligomycin, 0.5 \u0026micro;M carbonyl cyanide p-trifluoromethoxy phenylhydrazone (FCCP), and 0.5 \u0026micro;M rotenone/antimycin A solutions were prepared, and standard mix/wait/measure cycles were applied. The seahorse\u0026copy; wave software, which is equipped with the XF Mitostress\u0026copy; test report generator, was used to calculate the mitochondrial respiration parameters generated during the assay. Following the experiment, cells were lysed with RIPA buffer, and protein content was quantified using a BCA assay. ECAR and OCR values were normalized to the protein concentration of each well.\u003c/p\u003e\u003cp\u003eATP rate assay was performed using a Seahorse\u0026copy; XFe24 cell flux analyzer coupled with XF real-time ATP rate assay kit (Agilent Technologies, Santa Clara, CA). One hour before the experiment, cells were incubated with an assay medium comprising XF Base Medium, supplemented with 1 mM pyruvate, 2 mM L-glutamine, and 10 mM glucose (pH adjusted to 7.4) in a CO\u003csub\u003e2\u0026minus;\u003c/sub\u003efree incubator. OCR and ECAR were measured using a Seahorse\u0026copy; XFe24 flux analyzer according to the manufacturer\u0026rsquo;s protocol. 1.5 \u0026micro;M Oligomycin and 0.5 \u0026micro;M rotenone/antimycin A solutions were prepared, and standard mix/wait/measure cycles were applied. The Seahorse Wave\u0026copy; software, which is equipped with an XF real-time ATP rate assay report generator was used to calculate parameters generated during the assay. Following the experiment, cells were lysed with RIPA buffer, and protein content was quantified using a BCA assay. ECAR and OCR values were normalized to the protein concentration of each well.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eGlucose 6 phosphate dehydrogenase activity (G6PD) assay\u003c/h2\u003e\u003cp\u003eCells were seeded at a density of 2*10\u003csup\u003e6\u003c/sup\u003e cells/well in a 6-well plate and cultured in DMEM medium containing 1g/L D-glucose for 48 hours. Following the incubation, cells were lysed with RIPA buffer, and protein content was quantified using a BCA assay. To measure G6PD activity, the G6PD Activity Assay Kit (Novus Biologicals, Centennial, CO) was used according to the manufacturer\u0026rsquo;s protocol. Absorbance at 450 nm, corresponding to the formation of orange formazan, was recorded using a Synergy H1 microplate reader (BioTek, Winooski, VT). Formazan generated in the reaction system is proportional to the activity of the G6PD enzyme in the sample. The activity of the G6PD enzyme was reported as U/L per \u0026micro;g of total protein.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eLive cell imaging\u003c/h2\u003e\u003cp\u003eCells were seeded at a density of 5*10\u003csup\u003e3\u003c/sup\u003e cells/well in a 6-well plate. Imaging was performed using a LiveCyte kinetic cytometer (Phasefocus, Sheffield, UK) equipped with ptychographic quantitative phase imaging (QPI). Morphological and behavioral analysis of individual cells was carried out every 18 mins over a 72-hour period at 10x magnification, with 4 fields of view per well. The imaging chamber was maintained at 37\u0026deg; C with 5% CO\u003csub\u003e2\u003c/sub\u003e throughout the experiment.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eMitochondrial staining\u003c/h2\u003e\u003cp\u003eCells were seeded at 1*10\u003csup\u003e4\u003c/sup\u003e cells/well in a 6-well plate and incubated with 1 mL of 500 nM MitoSOX\u0026trade; Red and 1 mL of 1 \u0026micro;M MitoSOX\u0026trade; Green (ThermoFisher Scientific, Waltham, MA) for 30 minutes at 37\u0026deg; C and 5% CO\u003csub\u003e2\u003c/sub\u003e. Cells were then washed 3-times with PBS. Live cell imaging was performed for cells stained with MitoSOX\u0026trade; Red using a Leica Stellaris 8 Falcon STED Super-resolution confocal microscope at 100x magnification using the Leica Application Suite X, whereas at least 10,000 events were acquired for each sample that underwent MitoSOX\u0026trade; Green fluorogenic dye using a FACSVerse system (BD Biosciences, San Jose, CA). Relative MFI was obtained by subtracting the geometric mean fluorescence index (MFI) from stained samples from the MFI from the unstained samples.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eData are represented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD from a minimum of three independent biological replicates. Comparisons between wild-type and GLUT1DS cells were performed using a two-tailed Student\u0026rsquo;s t-test. All statistical analysis was carried out using Prism 10.0 software (GraphPad Software, La Jolla, CA) was used to perform statistical analysis. A \u003cem\u003ep\u003c/em\u003e-value less than (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) was considered to indicate statistical significance.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003eGeneration of the GLUT1DS clone\u003c/h2\u003e\n \u003cp\u003eOur first step was to generate a HEK293 clone as a model for GLUT1DS (GLUT1DS) to assess the impact of GLUT1 deficiency on non-cerebral cells. In our iPSC model of GLUT1DS (Pervaiz, Mehta and Al-Ahmad, \u003cspan class=\"CitationRef\"\u003e2025\u003c/span\u003e, Pervaiz, Zahra, Mikelis and Al-Ahmad, \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e), we generated GLUT1DS clones with frameshift mutations resulting in the introduction of a STOP codon within their 4th transmembrane domain. To our surprise, such clones were showing a reduced, but not a complete, reduction in glucose uptake. Such observation let us speculate that the 4th transmembrane domain (which plays an important role in the glucose transport through the pore) may be essential in the maintenance of a residual activity of the glucose transporter.\u003c/p\u003e\n \u003cp\u003eFor the generation of this clone, we aimed to introduce the STOP codon before such domain, by inserting a whole deletion of 101 nucleotides (543_644del, Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA), which resulted in the introduction of a frameshift mutation resulting in the introduction of two nonsense mutations after Val108 ( of a STOP codon by the amino-acid 110 (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB). Using the UniProtKB/Swiss-Prot database and the X-ray crystal structure of human GLUT1 (Deng, et al., \u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e), we assessed the impact of such a mutation on the expected outcome on GLUT1 conformation (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e\n \u003cp\u003eBased on such a crystallographic structure, we can anticipate that our GLUT1DS clone will result in a truncated protein product with a mostly complete 3rd transmembrane domain, with a truncation occurring before the 4th transmembrane domain.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003eValidation of the GLUT1DS HEK293 clone\u003c/h2\u003e\n \u003cp\u003eNext, we validated the truncation of the full-length GLUT1 from the GLUT1DS HEK293 clone (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Firstly, changes in \u003cem\u003eSLC2A1\u003c/em\u003e mRNA were assessed by qPCR using primers targeting exon sequences outside and inside the deleted region (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA). Interestingly, \u003cem\u003eSLC2A1\u003c/em\u003e mRNA levels were reduced (a\u0026thinsp;~\u0026thinsp;35% decrease) in the GLUT1DS clone compared to its wild-type (WT). Such a decrease was comparable to values reported in iPSC-derived GLUT1DS astrocyte-like (iAstros) and brain endothelial cell-like cells (iBMECs). We also confirmed that the deletion of the sequence in the \u003cem\u003eSLC2A1\u003c/em\u003e gene in the GLUT1DS clone was total, as we reported no amplification of mRNA products containing the excised sequence. To confirm the absence of full-length GLUT1 protein products, we performed experiments using immunofluorescence and Western blots (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB\u0026amp;C). Using antibodies raised against two distinct epitopes (one targeting the C-terminal intracellular domain of the full-length GLUT1, the second targeting the N-terminal region), we observed the absence of immunopositivity in the GLUT1DS clone (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB) for the C-terminal epitope. On the other hand, there were unremarkable differences between wild-type and the GLUT1DS clone when stained against the N-terminal region. As a confirmatory step, a semi-quantitative analysis by Western blot (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC) showed the absence of an immunoreactive band at 55kDa (expected GLUT1 apparent molecular weight), consistent with our iPSC-derived GLUT1DS-iAstros and iBMECs (Pervaiz, Mehta and Al-Ahmad, \u003cspan class=\"CitationRef\"\u003e2025\u003c/span\u003e, Pervaiz, Zahra, Mikelis and Al-Ahmad, \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). Finally, we confirmed the absence of a full-length GLUT1\u003csup\u003e+\u003c/sup\u003e population in our GLUT1DS clone by flow cytometry (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD\u0026amp;E). As expected, no GLUT1\u003csup\u003e+\u003c/sup\u003e population was detected in the GLUT1DS clone using the same antibody targeting GLUT1 in its C-terminal region, while no differences in terms of GLUT1\u003csup\u003e+\u003c/sup\u003e population and GLUT1 expression were observed between the wild-type and GLUT1DS clone when the antibody targeting the N-terminal region was used.\u003c/p\u003e\n \u003cp\u003eTaken together, our data suggest that the GLUT1DS clone is homogeneous with the majority of the cell population harboring a truncated GLUT1 protein product, validating our mutant construct as a cellular model for GLUT1DS.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003ch2\u003eGLUT1DS clone displays hypometabolism, reduced glucose uptake, glucose usage, and L-lactate production\u003c/h2\u003e\n \u003cp\u003eFollowing the validation of our model, we investigated the impact of GLUT1 truncation in HEK293 cells by assessing changes in glucose uptake and metabolism in general (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). Firstly, we assessed changes in overall cell metabolism using the MTS assay (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA) GLUT1DS clone showed over a 50% decrease in cell metabolic activity compared to their control clone (43.89\u0026plusmn;2.05 versus 100\u0026plusmn;9.77% respectively), indicative of a hypometabolism in such clone compared to its parental control.\u003c/p\u003e\n \u003cp\u003eTo better understand how such hypometabolism was linked to changes in glucose metabolism, we performed a series of experiments assessing glucose uptake in HEK293 cells (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB\u0026amp;C).\u003c/p\u003e\n \u003cp\u003eNotably, when compared to the undifferentiated iPSC line (iPS(IMR90)-c4) used to generate the GLUT1DS clones, the net glucose uptake (using \u003csup\u003e14\u003c/sup\u003eC-D-glucose, Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB) in wild-type HEK293 cells (WT) was much lower, with an average value of 39.14\u0026plusmn;0.97 \u0026micro;g/mg protein (versus 249.7\u0026plusmn;61.44 \u0026micro;g/mg protein). GLUT1DS clone showed a further reduction in glucose uptake by about 30% compared to wild-type, with a value of 26.83\u0026plusmn;1.38 \u0026micro;g/mg. A similar outcome was observed when 2-NBDG (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC) was used, as we reported an average value of 20064\u0026plusmn;2429 RFU in wild-type, with an average value of 11158\u0026plusmn;423.5 RFU in the GLUT1DS clone.\u003c/p\u003e\n \u003cp\u003eIn complement to changes in glucose uptake, we investigated changes in the extracellular glucose and L-lactate concentrations as proxies of glucose metabolism in those cells, by measuring concentrations following incubation in fresh medium (5.5mM glucose) for 24 hours (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD\u0026amp;E). Wild-type HEK293 showed a noticeable glucose consumption over this period of time, with an average of 1.67\u0026plusmn;0.03 mM/\u0026micro;g protein. Such concentration was in par with concentrations measured in iAstros conditioned medium (Pervaiz, Mehta and Al-Ahmad, \u003cspan class=\"CitationRef\"\u003e2025\u003c/span\u003e), but also suggests that HEK293 cells are less metabolically active when normalized to the initial glucose concentration in the medium (~\u0026thinsp;25mM). On the other hand, the GLUT1DS clone barely consumed glucose, as the average concentration measured was 4.99\u0026plusmn;0.29 mM/\u0026micro;g protein.\u003c/p\u003e\n \u003cp\u003eFurthermore, differences in extracellular L-lactate levels were more subtle, with a lower extracellular L-lactate level in conditioned medium from the GLUT1DS clone compared to wild-type (183.7\u0026plusmn;12.84 nM and 219.5\u0026plusmn;17.95 nM, respectively).\u003c/p\u003e\n \u003cp\u003eIn conclusion, the GLUT1DS clone showed impaired glucose uptake compared to its parental wild-type clone, as impaired uptake was accompanied by a drastic reduction in glucose consumption and a reduced L-lactate production.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003eGlucose uptake in GLUT1DS-HEK is unlikely driven by compensation from other GLUTs\u003c/h2\u003e\n \u003cp\u003eAs GLUT1 is considered the predominant GLUT isoform expressed at the blood-brain barrier in both astrocytes and brain microvascular endothelial cells (Asano, et al., \u003cspan class=\"CitationRef\"\u003e1991\u003c/span\u003e, Cornford, et al., \u003cspan class=\"CitationRef\"\u003e1994\u003c/span\u003e, Maher, et al., \u003cspan class=\"CitationRef\"\u003e1993\u003c/span\u003e), we speculated that the residual glucose uptake activity measured in our GLUT1DS model was indicative of a reduced, but still functional, GLUT1 transporter activity in such cells. However, Pistek and colleagues (Pistek, et al., \u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e), documented the expression of several GLUT isoforms in HEK293 cells. HEK293 cells express a variety of GLUT isoforms at mRNA levels. However, \u003cem\u003eSLC2A1\u003c/em\u003e is reported as the most abundant \u003cem\u003eSLC2\u003c/em\u003e isoform (followed by \u003cem\u003eSLC2A8\u003c/em\u003e and \u003cem\u003eSLC2A3\u003c/em\u003e in terms of abundance), and at least 5-fold higher expression amongst the different Class I (glucose-selective GLUTs, in contrast to the other GLUTs capable of transporting both glucose and fructose), such as \u003cem\u003eSLC2A2\u003c/em\u003e, \u003cem\u003eSLC2A3\u003c/em\u003e, and \u003cem\u003eSLC2A4\u003c/em\u003e.\u003c/p\u003e\n \u003cp\u003eTherefore, we investigated changes in Class I GLUT isoforms in our HEK-GLUT1DS clone at mRNA and protein levels to rule out any compensation by other GLUT isoforms (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). Notably, we reported a significant decrease in \u003cem\u003eSLC2A1\u003c/em\u003e and \u003cem\u003eSLC2A4\u003c/em\u003e at the mRNA level in the HEK-GLUT1DS clone compared to its wild-type control (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA), while we noted a significant increase in \u003cem\u003eSLC2A3\u003c/em\u003e.\u003c/p\u003e\n \u003cp\u003eTo confirm that such changes at mRNA levels were accompanied by changes at protein levels, we performed immunocytochemistry and flow cytometry experiments (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB\u0026amp;C). With the exception of GLUT1, other Class I GLUT isoforms (GLUT2, GLUT3, and GLUT4) showed no noticeable qualitative differences in immunoreactivity between wild-type and the HEK-GLUT1DS clone. Such unremarkable differences were further confirmed by flow cytometry (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC) Except GLUT1 (in which no fluorescence was detected over the IgG isotype control), no differences in GLUT expression were reported between wild-type and HEK-GLUT1DS clone.\u003c/p\u003e\n \u003cp\u003eIn conclusion, our data suggests that the reduced glucose uptake in our HEK-GLUT1DS clone was unlikely compensated by changes in protein expression of other Class I GLUT isoforms.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n \u003ch2\u003eGLUT1DS clone impaired glucose metabolism is accompanied by a glycolysis collapse and mitochondrial distress\u003c/h2\u003e\n \u003cp\u003eTo better understand the impact of GLUT1 truncation (and its reduced cellular glucose uptake and metabolism) on HEK293 glucose metabolism profile, we performed a series of experiments assessing changes in glycolysis and mitochondrial respiration, using the Seahorse\u0026copy; cell flux analyzer (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eA preliminary analysis of the cell energetic profile under basal conditions (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA) suggests that HEK293 cells harbor an energetic profile marked by a mixture of both glycolysis and mitochondrial respiration (oxidative phosphorylation), marked by a high extracellular acidification rate (ECAR) and oxygen consumption rate (OCR). However, our GLUT1DS clone showed a \u0026ldquo;quiescent\u0026rdquo; phenotype, marked by low ECAR and OCR values.\u003c/p\u003e\n \u003cp\u003eNext, we assessed changes in glycolysis (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB\u0026amp;C). The GLUT1DS clone responded to glycolytic stimulus (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB) was blunted and failed to compensate following blockade of mitochondrial activity with oligomycin treatment. A more detailed analysis of several glycolytic parameters (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eC) showed a complete collapse of glycolysis in the GLUT1DS clone. To better understand if our GLUT1DS clone compensated its energy need by compensating with mitochondrial respiration, we performed a series of experiments using the Mitostress\u0026copy; kit (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eD\u0026amp;E). GLUT1DS cells showed a 50% reduction in the basal respiration (BASAL) compared to their wild-type (WT) counterpart, as well as their ATP production (ATP). The highest decrease reported for the maximal mitochondrial respiration (MAX) with an 85% decrease in values observed in the GLUT1DS clone compared to wild-type, as well as a virtually zero spare capacity (CAP). Surprisingly, we noted no difference when it comes to proton leak (LEAK) and non-mitochondrial oxygen consumption (NONMITO). This impaired mitochondrial activity in GLUT1DS was further confirmed by the observation of reduced radical oxygen species (ROS) production in GLUT1DS cells compared to WT (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eF) using MitoSOX, as we noted a 50% decrease.\u003c/p\u003e\n \u003cp\u003eFinally, we determined the impact of such impaired energetic metabolism on the ATP production, using the ATP rate assay (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eG). Notably, HEK293 heavily relies on glycolysis (~\u0026thinsp;75% total ATP) to fulfill its energy needs. GLUT1DS showed a 60% decrease in total ATP production compared to their wild-type, although the ratio between glycolytic (glycoATP) versus non-glycolytic (mitoATP) remained about the same.\u003c/p\u003e\n \u003cp\u003eTo understand how glucose is utilized upon entering the GLUT1Ds clone, we performed a glucose-6-phosphate dehydrogenase (G6PD) activity assay (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eH). GLUT1DS showed a significant increase in G6PD activity compared to wild-type, with an increase of ~\u0026thinsp;23% (36.08\u0026plusmn;0.82 U/L/\u0026micro;g protein versus 46.65\u0026plusmn;1.07 U/L/\u0026micro;g protein).\u003c/p\u003e\n \u003cp\u003eTo summarize, our data indicate that the GLUT1 truncation has a significant effect on HEK293 energy metabolism, with a critical effect on glucose metabolism by impacting both glycolysis and oxidative phosphorylation while enhancing the reliance on the pentose phosphate pathway (PPP).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n \u003ch2\u003eGLUT1DS-HEK293 clone has decreased cell growth and impaired cell morphology\u003c/h2\u003e\n \u003cp\u003eFinally, we assessed changes in HEK293 phenotype by assessing changes in cell morphology and proliferation, using the LiveCyte\u0026reg; live cell imaging system (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eNo differences in gross morphology was observed between wild-type and GLUT1DS HEK293 cells (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA). However, a more detailed morphological analysis obtained from a 72-hour recording using the LiveCyte\u0026reg; (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eB) indicates that GLUT1DS doubling time was increased by 40% (47.58\u0026plusmn;2.63 versus 33.46\u0026plusmn; hours) compared to wild-type, with similar outcomes when accounting for dry mass doubling time. GLUT1DS also displayed a 26% increase (3.20 \u0026plusmn; 0.05 versus 2.53 \u0026plusmn; 0.12 \u0026micro;m) in cell thickness and a 13% increase (0.50 \u0026plusmn; 0.003 versus 0.44 \u0026plusmn; 0.012 \u0026micro;m) in cell sphericity. On the other hand, GLUT1DS cells showed a 15% decrease (5.20\u0026plusmn;0.07 versus 6.15\u0026plusmn;0.05nm/sec) in instantaneous velocity (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD) compared to wild-type.\u003c/p\u003e\n \u003cp\u003eIn conclusion, these results suggest that GLUT1DS show subtle but significant alterations in their morphology and motility, which suggests a sign of cellular distress.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eGlucose constitutes the major source of energy for mammalian cells, with certain organs and tissues, such as the central nervous system (CNS), highly dependent on its steady supply. The cellular entry of glucose inside the CNS is solely facilitated by the glucose transporter 1 (GLUT1) isoform, a GLUT isoform highly expressed at the blood-brain barrier (BBB).\u003c/p\u003e\u003cp\u003eImpairment of GLUT1 activity at the BBB is well-documented to be associated with GLUT1 Deficiency Syndrome (GLUT1DS, an autosomal dominant disease associated with mutations in the \u003cem\u003eSLC2A1\u003c/em\u003e gene). In our previous studies (Pervaiz, Mehta and Al-Ahmad, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2025\u003c/span\u003e, Pervaiz, Zahra, Mikelis and Al-Ahmad, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), we have developed an \u003cem\u003ein vitro\u003c/em\u003e model of GLUT1DS using human induced pluripotent stem cells (iPSCs) that were differentiated into astrocyte-like (iAstros) and brain endothelial cell-like (iBMECs) cells.\u003c/p\u003e\u003cp\u003eAlthough these cells shared a similar phenotype when it came to differentiation and reduced glucose uptake, they also displayed notable differences in terms of energetic profile, in particular when it comes to glycolysis and mitochondrial respiration.\u003c/p\u003e\u003cp\u003eFurthermore, the presence of a residual, but significant, glucose uptake in those cells either undifferentiated or differentiated raised the question about the ability of GLUT1 to function solely with four transmembrane domains.\u003c/p\u003e\u003cp\u003eThe goal of this study was a continuation of such previous studies performed by our group and to provide the impact of GLUT1 truncation in HEK293 cells, a non-cerebral cell type that is also a versatile model for transfection and protein expression studies (Simmons, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e1990\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eInterestingly, the GLUT1DS HEK293 clone displayed a 40% decrease in \u003cem\u003eSLC2A1\u003c/em\u003e gene expression at the mRNA level (using a primer targeting the exon 5) compared to its parental wild-type clone.\u003c/p\u003e\u003cp\u003eAlthough a similar observation was done in our GLUT1DS-iAstros and GLUT1DS-iBMECs (Pervaiz, Mehta and Al-Ahmad, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2025\u003c/span\u003e, Pervaiz, Zahra, Mikelis and Al-Ahmad, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), the extent of such a decrease was much less than the decrease (~\u0026thinsp;90% decrease) observed in our differentiated cells. A possible explanation to such difference could be explained by the nature of astrocytes and brain endothelial cells, in which GLUT1 is the most prominent GLUT isoform expressed by these cell types, about 10-fold higher than HEK293 cells (Mehta, et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). We cannot exclude that epigenetic differences may occur between cell types when it comes to GLUT1 expression at mRNA and/or protein levels, which may impact on its own gene regulation.\u003c/p\u003e\u003cp\u003eThe other interesting aspect noticed in our study is the actual reduction in glucose uptake between the wild-type and the GLUT1DS clone. We reported a 40% decrease in our GLUT1DS HEK293 clone, which is aligning with the values reported in our iAstros and iBMECs (~\u0026thinsp;50% decrease). This allows to speculate that the presence of a 4th transmembrane domain may not be necessary for the maintenance of a residual activity as our GLUT1DS HEK clone (which lacks such 4th transmembrane domain) showed no aggravation in glucose uptake. However, we cannot exclude that some compensatory mechanisms involving other GLUT isoforms (including Class II and Class III isoforms) maybe tempering such observation. Therefore, providing an absolute quantification (e.g. using an LC-MS analytical approach) of GLUT isoforms expression in HEK293 cells (and by extension to any cell types) would help distinguish such subtleties by addressing the presence or the absence of compensation between GLUTs.\u003c/p\u003e\u003cp\u003eInterestingly, we also noted notable differences in normalized glucose uptake between the radiolabelled \u003csup\u003e14\u003c/sup\u003eC-D-glucose and its fluorescent counterpart the 2-NBDG, with the latter showing a more accentuated decrease in the GLUT1DS clone. We cannot exclude differences inherent to the data normalization; however we are also possibly observing differences in affinity of GLUT1 towards these two markers as reported by Hamilton and colleagues on L929 fibroblasts (Hamilton, et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eFinally, the major finding in this study is the complete collapse in glycolysis (and in a lesser extent in mitochondrial respiration) in the GLUT1DS HEK293 cells. Such cells showed lower ECAR values under resting conditions compared to their wild-type. More importantly, these cells failed to increase their ECAR value following the addition of glucose in the incubation medium and failed to direct their ATP production exclusively through glycolysis when incubated in the presence of oligomycin. Such impairment was visible in the calculated glycolytic parameters obtained from such experiments, in which E11 cells showed a complete collapse of such value. By contrast, although the glycolysis was impaired in our GLUT1DS-iBMECs (Pervaiz, Zahra, Mikelis and Al-Ahmad, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), it never reached such intensity. The complete shutdown of glycolysis was accompanied by the subsequent adoption of the pentose phosphate pathway (PPP) in the GLUT1DS clone. This metabolic shift is evidenced by the increased G6PD activity, suggesting that the GLUT1DS clone may rely on the PPP to counter the glucose deprivation-mediated oxidative stress. Studies have shown that inhibiting glycolysis can redirect metabolic flux toward the oxidative branch of the pentose phosphate pathway (oxPPP), particularly under oxidative stress conditions (Britt, et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, Stincone, et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Furthermore, the upregulation of the PPP is supported by the observed reduction in mitochondrial ROS production in GLUT1DS cells. As the PPP serves as a major source of cytosolic NADPH, this shift likely helps in mitigating oxidative damage and supporting bioenergetic needs. These findings highlight the metabolic plasticity of HEK293 cells in response to GLUT1 deficiency and suggest a critical role for the PPP in maintaining redox balance under conditions of impaired glucose uptake. Further research is required to fully elucidate the regulatory mechanisms governing this shift and its broader implications for cellular energy metabolism. This differential behavior between GLUT1DS-iBMECs (which maintains a partial or almost full-length 4th transmembrane domain) and GLUT1DS-HEK293 cells (which lacks completely such 4th transmembrane domain) further suggests the importance of such domain in the maintenance of residual activity, as such domain plays an important function in the glucose transport activity (Deng, Xu, Sun, Wu, Yan, Hu and Yan, 2014, Kapoor, et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn addition, our findings suggest that the use of the cell flux analyzer (such as used in the Seahorse\u0026reg; glycolytic stress test) may be an adequate surrogate marker to assess the impact of genetic alteration of GLUT1 on the effective impact on glucose metabolism. Our next goal is to perform rescue experiments by transfecting our GLUT1DS-HEK293 cells with plasmids encoding for a full-length wild-type GLUT1 and documenting changes in glycolysis.\u003c/p\u003e\u003cp\u003eIn conclusion, this study provides a characterization and validation of a GLUT1DS-HEK293 platform that lacks a functional GLUT1 transporter and exhibits impaired glucose metabolism, providing a potential screening platform for genotype-phenotype association studies focusing on GLUT1, which eventually will provide a potent tool to better understand how documented mutations associated with GLUT1DS impact the activity of GLUT1 transporter.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cem\u003eAcknowledgments and funding\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to acknowledge the Jerry H. Hodge School of Pharmacy (JHH-SOP) Office of Sciences for granting access to their confocal and flow cytometry core facilities. This study was funded by a JHH-SOP Office of Sciences seed grant to AJA.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eEthics approval and consent to participate.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAvailability of data and materials\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCompeting Interests\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no competing interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAuthors\u0026rsquo; contributions\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAJA designed the study, performed the data analysis, and wrote the manuscript. YM performed the experiments, collected and processed the results, and contributed to the data analysis and manuscript writing\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAsano T, Katagiri H, Takata K, Lin JL, Ishihara H, Inukai K, Tsukuda K, Kikuchi M, Hirano H, Yazaki Y, et al. (1991) The role of N-glycosylation of GLUT1 for glucose transport activity. J Biol Chem 266:24632-24636\u003c/li\u003e\n\u003cli\u003eBak LK, Schousboe A, Sonnewald U, Waagepetersen HS (2006) Glucose is necessary to maintain neurotransmitter homeostasis during synaptic activity in cultured glutamatergic neurons. J Cereb Blood Flow Metab 26:1285-1297\u003c/li\u003e\n\u003cli\u003eBritt EC, Lika J, Giese MA, Schoen TJ, Seim GL, Huang Z, Lee PY, Huttenlocher A, Fan J (2022) Switching to the cyclic pentose phosphate pathway powers the oxidative burst in activated neutrophils. Nature metabolism 4:389-403\u003c/li\u003e\n\u003cli\u003eCornford EM, Hyman S, Swartz BE (1994) The human brain GLUT1 glucose transporter: ultrastructural localization to the blood-brain barrier endothelia. J Cereb Blood Flow Metab 14:106-112\u003c/li\u003e\n\u003cli\u003eDeng D, Xu C, Sun P, Wu J, Yan C, Hu M, Yan N (2014) Crystal structure of the human glucose transporter GLUT1. Nature 510:121-125\u003c/li\u003e\n\u003cli\u003eDeng D, Yan N (2016) GLUT, SGLT, and SWEET: Structural and mechanistic investigations of the glucose transporters. Protein Sci 25:546-558\u003c/li\u003e\n\u003cli\u003eDienel GA (2019) Brain Glucose Metabolism: Integration of Energetics with Function. Physiol Rev 99:949-1045\u003c/li\u003e\n\u003cli\u003eGras D, Roze E, Caillet S, Meneret A, Doummar D, Billette de Villemeur T, Vidailhet M, Mochel F (2014) GLUT1 deficiency syndrome: an update. Rev Neurol (Paris) 170:91-99\u003c/li\u003e\n\u003cli\u003eHamilton KE, Bouwer MF, Louters LL, Looyenga BD (2021) Cellular binding and uptake of fluorescent glucose analogs 2-NBDG and 6-NBDG occurs independent of membrane glucose transporters. Biochimie 190:1-11\u003c/li\u003e\n\u003cli\u003eHolman GD (2020) Structure, function and regulation of mammalian glucose transporters of the SLC2 family. Pflugers Arch 472:1155-1175\u003c/li\u003e\n\u003cli\u003eKahlig CI, Moser S, Micutkova L, Grillari J, Kraus B, Hernandez Bort JA (2024) Enhancement of rAAV titers via inhibition of the interferon signaling cascade in transfected HEK293 suspension cultures. Biotechnol J 19:e2300672\u003c/li\u003e\n\u003cli\u003eKapoor K, Finer-Moore JS, Pedersen BP, Caboni L, Waight A, Hillig RC, Bringmann P, Heisler I, Muller T, Siebeneicher H, Stroud RM (2016) Mechanism of inhibition of human glucose transporter GLUT1 is conserved between cytochalasin B and phenylalanine amides. Proceedings of the National Academy of Sciences of the United States of America 113:4711-4716\u003c/li\u003e\n\u003cli\u003eKoepsell H (2020) Glucose transporters in brain in health and disease. Pflugers Arch 472:1299-1343\u003c/li\u003e\n\u003cli\u003eKolic I, Radic Nisevic J, Vlasic Cicvaric I, Butorac Ahel I, Lah Tomulic K, Segulja S, Baraba Dekanic K, Serifi S, Ovuka A, Prpic I (2021) GLUT1 Deficiency Syndrome\u0026mdash;Early Treatment Maintains Cognitive Development?(Literature Review and Case Report). Genes 12:1379\u003c/li\u003e\n\u003cli\u003eLeen WG, Klepper J, Verbeek MM, Leferink M, Hofste T, van Engelen BG, Wevers RA, Arthur T, Bahi-Buisson N, Ballhausen D, Bekhof J, van Bogaert P, Carrilho I, Chabrol B, Champion MP, Coldwell J, Clayton P, Donner E, Evangeliou A, Ebinger F, Farrell K, Forsyth RJ, de Goede CG, Gross S, Grunewald S, Holthausen H, Jayawant S, Lachlan K, Laugel V, Leppig K, Lim MJ, Mancini G, Marina AD, Martorell L, McMenamin J, Meuwissen ME, Mundy H, Nilsson NO, Panzer A, Poll-The BT, Rauscher C, Rouselle CM, Sandvig I, Scheffner T, Sheridan E, Simpson N, Sykora P, Tomlinson R, Trounce J, Webb D, Weschke B, Scheffer H, Willemsen MA (2010) Glucose transporter-1 deficiency syndrome: the expanding clinical and genetic spectrum of a treatable disorder. Brain 133:655-670\u003c/li\u003e\n\u003cli\u003eMaher F, Vannucci SJ, Simpson IA (1993) Glucose transporter isoforms in brain: absence of GLUT3 from the blood-brain barrier. J Cereb Blood Flow Metab 13:342-345\u003c/li\u003e\n\u003cli\u003eMauri A, Duse A, Palm G, Previtali R, Bova SM, Olivotto S, Benedetti S, Coscia F, Veggiotti P, Cereda C (2022) Molecular Genetics of GLUT1DS Italian Pediatric Cohort: 10 Novel Disease-Related Variants and Structural Analysis. Int J Mol Sci 23:\u003c/li\u003e\n\u003cli\u003eMehta Y, Patel D, Pervaiz I, Bickel U, Al-Ahmad AJ (2025) Targeted proteomics for absolute quantification of glucose transporter 1 in mammalian brain cells using liquid chromatography-mass spectrometry. Journal of Chromatography Open 7:100198\u003c/li\u003e\n\u003cli\u003eMueckler M, Thorens B (2013) The SLC2 (GLUT) family of membrane transporters. Molecular aspects of medicine 34:121-138\u003c/li\u003e\n\u003cli\u003eNavale AM, Paranjape AN (2016) Glucose transporters: physiological and pathological roles. Biophys Rev 8:5-9\u003c/li\u003e\n\u003cli\u003ePearson TS, Akman C, Hinton VJ, Engelstad K, De Vivo DC (2013) Phenotypic spectrum of glucose transporter type 1 deficiency syndrome (Glut1 DS). Current neurology and neuroscience reports 13:1-9\u003c/li\u003e\n\u003cli\u003ePervaiz I, Mehta Y, Al-Ahmad AJ (2025) Glucose Transporter 1 Deficiency Impairs Glucose Metabolism and Barrier Induction in Human Induced Pluripotent Stem Cell-Derived Astrocytes. J Cell Physiol 240:e31523\u003c/li\u003e\n\u003cli\u003ePervaiz I, Zahra FT, Mikelis CM, Al-Ahmad AJ (2022) An in vitro model of glucose transporter 1 deficiency syndrome at the blood-brain barrier using induced pluripotent stem cells. J Neurochem 162:483-500\u003c/li\u003e\n\u003cli\u003ePistek M, Kahlig CI, Hackl M, Unterthurner S, Kraus B, Grabherr R, Grillari J, Hernandez Bort JA (2023) Comprehensive mRNA-sequencing-based characterization of three HEK-293 cell lines during an rAAV production process for gene therapy applications. Biotechnol J 18:e2200513\u003c/li\u003e\n\u003cli\u003eSeidner G, Alvarez MG, Yeh JI, O\u0026apos;Driscoll KR, Klepper J, Stump TS, Wang D, Spinner NB, Birnbaum MJ, De Vivo DC (1998) GLUT-1 deficiency syndrome caused by haploinsufficiency of the blood-brain barrier hexose carrier. Nat Genet 18:188-191\u003c/li\u003e\n\u003cli\u003eSimmons NL (1990) A cultured human renal epithelioid cell line responsive to vasoactive intestinal peptide. Exp Physiol 75:309-319\u003c/li\u003e\n\u003cli\u003eStincone A, Prigione A, Cramer T, Wamelink MM, Campbell K, Cheung E, Olin‐Sandoval V, Gr\u0026uuml;ning NM, Kr\u0026uuml;ger A, Tauqeer Alam M (2015) The return of metabolism: biochemistry and physiology of the pentose phosphate pathway. Biological Reviews 90:927-963\u003c/li\u003e\n\u003cli\u003eVannucci SJ, Clark RR, Koehler-Stec E, Li K, Smith CB, Davies P, Maher F, Simpson IA (1998) Glucose transporter expression in brain: relationship to cerebral glucose utilization. Dev Neurosci 20:369-379\u003c/li\u003e\n\u003cli\u003eVaresio C, Pasca L, Parravicini S, Zanaboni MP, Ballante E, Masnada S, Ferraris C, Bertoli S, Tagliabue A, Veggiotti P, De Giorgis V (2019) Quality of Life in Chronic Ketogenic Diet Treatment: The GLUT1DS Population Perspective. Nutrients 11:\u003c/li\u003e\n\u003cli\u003eZhang M-J, Wu D, Yu L-F, Li H, Sun D, Liang J-M, Lu X-P, Luo R, Guo Q-H, Jin R-F (2025) Diagnosis and treatment recommendations for glucose transporter 1 deficiency syndrome. World Journal of Pediatrics 1-10\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"cell-and-tissue-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ctre","sideBox":"Learn more about [Cell and Tissue Research](https://link.springer.com/journal/441)","snPcode":"441","submissionUrl":"https://submission.springernature.com/new-submission/441/3","title":"Cell and Tissue Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Glucose, HEK293, glycolysis, GLUT1 Deficiency Syndrome","lastPublishedDoi":"10.21203/rs.3.rs-7546700/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7546700/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eGlucose represents a major source of energy for mammalian cells. In such cells, glucose uptake is facilitated by the presence of various glucose transporters (GLUTs). Amongst the different GLUT isoforms expressed in mammalian cells, GLUT1 is a major isoform expressed during development, but becomes restricted to a select number of cell types in adult cells, which includes red blood cells, brain microvascular endothelial cells, or astrocytes.\u003c/p\u003e\u003cp\u003eGLUT1-deficiency syndrome (GLUT1DS) is an autosomal dominant neurological disease characterized by reduced cerebral glucose and lactate uptake in patients. We previously documented the impact of GLUT1DS on the glucose uptake and homeostasis in human pluripotent stem cell-derived brain microvascular endothelial cells and astrocytes. Although such cells showed similarities in terms of impaired glucose uptake, we also noticed differences in their metabolic adaptation to such impairment.\u003c/p\u003e\u003cp\u003eThis study aims to assess the impact of GLUT1DS on non-cerebral cells by investigating the impact of impaired GLUT1 in GLUT1-deficient human embryonic kidney cells (GLUT1DS-HEK293).\u003c/p\u003e\u003cp\u003eOur results suggest that GLUT1DS-HEK293 cells were viable but displayed altered cell doubling and cell morphology, reduced glucose uptake and consumption (with no apparent compensation by other GLUT isoforms), while accompanied by a severe reduction in cell glycolytic activity and a marked deficit in ATP production.\u003c/p\u003e\u003cp\u003eTaken together, our study demonstrates that the impairment of GLUT1 activity in human cells shares common phenotypic outcomes between various cell types but also displays unique cellular responses when it comes to metabolic adaptation to energy deficit, partially explaining the impact on tissues in GLUT1DS patients.\u003c/p\u003e","manuscriptTitle":"Glucose transporter 1 deficiency impairs glucose homeostasis, cell proliferation, and morphology in human embryonic kidney cells 293","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-23 02:33:53","doi":"10.21203/rs.3.rs-7546700/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-10-07T11:42:15+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-06T22:01:58+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-24T16:56:39+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"16515832865803900201847239151076243184","date":"2025-09-19T15:05:00+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"220317340862157486703349557558546556101","date":"2025-09-15T23:56:44+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-12T14:19:08+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-08T05:58:09+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-08T05:57:28+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell and Tissue Research","date":"2025-09-05T18:52:11+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"cell-and-tissue-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ctre","sideBox":"Learn more about [Cell and Tissue Research](https://link.springer.com/journal/441)","snPcode":"441","submissionUrl":"https://submission.springernature.com/new-submission/441/3","title":"Cell and Tissue Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"c75f84e5-111d-4e1f-8fe5-d73431c869a7","owner":[],"postedDate":"September 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-30T16:18:28+00:00","versionOfRecord":{"articleIdentity":"rs-7546700","link":"https://doi.org/10.1007/s00441-026-04061-w","journal":{"identity":"cell-and-tissue-research","isVorOnly":false,"title":"Cell and Tissue Research"},"publishedOn":"2026-03-25 16:12:08","publishedOnDateReadable":"March 25th, 2026"},"versionCreatedAt":"2025-09-23 02:33:53","video":"","vorDoi":"10.1007/s00441-026-04061-w","vorDoiUrl":"https://doi.org/10.1007/s00441-026-04061-w","workflowStages":[]},"version":"v1","identity":"rs-7546700","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7546700","identity":"rs-7546700","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.