Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health

preprint OA: closed
Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-14

Researchers developed and validated liquid culture media that mimic upper and lower airway conditions in health and cystic fibrosis to study bacterial adaptation.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-14 · read from full text

The paper describes the development of liquid culture media designed to mimic the chemical and physical conditions found in the sinuses and lungs of cystic fibrosis patients versus healthy conditions, with the goal of improving in vitro relevance for microbial or cellular studies. Using a media-engineering approach, the authors formulate culture conditions meant to better reproduce environment-specific factors rather than using standard laboratory broth. They report that these tailored liquid culture media can be used to model health- and cystic-fibrosis–associated environments in a controlled way, though the text provided does not specify detailed performance metrics or any limitations stated by the authors. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

The respiratory tract is a compartmentalised and heterogenous environment. The nasopharynx and sinuses of the upper airways have distinct properties from the lungs and these differences may shape bacterial adaptation and evolution. Upper airway niches act as early colonisation sites for respiratory bacterial pathogens, including those, such as Pseudomonas aeruginosa , that can go on to establish chronic infection of the lungs in people with cystic fibrosis (CF). Despite the importance of upper airway environments in facilitating early adaptation to host environments, currently available in vitro models for study of respiratory infection in CF focus exclusively on the lungs. Furthermore, animal models, widely used to bridge the gap between in vitro systems and the clinical scenario, do not allow the upper and lower airways to be studied in isolation. We have developed a suite of culture media reproducing key features of the upper and lower airways, for the study of bacterial adaptation and evolution in different respiratory environments. For both upper and lower airway-mimicking media, we have developed formulations that reflect airway conditions in health and those that reflect the altered environment of the CF respiratory tract. Here, we describe the development and validation of these media and their use for study of genetic and phenotypic adaptations in P. aeruginosa during growth under upper or lower airway conditions in health and in CF.
Full text 277,508 characters · extracted from preprint-html · click to expand
Development of liquid culture media mimicking the... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/11-1007" }, "headline": "Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and...", "datePublished": "2022-09-07T08:52:05", "dateModified": "2022-11-30T10:52:58", "author": [ { "@type": "Person", "name": "Dilem Ruhluel" }, { "@type": "Person", "name": "Siobhan O'Brien" }, { "@type": "Person", "name": "Joanne L Fothergill" }, { "@type": "Person", "name": "Daniel R Neill" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": "The respiratory tract is a compartmentalised and heterogenous environment. The nasopharynx and sinuses of the upper airways have distinct properties from the lungs and these differences may shape bacterial adaptation and evolution. Upper airway niches act as early colonisation sites for respiratory bacterial pathogens, including those, such as Pseudomonas aeruginosa, that can go on to establish chronic infection of the lungs in people with cystic fibrosis (CF). Despite the importance of upper airway environments in facilitating early adaptation to host environments, currently available in vitro models for study of respiratory infection in CF focus exclusively on the lungs. Furthermore, animal models, widely used to bridge the gap between in vitro systems and the clinical scenario, do not allow the upper and lower airways to be studied in isolation. We have developed a suite of culture media reproducing key features of the upper and lower airways, for the study of bacterial adaptation and evolution in different respiratory environments. For both upper and lower airway-mimicking media, we have developed formulations that reflect airway conditions in health and those that reflect the altered environment of the CF respiratory tract. Here, we describe the development and validation of these media and their use for study of genetic and phenotypic adaptations in P. aeruginosa during growth under upper or lower airway conditions in health and in CF." } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/11-1007/v2", "name": "Development of liquid culture media mimicking the conditions of sinuses..." } } ] } Home Browse Development of liquid culture media mimicking the conditions of sinuses... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Ruhluel D, O'Brien S, Fothergill JL and Neill DR. Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health [version 2; peer review: 2 approved] . F1000Research 2022, 11 :1007 ( https://doi.org/10.12688/f1000research.125074.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Method Article Revised Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health [version 2; peer review: 2 approved] Dilem Ruhluel https://orcid.org/0000-0001-8867-2925 1 , Siobhan O'Brien https://orcid.org/0000-0003-2741-6172 2 , Joanne L Fothergill 1 , Daniel R Neill https://orcid.org/0000-0002-7911-8153 1 Dilem Ruhluel https://orcid.org/0000-0001-8867-2925 1 , Siobhan O'Brien https://orcid.org/0000-0003-2741-6172 2 , Joanne L Fothergill 1 , Daniel R Neill https://orcid.org/0000-0002-7911-8153 1 PUBLISHED 30 Nov 2022 Author details Author details 1 University of Liverpool, Institute of Infection, Veterinary and Ecological Sciences,, Liverpool, L69 7BE, UK 2 Department of Microbiology, Moyne Institute of Preventive Medicine, Trinity College, Dublin, 2, Ireland Dilem Ruhluel Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Siobhan O'Brien Roles: Methodology, Project Administration, Supervision Joanne L Fothergill Roles: Conceptualization, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Writing – Review & Editing Daniel R Neill Roles: Conceptualization, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the NC3Rs gateway. Abstract The respiratory tract is a compartmentalised and heterogenous environment. The nasopharynx and sinuses of the upper airways have distinct properties from the lungs and these differences may shape bacterial adaptation and evolution. Upper airway niches act as early colonisation sites for respiratory bacterial pathogens, including those, such as Pseudomonas aeruginosa , that can go on to establish chronic infection of the lungs in people with cystic fibrosis (CF). Despite the importance of upper airway environments in facilitating early adaptation to host environments, currently available in vitro models for study of respiratory infection in CF focus exclusively on the lungs. Furthermore, animal models, widely used to bridge the gap between in vitro systems and the clinical scenario, do not allow the upper and lower airways to be studied in isolation. We have developed a suite of culture media reproducing key features of the upper and lower airways, for the study of bacterial adaptation and evolution in different respiratory environments. For both upper and lower airway-mimicking media, we have developed formulations that reflect airway conditions in health and those that reflect the altered environment of the CF respiratory tract. Here, we describe the development and validation of these media and their use for study of genetic and phenotypic adaptations in P. aeruginosa during growth under upper or lower airway conditions in health and in CF. READ ALL READ LESS Keywords Cystic Fibrosis (CF), sinuses, lungs, in vitro models, 3Rs Corresponding Author(s) Dilem Ruhluel ( [email protected] ) Joanne L Fothergill ( [email protected] ) Daniel R Neill ( [email protected] ) Close Corresponding authors: Dilem Ruhluel, Joanne L Fothergill, Daniel R Neill Competing interests: No competing interests were disclosed. Grant information: This work is supported by an NC3Rs PhD studentship grant (NC/S001700/1), awarded to DN and JF. JF and DN acknowledge grant support for the Strategic Research Centre (SRC) “An evidence-based preclinical framework for the development of antimicrobial therapeutics in cystic fibrosis” (PIPE-CF; Project No. SRC 022) from the UK Cystic Fibrosis Trust and CF Foundation (US). Copyright: © 2022 Ruhluel D et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Ruhluel D, O'Brien S, Fothergill JL and Neill DR. Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health [version 2; peer review: 2 approved] . F1000Research 2022, 11 :1007 ( https://doi.org/10.12688/f1000research.125074.2 ) First published: 07 Sep 2022, 11 :1007 ( https://doi.org/10.12688/f1000research.125074.1 ) Latest published: 30 Nov 2022, 11 :1007 ( https://doi.org/10.12688/f1000research.125074.2 ) Revised Amendments from Version 1 This revised version of the manuscript contains additional statistical analysis, to compare the phenotypes of two Pseudomonas aeruginosa strains, PAO1 and LESB65, in respiratory-mimicking media. The data for these two strains were originally shown on separate graphs. In this revised version, they are now presented on single graphs, to aid comparison. We additionally include some further discussion points, regarding further validation steps that could be undertaken with the media. This revised version of the manuscript contains additional statistical analysis, to compare the phenotypes of two Pseudomonas aeruginosa strains, PAO1 and LESB65, in respiratory-mimicking media. The data for these two strains were originally shown on separate graphs. In this revised version, they are now presented on single graphs, to aid comparison. We additionally include some further discussion points, regarding further validation steps that could be undertaken with the media. See the authors' detailed response to the review by Sheyda Azimi and Jelly Vanderwoude See the authors' detailed response to the review by Ville-Petri Friman READ REVIEWER RESPONSES Research highlights Scientific benefit(s): Allows: • Study of bacterial pathogenicity in infection relevant conditions of compartmentalised airway niches • Study of bacterial host adaptation in cystic fibrosis (CF) and other respiratory diseases 3Rs benefit(s): • Reduces the need for vertebrates in respiratory microbiology by providing a pre-screening platform for bacterial pathogenicity and host-pathogen interaction related research questions Practical benefit(s): • Inexpensive, simple to operate, no training required • Chemically defined and easy to manipulate the content of the media to study different research questions, with several respiratory pathogens Current applications: • Suitable for studying phenotypes including bacterial growth, antimicrobial resistance, biofilm formation, • Suitable for studying bacterial gene expression in health and CF under relevant host stresses Potential applications: Offers a platform for: • Studying long term evolution of bacteria in health and infection relevant media • Studying different pathogen combinations and how they affect virulence and resistance • Combining with cell or tissue-based models to fully capture the chemical and cellular characteristics of different airway niches in the lab environment • Assessing efficacy of drugs and therapeutics under relevant conditions Introduction Cystic Fibrosis (CF) is an autosomal recessive genetic disorder caused by mutations in the cystic fibrosis transmembrane conductance regulator ( CFTR ) gene, located on the long arm of chromosome 7. 1 CFTR protein functions as an apical ion channel. 1 CF has a range of severities, with airway disease being the main cause of morbidity and mortality. 1 Defects in CFTR affect its ion transporting functions, leading to accumulation of sticky mucus on epithelial surfaces in affected organs, including the lungs, sinuses, pancreas, gastrointestinal tract, sweat glands and reproductive tract. 1 The warm, humid and nutrient rich environment of CF airways supports growth of various bacteria. Pseudomonas aeruginosa is one of the most commonly isolated bacterial pathogens of the airways of people with CF (PwCF). 2 P. aeruginosa is a Gram-negative aerobic/facultative anaerobic bacterium found in high abundance in external environments. 2 P. aeruginosa colonization and infection of the airways is a significant contributor to morbidity and mortality in PwCF. 3 When P. aeruginosa enters into the airways from an environmental source, it not only must adapt to the changes in nutritional and physiochemical status associated with the airway environment, but also to stresses exerted from intense antimicrobial pressure and the actions of immune responses, competition from resident microbiota and viscous mucus-related osmotic stresses. 2 All of these factors influence the adaptation and evolution of P. aeruginosa within respiratory niches. 2 P. aeruginosa has a >6 Mb 4 plastic genome that facilitates rapid adaptation to environmental stimuli. 5 Environmental versatility is achieved through the action of regulatory systems, which collectively make up ~8% of the P. aeruginosa genome. 6 Transition from colonization to acute infection and subsequent biofilm-associated chronic infection takes place as a result of changes in these regulatory systems that are key for controlling the expression of virulence factors in response to host environmental cues. 7 The upper respiratory tract (and particularly the paranasal sinuses) has been suggested to be a protective niche for environmentally-acquired P. aeruginosa during early infection. Colonisation of this environment is thought to precede chronic lung infection. 8 , 9 P. aeruginosa has been identified in sinusitis samples and a high level of similarity has been observed between paranasal and lung isolates. 10 The presence of a low number of immune cells and reduced exposure to antibiotics in the upper airways, relative to lungs, provides a transitional niche within which the bacteria can adapt to host conditions before establishing chronic lung infection. Early infection of lungs with environmental P. aeruginosa may be cleared by a combination of host inflammatory responses and antibiotic treatment, but the persistence of the pathogen within the upper airways offers opportunity for later downward reseeding of a host-adapted bacterial population. Armbuster et al. documented the role of the sinuses in P. aeruginosa within-host adaptation in 106 adult CF patients. They found that the sinuses harboured isolates with pathoadaptive characteristics that were previously seen in isolates from sputum and that have been associated with persistence in the CF lung. 11 The continuous cycle of bacterial clearance from lungs and recolonization from sinuses may form an important part of the intermittent colonization stage that precedes chronic lung infection. 12 This proposed route to lung infection was recapitulated in a mouse natural inhalation infection model with P. aeruginosa , where persistence of bacteria in the upper airways was observed over the course of 28 days of infection. Initial colonisation of lungs was cleared within two weeks of infection , in the absence of antibiotic treatment, but P. aeruginosa was isolated from sinuses throughout infection and reappeared in the lungs of all mice at day 28 post-infection, suggesting that long-term upper airway persistence may allow bacterial migration and reseeding to the lower airways. 8 In later studies, this within-host adaptation was linked to loss-of-function mutations in the two component regulatory system gene pmrB, thought to have been acquired during upper airway infection. 13 Isolates carrying pmrB mutations, recovered from the murine airways, showed enhanced potential for establishment and maintenance of lung infection that was linked to increased resistance to lysozyme and increased attachment to host surfaces. Similar loss-of-function mutations were identified in pmrB in clinical isolates from CF. As the experiments undertaken in mice did not involve antibiotic treatment, the selective pressure for the observed changes was hypothesised to be the result of the action of host-derived antimicrobials. 13 Other pathoadaptive characteristics of strains from chronic infections have been identified and include overproduction of alginate, reduction in growth rate, loss of motility, decreased susceptibility to antimicrobials and diversification in colony morphology. 14 – 16 Changes in colony morphologies, towards a so-called ‘wrinkly’ phenotype, were indicated to be the result of redox-drive adaptations to maximize oxygen accessibility in biofilm by increasing the surface area exposed to air. 17 A slow growing phenotype has also been suggested to be a common characteristic of long term CF airway colonization and is thought to develop as a result of continuous activation of stress responses driven by exposure to cells and molecules of the immune system. 18 The respiratory tract is a heterogenous, compartmentalised environment, with the biological, chemical and physical properties of each niche shaping P. aeruginosa adaptive evolution in different ways. A range of in vitro and in vivo models are available for the study of respiratory infection in CF. The most basic of these involve in vitro culture in nutrient rich laboratory media that readily supports bacterial growth. These models are often a poor reflection of the airway environment, as they contain sugars and proteins at concentrations that are not physiologically relevant and they lack important host-derived factors that exert stress on pathogens or that are recognised by microbial environmental sensing systems. These limitations encouraged the development of chemically-defined liquid culture media that better reflect the conditions of the CF airways. Artificial sputum media (ASM), synthetic cystic fibrosis media (SCFM) and their derivatives 19 – 21 capture important chemical aspects of the CF airway environment, including extracellular DNA (eDNA), amino acids and mucins. 20 , 21 These media support infection-relevant biofilm formation and have been of significant value to the research community. Furthermore, they can be combined with host tissue to provide a physical scaffold for biofilm formation. 22 However, these models still lack key molecules of the lung, including host-derived antimicrobials, 23 , 24 polyamines 25 , 26 and a number of factors associated with CF comorbidities, including glucose, which is elevated in lungs in CF-related diabetes compared to healthy individuals, 27 and bile salts, which can be inhaled into lungs during CF-associated gastro-oesophageal reflux. 28 Most currently available in vitro and in vivo models focus on capturing conditions of the lung environment and therefore do not reflect the heterogeneity of the airways and are unsuitable for studying early infection processes that may take place in the sinuses. 21 , 29 Whilst in vivo infection models – most often performed in mice or rats - allow for a more holistic view of infection processes, 30 they are costly, hard to maintain and there are important differences in host-derived antimicrobial structure and function between rodents and man. 31 Furthermore, CF rodent models don’t reproduce the disease phenotypes and severity of human CF. 30 In particular, they poorly replicate the severe pathology of CF lung disease, with the major disease phenotype instead manifesting in the gastrointestinal tract. 32 The generation of gut-corrected CFTR transgenic mice has addressed this issue, but establishing chronic lung infection in these mice remains a challenge. 32 Embedding bacteria within agarose beads and instilling these into the trachea of mice allows for establishment of long-term infection, 33 albeit by an artificial route that requires surgical procedures and which is hard to standardise. Natural inhalation of CF-adapted P. aeruginosa suspended in saline offers an alternative that recapitulates the sinus to lung infection route and allows for long-term infection studies, 8 but this model has other drawbacks, including a relatively low density of infection in lungs. Study of major pathophysiological CF characteristics, such as chronic respiratory infection, inflammation, and mucus plugging, have been hampered by the limitations of existing in vivo models. 32 According to Home Office Report from 2021, 3.06 million procedures were performed involving living animals for scientific purposes. 34 More than half of these procedures were carried out in mice (54%) and 51% of overall procedures were for basic research while 27% was for applied research including human infectious disorders. 34 Moreover, in the field of respiratory microbiology, 10,540 publications report the use of mice for infection (Pubmed search “respiratory infection mouse” 2015-2022), more than half of these being for bacterial infections (6,274). Development of well-characterised respiratory mimicking media would offer opportunities for both replacement and reduction in such studies. With the aim of understanding the applicability of available in vivo and in vitro models to study human infections, Cornforth et al developed a computational framework that uses transcriptomic data from P. aeruginosa grown under different environmental conditions and benchmarks it against the gene expression patterns observed in clinical CF sputum samples. This approach has been used to assess the clinical relevance of in vitro and in vivo models, with results suggesting that in vitro models are as good as or better than mouse lung infection models at mimicking the P. aeruginosa transcriptome in human CF sputum. 35 Given the limitations of the available animal models for study of CF infection and bacterial within-host adaptation, we sought to develop novel culture media that mimics the conditions of compartmentalised airway regions. To enable study of early infection processes taking place in the upper airways, we designed sinus-mimicking media reflective of conditions in health or in CF (healthy sinus media [HSM] and CF sinus media [CFSM]). In parallel, we developed media reflective of the lungs in health or CF (healthy lung media [HLM] and CF lung media [CFLM]). The developed CF media will be of use for the study of CF pathogens under infection-relevant conditions, whilst the healthy media equivalents can be used for study of airway infection in other contexts, such as non-CF bronchiectasis, community-acquired or ventilator-acquired pneumonia, that occur without the underlying altered environment that is specific to CF. Many of the differences between airway niches and between health and CF that we aim to capture have been described previously, including in O 2 /CO 2 levels, temperature, 36 lysozyme, 23 lactoferrin, 23 polyamines, 25 , 26 mucins, 37 amino acids, carbon source content 21 and salt concentrations. 38 These media were designed to be cheap, accessible and readily modifiable, according to the research question being asked. Development of validated culture media that are more relevant than using nutrient broth and more cost effective and ethical than animal models can offer a platform to understand bacterial within-host adaptation, to use for isolate virulence or antimicrobial susceptibility testing, for efficacy testing of new therapeutics, or for study of bacterial growth, gene expression and biofilm formation under relevant environmental conditions. Methods Method for media development Microbial strains, base media and culture conditions All P. aeruginosa isolates used in this work are shown in Table 1 . Bacteria were routinely streaked onto Tryptone Soy Agar (TSA) (Sigma-Aldrich) from bead stocks and restreaked every other day to maintain a fresh stock or from bead stocks, as required. After 18 hours of growth on agar, overnight cultures were prepared in 5 ml Lysogeny Broth (LB) (Neogene) at 37°C and incubated for 18 hrs at 180 rpm. M9 medium (1 litre) was prepared by mixing 700 ml M9 salts (15 g/l KH 2 PO 4 , 64 g/l Na 2 HPO 4 , 2.5 g/l NaCl, 5.0 g/l NH 4 Cl) (Sigma-Aldrich) (autoclaved), 2 ml MgSO 4 (autoclaved) (Sigma-Aldrich) and 20 ml 20% glycerol (Sigma-Aldrich) (filter-sterilized), in order. Sterilized water was then used to make up the volume to 1 L. Table 1. Bacterial strains used in this study. Strain Description Origin PAO1 Widely used laboratory reference strain Spontaneous chloramphenicol-resistant mutant of original PAO strain isolated from a wound in Melbourne, Australia 67 LESB65 Liverpool Epidemic Strain B65 CF chronic infection isolate of a transmissible strain from United Kingdom 68 Single chemical growth rate assays Each chemical under consideration for inclusion in the respiratory tract-mimicking media was first assessed by supplementation individually into M9 media at ‘low’, ‘ideal’ or ‘high’ concentrations. Ideal concentrations represent those estimated to most closely reflect the physiological concentration found in each niche, in either health or disease. The relevance of the final list of chemicals included in the final media, in the context of bacterial adaptation to airway environments, is summarised in Table 2 . The tested concentration ranges were determined by reference to the literature or from experimental measurement of metabolites ( Table 3 ). Low and high concentration values were set at 2-fold below and above the ideal concentration of each chemical. Growth rates of PAO1 and LESB65 were assessed in M9 media supplemented with each chemical, using a microplate reader (Varioskan ® LUX, Thermo Scientific) (Underlying data Figures 1-4). 2 μl of bacteria from overnight cultures were added to 198 μl of M9 media supplemented with the appropriate chemical. The bacteria were then incubated in sterile 96-well plates (U-bottom) (Greiner) for 20 hours and the growth rates assessed at OD 600nm at 10 minutes intervals. Incubation conditions were 37°C/5% CO 2 for lung conditions and 34°C/0% CO 2 for sinus conditions. Three biological replicates were performed, per bacterial isolate, per condition. A single working concentration to be used in the final pooled media was then chosen for each chemical, per condition and growth rate assays were performed again with the chosen concentration before the chemicals were combined into a single pooled media. The ‘ideal’ concentration was chosen for the final media unless found to cause complete inhibition of bacterial growth. Table 2. Chemicals included in the media and their importance in shaping the bacterial adaptation in airways. Chemicals Importance in the airways Host-derived antimicrobials • Lysozyme • Lactoferrin • The effectiveness of lysozyme reduces in biofilms and in the chronically infected lung, due to electrostatic sequestration of the enzyme by infection-associated anionic biopolymers 33 , 34 • Pseudomonas aeruginosa acquire mutations leading to resistance against lysosomal killing in the lung. 10 • In CF, activity of lactoferrin can be inhibited by causing partial cleavage via high concentration of cathepsin (neutrophil elastase) and Pseudomonas elastase secretions. 69 Polyamines • Spermidine • Spermine • Putrescine • P. aeruginosa utilizes host-derived polyamines to facilitate antimicrobial tolerance. 25 • Spermidine was shown to readily coat the surface of PmrB - deficient P. aeruginosa , protecting P.aeruginosa from antibiotics and oxidative stress and leading to increase in biofilm formation. 25 Mucin • The abnormal mucin glycosylation in CF promotes bacterial adhesion and infection, via increased exposure of specific glycan receptors. 70 • P. aeruginosa can break down and utilize mucin glycans as monosaccharides. 71 eDNA • Necrosis products of neutrophils and component of extracellular polymeric substance (EPS) in biofilms. • Presence of neutrophils in infection leads to increased biofilm formation as result of formation of eDNA-actin polymers. 72 • Bacterial eDNA can also be secreted by P. aeruginosa to aid biofilm formation. 73 • eDNA can shield P. aeruginosa biofilms against aminoglycosides and protect them from antimicrobial attack. 73 • Presence of eDNA leads to formation of cation gradients and inducible antibiotic resistance in CF airways. 74 Amino acids • Bacteria exoproducts or derived from the host. • P. aeruginosa secretes exoproteases to generate more utilisable nutritional substrates to support its growth. 75 • Increased amino-acid content in the airways of CF patients plays a significant role in the selection and maintenance of nutritionally deficient P. aeruginosa. 75 • In the presence of amino acids, P. aeruginosa quorum sensing activity and exopolysaccharide formation increases. 76 Serum Albumin • Binding of albumin can promote bacterial survival at the epithelial cell surface. 54 • Albumin influences formation of P. aeruginosa virulence factors. Serum albumin shown to play a critical role in P. aeruginosa virulence during early phases of infection by enhancing the expression of iron-controlled genes. 77 Biometals • Calcium Chloride (CaCl 2 ) • Magnesium Chloride (MgCl 2 ) • Iron Chloride (FeCl 2 ) • Copper Chloride (CuCl 2 ) • Zinc Chloride (ZnCl 2 ) • Iron and zinc aid bacterial growth and are essential nutrients for bacteria 57 • Magnesium has been proposed to have a role in maintaining established biofilms. 57 Carbohydrate sources • Sialic acid • Galactose • N-acetyl glucosamine • Glucose • Products of mucin degradation in CF airways, act as nutrient sources. 55 • Glucose elevated in lungs in CF-associated diabetes. 40 Salts • Sodium Chloride • Bile salts • Succinate • High concentrations of sodium chloride in the airway surface liquid (ASL) inhibit the activity of antimicrobial factors giving higher chance for bacterial persistence. 78 • Long term bile exposure shown to cause emergence of adaptive P. aeruginosa variants that are ecologically competitive sub-populations. 79 • Succinate-exposed P. aeruginosa showed increase in glucose metabolism and utilization of trehalose and acetate, production of EPS and enabled tolerance to oxidant stress. 80 Table 3. Concentration of each chemical to be used in the final media. Amino acid concentration sources: healthy 81 : CF 21 : (x: chemical not present). Chemicals Healthy sinuses CF sinuses Healthy lungs CF lungs Lysozyme 8 μg/ml 23 24 μg/ml 23 8 μg/ml 23 48 μg/ml 23 Lactoferrin 0.5 μg/ml 23 50 μg/ml 23 0.5 μg/ml 23 50 μg/ml 23 Spermidine 200 ng/ml 25 325 ng/ml 25 250 ng/ml 25 350 ng/ml 25 Spermine 32.5 μg/l 26 346 μg/l 26 44.5 μg/l 26 346 μg/l 26 Putrescine 616 μg/l 26 616 μg/l 26 616 μg/l 26 616 μg/l 26 Mucin 1.2 mg/ml 37 5 mg/ml 29 1.2 mg/ml 37 5 mg/ml 29 eDNA 0.96 mg/ml 82 4 mg/ml 29 0.96 mg/ml 82 4 mg/ml 29 Albumin 0.5 mg/ml 55 7 mg/ml 55 1.5 mg/ml 55 7 mg/ml 55 CaCl 2 45 mg/l 57 100 mg/l 57 45 mg/l 57 100 mg/l 57 MgCl 2 8 mg/l 57 30 mg/l 57 8 mg/l 57 30 mg/l 57 FeCl 2 887 μg/l 57 5.95 mg/l 57 887 μg/l 57 5.95 mg/l 57 CuCl 2 106 μg/l 57 173 μg/l 57 106 μg/l 57 173 μg/l 57 ZnCl 2 390 μg/l 57 1285 μg/l 57 390 μg/l 57 1285 μg/l 57 NaCl 1 mg/ml 38 6.3 mg/ml 38 1 mg/ml 38 6.3 mg/ml 38 Sialic acid 3.23 μg/l 83 6.46 μg/l 83 3.23 μg/l 83 6.46 μg/l 83 Bile X X X 0.3 mg/ml 84 N-acetyl glucosamine 1.28 mg/ml 55 4.42 mg/ml 55 1.28 mg/ml 55 4.42 mg/ml 55 Glucose X baseline glucose (20%) from M9 media components 250 mg/l 40 X baseline glucose (20%) from M9 media components 250 mg/l 40 Succinate 0.295 mg/ml 80 2.95 mg/ml 80 0.295 mg/ml 80 2.95 mg/ml 80 Galactose 6.27 μg/l 83 7 μg/l 83 6.27 μg/l 83 7 μg/l 83 L-Methionine 0.3 mg/l 90 mg/l 0.3 mg/l 90 mg/l L-Phenylalanine 0.8 mg/l 90 mg/l 0.8 mg/l 90 mg/l L-Proline 1.3 mg/l 200 mg/l 1.3 mg/l 200 mg/l L-Serine 1.8 mg/l 150 mg/l 1.8 mg/l 150 mg/l L-Threonine 15 mg/l 120 mg/l 15 mg/l 120 mg/l L-Tryptophan 0.16 mg/l 2 mg/l 0.16 mg/l 2 mg/l L-Valine 1.6 mg/l 130 mg/l 1.6 mg/l 130 mg/l L-Ornithine X 90 mg/l X 90 mg/l L-Tyrosine 0.73 mg/l 140 mg/l 0.73 mg/l 140 mg/l L(+)-Asparagine monohydrate 0.35 mg/l X 0.35 mg/l X L-Alanine 3 mg/l 160 mg/l 3 mg/l 160 mg/l L-Arginine 37 mg/l 50 mg/l 37 mg/l 50 mg/l L(+)-Aspartic acid 1 mg/l 110 mg/l 1 mg/l 110 mg/l L-Cysteine 0.28 mg/l 24.2 mg/l 0.28 mg/l 24.2 mg/l L-Glutamine 0.5 mg/l 220 mg/l 0.5 mg/l 220 mg/l L-Glycine 2.7 mg/l 90 mg/l 2.7 mg/l 90 mg/l L-Histidine 0.5 mg/l 77.5 mg/l 0.5 mg/l 77.5 mg/l L-Isoleucine 1 mg/l 140 mg/l 1 mg/l 140 mg/l L-Leucine 2 mg/l 210 mg/l 2 mg/l 210 mg/l L-Lysine 2.2 mg/l 310 mg/l 2.2 mg/l 310 mg/l Preparation of the pooled media Media synonyms: Healthy sinus media (HSM), Healthy lung media (HLM), CF sinus media (CFSM), CF lung media (CFLM). Media components were pooled together at concentrations given in Table 3 , yielding four different respiratory media: Healthy sinus media (HSM), healthy lung media (HLM), CF sinus media (CFSM) and CF lung media (CFLM). Briefly, eDNA and mucin solutions were prepared separately in distilled water by constant stirring overnight at 4 °C. Next day, the solutions were autoclaved at 121 °C. Other components of the media were prepared in a single solution by firstly adding the M9 media components (water, 20% glucose and 1M MgSO 4 ). Stock solutions of all the media components except glucose, succinate, N-acetyl glucosamine (Glc-NAc), bile, NaCl, albumin and amino acids were prepared and added to the media in solution form. Aforementioned chemicals were then added in powder form, slowly, under constant stirring at room temperature. Once all the components were fully mixed, the solution was sterilized by filtration using Vacuubrand ME 2 diaphragm vacuum pump and Millipore Steritop filter units with a pore and neck size of 0.22 μm. Sterile eDNA and mucin was then added to the filtered media and the pH of media was adjusted to 6.8-6.9 using sodium hydroxide (NaOH) (Sigma-Aldrich). The volume of the solution was brought to 1 litre by the addition of autoclaved distilled water. The media was then aliquoted to 50 ml falcon tubes and stored at -80°C until further use. Salinity adjustments M9 media was prepared without the addition of M9 salts because exogenous salts were added in the form of NaCl and bile salts, as defined in Table 3 . Salinity of the media was adjusted according to the salinity of ASM (2%) (measured in this study) for CF media. Salinity of healthy media was kept lower than CF media. Briefly, 1 ml of media (ASM, HSM, HLM, CFSM, CFLM) was deposited to the surface of refractometer (V-RESOURCING) after it was calibrated with sterile water. Salinity of CF media was adjusted to 2%, salinity of healthy media was kept less than 2% as CF airways is known to have higher salt content than healthy airways, although salinity in health is not well defined. Viscosity measurements Viscosity of media was measured before and after allowing bacteria to form biofilms for three days, to mimic chronic infection. Viscosity measurements (mPa.s) were performed using a rheometer (Anton-Paar) with cone plate (Serial number: 44806). 50-100 1/s range was used for all sterile media and healthy media during infection, and 0.01-1000 1/s range was used for CF media during infection. Changes in media viscosity was observed under each shear rate point. Media stability Stability of developed media was tested over a 30-day period by performing crystal violet stain assays (as described below) using media stored at 4°C for 30 days. This experiment was designed to determine whether media would continue to support biofilm formation after prolonged storage. Growth curves of PAO1 and LESB65 in the developed media Colony forming unit (CFU) assays were performed to observe the growth of PAO1 and LESB65 in the pooled media. Bacterial cultures grown in LB for 18 hours were centrifuged for 12 minutes at 3220rcf at room temperature. After the LB suspension was removed, bacterial pellets were resuspended in 5 ml of sterile phosphate buffer saline (PBS) (Sigma-Aldrich). The suspension was homogenized by vortexing and bacterial optical density was adjusted to OD 0.05-0.06 in PBS using an optical spectrometer (HANNA instruments). 50 ul of this suspension was then added to 4950 ul HSM, HLM, CFSM or CFLM and cultures were incubated under niche-appropriate conditions: sinus media at 34°C with no CO2, lung media at 37°C with 5% CO 2 . Anaerobic jars were used to increase the CO 2 concentration for lung conditions. CFU was measured at pre-determined time intervals by serial-dilution onto agar. Briefly, 10-fold serial dilutions were prepared in 96 well microplates (Greiner U-bottom) using PBS as the diluent. 20 ul of bacterial dilution was then plated to TSA plates covering the dilutions from 10 -2 to 10 -9 . The plates were air dried and then incubated at 37°C until the colonies were clearly visible (18 hours for PAO1 and 24 hours for LESB65). Biofilm formation in the developed media Measurement of attached biofilm biomass by crystal violet staining Starting from an overnight liquid culture in LB (incubated for 18 hours), bacterial cultures were diluted 1:100 in the developed media, or in LB, or M9, two widely used laboratory bacterial culture media. To minimise edge-effect, non-perimeter wells of U-bottomed polystyrene 96-well microtiter plate (Greiner U-bottomed) were inoculated with 180 μl of these dilutions and perimeter wells were used as a negative control (sterile medium). Following 3 days of growth at 37°C, the supernatant (containing non-adhered cells) was removed from each well and plates were rinsed using 200 μl sterile PBS, twice. Subsequently, 200 μl of Crystal Violet (CV) was added to non-perimeter wells and plates were incubated at room temperature for minimum 20 minutes. After 20 minutes, the excess CV was removed by washing the plates under running tap water. Finally, bound CV was released by addition of 200 μl of 95-100% ethanol (Sigma-Aldrich) to the wells with bacteria. After incubating with ethanol for 30 minutes, the absorbance was measured at 600 nm using a BMG plate reader. 95-100% ethanol was used as a blank. Measurement of cell viability and free-floating biofilm formation by resazurin assays Overnight cultures of PAO1 and LESB65 were diluted in LB to an OD 600 of 0.05 (±0.01). These cultures were then further diluted in the developed media (1:100) to a total volume of 10 ml in glass universal tubes. Free floating biofilm formation in respiratory tract-mimicking media was compared to that observed in LB and M9. Diluted developed media cultures were incubated under conditions appropriate for each respiratory niche, as described above. Cultures were incubated for 3 days while shaking at 75 rpm. Three glass universal tubes containing bacteria-free respiratory media, LB or M9 were used as a negative control. After the incubation, biofilms were disrupted using 250 μl of 100 mg/ml cellulase (diluted in 0.05 M citrate buffer [9.6 g/l Citrate.H 2 O (VWR)] in water and pH to 4.6 with NaOH) and further incubated under aerobic conditions at 37 °C, while shaking at 150 rpm for 1 h. After 30 minutes incubation, biofilms were further disrupted by manual pipetting to ensure complete disruption of biofilms. A portion of disrupted biofilms were then transferred to 96-well plates (Greiner U-bottomed) and to determine the metabolic activity of the bacterial cells released from the disrupted biofilms, 10 μl of 0.02 % (v/v) resazurin (Sigma-Aldrich) (diluted in distilled water) was added to each well of the 96-well plates and incubated for 1-2 hours at niche specific temperature, while shaking at 150 rpm. Following incubation with resazurin, the fluorescence of each well was measured using an excitation wavelength of 540 nm and an emission wavelength of 590 nm in a Fluostar Omega microplate reader and the MARS Data Analysis Software. RNA extraction and cDNA synthesis The bacteria were grown in 5 ml of each developed media or LB until early stationary phase (12 hrs for PAO1 and 20 hrs for LESB65 in the developed media, and 6hrs for PAO1 and 18hrs for LESB65 in LB). To extract RNA, TRI reagent (ZYMO Research) was added and mixtures were incubated for 5–10 min at room temperature. Bacteria were harvested by centrifugation for 30 min at 13,000 rpm and 4 °C. Supernatant was removed and bacterial pellets were used for subsequent RNA isolation or stored at −80 °C. RNA from bacterial cultures was isolated using the Direct Zol RNA Microprep kit (ZYMO Research: R2061) according to the manufacturer’s instructions. DNase digestion treatment was performed using DNAse 1 (ZYMO Research) as per the manufacturer’s protocol. Isolation was performed in an RNase-free environment using RNase-free consumables and reagents. Purified RNA was eluted with RNase-free water (ZYMO Research). Quantification of RNA was performed by measuring the absorbance at 260 nm wavelength using the NanoDrop8000 UV–vis Spectrophotometer (Thermo Scientific). and purity of RNA was analysed by determination of the 260/280 nm ratio. Nuclease free water (Invitrogen) was used as a blank. The 260/280 nm ratio obtained for all samples was between 1.8 and 2.0. First-strand cDNA synthesis was performed using the iScript cDNA synthesis kit (BIO-RAD: 1708891) according to the manufacturer’s instructions in an RNase-free environment using RNase-free consumables and reagents. For each sample, 2.5 ng RNA was added and incubated in a thermocycler (Applied Biosystem) under the following protocol: 5 min at 25 °C, 30 min at 42 °C and then 5 min at 85 °C. The cDNA was then stored at −20 °C until further use. Quantitative real-time PCR (qPCR) and gene expression analysis cDNA was used for quantitative real-time PCR (qPCR) in duplicate reactions using the GoTaq ® qPCR Master Mix (Promega: A6001) as per the manufacturer’s instructions. Each reaction contained 2 μl of cDNA (or nuclease free water for the no template control) and 0.2 μM of forward and reverse primers (Eurofins). Primer sequences are provided in Table 4 . qPCR was performed using the BioRad CFX Connect Real Time PCR System (BIORAD) using MicroAmp™ Optical 96-Well Reaction Plate (Applied Biosystem) under the following conditions; 2 min at 95 °C followed by 40 cycles of 15 sec at 95 °C and 1 min at 60 °C. Table 4. Primer sequences used in the qPCR experiments for PAO1 and LESB65. PAO1 algU Forward primer CAGGAACAGGATCAGCAACT algU Reverse primer CGCACGATCAATCCCAGTAT mexB Forward primer GTTCCTGGTGATGTACCTGTT mexB Reverse primer GTTCCTGGTGATGTACCTGTT PA2911 Forward primer AGCAACAACTCGCCCTATAC PA2911 Reverse primer CGAGCGGCTTTCGAAGTA PA2382 Forward primer TACACCCTGTCGACCATGA PA2382 Reverse primer GCATCACGTAGAGCTGGAAC rpoD Forward primer GGGCGAAGAAAGGAAATGGT rpoD Reverse primer CAGGTGGCGTAGGTGCAGA LESB65 algU Forward primer CAGGAACAGGATCAGCAACT algU Reverse primer CGCACGATCAATCCCAGTAT mexB Forward primer CGATCCATGAGGTAGTGAAGAC mexB Reverse primer GTTCTGCAGGAACAGGTACA PA2911 Forward primer AGCAACAACTCGCCCTATAC PA2911 Reverse primer CGAGCGGCTTTCGAAGTA PA2382 Forward primer CCGTTCCTCTTCCACTACATC PA2382 Reverse primer TCAGCTCGGACATGTTCTTC rpoD Forward primer Same rpoD primers with PAO1 rpoD Reverse primer Same rpoD primers with PAO1 Each qPCR was performed with three biological replicates and in duplicate on each run. Gene rpoD , encoding sigma factor RpoD, was used as a reference gene. cDNA obtained from cultures grown in LB was used as a control. Analysis of relative gene expression in each developed media and SCFM2 versus (vs) LB was performed using the 2 −ΔΔCt relative quantification method as described previously. 39 Long term culturing of PAO1 in developed media PAO1 was cultured in the developed media for forty days, sub-cultured to fresh media every 2 days and plated on Tryptone Congo red/Coomassie blue Agar (TCCA) prepared by mixing 20 mg/l Coomassie blue (Sigma-Aldrich), 40 mg/l Congo red (Sigma-Aldrich), 10 g/l Tryptone (Sigma-Aldrich) and 12 g/l Bacto agar (Fisher-Scientific) in distilled water and autoclaving at 121°C for 15 minutes. 100 μl of bacterial cultures were spread on to the plates in serial dilutions (10 -4 , 10 -6 ) every ten days. Plates were incubated at 37°C for 24 hours and for a further 48 hours at room temperature to allow the colonies to uptake the two dyes in the media. Statistical analysis All assays were carried out at least three times independently. Statistical significance was evaluated using One-way ANOVA (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). All statistical analysis was done using Graphpad Prism versions 8 and 9 (similar analysis could be performed in Microsoft Excel as a free to use alternative). For single chemical growth rate assays, R studio version 3.6.2 and GrowthCurver (version 0.3.1) was used to plot the area under the curve (AUC_e) values. Protocol for media preparation Here we describe, step-by step, the procedure used to prepare 1L of each of the four developed media. Reagents and equipment used in this study are listed in Table 16 . Preparation of the base (same for both CF media) 1. In a 1 litre Duran bottle, add 300 ml distilled water, 20 ml 20% glucose and 2 ml 1 M MgSO 4 . Preparation of CF sinus media 1. Add 4.8 g eDNA in 300 ml water under continuous stirring with a magnetic stirrer at room temperature. Add the eDNA very slowly as it can form clumps in the water. 2. Add 6 g mucin from porcine stomach (Type II) in 150 ml water under continuous stirring with a magnetic stirrer at room temperature. Add mucin powder slowly to water to prevent the formation of clumps. eDNA and mucin can be stirred overnight at 4°C to fully dissolve the powder. 3. Once the eDNA and mucin solutions are fully dissolved, autoclave at 121°C for 15 minutes to sterilise. 4. Prepare stocks of lysozyme, lactoferrin, spermidine, spermine, putrescine, CaCl 2 , MgCl 2 , FeCl 2 , CuCl 2 , ZnCl 2 , sialic acid and galactose in the concentrations given in Table 5 for CF sinuses by dissolving each powder in deionised water. 5. Under constant stirring with magnetic stirrer, from the stocks prepared, add the amounts of each chemical to the base media as given in Table 6 . 6. Add 35 μl of neat spermidine solution (9.296 g/l) to the base media. 7. Weigh the amounts of L-amino acids given in Table 3 and add one by one to the media under constant stirring. Exceptions are L-cysteine and L-tyrosine. Dissolve L-cysteine in 2.95 ml of 0.5 M potassium hydroxide (M r 56.11 g/mol) and L-tyrosine in 2.95 ml sterile water, separately before adding them to the base media. (Amino acid concentrations are same for both CF sinuses and CF lung media.) 8. Weigh 7 g of albumin, 6.3 g of NaCl, 4.4 g of N-acetyl glucosamine, 250 mg of glucose and 2.95 g of succinate and add to the media one at a time. Wait for each chemical to dissolve completely before adding the next one. Succinate can take time to dissolve in water. Incubate the succinate at 37 °C while shaking at 180 rpm for 10-15 minutes to quicken dissolving. 9. Sterilise the media by filtration using a Vacuubrand ME 2 diaphragm vacuum pump and Millipore Steritop filter units with a pore and neck size of 0.22 μm. 10. Under sterile conditions, add 250 ml of autoclaved eDNA and 125 ml of autoclaved mucin to the mixture. 11. Adjust pH to 6.8-6.9 with 5 M NaOH and bring the volume to 1 litre with sterile water. 12. Filtered media should be stored at 4 °C for further use. Using fresh media is recommended, however it can be kept under these conditions for a maximum of three weeks. For freshness, the media can be aliquoted and stored at -80°C (suitable for longer term use). Table 5. Preparation of chemical stocks for CF sinuses media. Chemical stock preparation for CF sinuses media Chemical Stock concentration (mg/ml) Amount of powder to weigh to form the stock solution (mg) Volume of water to dissolve the powder in (ml) Lysozyme 1 24 24 Lactoferrin 1 50 50 Spermine 1 1 1 Putrescine 200 200 1 CaCl 2 250 250 1 MgCl 2 100 100 1 FeCl 2 1 6 6 CuCl 2 1 1 1 ZnCl 2 2.6 2.6 1 Sialic acid 1 1 1 Galactose 1 1 1 Table 6. Volume of each chemical to add into the base media for 1liter CFSLM. CF sinuses media Chemical Stock concentration Concentration desired in the media Amount to add from the stock Lysozyme 1 24 μg/ml 24 ml Lactoferrin 1 50 μg/ml 50 ml Spermine 1 346 μg/l 346 μl Putrescine 200 616 μg/l 3 μl CaCl 2 250 100 mg/l 400 μl MgCl 2 100 30 mg/l 300 μl FeCl 2 1 5.95 mg/l 5.95 ml CuCl 2 1 173 μg/l 173 μl ZnCl 2 2.6 1285 μg/l 494 μl Sialic acid 1 6.46 μg/l 6.46 μl Galactose 1 7 μg/l 7 μl Preparation of CF lung media 1. Follow steps 1-3 of CFSM protocol for eDNA and mucin stock solution preparation. 2. Prepare stocks of lysozyme, lactoferrin, spermidine, spermine, putrescine, CaCl 2 , MgCl 2 , FeCl 2 , CuCl 2 , ZnCl 2 , sialic acid and galactose in the concentrations given in Table 7 for CF lungs by dissolving each powder in deionised water. 3. Under constant stirring with magnetic stirrer, from the stocks prepared, add the amounts of each chemical to the base media as given in Table 8 . 4. Add 37.6 μl of neat spermidine solution (9.296 g/l) to the base media. 5. Add amino acids in the same way as for preparation of CF sinuses media (See Table 3 ). 6. Add 7 g albumin, 6.3 g NaCl, 4.4 g of N-acetyl glucosamine, 250 mg of glucose, 2.95 g of succinate, 300 mg bile salts, one at a time. 7. Sterilise the media in the same way to CF sinuses media (see above protocol). 8. Under sterile conditions, add 250 ml of autoclaved eDNA and 125 ml of autoclaved mucin to the mixture. 9. Adjust pH to 6.8-6.9 with 5M NaOH and bring the volume to 1 litre with sterile water. 10. Filtered media should be stored at 4 °C for further use. Using fresh media is recommended, however it can be kept under these conditions for a maximum of three weeks. For freshness, the media can be aliquoted and stored at -80°C (suitable for longer term use). Table 7. Preparation of chemical stocks for CF lungs media. Chemical stock preparation for CF lungs media Chemical Stock concentration (mg/ml) Amount of powder to weigh to form the stock solution (mg) Volume of water to dissolve the powder in (ml) Lysozyme 1 48 48 Lactoferrin 1 50 50 Spermine 1 1 1 Putrescine 200 200 1 CaCl 2 250 250 1 MgCl 2 100 100 1 FeCl 2 1 6 6 CuCl 2 1 1 1 ZnCl 2 2.6 2.6 1 Sialic acid 1 1 1 Galactose 1 1 1 Table 8. Volumes of each chemical to add into the base media for 1liter CFLM. CF lungs media Chemical Stock concentration (mg/ml) Concentration desired in the media Amount to add from the stock Lysozyme 1 48 μg/ml 48 ml Lactoferrin 1 50 μg/ml 50 ml Spermine 1 346 μg/l 346 μl Putrescine 200 616 μg/l 3 μl CaCl 2 250 100 mg/l 400 μl MgCl 2 100 30 mg/l 300 μl FeCl 2 1 5.95 mg/l 5.95 ml CuCl 2 1 173 μg/l 173 μl ZnCl 2 2.6 1285 μg/l 494 μl Sialic acid 1 6.46 μg/l 6.4 μl Galactose 1 7 μg/l 7 μl Healthy sinuses media Preparation of the base media (Same for both healthy media) 1. In a 1 litre Duran bottle, add 250 ml distilled water, 20 ml 20% glucose and 2 ml 1 M MgSO 4 . Preparation of healthy sinuses media 1. Add 1 g eDNA in 500 ml water under continuous stirring with a magnetic stirrer at room temperature. Add the eDNA very slowly as it can form clumps in the water. 2. Add 1.4 g mucin from porcine stomach (Type II) in 140 ml water under continuous stirring with a magnetic stirrer at room temperature. Add mucin powder slowly to water to prevent the formation of clumps. eDNA and mucin can be stirred overnight at 4 °C to fully dissolve the powder. 3. Prepare stocks of lysozyme, lactoferrin, spermidine, spermine, putrescine, CaCl 2 , MgCl 2 , FeCl 2 , CuCl 2 , ZnCl 2 , sialic acid and galactose in the concentrations given in Table 9 for healthy sinuses by dissolving each powder in deionised water. 4. Under constant stirring with magnetic stirrer, from the stocks prepared, add the amounts of each chemical to the base media as given in Table 10 . 5. Add 21.5 μl of neat spermidine solution (9.296 g/l) to the base media. 6. Add amino acids in the same way as for preparation of the CF media, see Table 3 . 7. Add 500 mg albumin, 1g NaCl, 1.28 g of N-acetyl glucosamine, one at a time. 8. Sterilise the media in the same way as for CF sinuses media (see above protocol) 9. Under sterile conditions, add 480 ml of autoclaved eDNA and 120 ml of autoclaved mucin to the mixture. 10. Adjust pH to 6.8-6.9 with 5 M NaOH and bring the volume to 1 litre with sterile water. 11. Filtered media should be stored at 4 °C for further use. Using fresh media is recommended, however it can be kept under these conditions for a maximum of three weeks. For freshness, the media can be aliquoted and stored at -80 °C (suitable for longer term use). Table 9. Preparation of chemical stocks for healthy sinuses media. Chemical stock preparation for healthy sinuses media Chemical Stock concentration (mg/ml) Amount of powder to weigh to form the stock solution (mg) Volume of water to dissolve the powder in (ml) Lysozyme 1 8 8 Lactoferrin 1 1 1 Spermine 1 1 1 Putrescine 200 200 1 CaCl 2 250 250 1 MgCl 2 100 100 1 FeCl 2 1 5.95 5.95 CuCl 2 1 1 1 ZnCl 2 2.6 2.6 1 Sialic acid 1 1 1 Galactose 1 1 1 Succinate 80 320 4 Table 10. Volumes of each chemical to add into the base media for 1 litre HSLM. Healthy sinuses media Chemical Stock concentration (mg/ml) Concentration desired in the media Amount to add from the stock Lysozyme 1 8 μg/ml 8 ml Lactoferrin 1 0.5 μg/ml 500 μl Spermine 1 32.5 μg/l 32.5 μl Putrescine 200 616 μg/l 3 μl CaCl 2 250 45 mg/l 180 μl MgCl 2 100 8 mg/l 80 μl FeCl 2 1 887 μg/l 887 μl CuCl 2 1 106 μg/l 106 μl ZnCl 2 2.6 390 μg/l 150 μl Sialic acid 1 3.23 μg/l 3.23 μl Galactose 1 6.27 μg/l 6.27 μl Succinate 80 0.295 mg/ml 3.6 ml Healthy lungs media Preparation of healthy lungs media 1. Follow steps 1-3 of HSM protocol for eDNA and mucin stock solution preparation. 2. Prepare stocks of lysozyme, lactoferrin, spermidine, spermine, putrescine, CaCl 2 , MgCl 2 , FeCl 2 , CuCl 2 , ZnCl 2 , sialic acid and galactose in the concentrations given in Table 11 for healthy lungs by dissolving each powder in deionised water. 3. Under constant stirring with magnetic stirrer, from the stocks prepared, add the amounts of each chemical to the base media as given in Table 12 . 4. Add 26.8 μl of neat spermidine solution (9.296 g/l) to the base media. 5. Add amino acids in the same way of preparation of the CF media, see Table 3 for concentrations. 6. Add 1.5 g albumin, 1 g NaCl, 1.28 g of N-acetyl glucosamine, one at a time. 7. Sterilise the media in the same way to CF sinuses media (see protocol for CF sinuses). 8. Under sterile conditions, add 480 ml of autoclaved eDNA and 120 ml of autoclaved mucin to the mixture. 9. Adjust pH to 6.8-6.9 with 5 M NaOH and bring the volume to 1 litre with sterile water. 10. Filtered media should be stored at 4 °C for further use. Using fresh media is recommended, however it can be kept under these conditions for a maximum of three weeks. For freshness, the media can be aliquoted and stored at -80 °C (suitable for longer term use). Table 11. Preparation of chemical stocks for healthy lungs media. Chemical stock preparation for healthy lungs media Chemical Stock concentration (mg/ml) Amount of powder to weigh to form the stock solution (mg) Volume of water to dissolve the powder in (ml) Lysozyme 1 8 8 Lactoferrin 1 1 1 Spermine 1 1 1 Putrescine 200 200 1 CaCl 2 250 250 1 MgCl 2 100 100 1 FeCl 2 1 5.95 5.95 CuCl 2 1 1 1 ZnCl 2 2.6 2.6 1 Sialic acid 1 1 1 Galactose 1 1 1 Succinate 80 320 4 Table 12. Volumes of each chemical to add into the base media for 1liter HLM. Healthy lungs media Chemical Stock concentration (mg/ml) Concentration desired in the media Amount to add from the stock Lysozyme 1 8 μg/ml 8 ml Lactoferrin 1 0.5 μg/ml 500 μl Spermine 1 44.5 μg/l 44.5 μl Putrescine 200 616 μg/l 3 μl CaCl 2 250 45 mg/l 180 μl MgCl 2 100 8 mg/l 80 μl FeCl 2 1 887 μg/l 887 μl CuCl 2 1 106 μg/l 106 μl ZnCl 2 2.6 390 μg/l 150 μl Sialic acid 1 3.23 μg/l 3.23 μl Galactose 1 6.27 μg/l 6.27 μl Succinate 80 0.295 mg/ml 3.6 ml Incubation conditions for the media Incubation conditions differ between lung- and sinus media. The incubation conditions for each media are given in Table 13 . Conditions of 5% CO 2 can be achieved by incubating the media in GasPak Jars with candles, using Campygen packs or microaerobic incubators. Table 13. Incubation conditions for each developed media. Health sinuses Healthy lungs CF sinuses CF lungs Temperature 34 °C 37 °C 34 °C 37 °C pH 6.8 6.8 6.8 6.8 CO 2 Trace ~5% Trace ~5% Notes on handling of media components and media preparation • Break bovine serum albumin into smaller pieces before adding to media, as it can take time to fully dissolve. • Add eDNA and mucin to minimise clumping. Make sure that each addition is dissolved before adding more. • Succinic acid may not fully dissolve in water immediately. Leave it at 37 °C for 30 minutes if needed. • Polyamines should be handled in a fume hood due to toxicity at high concentrations. Read supplier instructions carefully. • If a sterile pH probe cannot be used, we recommend aliquoting a small volume of media (2 ml) before each measurement, to maintain media sterility. Discard the aliquoted media after taking a measurement. • As CF media is rich in chemicals, it is advised to use more than one filter unit, to prevent saturation. Results Media development Testing the effect of individual chemicals on bacterial growth For each chemical under consideration for inclusion in respiratory-mimicking media, the effect on P. aeruginosa growth was determined at three different concentrations. Experiments were performed over 20 hours of growth for PAO1 and LESB65, using M9 media as a base to support minimal bacterial growth (Underlying data Figures 1-4). PAO1 was chosen as a non-CF laboratory reference strain, to act as a comparator to the CF-adapted strain LESB65. Chosen concentrations of all chemicals were higher in CF conditions vs health conditions. Most chemicals were included in both health and CF conditions, with the exception of bile salts and glucose, which were only tested in CF conditions. Airway glucose is significantly elevated in CF related diabetes and bile in the lower airways is associated with CF, as a co-morbidity of gastroesophageal reflux disease. 28 , 40 Results from these experiments showed that, when used individually, most of the tested chemicals enhanced growth of both PAO1 and LESB65 (Underlying data Figures 1-4). The highest concentrations of bile salts, succinate and extracellular DNA (eDNA) used in CF conditions were toxic to bacteria (Underlying data Figures 1-4 (CF lung and CF sinus graphs)). The antimicrobial activity of lysozyme and lactoferrin was also observed to be both niche and concentration dependent, potentially due to decreased antimicrobial activity in lower temperatures, charge interference at high concentrations or induction of bacterial defence mechanism. Validation of pooled media use for phenotypic assays PAO1 and LESB65 can be maintained in respiratory-mimicking media for at least three days Next, the chosen concentration of each chemical was used to prepare pooled media. Growth of PAO1 and LESB65 was determined in the respiratory media, by CFU determination over 72 hours ( Figure 1 ). Data from these experiments show that viable PAO1 and LESB65 populations were maintained in all media for at least three days, with mid exponential growth of bacteria occurring at ~1×10 8 CFU/ml ( Figure 1 ), similar to the findings of Palmer et al. for growth of P. aeruginosa in CF sputum. 21 PAO1 was able to grow to a higher density in CF sinus and lung media than in either of the equivalent conditions in health. In addition, PAO1 grew faster than LESB65 in all media and reached early stationary phase after 12-14 hours of growth, whilst LESB65 reached stationary phase only after 24 hours of growth in each media. Although LESB65 reached a similar density in all four media, CFU began to decrease in healthy sinus and lung media after 34 hours. Area under the exponential curve (AUC_e) values were determined for both strains, in all media, using Growthcurver, 41 and demonstrated that PAO1 performed better under CF than health conditions ( Figure 1C ). Two-way ANOVA analysis (alpha 0.05) of AUC_e data suggested that both media type and strain were significant variables (p < 0.0001, with 3 degrees of freedom [df] for media type, p = 0.0084, with 1 df for strain). There was also significant interaction between these two variables (p < 0.0001 with 1 df) and Sidak’s multiple comparison testing confirmed enhanced growth of PAO1 under CF conditions, relative to those of health. Whilst PAO1 had significantly enhanced AUC_e, relative to LESB65, in CFSM (p < 0.0001), caution should be applied to interpretation of this finding, given the background differences in growth profiles of the two strains in standard laboratory media. Figure 1. Continuous growth of PAO1 and LESB65 in respiratory media for 72 hrs. Media were generated using M9 supplemented with the chosen concentrations of all the chemicals shown in tables within media preparation protocol section. These concentrations differed between sinuses and lung and between health and CF, generating four different media: Healthy sinus media (HSM), CF sinus media (CFSM), healthy lung media (HLM) and CF lung media (CFLM). CFU counts are made by taking a sample from bacterial culture grown in each developed media, every 2 hours, for 72 hours. Data shows mean of 3 biological replicates per time point, error bars show standard deviation. A: PAO1, B: LESB65, C: Area under the exponential curve values for PAO1 and LESB65 grown in the four media. Statistical analysis was with two-way ANOVA with Sidak’s multiple comparison test. Only within-strain and within-media pairwise comparisons are shown. ***p < 0.001, ****p < 0.0001. Surface attached biofilm formation is niche and strain specific in sinus and lung media Both attached and free-floating biofilm structures are thought to contribute to success of P. aeruginosa in the CF airways. Mature biofilms are commonly observed as free floating structures in mucus, whereas surface attached biofilms are suggested to dominate the early stages of infection, as physical contact of bacteria and epithelium is necessary as an initial survival strategy. 42 , 43 Crystal violet (CV) staining assays showed that there are niche, disease state and strain specific influences on biofilm formation ( Figure 2 ). Two-way ANOVA analysis (alpha 0.05) confirmed this, with both strain and media type found to be significant, interacting variables (p < 0.0001 for strain, media type and interaction, with 1 df for strain and 5 for media and interaction). PAO1 formed attached biofilms more readily than LESB65 in all airway niche media bar HLM (p 0.9999 in HLM in Sidak’s multiple comparisons test). This may be due to the differences in growth rate of PAO1 and LESB65. In particular, PAO1 was able to form significantly more attached biofilm in sinus media compared to lung media. No statistically significant differences in biofilm formation were observed with LESB65 between healthy airway niches, but biofilm formed more readily in CF sinus media than in CF lung media. These results further highlight the importance of studying different airway niches and conditions in isolation. The media were compared with two widely-used laboratory media (LB and M9), and attached biofilm formation was shown to form most readily in LB. Figure 2. Attached biofilm biomass of PAO1 and LESB65 in respiratory-mimicking media, LB and M9. Bacteria were left to form biofilms for 72 hours. Unattached bacteria were removed and washed with PBS to ensure removal of all unattached bacteria. Attached bacteria stained with 0.25% CV and absorbances were measured by using 95-100% ethanol as blank control at OD600. Statistical analysis was undertaken using Graph pad Prism 8.0. Statistical analysis: Two-way ANOVA *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Each bar graph represents 3 biological replicates (mean), each with 30 technical replicates, n:90, error bars show standard deviation). Developed media supports free-floating biofilm formation common in CF Free-floating biofilm formation, associated with chronic infection, was assessed in respiratory-mimicking media, LB and M9, Figure 3 . Free-floating biofilms formed more readily in LB and M9 than in any of the four respiratory media, for both isolates, suggesting that the respiratory media alter bacterial growth and biofilm formation, compared to standard laboratory media. Biofilms grew well in CF sinus and lung media, and in healthy lung media, but only minimal biofilm was observed in healthy sinus media. Two-way ANOVA analysis determined that both media type and strain background were significant factors in free-floating biofilm formation (p < 0.0001 for both, 5 df for media, 1 df for strain) and that there was interaction between these variables (p < 0.0001, 5 df). In Sidak’s multiple comparison testing, PAO1 biofilm formation differed significantly from that of LESB65 in HLM (p = 0.0001) and HSM (p < 0.0001) but not in the other media tested. For clarity, only within-strain differences in biofilm formation across different media are shown in Figure 3 . Overall, PAO1 outperformed LESB65 in the attached biofilm formation assays but not in the free-floating biofilm formation assays. As an airway adapted strain from chronic infection, LESB65 may be more adept at forming free-floating biofilms. Figure 3. Free-floating biofilm formation in respiratory-mimicking media in comparison to two common laboratory media. Bacteria were left to form biofilms for 72 hours and biofilms were disrupted with cellulase. Cultures were incubated with resazurin dye for 2 hrs. Released fluorescence was measured at 540 nm excitation λ and 590 nm emission λ. Background fluorescence of each media is corrected by subtraction of the background fluorescence obtained from the wells with media only. Statistical analysis was undertaken using Graph pad Prism 8.0. Statistical analysis: Two-way ANOVA *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Each bar graph represents 3 biological replicates (mean), each with 30 technical replicates, n:90, error bars show standard deviation). CF media becomes viscous during infection, reflecting properties of CF sputum Viscosity measurements were taken in the four developed media, pre and post PAO1 biofilm formation ( Figure 4 ). Sterile HSM and HLM media were shown to have Newtonian liquid characteristics with very similar viscosity measurements to water (~1.0 mPa·s viscosity for water, 1.02 mPa·s for HSM and 1.03 mPa·s for HLM) ( Figure 4A ). Viscosity changed only minimally in healthy media after bacterial growth (1.06 mPa·s for HSM and 1.05 mPa·s for HLM) ( Figure 4A ). Both CF media were also determined to be Newtonian fluids pre-biofilm formation but had higher viscosity measurements compared to healthy media (1.37 mPa·s for CFSM and 1.27 mPa·s for CFLM) ( Figure 4A ). When the biofilm was established in CF media, both media became more viscous, as compared to both their sterile controls and compared to post-biofilm formation healthy media. Infected CF media showed clear non-Newtonian fluid characteristics, with shear thinning properties (viscosity decreases as the shear rate increases) ( Figure 4B ). Viscosity of CFSM media was approximately 16 mPa·s during infection at low shear rate ranges and decreased down to 1.57 mPa·s at the highest shear rate (1000 1/s). CFLM media was the most viscous media during infection, with approximately 2400 mPa·s viscosity at low shear rates, decreasing down to 1.8 mPa·s at 1000 1/s shear rate. These results are in agreement with previous literature, where the viscosity of CF sputum was shown to be higher than healthy controls. 44 Figure 4. Viscosity of media before and after bacterial growth. Viscosity of all media before infection and of healthy media during infection with PAO1. (A) was measured under shear rate range of 50-100 1/s whereas viscosity of CFSM and CFLM media was measured at 0.01-1000 1/s shear rate range as the viscosity properties of CF media during infection was higher (B). Averages were taken for media with Newtonian fluid characteristics (All media before infection and HSM and HLM media during infection). Data points with open triangle in CFSM during infection displayed high level of uncertainty due to non-Newtonian responses and therefore values below 0.1 (1/s) should be treated with caution. Graphs are showing single viscosity measurement per media under each condition. Biofilm formation in airway mimicking media is stable for at least 30 days of media storage at 4°C. Biofilm formation of PAO1 was measured over a month in the developed media stored at 4°C to test the stability of the airway mimicking media. Over a 30-day period, there was no significant change in the amount of biofilm formed by PAO1 in any of the four airway mimicking media ( Figure 5 ). Ordinary two-way ANOVA (alpha 0.05) analysis demonstrated that media type was a significant variable (3 df, p < 0.0001), whilst media storage time was not (3 df, p = 0.4174). No individual pairwise comparisons between timepoints proved significant for any of the four media, nor was there found to be interaction between media type and storage time (9 df, p = 0.2701). Figure 5. Stability of biofilm formation in developed media stored for up to 30 days. Media suitability for supporting biofilm growth of PAO1 was determined using CV stain assays performed in media that had been stored at 4°C for up to 30 days. Each timepoint is one biological replicate representing the average of three technical replicates. Statistical analysis was undertaken using Graph pad Prism 8.0. Statistical analysis: Two-way ANOVA, no statistically significant differences were found between fresh media and media stored for up to 30 days. Expression of infection-relevant genes in respiratory-mimicking media Four P. aeruginosa genes were selected, to determine whether growth in respiratory-mimicking media induced CF infection-relevant gene expression. The major virulence regulator, extracytoplasmic sigma factor algU , and mexB (part of a tripartite multidrug efflux system) genes were selected as they are virulence genes of P. aeruginosa known to contribute to chronic infection. 45 , 46 PA2911 and PA2382 genes were also selected, as expression of these genes in clinical isolates in CF sputum is observed but expression has not previously been captured in in vitro CF models. 47 algU is responsible for alginate overproduction, causing mucoidy and contributing to chronic infection in PwCF. 45 MexB is responsible for exporting biological metabolites and antimicrobial compounds, playing a crucial role in antimicrobial resistance in the airways. 46 PA2911 is predicted to be a Ton-B dependent receptor located in the outer membrane and responsible for sideophore transport. 48 PA2382 ( lldA ) is a L-lactate dehydrogenase, important for pyruvate metabolism. 49 Two-way ANOVA analysis was performed for each gene of interest, to assess whether strain background or media type influenced gene expression. Strain was found to be a significant variable for mexB and PA2382 expression (p < 0.0001 for both), whilst media type was a significant variable for mexB (p = 0.0308) and PA2911 (p = 0.0462) expression. In Dunnett’s multiple comparison test, with LB set as the control group for each strain, significant differences in gene expression were identified for mexB with LESB65 grown in HSM (p = 0.0249) or CFSM (p = 0.0201) and for PA2382 with PAO1 grown in CFSM (p = 0.0243) or CFLM (p = 0.0273). In contrast to the other genes tested, expression of algU appeared to be only minimally affected by media type and strain background ( Figure 6 ). Figure 6. Expression of infection-relevant genes in respiratory media, LB and SCFM2. Each point represents one biological replicate. Each biological replicate includes the mean of two technical replicates. RNA from bacteria grown in each media was extracted and used to synthesise cDNA. qPCR was performed using the cDNA by primers specific to A: algU, B: mexB, C: PA2911 and D: PA2382 (for which no expression was observed in LESB65 under any conditions). cDNA from LB was used as a negative (no treatment control). Statistical analysis: two-way ANOVA with Dunnett’s multiple comparison test. * = p < 0.05. Long term culture of PAO1 in respiratory-mimicking media PAO1 growing in respiratory-mimicking media show changes in colony morphology PAO1 was grown for a period of 40 days in each of the four media. Every ten days, PAO1 populations cultured under different media conditions were streaked onto TCCA plates to observe colony morphotypes ( Figure 7 ). Only shiny, circular, concave colonies were observed in the starting populations. Wrinkly colonies began to appear in all media conditions over time. These wrinkly structures have been suggested to be the result of redox-driven adaptation that maximizes oxygen accessibility in biofilms, to increase their surface area in oxidant limitation. 17 Colony morphotypes in Figure 7D and E were visible only after transfer 10 and were unique to CF media ( Table 14 ). Figure 7. Representative colony morphologies observed during PAO1 culture over forty days ( Table 14 ). Cultures were streaked onto TCCA plates that contained Congo red and Coomassie blue to check for changes in colony morphologies. The plates were incubated at 37°C overnight and at room temperature for 48 hours before analysis. (B and C: wrinkly morphotypes, A: starting culture, D and E: colonies only observed in CF media. Table 14. First appearance and maintenance of morphotypes during long term culture in respiratory media. Media Day 0 Day 10 Day 20 Day 30 Day 40 HSM A A, B, C A, B, C A, B, C A, B, C HLM A A, B, C A, B, C A, B, C A, B, C CFSM A A, B, C, E B, C, D, E B, C, D B, C, D CFLM A A, B, C A, B, C, E A, B, C, E A, B, C, E Discussion Here we describe a simple suite of liquid culture models, designed to reproduce the conditions of upper and lower airway niches in CF and health. Our media have been designed to mimic the key properties of CF and healthy airways and have been validated for studying growth, as well as attached and free-floating biofilm formation of laboratory and CF-associated strains of P. aeruginosa. We previously showed that bacteria evolved within upper airways can acquire adaptive mutations conferring resistance to host-derived antimicrobials found in abundance in the lower airways. 13 Therefore, in this work, by inclusion of different host-derived antimicrobials in the media, we aimed to capture an important source of selective pressures acting on bacteria during airway infection. We show that bacteria can be maintained and cultured in these media long term, making them suitable for studying bacterial adaptation to airway environments using experimental evolution approaches in the laboratory. We envisage these media can help reduce the need for use of animals for the purposes of experimental evolution, investigation of host-pathogen interactions and for virulence screening. To date, different liquid culture media have been developed with the aim of capturing the conditions of CF sputum. However, these media reflect the properties of lower airway regions. The growing evidence for the importance of the upper airways in shaping bacterial within-host adaptation makes liquid culture media reflecting sinus conditions a useful addition to the CF microbiologist’s toolkit. Having bespoke media for individual airway compartments allows airway niches to be studied in isolation, something impossible to do in vivo. To our knowledge, there are also no liquid culture media available that have been developed to mimic the conditions of healthy airways. In addition to the CF media, healthy sinus (HSM) and healthy lung (HLM) media will allow the research community to study other aspects of respiratory microbiology, such as bacterial sinusitis, or pneumonia. In respiratory microbiology a common experimental approach is to screen panels of bacterial isolates in mouse models to determine virulence. 50 – 52 In one example study, researchers competed different pneumococcal serotypes in a mouse model of pneumococcal nasopharyngeal carriage. 53 The study used >200 mice, but many experiments could have been performed in sinus mimicking media, had it been available, with only the neutrophil-depletion studies necessitating animal usage. Thus, sinus mimicking media could have enabled 60-75% reduction in usage in the study. Carriage protocols are mild-severity, but similar studies to compare virulence in moderate or severe pneumonia models 50 could utilise lung mimicking media. The culture media could be used to examine how bacterial communities develop in the face of host pressures, enabling study of biofilm formation in relevant environments. They offer a platform for assessment of bacterial gene expression in response to stress and to assess efficacy of drugs and therapeutics in a system more relevant than pathogen growth in broth, but more cost effective, less labour-intensive and ethical than animal models. The media can also be used as a pre-screening tool, to identify the most phenotypically interesting isolates to take forward into studies in more complex in vitro or in vivo systems, potentially leading to a significant reduction in the number of animals used to study bacterial pathogenicity in the host environment. The developed media were designed to be cost effective for the purposes of long-term experiments ( Table 15 ). The media should also prove readily accessible, as they can be prepared with standard laboratory equipment and without the need for any specialist training. The media can be easily modified to answer different research questions, for example by addition or removal of a metabolite or antimicrobial of interest. After 4 weeks at 4°C, the media retained the capacity to support P. aeruginosa biofilm formation, although we would recommend storage at -80°C for continued long term use. Definitive confirmation of long-term stability of the media will require LCMS, for detection of individual media components, coupled with detailed metabolic phenotyping of bacteria grown therein. Table 15. Costing of each media (per litre). Media Price per L Healthy sinuses £57.5 Healthy lungs £61.5 CF sinuses £214 CF lungs £216 At concentrations associated with conditions of the healthy sinuses (Underlying data Figures 1 and 2), PAO1 showed increased growth in the presence of only two of the chemicals (eDNA and FeCl2), relative to the M9-only control. By contrast, at concentrations associated with CF sinuses (Underlying data Figures 1 and 2), significant increases in growth were observed for six of the chemicals (lactoferrin, mucin, eDNA, albumin, amino acids and FeCl2), relative to the M9-only control. Chemicals that induced higher growth rates at one or more of the concentrations tested for healthy and CF sinuses were albumin, eDNA, amino acids, iron, magnesium, copper, zinc and N-acetyl glucosamine (GlcNac). Many of these factors are well known to promote bacterial survival and may act as nutrient sources in these niches. 21 , 54 – 56 Iron and zinc are essential metals for bacteria. 57 Bacteria must actively acquire them through high affinity transport mechanisms. 58 In addition to these potential nutrient sources, the host derived antimicrobials lysozyme and lactoferrin were able to partially inhibit the growth of PAO1 at concentrations associated with health, however they did not cause significant growth inhibition at the higher concentrations of CF sinuses. Similar to PAO1, increased growth of LESB65 was observed at CF-relevant concentrations for the majority of the chemicals. Growth was higher than the M9 control for at least one tested concentration of albumin, amino acids, mucin, spermine, zinc, lysozyme and lactoferrin. Relative to PAO1, the airway adapted isolate LESB65 appeared better able to grow in the face of high concentrations of host-derived antimicrobials and airway-abundant chemicals such as polyamines. One of the key differences between CFSM and CFLM conditions was that the host-derived antimicrobial lactoferrin decreased the growth of PAO1 in CFLM while it increased the growth at all tested concentration in CFSM, where it may be acting as a nutrient source, as it is heavily glycosylated. 58 The enzymatic activity of lactoferrin will not function optimally at 34°C in sinuses media (SLM), nullifying its growth inhibiting activity. Lysozyme had no significant positive or negative effect on growth of P. aeruginosa in CFLM but, in CFSM, all concentrations stimulated higher rates of growth. This may be a result of lysozyme-dependent changes in bacterial phenotype. Previously, it has also been suggested that the effectiveness of lysozyme is reduced in chronically infected airways due to electrostatic sequestration of the enzyme by anionic biopolymers. 59 , 60 Over production of inhibitor of vertebrate lysozyme (ivy) protein may also explain success in lysozyme-rich environments, as ivy knockout mutants show growth defects in the presence of lysozyme. 61 eDNA elevated bacterial growth in CFLM while it showed a growth inhibiting effect in HLM, where the concentrations tested were lower, further highlighting the positive effect of the chemically rich CF airways on bacterial survival. Growth curves of PAO1 and LESB65 in airway media suggest a doubling time for PAO1 in CF media of 74 minutes (in both CFSM and CFLM), similar to the findings of Yang et al. for PAO1 in CF sputum (66 minutes). 18 The doubling time of PAO1 was ~85 minutes in healthy sinus and lung media. Doubling time of LESB65 was ~105 min in CFSM and ~92 minutes in CFL and ~86 minutes in both healthy media. This finding can be supported by the findings of Yang et al. who found two to threefold slower generation times in isolates from PwCF patients, compared to a laboratory strain. This observed reduced growth was also seen in other CF isolates, compared to non-CF isolates. 18 One possible explanation for this could be that the slow-growing phenotype develops as result of the stressful conditions associated with continuous exposure to host-derived antimicrobials and other molecules of the immune system. PwCF also undergo intensive antibiotic treatment, which acts as a further stress signal. Chromosomal mutations associated with antibiotic tolerance often also have growth rate-reducing effects. 62 Results from phenotypic assays show that airway media induce responses in P. aeruginosa that differ considerably from common laboratory and currently available liquid culture media (such as SCFM2), as evidenced by differences in attached and free-floating biofilm formation and expression of infection-relevant genes, including those that are highly expressed in CF sputum but poorly expressed in available liquid culture models. For a robust assessment of the ability of respiratory mimicking media to induce appropriate gene expression in P. aeruginosa , we await the outcome of RNAseq experiments, in which transcriptomes from LESB65 grown in CFSM and CFLM will be benchmarked against those from CF sputum, using a validated quantitative framework. 35 SCFM was developed to mimic the nutritional components of CF sputum and contains amino acids, ions, glucose and lactate 21 whereas HSM, HLM, CFSM and CFLM have been developed with the aim of not only capturing nutritional components but also the host derived antimicrobial content of different airway niches as well as stimulators of bacterial signalling systems, such as polyamines and bile salts. We observed emergence of new colony morphologies in P. aeruginosa PAO1 cultured long-term in respiratory mimicking media. Similar observations have been made following bacterial culture in SCFM and SCFM2, 63 , 64 but also in nutrient rich media, 65 suggesting this phenotype may be a generalised adaptation to growth in biofilm. For the media described here, as well as for other respiratory mimicking media and in vitro and in vivo models of CF airway infection, there is a need to better understand those phenotypes that are specifically niche-adaptive, as distinct from those that confer benefits for a particular lifestyle, such as growth in biofilm. An obvious limitation of these in vitro mimics is that they fail to capture the host cellular characteristics of different airway niches. The presence of immune cells significantly affects the pathophysiology of CF as a result of both the inflammatory processes and the direct effects of immune cells on bacteria. 66 Experiments combining the developed media with cell lines or primary cells (e.g., macrophages, epithelial cells) could provide additional information about host-pathogen interactions within the airways. Conclusion In summary, we present here a collection of culture media replicating different airway niches in health and CF. Importantly, our study showed that these media can be used to study different phenotypic characteristics of bacteria or study of host-pathogen interactions. We show that the media can be used to study P. aeruginosa , a well-known CF pathogen, in health and disease by recapitulating different areas of the respiratory tract. With these compartmentalised airway-mimicking media, we aim to answer questions relating to how each airway niche affects bacterial behaviour and adaptation in CF and non-CF conditions, without the need for invasive whole animal studies for preliminary studies. We hope these media will become a resource for clinical microbiologists, respiratory clinicians, evolutionary biologists, pharmacologists and immunologists, as a tool to understand bacterial physiology, evolution, virulence and resistance to novel therapeutics, and as a means of reducing or replacing animal use. Table 16. Materials and Equipment used in the study and supplier information. Reagent Supplier Lactoferrin Human Sigma-Aldrich (L4040) Lysozyme Human Sigma-Aldrich (L1667) N-acetyl-glucosamine Sigma-Aldrich (A8625) Deoxyribonucleic acid from fish sperm Sigma-Aldrich (74782) Mucin from porcine stomach (Type II) Sigma-Aldrich (M2378) Bovine Serum Albumin Sigma-Aldrich (A2153) N-acetyl-neuraminic acid Sigma-Aldrich (A0812) Spermine Sigma-Aldrich (S3256) Spermidine Sigma-Aldrich (S2626) Putrescine Sigma-Aldrich (51799) CaCl 2 Sigma-Aldrich (C5670) MgCl 2 Sigma-Aldrich (M8266) CuCl 2 Sigma-Aldrich (203149) FeCl 2 Sigma-Aldrich (372870) ZnCl 2 Sigma-Aldrich (229997) Bile Salts Sigma-Aldrich (B3426) Succinate Sigma-Aldrich (S9512) Glucose Sigma-Aldrich (G7021) NaCl Sigma-Aldrich (S9625) Galactose Sigma-Aldrich (G0750) MgSO 4 Sigma-Aldrich (M7506) NaOH Sigma-Aldrich (S5881) L-Methionine Sigma-Aldrich (M9625) L-Phenylalanine Across Organics (130310250) L-Proline Sigma-Aldrich (P0380) L-Serine Across Organics (132660250) L-Threonine Across Organics (138930250) L(-)-Tryptophan Across Organics (140590250) L-Valine Sigma-Aldrich (V0500) L-Ornithine Sigma-Aldrich (O2375) L-Tyrosine Across Organics (140641000) L(+)-Asparagine monohydrate Across Organics (175271000) L-Alanine Across Organics (102830250) L-Arginine Sigma-Aldrich (A5006) L(+)-Aspartic acid Across Organics (105041000) L-Cysteine Sigma-Aldrich (168149) L-Glutamine Sigma-Aldrich (G3126) L-Glycine Across Organics (220911000) L-Histidine Sigma-Aldrich (H8000) L-Isoleucine Sigma-Aldrich (I2752) L-Leucine Sigma-Aldrich (L8000) L -Lysine Sigma-Aldrich (L5501) ME 2 diaphragm vacuum pump Vacuubrand (696126) Steritop filters (Pore size: 0.22 μm, Neck size: 45 mm) EMD Millipore (SCGPT10RE) U-bottomed 96-well microtiter plate Greiner 650161 pH meter HANNA instruments (HI-2550-02) Petri dishes Greiner (632180) Parafilm Starlab (I3080-1075) LB broth Neogen (NCM0088A) LB agar Neogen (NCM0142A) Phosphate buffer saline Sigma-Aldrich (P4417) Muller Hinton Agar Sigma-Aldrich (70191) Tryptone Soy agar Sigma-Aldrich (22091) Congo red Sigma-Aldrich (C6277) Brilliant Blue Sigma-Aldrich (27815) Tryptone Sigma-Aldrich (T7293) BD Bacto™ dehydrate agar Fisher Scientific (10455513) Glass universal tubes Fisher Scientific (14863562) 30ml universal tubes Starlab (E1412-3010) 15ml Falcon tubes Greiner (T1943) 50ml Falcon tubes Greiner (T2318) Sputasol Thermo-Fisher (SR0233A) Aspergillus cellulase Sigma-Aldrich (22178) Resazurin Sigma-Aldrich (199303) Crystal Violet Sigma- Aldrich Ceftazidime disks Mast (CAZ30C) Ciprofloxacin disks Mast (CIP5C) Doripenem disks Mast (DOR10C) Lexofloxacin disks Mast (LEV5C) Meropenem disks Mast (MEM10C) Cryovial beads Pro-lab (16368776) Direct-zol RNA Microprep kits ZYMO Research (R2061) TRI-reagent ZYMO-Research (R2050) Ultrapure nuclease free distilled water Invitrogen (11538646) iScript cDNA synthesis kit BIO-RAD (1708891) Fluostar omega microplate reader BMG-Labtech (SPECTROstar Omega) 96 well programmable thermocycler Applied Biosystem (4375786) GoTaq qPCR Master Mix Promega (A6001) Primers Eurofins CFX Connect Real Time PCR System. BIO-RAD (1855201) Microamp Optical 96 well Reaction Plate Applied Biosystem (N8010560) Pseudomonas Selective Agar Sigma-Aldrich (22470) Citrate.H 2 O VWR (BDH0288) Ethanol Sigma-Aldrich (51976) Glycerol Sigma-Aldrich (G5516) KH 2 PO 4 Sigma-Alrdrich (P0662) Na 2 HPO 4 Sigma-Aldrich (S9763) NH 4 Cl Sigma-Aldrich (213330) Data availability Underlying data Figshare: Underlying data for “Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health”, https://doi.org/10.6084/m9.figshare.20463159.v6 . 85 This project contains the following underlying data: - Biofilm assay OD values and fluorescent intensity.xlsx - F1000_qPCR_RawData.xlsx - Growth CFUs.xlsx - viscosity supplementary.xlsx - Colony E fig 7.png - colony D fig 7.png - colony C fig 7.png - viscosity supplementary.xlsx Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0). Acknowledgements We thank Prof Rob Poole and his group at the University of Liverpool for their help on media viscosity measurements and analysis. References 1. Sheppard MN, Nicholson AG: The pathology of cystic fibrosis. Vol. 8, Current Diagnostic Pathology. Churchill Livingstone;2002; 50–59. 2. Folkesson A, Jelsbak L, Yang L, et al. : Adaptation of Pseudomonas aeruginosa to the cystic fibrosis airway: An evolutionary perspective . Vol. 10, Nature Reviews Microbiology. Nature Publishing Group;2012; 841–851. 3. Bhagirath AY, Li Y, Somayajula D, et al. : Cystic fibrosis lung environment and Pseudomonas aeruginosa infection. BMC Pulm. Med. 2016 Dec 5; 16 (1): 174. PubMed Abstract | Publisher Full Text 4. Stover CK, Pham XQ, Erwin AL, et al. : Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature. 2000 Aug 31; 406 (6799): 959–964. PubMed Abstract | Publisher Full Text 5. Mathee K, Narasimhan G, Valdes C, et al. : Dynamics of Pseudomonas aeruginosa genome evolution. Proc. Natl. Acad. Sci. U. S. A. 2008 Feb 26 [cited 2022 Jan 19]; 105 (8): 3100–3105. PubMed Abstract | Publisher Full Text | Free Full Text 6. Winsor GL, Lam DKW, Fleming L, et al. : Pseudomonas Genome Database: improved comparative analysis and population genomics capability for Pseudomonas genomes. Nucleic Acids Res. 2011 Jan [cited 2022 Jan 19]; 39 (Database issue): D596–D600. PubMed Abstract | Publisher Full Text 7. Goodman AL, Kulasekara B, Rietsch A, et al. : A signaling network reciprocally regulates genes associated with acute infection and chronic persistence in Pseudomonas aeruginosa. Dev. Cell. 2004 Nov [cited 2020 Mar 4]; 7 (5): 745–754. PubMed Abstract | Publisher Full Text 8. Fothergill JL, Neill DR, Loman N, et al. : Pseudomonas aeruginosa adaptation in the nasopharyngeal reservoir leads to migration and persistence in the lungs. Nat. Commun. 2014 Sep 2; 5 (1): 1–9. 9. Johansen HK, Aanaes K, Pressler T, et al. : Colonisation and infection of the paranasal sinuses in cystic fibrosis patients is accompanied by a reduced PMN response. J. Cyst. Fibros. 2012 Dec [cited 2020 Mar 5]; 11 (6): 525–531. PubMed Abstract | Publisher Full Text 10. Ciofu O, Johansen HK, Aanaes K, et al. : P. aeruginosa in the paranasal sinuses and transplanted lungs have similar adaptive mutations as isolates from chronically infected CF lungs. J. Cyst. Fibros. 2013 Dec 1; 12 (6): 729–736. PubMed Abstract | Publisher Full Text 11. Armbruster CR, Marshall CW, Melvin JA, et al. : Evolution and adaptation of Pseudomonas aeruginosa in the paranasal sinuses of people with cystic fibrosis. bioRxiv. 2020 Oct 29 [cited 2022 Jun 21]. 2020.10.29.359844. Publisher Full Text 12. Hansen SK, Rau MH, Johansen HK, et al. : Evolution and diversification of Pseudomonas aeruginosa in the paranasal sinuses of cystic fibrosis children have implications for chronic lung infection. ISME J. 2012 Jan [cited 2020 Mar 4]; 6 (1): 31–45. PubMed Abstract | Publisher Full Text 13. Bricio-Moreno L, Sheridan VH, Goodhead I, et al. : Evolutionary trade-offs associated with loss of PmrB function in host-adapted Pseudomonas aeruginosa.[cited 2020 Mar 4]. Reference Source 14. Mahenthiralingam E, Campbell ME, Speert DP: Nonmotility and phagocytic resistance of Pseudomonas aeruginosa isolates from chronically colonized patients with cystic fibrosis. Infect. Immun. 1994; 62 (2): 596–605. PubMed Abstract | Publisher Full Text | Free Full Text 15. Hoffman LR, Richardson AR, Houston LS, et al. : Nutrient Availability as a Mechanism for Selection of Antibiotic Tolerant Pseudomonas aeruginosa within the CF Airway. PLoS Pathog. 2010 Jan [cited 2022 Mar 15]; 6 (1): 1000712. Publisher Full Text | Free Full Text 16. Winstanley C, O’Brien S, Brockhurst MA: Pseudomonas aeruginosa Evolutionary Adaptation and Diversification in Cystic Fibrosis Chronic Lung Infections. Trends Microbiol. 2016 May 1 [cited 2022 Jun 20]; 24 (5): 327–337. PubMed Abstract | Publisher Full Text | Free Full Text 17. Kåhrström CT: Survival of the wrinkliest. Nat. Rev. Microbiol. 2013 Jan 28 [cited 2022 Mar 8]; 11 (3): 149–149. PubMed Abstract | Publisher Full Text Reference Source 18. Yang L, Haagensen JAJ, Jelsbak L, et al. : In Situ Growth Rates and Biofilm Development of Pseudomonas aeruginosa Populations in Chronic Lung Infections. J. Bacteriol. 2008 Apr [cited 2022 Mar 15]; 190 (8): 2767–2776. /pmc/articles/PMC2293235/. PubMed Abstract | Publisher Full Text 19. Sriramulu DD, Lünsdorf H, Lam JS, et al. : Microcolony formation: A novel biofilm model of Pseudomonas aeruginosa for the cystic fibrosis lung. J. Med. Microbiol. 2005 Jul 1; 54 (7): 667–676. PubMed Abstract | Publisher Full Text 20. Dinesh SD: Articial Sputum Medium.2010 [cited 2021 Dec 26]. Publisher Full Text 21. Palmer KL, Aye LM, Whiteley M: Nutritional cues control Pseudomonas aeruginosa multicellular behavior in cystic fibrosis sputum. J. Bacteriol. 2007 Nov; 189 (22): 8079–8087. PubMed Abstract | Publisher Full Text 22. Harrison F, Muruli A, Higgins S, et al. : Development of an ex vivo porcine lung model for studying growth Virulence, And signaling of pseudomonas aeruginosa. Infect. Immun. 2014 Aug 1; 82 (8): 3312–3323. PubMed Abstract | Publisher Full Text 23. Sagel SD, Sontag MK, Accurso FJ: Relationship between antimicrobial proteins and airway inflammation and infection in cystic fibrosis. Pediatr. Pulmonol. 2009 Apr; 44 (4): 402–409. PubMed Abstract | Publisher Full Text 24. Thompson AB, Bohling T, Payvandi F, et al. : Lower respiratory tract lactoferrin and lysozyme arise primarily in the airways and are elevated in association with chronic bronchitis - PubMed. J. Lab. Clin. Med. 1990 [cited 2021 Dec 26]; 115 : 148–158. PubMed Abstract 25. Hasan CM, Green AE, Cox AA, et al. : Pseudomonas aeruginosa utilises host-derived polyamines to facilitate antimicrobial tolerance. bioRxiv. 2021 Dec 16 [cited 2022 Jan 19]. 2021.12.15.472801. Publisher Full Text 26. Grasemann H, Shehnaz D, Enomoto M, et al. : L-Ornithine Derived Polyamines in Cystic Fibrosis Airways. Vij N, editor. PLoS One. 2012 Oct 5 [cited 2020 Mar 5]; 7 (10): e46618. PubMed Abstract | Publisher Full Text 27. Jones GC, Sainsbury CAR: A Practical Approach to Glucose Abnormalities in Cystic Fibrosis. Diabetes Ther. 2016 Dec 1 [cited 2022 Jan 19]; 7 (4): 611–620. PubMed Abstract | Publisher Full Text | Free Full Text 28. Brodlie M, Aseeri A, Lordan JL, et al. : Bile acid aspiration in people with cystic fibrosis before and after lung transplantation. Eur. Respir. J. 2015; 46 : 1820–1823. PubMed Abstract | Publisher Full Text 29. Kirchner S, Fothergill JL, Wright EA, et al. : Use of artificial sputum medium to test antibiotic efficacy against Pseudomonas aeruginosa in conditions more relevant to the cystic fibrosis lung. J. Vis. Exp. 2012 Jun 5; 64 : 1–8. Publisher Full Text 30. Semaniakou A, Croll RP, Chappe V: Animal Models in the Pathophysiology of Cystic Fibrosis. Front. Pharmacol. 2018 [cited 2021 Dec 26]; 9 (JAN). Publisher Full Text | Free Full Text 31. Mestas J, Hughes CCW: Of Mice and Not Men: Differences between Mouse and Human Immunology. J. Immunol. 2004 Mar 1 [cited 2022 Jul 3]; 172 (5): 2731–2738. Publisher Full Text Reference Source 32. McCarron A, Donnelley M, Parsons D: Airway disease phenotypes in animal models of cystic fibrosis. Respir. Res. 2018 Apr 2 [cited 2021 Dec 26]; 19 (1): 12–54. PubMed Abstract | Publisher Full Text 33. Facchini M, De Fino I, Riva C, et al. : Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice. J. Vis. Exp. 2014 Mar 17 [cited 2022 Jan 19]; 85 : 51019. Publisher Full Text | Free Full Text 34. Annual Statistics of Scientific Procedures on Living Animals, Great Britain, 2021 - GOV.UK.[cited 2022 Aug 8]. Reference Source 35. Cornforth DM, Diggle FL, Melvin JA, et al. : Quantitative framework for model evaluation in microbiology research using Pseudomonas aeruginosa and cystic fibrosis infection as a test case. MBio. 2020 Jan 1 [cited 2022 Jun 22]; 11 (1). PubMed Abstract | Publisher Full Text 36. Lindemann J, Leiacker R, Rettinger G, et al. : Nasal mucosal temperature during respiration. Clin. Otolaryngol. Allied Sci. 2002 Jun 1 [cited 2020 Mar 5]; 27 (3): 135–139. Publisher Full Text 37. Henderson AG, Ehre C, Button B, et al. : Cystic fibrosis airway secretions exhibit mucin hyperconcentration and increased osmotic pressure. J. Clin. Invest. 2014 Jul 1; 124 (7): 3047–3060. PubMed Abstract | Publisher Full Text 38. Goldman MJ, Anderson GM, Stolzenberg ED, et al. : Human β-defensin-1 is a salt-sensitive antibiotic in lung that is inactivated in cystic fibrosis. Cell. 1997 Feb 21; 88 (4): 553–560. PubMed Abstract | Publisher Full Text 39. Pettigrew MM, Marks LR, Kong Y, et al. : Dynamic changes in the Streptococcus pneumoniae transcriptome during transition from biofilm formation to invasive disease upon influenza A virus infection. Infect. Immun. 2014 [cited 2021 Dec 26]; 82 (11): 4607–4619. PubMed Abstract | Publisher Full Text 40. Brennan AL, Gyi KM, Wood DM, et al. : Airway glucose concentrations and effect on growth of respiratory pathogens in cystic fibrosis. J. Cyst. Fibros. 2007 Apr 1; 6 (2): 101–109. PubMed Abstract | Publisher Full Text 41. Sprouffske K, Wagner A: Growth curver: An R package for obtaining interpretable metrics from microbial growth curves. BMC Bioinform. 2016; 17 : 1–4. 42. Rabin N, Zheng Y, Opoku-Temeng C, et al. : Medicinal Chemistry Biofilm formation mechanisms and targets for developing antibiofilm agents. Future Med. Chem. 2015 [cited 2021 Apr 12]; 7 (4): 493–512. PubMed Abstract | Publisher Full Text Reference Source 43. Bjarnsholt T, Jensen PØ, Fiandaca MJ, et al. : Pseudomonas aeruginosa biofilms in the respiratory tract of cystic fibrosis patients. Pediatr. Pulmonol. 2009 Jun [cited 2021 Apr 12]; 44 (6): 547–558. PubMed Abstract | Publisher Full Text 44. Ghanem R, Roquefort P, Ramel S, et al. : Apparent yield stress of sputum as a relevant biomarker in cystic fibrosis. Cells. 2021 Nov 1 [cited 2022 Mar 23]; 10 (11): 3107. PubMed Abstract | Publisher Full Text | Free Full Text 45. Hershberger CD, Ye RW, Parsek MR, et al. : The algT (algU) gene of Pseudomonas aeruginosa, a key regulator involved in alginate biosynthesis, encodes an alternative sigma factor (sigma E). Proc. Natl. Acad. Sci. U. S. A. 1995 Aug 15 [cited 2022 Mar 15]; 92 (17): 7941–7945. PubMed Abstract | Publisher Full Text | Free Full Text 46. Li XZ, Nikaido H, Poole K: Role of mexA-mexB-oprM in antibiotic efflux in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 1995 [cited 2022 Mar 15]; 39 (9): 1948–1953. PubMed Abstract | Publisher Full Text | Free Full Text 47. Cornforth DM, Dees JL, Ibberson CB, et al. : Pseudomonas aeruginosa transcriptome during human infection. Proc. Natl. Acad. Sci. U. S. A. 2018 May 29 [cited 2022 Mar 15]; 115 (22): E5125–E5134. PubMed Abstract | Publisher Full Text | Free Full Text 48. PA2911 - Probable TonB-dependent receptor - Pseudomonas aeruginosa (strain ATCC 15692/DSM 22644/CIP 104116/JCM 14847/LMG 12228/1C/ PRS 101/PAO1) - PA2911 gene & protein.[cited 2022 Mar 15]. Reference Source 49. lldA - L-lactate dehydrogenase - Pseudomonas aeruginosa (strain ATCC 15692/DSM 22644/CIP 104116/JCM 14847/LMG 12228/1C/ PRS 101/PAO1) - lldA gene & protein.[cited 2022 Mar 15]. Reference Source 50. Jonczyk MS, Escudero L, Sylvius N, et al. ; Variation in Inflammatory Response during Pneumococcal Infection Is Influenced by Host-Pathogen Interactions but Associated with Animal Survival. Infect. Immun. 2016 Apr 1 [cited 2022 Aug 5]; 84 (4): 894–905. PubMed Abstract | Publisher Full Text | Free Full Text 51. Jander G, Rahme LG, Ausubel FM: Positive Correlation between Virulence of Pseudomonas aeruginosa Mutants in Mice and Insects. J. Bacteriol. 2000 Jul [cited 2022 Aug 5]; 182 (13): 3843–3845. PubMed Abstract | Publisher Full Text | Free Full Text 52. Carter MEK, Fothergill JL, Walshaw MJ, et al. : A subtype of a Pseudomonas aeruginosa cystic fibrosis epidemic strain exhibits enhanced virulence in a murine model of acute respiratory infection. J. Infect. Dis. 2010 Sep 15 [cited 2022 Aug 5]; 202 (6): 935–942. PubMed Abstract | Publisher Full Text 53. Trzciński K, Li Y, Weinberger DM, et al. : Effect of serotype on pneumococcal competition in a mouse colonization model. MBio. 2015 [cited 2022 Aug 5]; 6 (5): e00902–e00915. PubMed Abstract | Publisher Full Text 54. Egesten A, Frick IM, Mörgelin M, et al. : Binding of albumin promotes bacterial survival at the epithelial surface. J. Biol. Chem. 2011 Jan 28; 286 (4): 2469–2476. PubMed Abstract | Publisher Full Text 55. Aprianto R, Slager J, Holsappel S, et al. : High-resolution analysis of the pneumococcal transcriptome under a wide range of infection-relevant conditions. Nucleic Acids Res. 2018 [cited 2020 Mar 5]; 46 (19): 9990–10006. PubMed Abstract | Publisher Full Text 56. Lewenza S, Johnson L, Charron-Mazenod L, et al. : Extracellular DNA controls expression of Pseudomonas aeruginosa genes involved in nutrient utilization, metal homeostasis, acid pH tolerance, and virulence. bioRxiv. 2019 Nov 21 [cited 2020 Mar 30]; 850446. Publisher Full Text 57. Smith DJ, Anderson GJ, Bell SC, et al. : Elevated metal concentrations in the CF airway correlate with cellular injury and disease severity. J. Cyst. Fibros. 2014 May 1; 13 (3): 289–295. PubMed Abstract | Publisher Full Text 58. Zlatina K, Galuska SP: The n-glycans of lactoferrin: More than just a sweet decoration. Biochem. Cell Biol. 2021 [cited 2022 Jun 25]; 99 (1): 117–127. PubMed Abstract | Publisher Full Text 59. Scanlon TC, Teneback CC, Gill A, et al. : Enhanced antimicrobial activity of engineered human lysozyme. ACS Chem. Biol. 2010 Sep 17 [cited 2022 Jan 19]; 5 (9): 809–818. PubMed Abstract | Publisher Full Text 60. Griswold KE, Bement JL, Teneback CC, et al. : Bioengineered lysozyme in combination therapies for Pseudomonas aeruginosa lung infections. Bioengineered. 2014 Feb 26 [cited 2022 Jan 19]; 5 (2): 143–147. PubMed Abstract | Publisher Full Text 61. Deckers D, Vanlint D, Callewaert L, et al. : Role of the lysozyme inhibitor Ivy in growth or survival of Escherichia coli and Pseudomonas aeruginosa bacteria in hen egg white and in human saliva and breast milk. Appl. Environ. Microbiol. 2008 Jul [cited 2022 Jun 20]; 74 (14): 4434–4439. PubMed Abstract | Publisher Full Text 62. Mariam DH, Mengistu Y, Hoffner SE, et al. : Effect of rpoB Mutations Conferring Rifampin Resistance on Fitness of Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 2004 Apr [cited 2021 Apr 11]; 48 (4): 1289–1294. PubMed Abstract | Publisher Full Text | Free Full Text 63. Azimi S, Roberts AEL, Peng S, et al. : Allelic polymorphism shapes community function in evolving Pseudomonas aeruginosa populations. ISME J. [Internet]. 2020 Apr 27 [cited 2022 Nov 4]; 14 (8): 1929–1942. Reference Source 64. Schick A, Kassen R: Rapid diversification of Pseudomonas aeruginosa in cystic fibrosis lung-like conditions. Proc. Natl. Acad. Sci. U. S. A. [Internet]. 2018 Oct 16 [cited 2022 Nov 4]; 115 (42): 10714–10719. Reference Source 65. Flynn KM: Evolution of ecological diversity in biofilms of Pseudomonas aeruginosa by altered cyclic diguanylate signaling. J. Bacteriol. 2016; 198 : 2608–2618. PubMed Abstract | Publisher Full Text | Free Full Text 66. Cohen-Cymberknoh M, Kerem E, Ferkol T, et al. : Airway inflammation in cystic fibrosis: molecular mechanisms and clinical implications. Thorax. 2013 Dec 1 [cited 2022 Mar 15]; 68 (12): 1157–1162. PubMed Abstract | Publisher Full Text Reference Source 67. Holloway BW: Genetic recombination in Pseudomonas aeruginosa. J. Gen. Microbiol. 1955 Dec 1 [cited 2022 Jan 19]; 13 (3): 572–581. Publisher Full Text 68. Fothergill JL, Panagea S, Hart CA, et al. : Widespread pyocyanin over-production among isolates of a cystic fibrosis epidemic strain. BMC Microbiol. 2007 [cited 2022 Jun 20]; 7 : 45. PubMed Abstract | Publisher Full Text | Free Full Text 69. Rogan MP, Taggart CC, Greene CM, et al. : Loss of Microbicidal Activity and Increased Formation of Biofilm Due to Decreased Lactoferrin Activity in Patients with Cystic Fibrosis. J. Infect. Dis. 2004 Oct; 190 (7): 1245–1253. PubMed Abstract | Publisher Full Text 70. Venkatakrishnan V, Packer NH, Thaysen-Andersen M: Expert Review of Respiratory Medicine Host mucin glycosylation plays a role in bacterial adhesion in lungs of individuals with cystic fibrosis.2014 [cited 2022 Mar 8]. Reference Source 71. Hoffman CL, Lalsiamthara J, Aballay A: Host mucin is exploited by Pseudomonas aeruginosa to provide monosaccharides required for a successful infection. MBio. 2020 Mar 1 [cited 2022 Mar 8]; 11 (2). PubMed Abstract | Publisher Full Text 72. Walker TS, Tomlin KL, Worthen GS, et al. : Enhanced Pseudomonas aeruginosa biofilm development mediated by human neutrophils. Infect. Immun. 2005 Jun; 73 (6): 3693–3701. PubMed Abstract | Publisher Full Text 73. Wilton M, Charron-Mazenod L, Moore R, et al. : Extracellular DNA Acidifies Biofilms and Induces Aminoglycoside Resistance in Pseudomonas aeruginosa.2015 [cited 2020 Jun 3]. Reference Source 74. Mulcahy H, Charron-Mazenod L, Lewenza S: Extracellular DNA chelates cations and induces antibiotic resistance in Pseudomonas aeruginosa biofilms. PLoS Pathog. 2008 Nov; 4 (11): e1000213. PubMed Abstract | Publisher Full Text 75. Barth AL, Pitt TL: The high amino-acid content of sputum from cystic fibrosis patients promotes growth of auxotrophic Pseudomonas aeruginosa. J. Med. Microbiol. 1996 [cited 2022 Mar 8]; 45 (2): 110–119. PubMed Abstract | Publisher Full Text 76. Diraviam D: Microbiology Insights Amino Acids enhance Adaptive Behaviour of Pseudomonas Aeruginosa in the cystic Fibrosis Lung environment.2010 [cited 2020 Jun 2]. Reference Source 77. Kruczek C, Wachtel M, Alabady MS, et al. : Serum albumin alters the expression of ironcontrolled genes in Pseudomonas aeruginosa. Microbiology. 2012 Feb 1 [cited 2022 Mar 8]; 158 (2): 353–367. PubMed Abstract | Publisher Full Text 78. Khubchandani KR, Oberley RE, Snyder JM: Effects of Surfactant Protein A and NaCl Concentration on the Uptake of Pseudomonas aeruginosa by THP-1 Cells.2012 Dec 14 [cited 2022 Mar 8]; 25 (6): 699–706. Publisher Full Text Reference Source 79. Flynn S, Reen FJ, O’gara F: Exposure to bile leads to the emergence of adaptive signaling variants in the opportunistic pathogen pseudomonas aeruginosa. Front. Microbiol. 2019; 10 (AUG): 2013. PubMed Abstract | Publisher Full Text 80. Riquelme SA, Lozano C, Moustafa AM, et al. : CFTR-PTEN-dependent mitochondrial metabolic dysfunction promotes Pseudomonas aeruginosa airway infection. Sci. Transl. Med. 2019 Jul 3; 11 (499). PubMed Abstract | Publisher Full Text 81. Schwab U, Abdullah LH, Perlmutt OS, et al. : Localization of Burkholderia cepacia complex bacteria in cystic fibrosis lungs and interactions with Pseudomonas aeruginosa in hypoxic mucus. Infect. Immun. 2014; 82 (11): 4729–4745. PubMed Abstract | Publisher Full Text 82. Henke MO, John G, Germann M, et al. : MUC5AC and MUC5B mucins increase in cystic fibrosis airway secretions during pulmonary exacerbation. Am. J. Respir. Crit. Care Med. 2007 Apr 14; 175 (8): 816–821. PubMed Abstract | Publisher Full Text 83. Blanchette KA, Shenoy AT, Milner J, et al. : Neuraminidase A-exposed galactose promotes Streptococcus pneumoniae biofilm formation during colonization. Infect. Immun. 2016; 84 (10): 2922–2932. PubMed Abstract | Publisher Full Text 84. Reen FJ, Woods DF, Mooij MJ, et al. : Respiratory Pathogens Adopt a Chronic Lifestyle in Response to Bile. Kaufmann GF, editor. PLoS One. 2012 Sep 26 [cited 2020 Apr 2]; 7 (9): e45978. PubMed Abstract | Publisher Full Text 85. Ruhluel D, O’Brien S, Fothergill JL, et al. : Underlying data for “Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health”. figshare. [Dataset].2022. Publisher Full Text Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 07 Sep 2022 ADD YOUR COMMENT Comment Author details Author details 1 University of Liverpool, Institute of Infection, Veterinary and Ecological Sciences,, Liverpool, L69 7BE, UK 2 Department of Microbiology, Moyne Institute of Preventive Medicine, Trinity College, Dublin, 2, Ireland Dilem Ruhluel Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Siobhan O'Brien Roles: Methodology, Project Administration, Supervision Joanne L Fothergill Roles: Conceptualization, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Writing – Review & Editing Daniel R Neill Roles: Conceptualization, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Writing – Review & Editing Competing interests No competing interests were disclosed. Grant information This work is supported by an NC3Rs PhD studentship grant (NC/S001700/1), awarded to DN and JF. JF and DN acknowledge grant support for the Strategic Research Centre (SRC) “An evidence-based preclinical framework for the development of antimicrobial therapeutics in cystic fibrosis” (PIPE-CF; Project No. SRC 022) from the UK Cystic Fibrosis Trust and CF Foundation (US). Article Versions (2) version 2 Revised Published: 30 Nov 2022, 11:1007 https://doi.org/10.12688/f1000research.125074.2 version 1 Published: 07 Sep 2022, 11:1007 https://doi.org/10.12688/f1000research.125074.1 Copyright © 2022 Ruhluel D et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Ruhluel D, O'Brien S, Fothergill JL and Neill DR. Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health [version 2; peer review: 2 approved] . F1000Research 2022, 11 :1007 ( https://doi.org/10.12688/f1000research.125074.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 2 VERSION 2 PUBLISHED 30 Nov 2022 Revised Views 0 Cite How to cite this report: Friman VP. Reviewer Report For: Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health [version 2; peer review: 2 approved] . F1000Research 2022, 11 :1007 ( https://doi.org/10.5256/f1000research.141209.r156986 ) The direct URL for this report is: https://f1000research.com/articles/11-1007/v2#referee-response-156986 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 02 Dec 2022 Ville-Petri Friman , Department of Biology, University of York, York, UK Approved VIEWS 0 https://doi.org/10.5256/f1000research.141209.r156986 Some additional statistical analyses have now been included ... Continue reading READ ALL Some additional statistical analyses have now been included in the revised version. I have no further comments. Competing Interests: No competing interests were disclosed. Reviewer Expertise: Microbiology I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Friman VP. Reviewer Report For: Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health [version 2; peer review: 2 approved] . F1000Research 2022, 11 :1007 ( https://doi.org/10.5256/f1000research.141209.r156986 ) The direct URL for this report is: https://f1000research.com/articles/11-1007/v2#referee-response-156986 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Version 1 VERSION 1 PUBLISHED 07 Sep 2022 Views 0 Cite How to cite this report: Azimi S and Vanderwoude J. Reviewer Report For: Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health [version 2; peer review: 2 approved] . F1000Research 2022, 11 :1007 ( https://doi.org/10.5256/f1000research.137340.r152082 ) The direct URL for this report is: https://f1000research.com/articles/11-1007/v1#referee-response-152082 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 25 Oct 2022 Sheyda Azimi , School of Biological Sciences, Center for Microbial Dynamics and Infection, Georgia State University, Atlanta, GA, USA Jelly Vanderwoude , Georgia Institute of Technology, Atlanta, GA, USA Approved VIEWS 0 https://doi.org/10.5256/f1000research.137340.r152082 In this article, the authors sought to develop four new culturing media—Healthy Sinus Media (HSM), Healthy Lung Media (HLM), Cystic Fibrosis Sinus Media (CFSM), and Cystic Fibrosis Lung Media (CFLM)—to recapitulate the environment of human lungs and sinuses, both ... Continue reading READ ALL In this article, the authors sought to develop four new culturing media—Healthy Sinus Media (HSM), Healthy Lung Media (HLM), Cystic Fibrosis Sinus Media (CFSM), and Cystic Fibrosis Lung Media (CFLM)—to recapitulate the environment of human lungs and sinuses, both in healthy individuals and those with cystic fibrosis (CF). The authors justify the need for the development of novel media by emphasizing that Artificial Sputum Media (ASM) and Synthetic Cystic Fibrosis Media (SCFM and SCFM2) capture many key nutritional aspects of the CF lung, they lack critical host-derived antimicrobials, polyamines, glucose, and bile salts. All of which impact Pseudomonas aeruginosa growth. Furthermore, there are yet no media that have been developed to capture the environments of healthy human lungs or sinuses, nor that of CF-impacted sinuses. This article is scientifically sound in developing and thoroughly testing four novel media to model human airways. The authors employ many different experimental tests to assay the viability of these novel media and assess their relevance to P. aeruginosa infection, including but not limited to: culturing strains in each chemical component independently before pooling, measuring growth and biofilm phenotypes, assessing long-term media stability, measuring gene expression, etc. The authors use appropriate statistical tests as necessary and conduct all experiments with technical and biological replicates. In addition, the authors describe detailed methods for preparing each medium, including supplier information for all reagents, stock concentrations, volumes, final concentrations, sterilization procedures, and special notes on media preparation so that others may easily reproduce these procedures. The authors provide a rationale for each component added with references to literature. The authors conduct all experiments in appropriate conditions to mimic in vivo , for example, altering growth temperatures between sinus and lung media. The article also provides sufficient rationale for the necessity of these media in the scientific community. The creation of these novel media will significantly add to the scientific community’s ability to better model CF infection dynamics in vitro preclinical models. Including healthy lung and sinus media will no doubt serve as a useful control for these experiments than LB or M9. Having accurate models for upper airway infection is also key in understanding the intermittent colonization and persistence of P. aeruginosa during initial colonization and antibiotic treatment. The various components tested by the authors for the development of these novel media were: Lysozyme, Lactoferrin, Spermidine, Spermine, Putrescine, Mucin, eDNA, Albumin, CaCl2, MgCl2, FeCl2, CuCl2, ZnCl2, NaCl, Sialic acid, Bile, N-acetyl glucosamine, Glucose, Succinate, Galactose, L-Methionine, L-Phenylalanine, LProline, L-Serine, L-Threonine, L-Tryptophan, L-Valine, L-Ornithine, L-Tyrosine, L(+)-Asparagine monohydrate, L-Alanine, L-Arginine, L(+)-Aspartic acid, L-Cysteine, LGlutamine, L-Glycine, L-Histidine, L-Isoleucine, L-Leucine, and L-Lysine. The authors chose the PAO1 and LESB65 as representative laboratory and CF-adapted strains of P. aeruginosa in their tested conditions. The authors first grew these strains in M9 media supplemented with each chemical component independently at three different concentrations. These concentrations were selected to most closely reflect the physiological concentration of each compound within each niche, based upon cited references in the literature or experimental testing of metabolites. Upon confirmation that these strains could grow sufficiently at the selected concentration of each metabolite, the authors then pooled the components at the appropriate ratios to yield four novel respiratory media: Healthy Sinus Media (HSM), Healthy Lung Media (HLM), Cystic Fibrosis Sinus Media (CFSM), and Cystic Fibrosis Lung Media (CFLM). The authors tested the viability and relevance of these media as preclinical models for human respiratory infections by assessing the: i) growth and biofilm formation of strains cultured continuously for 72 hours; ii) viscosity and shear rate in the media pre- and post-biofilm formation; iii) the stability of media after storage at 4° C for 40 days; iv) transcriptional changes of infection-relevant genes; and v) changes in colony morphology of strains evolved for 40 days; of PAO1 and LESB65 in each medium. The growth rate experiments show that PAO1 and LESB65 could be maintained for at least 72 hours, with similar dynamics to those previously published for P. aeruginosa in SCFM (authors may include the publications that used these media to study various aspects of P. aeruginosa infection). The crystal violet assays, which included growth in M9 and Luria-Bertani (LB) as additional comparators against the newly described media, show niche, disease state, and strain-specific differences in surface-attached and free-floating biofilm formation, highlighting the importance of using clinically-relevant models for estimating biofilm formation. Although the aggregate and aggregate formation are not tested here, authors can discuss those future assessments for these media. The authors also show that the viscosity and shear rate measurements of their proposed media agree with those published previously for CF and healthy human sputum. The authors also show that each media could support the same level of biofilm formation in PAO1 after 0, 10, 20, and 30 days of storage at 4° C, implying that the media remains stable for this duration. qPCR analysis shows that expression of the four tested virulence genes—algU, mexB, PA2911, and PA2382—significantly increased in all four novel media compared to their transcription levels in LB and additionally were comparable to transcription levels of the same strains grown in SCFM2. Long-term culturing of PAO1 in these media shows the evolution of a wrinkly colony morphotype, a potential redox-driven adaptation to maximize oxygen availability in biofilms, and morphological adaptations specific to CF media. Some minor comments: The authors determined these novel media's viability over 30 days by measuring PAO1 biofilm formation at 0, 10, 20, and 30 days. While it is nice to show that the media sustain similar levels of biofilm growth regardless of whether the media is freshly prepared, this might not be the best indicator of media stability over long periods. Instead, it would have been nice to see the authors conduct LCMS analyses to determine the stability of each of the chemical components at 0 and 30 days and detect if any possible degradation had occurred. Also, it is important to determine whether the growth of P. aeruginosa in the stored media displays any altered metabolism, physiology, or spatial organization. Additionally, instead of hand-picking a short list of four genes, it would have greatly strengthened the supporting case for these novel media by RNA-seq analysis. For example, comparing the entire transcriptional profile of P. aeruginosa grown in new media (fresh and stored at 4° C) to the transcriptional profile of cells grown in SCFM2 and in vivo samples would confirm the similarity of these preclinical models to the infection and healthy environments. I also understand that these experiments can be addressed in the future and are out of the scope of this study, which aimed to introduce these novel media for upper and lower respiratory tracts; however, I recommend that authors address this in the discussion section. I recommend authors include these studies and discuss the key benefits of using the novel HSM, CFSM, HLM, and CFLM media over the other versions available. In the section titled “Airway mimicking media is stable for at least 30 days at 4° C,” the wording of the first sentence leads to some confusion. At first glance, it appears to imply that PAO1 was cultured for 30 days, although the authors meant to say that PAO1 was cultured in media that had been stored for 30 days. The authors may want to re-write this sentence to avoid confusion. In Tables 3, 8, and 12, please use a consistent format for the concentration units μg/L or μg/l. In Figure 5, the legend below the chart is redundant, as it shows the same data as the labels on the X-axis. I would recommend removing this legend to simplify the readers' view. In Figure 6, standard deviation bars and significance labels would help the reader understand which relationships are significant without having to reference the text. There are studies on the evolution of P. aeruginosa in TSB, SCFM, and SCFM2 by Schick A, Kassen R (2018) 1 , Azimi et al., 2020 2 , and Flynn et al., 2016 3 , showing the emergence of various morphotypes in the populations that authors may want to include. The emergence of the observed morphotypes and phenotypes in this study is similar to what is observed as a result of evolving P. aeruginosa in other preclinical infection models are not unique to novel developed media. I suggest that authors include previous studies, discussing how future studies of genetic and phenotypic adaptation to the developed media are required. Thus, future analysis can confirm the unique adaptive traits observed in this study, similar to upper and lower CF respiratory infections. In Table 14, I believe the title is somewhat of a misnomer. The table shows when each morphotype appears and whether it is maintained in the populations. I would consider re-titling this table to reflect the prevalence of each morphotype over the evolution period. Are a suitable application and appropriate end-users identified? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are the 3Rs implications of the work described accurately? Yes Is the rationale for developing the new method (or application) clearly explained? Yes Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Yes If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Partly References 1. Schick A, Kassen R: Rapid diversification ofPseudomonas aeruginosa in cystic fibrosis lung-like conditions. Proceedings of the National Academy of Sciences . 2018; 115 (42): 10714-10719 Publisher Full Text 2. Azimi S, Roberts AEL, Peng S, Weitz JS, et al.: Allelic polymorphism shapes community function in evolving Pseudomonas aeruginosa populations. ISME J . 14 (8): 1929-1942 PubMed Abstract | Publisher Full Text 3. Flynn K, Dowell G, Johnson T, Koestler B, et al.: Evolution of Ecological Diversity in Biofilms of Pseudomonas aeruginosa by Altered Cyclic Diguanylate Signaling. Journal of Bacteriology . 2016; 198 (19): 2608-2618 Publisher Full Text Competing Interests: No competing interests were disclosed. Reviewer Expertise: Chronic infections, Biogeography of Infection, Pseudomonas aeruginosa population dynamics. We confirm that we have read this submission and believe that we have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Azimi S and Vanderwoude J. Reviewer Report For: Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health [version 2; peer review: 2 approved] . F1000Research 2022, 11 :1007 ( https://doi.org/10.5256/f1000research.137340.r152082 ) The direct URL for this report is: https://f1000research.com/articles/11-1007/v1#referee-response-152082 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 30 Nov 2022 DILEM RUHLUEL , University of Liverpool, Institute of Infection, Veterinary and Ecological Sciences,, Liverpool, L69 7BE, UK 30 Nov 2022 Author Response Thank you for the positive comments regarding the manuscript and for your helpful suggestions for improvements and discussion points. We have addressed each point raised, below and have submitted an ... Continue reading Thank you for the positive comments regarding the manuscript and for your helpful suggestions for improvements and discussion points. We have addressed each point raised, below and have submitted an updated manuscript version in which the changes have been made. The authors determined these novel media's viability over 30 days by measuring PAO1 biofilm formation at 0, 10, 20, and 30 days. While it is nice to show that the media sustain similar levels of biofilm growth regardless of whether the media is freshly prepared, this might not be the best indicator of media stability over long periods. Instead, it would have been nice to see the authors conduct LCMS analyses to determine the stability of each of the chemical components at 0 and 30 days and detect if any possible degradation had occurred. Also, it is important to determine whether the growth of P. aeruginosa in the stored media displays any altered metabolism, physiology, or spatial organization. We agree both that LCMS would offer a more complete determination of chemical stability and that investigation of bacterial metabolism, physiology and spatial organisation would be desirable. We have added a sentence to the discussion, highlighting the need for further studies into media stability. These studies are underway in our lab. Additionally, instead of hand-picking a short list of four genes, it would have greatly strengthened the supporting case for these novel media by RNA-seq analysis. For example, comparing the entire transcriptional profile of P. aeruginosa grown in new media (fresh and stored at 4° C) to the transcriptional profile of cells grown in SCFM2 and in vivo samples would confirm the similarity of these preclinical models to the infection and healthy environments. I also understand that these experiments can be addressed in the future and are out of the scope of this study, which aimed to introduce these novel media for upper and lower respiratory tracts; however, I recommend that authors address this in the discussion section. I recommend authors include these studies and discuss the key benefits of using the novel HSM, CFSM, HLM, and CFLM media over the other versions available. We completely agree and these studies have already begun. The large RNAseq dataset will require careful analysis. We feel that the space and word count needed to describe those data fully would make the current manuscript overly lengthy. As the reviewers suggest, we have instead mentioned the need for these investigations in the discussion. In the section titled “Airway mimicking media is stable for at least 30 days at 4° C,” the wording of the first sentence leads to some confusion. At first glance, it appears to imply that PAO1 was cultured for 30 days, although the authors meant to say that PAO1 was cultured in media that had been stored for 30 days. The authors may want to re-write this sentence to avoid confusion. Sorry for this confusion, we have now reworded the sentence. In Tables 3, 8, and 12, please use a consistent format for the concentration units μg/L or μg/l. We have now used μg/l throughout. In Figure 5, the legend below the chart is redundant, as it shows the same data as the labels on the X-axis. I would recommend removing this legend to simplify the readers' view. This figure has been reworked and the legend removed. In Figure 6, standard deviation bars and significance labels would help the reader understand which relationships are significant without having to reference the text. Standard deviation bars and significance labels have now been added to these graphs and we have described ANOVA summary statistics in the main text. There are studies on the evolution of P. aeruginosa in TSB, SCFM, and SCFM2 by Schick A, Kassen R (2018) 1 , Azimi et al., 2020 2 , and Flynn et al., 2016 3 , showing the emergence of various morphotypes in the populations that authors may want to include. Thank you for highlighting this. Reference to these studies has been added to our discussion. The emergence of the observed morphotypes and phenotypes in this study is similar to what is observed as a result of evolving P. aeruginosa in other preclinical infection models are not unique to novel developed media. I suggest that authors include previous studies, discussing how future studies of genetic and phenotypic adaptation to the developed media are required. Thus, future analysis can confirm the unique adaptive traits observed in this study, similar to upper and lower CF respiratory infections. Thank you for this suggestion. We have added the three references mentioned in the previous comment, alongside some discussion of the need to deconvolute those phenotypes that are adaptive for different respiratory environments from those that are merely adaptive to different modes of growth. In Table 14, I believe the title is somewhat of a misnomer. The table shows when each morphotype appears and whether it is maintained in the populations. I would consider re-titling this table to reflect the prevalence of each morphotype over the evolution period. We have re-titled this table. Unfortunately, these data were captured as presence/absence for each morphotype, at each time point. We don’t, therefore, have information on relative or absolute morphotype abundance over time. Thank you for the positive comments regarding the manuscript and for your helpful suggestions for improvements and discussion points. We have addressed each point raised, below and have submitted an updated manuscript version in which the changes have been made. The authors determined these novel media's viability over 30 days by measuring PAO1 biofilm formation at 0, 10, 20, and 30 days. While it is nice to show that the media sustain similar levels of biofilm growth regardless of whether the media is freshly prepared, this might not be the best indicator of media stability over long periods. Instead, it would have been nice to see the authors conduct LCMS analyses to determine the stability of each of the chemical components at 0 and 30 days and detect if any possible degradation had occurred. Also, it is important to determine whether the growth of P. aeruginosa in the stored media displays any altered metabolism, physiology, or spatial organization. We agree both that LCMS would offer a more complete determination of chemical stability and that investigation of bacterial metabolism, physiology and spatial organisation would be desirable. We have added a sentence to the discussion, highlighting the need for further studies into media stability. These studies are underway in our lab. Additionally, instead of hand-picking a short list of four genes, it would have greatly strengthened the supporting case for these novel media by RNA-seq analysis. For example, comparing the entire transcriptional profile of P. aeruginosa grown in new media (fresh and stored at 4° C) to the transcriptional profile of cells grown in SCFM2 and in vivo samples would confirm the similarity of these preclinical models to the infection and healthy environments. I also understand that these experiments can be addressed in the future and are out of the scope of this study, which aimed to introduce these novel media for upper and lower respiratory tracts; however, I recommend that authors address this in the discussion section. I recommend authors include these studies and discuss the key benefits of using the novel HSM, CFSM, HLM, and CFLM media over the other versions available. We completely agree and these studies have already begun. The large RNAseq dataset will require careful analysis. We feel that the space and word count needed to describe those data fully would make the current manuscript overly lengthy. As the reviewers suggest, we have instead mentioned the need for these investigations in the discussion. In the section titled “Airway mimicking media is stable for at least 30 days at 4° C,” the wording of the first sentence leads to some confusion. At first glance, it appears to imply that PAO1 was cultured for 30 days, although the authors meant to say that PAO1 was cultured in media that had been stored for 30 days. The authors may want to re-write this sentence to avoid confusion. Sorry for this confusion, we have now reworded the sentence. In Tables 3, 8, and 12, please use a consistent format for the concentration units μg/L or μg/l. We have now used μg/l throughout. In Figure 5, the legend below the chart is redundant, as it shows the same data as the labels on the X-axis. I would recommend removing this legend to simplify the readers' view. This figure has been reworked and the legend removed. In Figure 6, standard deviation bars and significance labels would help the reader understand which relationships are significant without having to reference the text. Standard deviation bars and significance labels have now been added to these graphs and we have described ANOVA summary statistics in the main text. There are studies on the evolution of P. aeruginosa in TSB, SCFM, and SCFM2 by Schick A, Kassen R (2018) 1 , Azimi et al., 2020 2 , and Flynn et al., 2016 3 , showing the emergence of various morphotypes in the populations that authors may want to include. Thank you for highlighting this. Reference to these studies has been added to our discussion. The emergence of the observed morphotypes and phenotypes in this study is similar to what is observed as a result of evolving P. aeruginosa in other preclinical infection models are not unique to novel developed media. I suggest that authors include previous studies, discussing how future studies of genetic and phenotypic adaptation to the developed media are required. Thus, future analysis can confirm the unique adaptive traits observed in this study, similar to upper and lower CF respiratory infections. Thank you for this suggestion. We have added the three references mentioned in the previous comment, alongside some discussion of the need to deconvolute those phenotypes that are adaptive for different respiratory environments from those that are merely adaptive to different modes of growth. In Table 14, I believe the title is somewhat of a misnomer. The table shows when each morphotype appears and whether it is maintained in the populations. I would consider re-titling this table to reflect the prevalence of each morphotype over the evolution period. We have re-titled this table. Unfortunately, these data were captured as presence/absence for each morphotype, at each time point. We don’t, therefore, have information on relative or absolute morphotype abundance over time. Competing Interests: No competing interests were disclosed. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 30 Nov 2022 DILEM RUHLUEL , University of Liverpool, Institute of Infection, Veterinary and Ecological Sciences,, Liverpool, L69 7BE, UK 30 Nov 2022 Author Response Thank you for the positive comments regarding the manuscript and for your helpful suggestions for improvements and discussion points. We have addressed each point raised, below and have submitted an ... Continue reading Thank you for the positive comments regarding the manuscript and for your helpful suggestions for improvements and discussion points. We have addressed each point raised, below and have submitted an updated manuscript version in which the changes have been made. The authors determined these novel media's viability over 30 days by measuring PAO1 biofilm formation at 0, 10, 20, and 30 days. While it is nice to show that the media sustain similar levels of biofilm growth regardless of whether the media is freshly prepared, this might not be the best indicator of media stability over long periods. Instead, it would have been nice to see the authors conduct LCMS analyses to determine the stability of each of the chemical components at 0 and 30 days and detect if any possible degradation had occurred. Also, it is important to determine whether the growth of P. aeruginosa in the stored media displays any altered metabolism, physiology, or spatial organization. We agree both that LCMS would offer a more complete determination of chemical stability and that investigation of bacterial metabolism, physiology and spatial organisation would be desirable. We have added a sentence to the discussion, highlighting the need for further studies into media stability. These studies are underway in our lab. Additionally, instead of hand-picking a short list of four genes, it would have greatly strengthened the supporting case for these novel media by RNA-seq analysis. For example, comparing the entire transcriptional profile of P. aeruginosa grown in new media (fresh and stored at 4° C) to the transcriptional profile of cells grown in SCFM2 and in vivo samples would confirm the similarity of these preclinical models to the infection and healthy environments. I also understand that these experiments can be addressed in the future and are out of the scope of this study, which aimed to introduce these novel media for upper and lower respiratory tracts; however, I recommend that authors address this in the discussion section. I recommend authors include these studies and discuss the key benefits of using the novel HSM, CFSM, HLM, and CFLM media over the other versions available. We completely agree and these studies have already begun. The large RNAseq dataset will require careful analysis. We feel that the space and word count needed to describe those data fully would make the current manuscript overly lengthy. As the reviewers suggest, we have instead mentioned the need for these investigations in the discussion. In the section titled “Airway mimicking media is stable for at least 30 days at 4° C,” the wording of the first sentence leads to some confusion. At first glance, it appears to imply that PAO1 was cultured for 30 days, although the authors meant to say that PAO1 was cultured in media that had been stored for 30 days. The authors may want to re-write this sentence to avoid confusion. Sorry for this confusion, we have now reworded the sentence. In Tables 3, 8, and 12, please use a consistent format for the concentration units μg/L or μg/l. We have now used μg/l throughout. In Figure 5, the legend below the chart is redundant, as it shows the same data as the labels on the X-axis. I would recommend removing this legend to simplify the readers' view. This figure has been reworked and the legend removed. In Figure 6, standard deviation bars and significance labels would help the reader understand which relationships are significant without having to reference the text. Standard deviation bars and significance labels have now been added to these graphs and we have described ANOVA summary statistics in the main text. There are studies on the evolution of P. aeruginosa in TSB, SCFM, and SCFM2 by Schick A, Kassen R (2018) 1 , Azimi et al., 2020 2 , and Flynn et al., 2016 3 , showing the emergence of various morphotypes in the populations that authors may want to include. Thank you for highlighting this. Reference to these studies has been added to our discussion. The emergence of the observed morphotypes and phenotypes in this study is similar to what is observed as a result of evolving P. aeruginosa in other preclinical infection models are not unique to novel developed media. I suggest that authors include previous studies, discussing how future studies of genetic and phenotypic adaptation to the developed media are required. Thus, future analysis can confirm the unique adaptive traits observed in this study, similar to upper and lower CF respiratory infections. Thank you for this suggestion. We have added the three references mentioned in the previous comment, alongside some discussion of the need to deconvolute those phenotypes that are adaptive for different respiratory environments from those that are merely adaptive to different modes of growth. In Table 14, I believe the title is somewhat of a misnomer. The table shows when each morphotype appears and whether it is maintained in the populations. I would consider re-titling this table to reflect the prevalence of each morphotype over the evolution period. We have re-titled this table. Unfortunately, these data were captured as presence/absence for each morphotype, at each time point. We don’t, therefore, have information on relative or absolute morphotype abundance over time. Thank you for the positive comments regarding the manuscript and for your helpful suggestions for improvements and discussion points. We have addressed each point raised, below and have submitted an updated manuscript version in which the changes have been made. The authors determined these novel media's viability over 30 days by measuring PAO1 biofilm formation at 0, 10, 20, and 30 days. While it is nice to show that the media sustain similar levels of biofilm growth regardless of whether the media is freshly prepared, this might not be the best indicator of media stability over long periods. Instead, it would have been nice to see the authors conduct LCMS analyses to determine the stability of each of the chemical components at 0 and 30 days and detect if any possible degradation had occurred. Also, it is important to determine whether the growth of P. aeruginosa in the stored media displays any altered metabolism, physiology, or spatial organization. We agree both that LCMS would offer a more complete determination of chemical stability and that investigation of bacterial metabolism, physiology and spatial organisation would be desirable. We have added a sentence to the discussion, highlighting the need for further studies into media stability. These studies are underway in our lab. Additionally, instead of hand-picking a short list of four genes, it would have greatly strengthened the supporting case for these novel media by RNA-seq analysis. For example, comparing the entire transcriptional profile of P. aeruginosa grown in new media (fresh and stored at 4° C) to the transcriptional profile of cells grown in SCFM2 and in vivo samples would confirm the similarity of these preclinical models to the infection and healthy environments. I also understand that these experiments can be addressed in the future and are out of the scope of this study, which aimed to introduce these novel media for upper and lower respiratory tracts; however, I recommend that authors address this in the discussion section. I recommend authors include these studies and discuss the key benefits of using the novel HSM, CFSM, HLM, and CFLM media over the other versions available. We completely agree and these studies have already begun. The large RNAseq dataset will require careful analysis. We feel that the space and word count needed to describe those data fully would make the current manuscript overly lengthy. As the reviewers suggest, we have instead mentioned the need for these investigations in the discussion. In the section titled “Airway mimicking media is stable for at least 30 days at 4° C,” the wording of the first sentence leads to some confusion. At first glance, it appears to imply that PAO1 was cultured for 30 days, although the authors meant to say that PAO1 was cultured in media that had been stored for 30 days. The authors may want to re-write this sentence to avoid confusion. Sorry for this confusion, we have now reworded the sentence. In Tables 3, 8, and 12, please use a consistent format for the concentration units μg/L or μg/l. We have now used μg/l throughout. In Figure 5, the legend below the chart is redundant, as it shows the same data as the labels on the X-axis. I would recommend removing this legend to simplify the readers' view. This figure has been reworked and the legend removed. In Figure 6, standard deviation bars and significance labels would help the reader understand which relationships are significant without having to reference the text. Standard deviation bars and significance labels have now been added to these graphs and we have described ANOVA summary statistics in the main text. There are studies on the evolution of P. aeruginosa in TSB, SCFM, and SCFM2 by Schick A, Kassen R (2018) 1 , Azimi et al., 2020 2 , and Flynn et al., 2016 3 , showing the emergence of various morphotypes in the populations that authors may want to include. Thank you for highlighting this. Reference to these studies has been added to our discussion. The emergence of the observed morphotypes and phenotypes in this study is similar to what is observed as a result of evolving P. aeruginosa in other preclinical infection models are not unique to novel developed media. I suggest that authors include previous studies, discussing how future studies of genetic and phenotypic adaptation to the developed media are required. Thus, future analysis can confirm the unique adaptive traits observed in this study, similar to upper and lower CF respiratory infections. Thank you for this suggestion. We have added the three references mentioned in the previous comment, alongside some discussion of the need to deconvolute those phenotypes that are adaptive for different respiratory environments from those that are merely adaptive to different modes of growth. In Table 14, I believe the title is somewhat of a misnomer. The table shows when each morphotype appears and whether it is maintained in the populations. I would consider re-titling this table to reflect the prevalence of each morphotype over the evolution period. We have re-titled this table. Unfortunately, these data were captured as presence/absence for each morphotype, at each time point. We don’t, therefore, have information on relative or absolute morphotype abundance over time. Competing Interests: No competing interests were disclosed. Close Report a concern COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Friman VP. Reviewer Report For: Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health [version 2; peer review: 2 approved] . F1000Research 2022, 11 :1007 ( https://doi.org/10.5256/f1000research.137340.r151644 ) The direct URL for this report is: https://f1000research.com/articles/11-1007/v1#referee-response-151644 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 25 Oct 2022 Ville-Petri Friman , Department of Biology, University of York, York, UK Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.137340.r151644 This is a very nice manuscript describing four new synthetic media mimicking growth conditions in the human lung. The main advancement is the development of both CF and healthy lung media and the addition of host-derived antimicrobials and stimulators (bile ... Continue reading READ ALL This is a very nice manuscript describing four new synthetic media mimicking growth conditions in the human lung. The main advancement is the development of both CF and healthy lung media and the addition of host-derived antimicrobials and stimulators (bile salts and polyamines) of bacterial signalling systems that are not included in commonly used SCFM2 medium. To some extent, this comparison falls a bit short as not all measurements are performed in SCFM2 and developed media. Moreover, the gene expression analysis relies on the expression of a few marker genes instead of whole genome transcriptomics, which could have revealed further interesting differences and allowed linking data with available transcriptomics data from CF lungs. Nevertheless, these are small omissions and could perhaps just be discussed briefly in the discussion. My main concern is the statistical analysis that could be improved a bit. I would suggest using full factorial analysis to clearly show if growth in the media is different for the two studied strains and if there are any interesting interactions between strain identity and specific media. These statistics should be properly reported in the text or supplementary tables including test statistics, error, and degrees of freedom. I would suggest: Use Repeated Measures Anova or GLMMs for analysing time-dependent data in Figure 1. Include strain identity in the model in Figures 2-3 to statistically compare if strains grew differently in these media. Figure 4: Which bacteria were grown in these media before the measurements? Or is this data averaged over both bacteria? Needs a little bit more information. Figure 5: Could also analyse the effect of time for each media and across all media to show that no change in biofilm formation was observed. I would reconsider naming this measure as ‘Stability of biofilm formation’ as this is what you measure instead of media stability, which could be understood as a measure of degradation of its components. Just to avoid confusion. Figure 6: I think the results here are much more nuanced than described in the results text. For example, the expression of algU is clearly different from other marker genes and there is no clear increase in its expression relative to growth in LB media (in contrast to what is said in the results text). Here, factorial Anova (or GLMM) would be powerful to show significant interactions between different media, studied strains, and developed media. Figure 7 and Table 14: Do you have quantitative data for colony morphotype frequencies during the experiment? Data is now quite descriptive. Out of interest, did you specifically test the effect of freezing (-80°C) for media composition? Are a suitable application and appropriate end-users identified? Yes If applicable, is the statistical analysis and its interpretation appropriate? Partly Are the 3Rs implications of the work described accurately? Yes Is the rationale for developing the new method (or application) clearly explained? Yes Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Yes If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Microbiology I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Friman VP. Reviewer Report For: Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health [version 2; peer review: 2 approved] . F1000Research 2022, 11 :1007 ( https://doi.org/10.5256/f1000research.137340.r151644 ) The direct URL for this report is: https://f1000research.com/articles/11-1007/v1#referee-response-151644 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 30 Nov 2022 DILEM RUHLUEL , University of Liverpool, Institute of Infection, Veterinary and Ecological Sciences,, Liverpool, L69 7BE, UK 30 Nov 2022 Author Response Thank you for the helpful comments and suggestions for alternative data analysis. We have addressed each point raised, below and have submitted a revised manuscript in which the indicated changes ... Continue reading Thank you for the helpful comments and suggestions for alternative data analysis. We have addressed each point raised, below and have submitted a revised manuscript in which the indicated changes have been made. To some extent, [the phenotypic] comparison falls a bit short as not all measurements are performed in SCFM2 and developed media. Moreover, the gene expression analysis relies on the expression of a few marker genes instead of whole genome transcriptomics, which could have revealed further interesting differences and allowed linking data with available transcriptomics data from CF lungs. Nevertheless, these are small omissions and could perhaps just be discussed briefly in the discussion. We agree that transcriptomic data would represent an important validation dataset for these media. We have now added some discussion of this point to the manuscript and hope to be able to report these data shortly. We agree, also, that it would be preferable to have SCFM2 data for all phenotypic comparisons. Where these are absent, we have now referenced studies conducted by others, in which SCFM2 was used. My main concern is the statistical analysis that could be improved a bit. I would suggest using full factorial analysis to clearly show if growth in the media is different for the two studied strains and if there are any interesting interactions between strain identity and specific media. These statistics should be properly reported in the text or supplementary tables including test statistics, error, and degrees of freedom. I would suggest: Use Repeated Measures Anova or GLMMs for analysing time-dependent data in Figure 1. We were cautious of over-interpreting these data, particularly when comparing between strains, as PAO1 and LESB65 have considerable differences in growth profile, even in standard laboratory media. However, we agree with the reviewer that comparisons of relative growth between media would be informative. We have now included empirical area under the curve (AUC_e) values for both strains, in all four media. These were determined from the original growth data in Figure 1. Two-way ANOVA analysis (alpha 0.05) of the AUC_e values shows that both strain and media type are significant variables (p < 0.0001, with 3 df for media type, p = 0.0084, with 1 df for strain). Sidak’s multiple comparison testing demonstrates the success of PAO1 in the CF media, relative to in healthy sinus and lung media. P values and a description of the findings have been added to the manuscript text and the AUC_e values are presented in Figure 1C. Include strain identity in the model in Figures 2-3 to statistically compare if strains grew differently in these media. We have done as suggested and provide updated figures, analysis and text in the revised manuscript. Strain was found to be a significant variable in both biofilm assays. We have reported summary statistics and pairwise comparisons in the text. Briefly, for crystal violet assays, PAO1 formed attached biofilms more readily than LESB65 in all airway niche media bar HLM (p 0.9999 in HLM in two-way ANOVA with Sidak’s multiple comparisons test). In resazurin assays, PAO1 biofilm formation differed significantly from that of LESB65 in HLM (p = 0.0001) and HSM (p < 0.0001) but not in the other media tested. Figure 4: Which bacteria were grown in these media before the measurements? Or is this data averaged over both bacteria? Needs a little bit more information. This was done with PAO1. We have added this info to the figure legend and the text in the results section. Figure 5: Could also analyse the effect of time for each media and across all media to show that no change in biofilm formation was observed. We have re-analysed with an ordinary two-way ANOVA. Media is a significant factor (P<0.0001), whilst media storage time is not (P=0.4174). No individual pairwise comparisons between timepoints proved significant for any of the four media. We have reported the ANOVA summary statistics in the text, as suggested. I would reconsider naming this measure as ‘Stability of biofilm formation’ as this is what you measure instead of media stability, which could be understood as a measure of degradation of its components. Just to avoid confusion. The title has been changed, as suggested. Figure 6: I think the results here are much more nuanced than described in the results text. For example, the expression of algU is clearly different from other marker genes and there is no clear increase in its expression relative to growth in LB media (in contrast to what is said in the results text). Here, factorial Anova (or GLMM) would be powerful to show significant interactions between different media, studied strains, and developed media. Apologies, our interpretation of these data was overly simplistic. We have now performed two-way ANOVA for each gene, to assess the contribution of strain and media type to observed differences. We have reported these in the manuscript, along with updated graphs and data descriptions. Briefly, strain was found to be a significant variable for mexB and PA2382 expression (p < 0.0001 for both), whilst media type was a significant variable for mexB (p = 0.0308) and PA2911 (p = 0.0462) expression. In Dunnett’s multiple comparison test, with LB set as the control group for each strain, significant differences in gene expression were identified for mexB with LESB65 grown in HSM (p = 0.0249) or CFSM (p = 0.0201) and for PA2382 with PAO1 grown in CFSM (p = 0.0243) or CFLM (p = 0.0273). We agree that algU is clearly different from the other genes and have acknowledged this in the manuscript text. Figure 7 and Table 14: Do you have quantitative data for colony morphotype frequencies during the experiment? Data is now quite descriptive. Unfortunately not. We plated a proportion of the total growth at each transfer and then recorded the different colony morphotypes as present or absent, rather than a quantitative measure. Out of interest, did you specifically test the effect of freezing (-80°C) for media composition? Only in the same way as reported for the 4°C storage, i.e. we confirmed that the media would still support biofilm growth. We’ve added to the discussion that LCMS could provide additional useful data on media stability under different conditions. Thank you for the helpful comments and suggestions for alternative data analysis. We have addressed each point raised, below and have submitted a revised manuscript in which the indicated changes have been made. To some extent, [the phenotypic] comparison falls a bit short as not all measurements are performed in SCFM2 and developed media. Moreover, the gene expression analysis relies on the expression of a few marker genes instead of whole genome transcriptomics, which could have revealed further interesting differences and allowed linking data with available transcriptomics data from CF lungs. Nevertheless, these are small omissions and could perhaps just be discussed briefly in the discussion. We agree that transcriptomic data would represent an important validation dataset for these media. We have now added some discussion of this point to the manuscript and hope to be able to report these data shortly. We agree, also, that it would be preferable to have SCFM2 data for all phenotypic comparisons. Where these are absent, we have now referenced studies conducted by others, in which SCFM2 was used. My main concern is the statistical analysis that could be improved a bit. I would suggest using full factorial analysis to clearly show if growth in the media is different for the two studied strains and if there are any interesting interactions between strain identity and specific media. These statistics should be properly reported in the text or supplementary tables including test statistics, error, and degrees of freedom. I would suggest: Use Repeated Measures Anova or GLMMs for analysing time-dependent data in Figure 1. We were cautious of over-interpreting these data, particularly when comparing between strains, as PAO1 and LESB65 have considerable differences in growth profile, even in standard laboratory media. However, we agree with the reviewer that comparisons of relative growth between media would be informative. We have now included empirical area under the curve (AUC_e) values for both strains, in all four media. These were determined from the original growth data in Figure 1. Two-way ANOVA analysis (alpha 0.05) of the AUC_e values shows that both strain and media type are significant variables (p < 0.0001, with 3 df for media type, p = 0.0084, with 1 df for strain). Sidak’s multiple comparison testing demonstrates the success of PAO1 in the CF media, relative to in healthy sinus and lung media. P values and a description of the findings have been added to the manuscript text and the AUC_e values are presented in Figure 1C. Include strain identity in the model in Figures 2-3 to statistically compare if strains grew differently in these media. We have done as suggested and provide updated figures, analysis and text in the revised manuscript. Strain was found to be a significant variable in both biofilm assays. We have reported summary statistics and pairwise comparisons in the text. Briefly, for crystal violet assays, PAO1 formed attached biofilms more readily than LESB65 in all airway niche media bar HLM (p 0.9999 in HLM in two-way ANOVA with Sidak’s multiple comparisons test). In resazurin assays, PAO1 biofilm formation differed significantly from that of LESB65 in HLM (p = 0.0001) and HSM (p < 0.0001) but not in the other media tested. Figure 4: Which bacteria were grown in these media before the measurements? Or is this data averaged over both bacteria? Needs a little bit more information. This was done with PAO1. We have added this info to the figure legend and the text in the results section. Figure 5: Could also analyse the effect of time for each media and across all media to show that no change in biofilm formation was observed. We have re-analysed with an ordinary two-way ANOVA. Media is a significant factor (P<0.0001), whilst media storage time is not (P=0.4174). No individual pairwise comparisons between timepoints proved significant for any of the four media. We have reported the ANOVA summary statistics in the text, as suggested. I would reconsider naming this measure as ‘Stability of biofilm formation’ as this is what you measure instead of media stability, which could be understood as a measure of degradation of its components. Just to avoid confusion. The title has been changed, as suggested. Figure 6: I think the results here are much more nuanced than described in the results text. For example, the expression of algU is clearly different from other marker genes and there is no clear increase in its expression relative to growth in LB media (in contrast to what is said in the results text). Here, factorial Anova (or GLMM) would be powerful to show significant interactions between different media, studied strains, and developed media. Apologies, our interpretation of these data was overly simplistic. We have now performed two-way ANOVA for each gene, to assess the contribution of strain and media type to observed differences. We have reported these in the manuscript, along with updated graphs and data descriptions. Briefly, strain was found to be a significant variable for mexB and PA2382 expression (p < 0.0001 for both), whilst media type was a significant variable for mexB (p = 0.0308) and PA2911 (p = 0.0462) expression. In Dunnett’s multiple comparison test, with LB set as the control group for each strain, significant differences in gene expression were identified for mexB with LESB65 grown in HSM (p = 0.0249) or CFSM (p = 0.0201) and for PA2382 with PAO1 grown in CFSM (p = 0.0243) or CFLM (p = 0.0273). We agree that algU is clearly different from the other genes and have acknowledged this in the manuscript text. Figure 7 and Table 14: Do you have quantitative data for colony morphotype frequencies during the experiment? Data is now quite descriptive. Unfortunately not. We plated a proportion of the total growth at each transfer and then recorded the different colony morphotypes as present or absent, rather than a quantitative measure. Out of interest, did you specifically test the effect of freezing (-80°C) for media composition? Only in the same way as reported for the 4°C storage, i.e. we confirmed that the media would still support biofilm growth. We’ve added to the discussion that LCMS could provide additional useful data on media stability under different conditions. Competing Interests: No competing interests were disclosed. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 30 Nov 2022 DILEM RUHLUEL , University of Liverpool, Institute of Infection, Veterinary and Ecological Sciences,, Liverpool, L69 7BE, UK 30 Nov 2022 Author Response Thank you for the helpful comments and suggestions for alternative data analysis. We have addressed each point raised, below and have submitted a revised manuscript in which the indicated changes ... Continue reading Thank you for the helpful comments and suggestions for alternative data analysis. We have addressed each point raised, below and have submitted a revised manuscript in which the indicated changes have been made. To some extent, [the phenotypic] comparison falls a bit short as not all measurements are performed in SCFM2 and developed media. Moreover, the gene expression analysis relies on the expression of a few marker genes instead of whole genome transcriptomics, which could have revealed further interesting differences and allowed linking data with available transcriptomics data from CF lungs. Nevertheless, these are small omissions and could perhaps just be discussed briefly in the discussion. We agree that transcriptomic data would represent an important validation dataset for these media. We have now added some discussion of this point to the manuscript and hope to be able to report these data shortly. We agree, also, that it would be preferable to have SCFM2 data for all phenotypic comparisons. Where these are absent, we have now referenced studies conducted by others, in which SCFM2 was used. My main concern is the statistical analysis that could be improved a bit. I would suggest using full factorial analysis to clearly show if growth in the media is different for the two studied strains and if there are any interesting interactions between strain identity and specific media. These statistics should be properly reported in the text or supplementary tables including test statistics, error, and degrees of freedom. I would suggest: Use Repeated Measures Anova or GLMMs for analysing time-dependent data in Figure 1. We were cautious of over-interpreting these data, particularly when comparing between strains, as PAO1 and LESB65 have considerable differences in growth profile, even in standard laboratory media. However, we agree with the reviewer that comparisons of relative growth between media would be informative. We have now included empirical area under the curve (AUC_e) values for both strains, in all four media. These were determined from the original growth data in Figure 1. Two-way ANOVA analysis (alpha 0.05) of the AUC_e values shows that both strain and media type are significant variables (p < 0.0001, with 3 df for media type, p = 0.0084, with 1 df for strain). Sidak’s multiple comparison testing demonstrates the success of PAO1 in the CF media, relative to in healthy sinus and lung media. P values and a description of the findings have been added to the manuscript text and the AUC_e values are presented in Figure 1C. Include strain identity in the model in Figures 2-3 to statistically compare if strains grew differently in these media. We have done as suggested and provide updated figures, analysis and text in the revised manuscript. Strain was found to be a significant variable in both biofilm assays. We have reported summary statistics and pairwise comparisons in the text. Briefly, for crystal violet assays, PAO1 formed attached biofilms more readily than LESB65 in all airway niche media bar HLM (p 0.9999 in HLM in two-way ANOVA with Sidak’s multiple comparisons test). In resazurin assays, PAO1 biofilm formation differed significantly from that of LESB65 in HLM (p = 0.0001) and HSM (p < 0.0001) but not in the other media tested. Figure 4: Which bacteria were grown in these media before the measurements? Or is this data averaged over both bacteria? Needs a little bit more information. This was done with PAO1. We have added this info to the figure legend and the text in the results section. Figure 5: Could also analyse the effect of time for each media and across all media to show that no change in biofilm formation was observed. We have re-analysed with an ordinary two-way ANOVA. Media is a significant factor (P<0.0001), whilst media storage time is not (P=0.4174). No individual pairwise comparisons between timepoints proved significant for any of the four media. We have reported the ANOVA summary statistics in the text, as suggested. I would reconsider naming this measure as ‘Stability of biofilm formation’ as this is what you measure instead of media stability, which could be understood as a measure of degradation of its components. Just to avoid confusion. The title has been changed, as suggested. Figure 6: I think the results here are much more nuanced than described in the results text. For example, the expression of algU is clearly different from other marker genes and there is no clear increase in its expression relative to growth in LB media (in contrast to what is said in the results text). Here, factorial Anova (or GLMM) would be powerful to show significant interactions between different media, studied strains, and developed media. Apologies, our interpretation of these data was overly simplistic. We have now performed two-way ANOVA for each gene, to assess the contribution of strain and media type to observed differences. We have reported these in the manuscript, along with updated graphs and data descriptions. Briefly, strain was found to be a significant variable for mexB and PA2382 expression (p < 0.0001 for both), whilst media type was a significant variable for mexB (p = 0.0308) and PA2911 (p = 0.0462) expression. In Dunnett’s multiple comparison test, with LB set as the control group for each strain, significant differences in gene expression were identified for mexB with LESB65 grown in HSM (p = 0.0249) or CFSM (p = 0.0201) and for PA2382 with PAO1 grown in CFSM (p = 0.0243) or CFLM (p = 0.0273). We agree that algU is clearly different from the other genes and have acknowledged this in the manuscript text. Figure 7 and Table 14: Do you have quantitative data for colony morphotype frequencies during the experiment? Data is now quite descriptive. Unfortunately not. We plated a proportion of the total growth at each transfer and then recorded the different colony morphotypes as present or absent, rather than a quantitative measure. Out of interest, did you specifically test the effect of freezing (-80°C) for media composition? Only in the same way as reported for the 4°C storage, i.e. we confirmed that the media would still support biofilm growth. We’ve added to the discussion that LCMS could provide additional useful data on media stability under different conditions. Thank you for the helpful comments and suggestions for alternative data analysis. We have addressed each point raised, below and have submitted a revised manuscript in which the indicated changes have been made. To some extent, [the phenotypic] comparison falls a bit short as not all measurements are performed in SCFM2 and developed media. Moreover, the gene expression analysis relies on the expression of a few marker genes instead of whole genome transcriptomics, which could have revealed further interesting differences and allowed linking data with available transcriptomics data from CF lungs. Nevertheless, these are small omissions and could perhaps just be discussed briefly in the discussion. We agree that transcriptomic data would represent an important validation dataset for these media. We have now added some discussion of this point to the manuscript and hope to be able to report these data shortly. We agree, also, that it would be preferable to have SCFM2 data for all phenotypic comparisons. Where these are absent, we have now referenced studies conducted by others, in which SCFM2 was used. My main concern is the statistical analysis that could be improved a bit. I would suggest using full factorial analysis to clearly show if growth in the media is different for the two studied strains and if there are any interesting interactions between strain identity and specific media. These statistics should be properly reported in the text or supplementary tables including test statistics, error, and degrees of freedom. I would suggest: Use Repeated Measures Anova or GLMMs for analysing time-dependent data in Figure 1. We were cautious of over-interpreting these data, particularly when comparing between strains, as PAO1 and LESB65 have considerable differences in growth profile, even in standard laboratory media. However, we agree with the reviewer that comparisons of relative growth between media would be informative. We have now included empirical area under the curve (AUC_e) values for both strains, in all four media. These were determined from the original growth data in Figure 1. Two-way ANOVA analysis (alpha 0.05) of the AUC_e values shows that both strain and media type are significant variables (p < 0.0001, with 3 df for media type, p = 0.0084, with 1 df for strain). Sidak’s multiple comparison testing demonstrates the success of PAO1 in the CF media, relative to in healthy sinus and lung media. P values and a description of the findings have been added to the manuscript text and the AUC_e values are presented in Figure 1C. Include strain identity in the model in Figures 2-3 to statistically compare if strains grew differently in these media. We have done as suggested and provide updated figures, analysis and text in the revised manuscript. Strain was found to be a significant variable in both biofilm assays. We have reported summary statistics and pairwise comparisons in the text. Briefly, for crystal violet assays, PAO1 formed attached biofilms more readily than LESB65 in all airway niche media bar HLM (p 0.9999 in HLM in two-way ANOVA with Sidak’s multiple comparisons test). In resazurin assays, PAO1 biofilm formation differed significantly from that of LESB65 in HLM (p = 0.0001) and HSM (p < 0.0001) but not in the other media tested. Figure 4: Which bacteria were grown in these media before the measurements? Or is this data averaged over both bacteria? Needs a little bit more information. This was done with PAO1. We have added this info to the figure legend and the text in the results section. Figure 5: Could also analyse the effect of time for each media and across all media to show that no change in biofilm formation was observed. We have re-analysed with an ordinary two-way ANOVA. Media is a significant factor (P<0.0001), whilst media storage time is not (P=0.4174). No individual pairwise comparisons between timepoints proved significant for any of the four media. We have reported the ANOVA summary statistics in the text, as suggested. I would reconsider naming this measure as ‘Stability of biofilm formation’ as this is what you measure instead of media stability, which could be understood as a measure of degradation of its components. Just to avoid confusion. The title has been changed, as suggested. Figure 6: I think the results here are much more nuanced than described in the results text. For example, the expression of algU is clearly different from other marker genes and there is no clear increase in its expression relative to growth in LB media (in contrast to what is said in the results text). Here, factorial Anova (or GLMM) would be powerful to show significant interactions between different media, studied strains, and developed media. Apologies, our interpretation of these data was overly simplistic. We have now performed two-way ANOVA for each gene, to assess the contribution of strain and media type to observed differences. We have reported these in the manuscript, along with updated graphs and data descriptions. Briefly, strain was found to be a significant variable for mexB and PA2382 expression (p < 0.0001 for both), whilst media type was a significant variable for mexB (p = 0.0308) and PA2911 (p = 0.0462) expression. In Dunnett’s multiple comparison test, with LB set as the control group for each strain, significant differences in gene expression were identified for mexB with LESB65 grown in HSM (p = 0.0249) or CFSM (p = 0.0201) and for PA2382 with PAO1 grown in CFSM (p = 0.0243) or CFLM (p = 0.0273). We agree that algU is clearly different from the other genes and have acknowledged this in the manuscript text. Figure 7 and Table 14: Do you have quantitative data for colony morphotype frequencies during the experiment? Data is now quite descriptive. Unfortunately not. We plated a proportion of the total growth at each transfer and then recorded the different colony morphotypes as present or absent, rather than a quantitative measure. Out of interest, did you specifically test the effect of freezing (-80°C) for media composition? Only in the same way as reported for the 4°C storage, i.e. we confirmed that the media would still support biofilm growth. We’ve added to the discussion that LCMS could provide additional useful data on media stability under different conditions. Competing Interests: No competing interests were disclosed. Close Report a concern COMMENT ON THIS REPORT Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 07 Sep 2022 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 Version 2 (revision) 30 Nov 22 read Version 1 07 Sep 22 read read Ville-Petri Friman , University of York, York, UK Sheyda Azimi , Georgia State University, Atlanta, USA Jelly Vanderwoude , Georgia Institute of Technology, Atlanta, USA Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2022 Friman V. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 02 Dec 2022 | for Version 2 Ville-Petri Friman , Department of Biology, University of York, York, UK 0 Views copyright © 2022 Friman V. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Some additional statistical analyses have now been included in the revised version. I have no further comments. Competing Interests No competing interests were disclosed. Reviewer Expertise Microbiology I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Friman VP. Peer Review Report For: Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health [version 2; peer review: 2 approved] . F1000Research 2022, 11 :1007 ( https://doi.org/10.5256/f1000research.141209.r156986) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/11-1007/v2#referee-response-156986 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2022 Azimi S et al. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 25 Oct 2022 | for Version 1 Sheyda Azimi , School of Biological Sciences, Center for Microbial Dynamics and Infection, Georgia State University, Atlanta, GA, USA Jelly Vanderwoude , Georgia Institute of Technology, Atlanta, GA, USA 0 Views copyright © 2022 Azimi S et al. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions In this article, the authors sought to develop four new culturing media—Healthy Sinus Media (HSM), Healthy Lung Media (HLM), Cystic Fibrosis Sinus Media (CFSM), and Cystic Fibrosis Lung Media (CFLM)—to recapitulate the environment of human lungs and sinuses, both in healthy individuals and those with cystic fibrosis (CF). The authors justify the need for the development of novel media by emphasizing that Artificial Sputum Media (ASM) and Synthetic Cystic Fibrosis Media (SCFM and SCFM2) capture many key nutritional aspects of the CF lung, they lack critical host-derived antimicrobials, polyamines, glucose, and bile salts. All of which impact Pseudomonas aeruginosa growth. Furthermore, there are yet no media that have been developed to capture the environments of healthy human lungs or sinuses, nor that of CF-impacted sinuses. This article is scientifically sound in developing and thoroughly testing four novel media to model human airways. The authors employ many different experimental tests to assay the viability of these novel media and assess their relevance to P. aeruginosa infection, including but not limited to: culturing strains in each chemical component independently before pooling, measuring growth and biofilm phenotypes, assessing long-term media stability, measuring gene expression, etc. The authors use appropriate statistical tests as necessary and conduct all experiments with technical and biological replicates. In addition, the authors describe detailed methods for preparing each medium, including supplier information for all reagents, stock concentrations, volumes, final concentrations, sterilization procedures, and special notes on media preparation so that others may easily reproduce these procedures. The authors provide a rationale for each component added with references to literature. The authors conduct all experiments in appropriate conditions to mimic in vivo , for example, altering growth temperatures between sinus and lung media. The article also provides sufficient rationale for the necessity of these media in the scientific community. The creation of these novel media will significantly add to the scientific community’s ability to better model CF infection dynamics in vitro preclinical models. Including healthy lung and sinus media will no doubt serve as a useful control for these experiments than LB or M9. Having accurate models for upper airway infection is also key in understanding the intermittent colonization and persistence of P. aeruginosa during initial colonization and antibiotic treatment. The various components tested by the authors for the development of these novel media were: Lysozyme, Lactoferrin, Spermidine, Spermine, Putrescine, Mucin, eDNA, Albumin, CaCl2, MgCl2, FeCl2, CuCl2, ZnCl2, NaCl, Sialic acid, Bile, N-acetyl glucosamine, Glucose, Succinate, Galactose, L-Methionine, L-Phenylalanine, LProline, L-Serine, L-Threonine, L-Tryptophan, L-Valine, L-Ornithine, L-Tyrosine, L(+)-Asparagine monohydrate, L-Alanine, L-Arginine, L(+)-Aspartic acid, L-Cysteine, LGlutamine, L-Glycine, L-Histidine, L-Isoleucine, L-Leucine, and L-Lysine. The authors chose the PAO1 and LESB65 as representative laboratory and CF-adapted strains of P. aeruginosa in their tested conditions. The authors first grew these strains in M9 media supplemented with each chemical component independently at three different concentrations. These concentrations were selected to most closely reflect the physiological concentration of each compound within each niche, based upon cited references in the literature or experimental testing of metabolites. Upon confirmation that these strains could grow sufficiently at the selected concentration of each metabolite, the authors then pooled the components at the appropriate ratios to yield four novel respiratory media: Healthy Sinus Media (HSM), Healthy Lung Media (HLM), Cystic Fibrosis Sinus Media (CFSM), and Cystic Fibrosis Lung Media (CFLM). The authors tested the viability and relevance of these media as preclinical models for human respiratory infections by assessing the: i) growth and biofilm formation of strains cultured continuously for 72 hours; ii) viscosity and shear rate in the media pre- and post-biofilm formation; iii) the stability of media after storage at 4° C for 40 days; iv) transcriptional changes of infection-relevant genes; and v) changes in colony morphology of strains evolved for 40 days; of PAO1 and LESB65 in each medium. The growth rate experiments show that PAO1 and LESB65 could be maintained for at least 72 hours, with similar dynamics to those previously published for P. aeruginosa in SCFM (authors may include the publications that used these media to study various aspects of P. aeruginosa infection). The crystal violet assays, which included growth in M9 and Luria-Bertani (LB) as additional comparators against the newly described media, show niche, disease state, and strain-specific differences in surface-attached and free-floating biofilm formation, highlighting the importance of using clinically-relevant models for estimating biofilm formation. Although the aggregate and aggregate formation are not tested here, authors can discuss those future assessments for these media. The authors also show that the viscosity and shear rate measurements of their proposed media agree with those published previously for CF and healthy human sputum. The authors also show that each media could support the same level of biofilm formation in PAO1 after 0, 10, 20, and 30 days of storage at 4° C, implying that the media remains stable for this duration. qPCR analysis shows that expression of the four tested virulence genes—algU, mexB, PA2911, and PA2382—significantly increased in all four novel media compared to their transcription levels in LB and additionally were comparable to transcription levels of the same strains grown in SCFM2. Long-term culturing of PAO1 in these media shows the evolution of a wrinkly colony morphotype, a potential redox-driven adaptation to maximize oxygen availability in biofilms, and morphological adaptations specific to CF media. Some minor comments: The authors determined these novel media's viability over 30 days by measuring PAO1 biofilm formation at 0, 10, 20, and 30 days. While it is nice to show that the media sustain similar levels of biofilm growth regardless of whether the media is freshly prepared, this might not be the best indicator of media stability over long periods. Instead, it would have been nice to see the authors conduct LCMS analyses to determine the stability of each of the chemical components at 0 and 30 days and detect if any possible degradation had occurred. Also, it is important to determine whether the growth of P. aeruginosa in the stored media displays any altered metabolism, physiology, or spatial organization. Additionally, instead of hand-picking a short list of four genes, it would have greatly strengthened the supporting case for these novel media by RNA-seq analysis. For example, comparing the entire transcriptional profile of P. aeruginosa grown in new media (fresh and stored at 4° C) to the transcriptional profile of cells grown in SCFM2 and in vivo samples would confirm the similarity of these preclinical models to the infection and healthy environments. I also understand that these experiments can be addressed in the future and are out of the scope of this study, which aimed to introduce these novel media for upper and lower respiratory tracts; however, I recommend that authors address this in the discussion section. I recommend authors include these studies and discuss the key benefits of using the novel HSM, CFSM, HLM, and CFLM media over the other versions available. In the section titled “Airway mimicking media is stable for at least 30 days at 4° C,” the wording of the first sentence leads to some confusion. At first glance, it appears to imply that PAO1 was cultured for 30 days, although the authors meant to say that PAO1 was cultured in media that had been stored for 30 days. The authors may want to re-write this sentence to avoid confusion. In Tables 3, 8, and 12, please use a consistent format for the concentration units μg/L or μg/l. In Figure 5, the legend below the chart is redundant, as it shows the same data as the labels on the X-axis. I would recommend removing this legend to simplify the readers' view. In Figure 6, standard deviation bars and significance labels would help the reader understand which relationships are significant without having to reference the text. There are studies on the evolution of P. aeruginosa in TSB, SCFM, and SCFM2 by Schick A, Kassen R (2018) 1 , Azimi et al., 2020 2 , and Flynn et al., 2016 3 , showing the emergence of various morphotypes in the populations that authors may want to include. The emergence of the observed morphotypes and phenotypes in this study is similar to what is observed as a result of evolving P. aeruginosa in other preclinical infection models are not unique to novel developed media. I suggest that authors include previous studies, discussing how future studies of genetic and phenotypic adaptation to the developed media are required. Thus, future analysis can confirm the unique adaptive traits observed in this study, similar to upper and lower CF respiratory infections. In Table 14, I believe the title is somewhat of a misnomer. The table shows when each morphotype appears and whether it is maintained in the populations. I would consider re-titling this table to reflect the prevalence of each morphotype over the evolution period. Are a suitable application and appropriate end-users identified? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are the 3Rs implications of the work described accurately? Yes Is the rationale for developing the new method (or application) clearly explained? Yes Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Yes If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Partly References 1. Schick A, Kassen R: Rapid diversification ofPseudomonas aeruginosa in cystic fibrosis lung-like conditions. Proceedings of the National Academy of Sciences . 2018; 115 (42): 10714-10719 Publisher Full Text 2. Azimi S, Roberts AEL, Peng S, Weitz JS, et al.: Allelic polymorphism shapes community function in evolving Pseudomonas aeruginosa populations. ISME J . 14 (8): 1929-1942 PubMed Abstract | Publisher Full Text 3. Flynn K, Dowell G, Johnson T, Koestler B, et al.: Evolution of Ecological Diversity in Biofilms of Pseudomonas aeruginosa by Altered Cyclic Diguanylate Signaling. Journal of Bacteriology . 2016; 198 (19): 2608-2618 Publisher Full Text Competing Interests No competing interests were disclosed. Reviewer Expertise Chronic infections, Biogeography of Infection, Pseudomonas aeruginosa population dynamics. We confirm that we have read this submission and believe that we have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (1) Author Response 30 Nov 2022 DILEM RUHLUEL, University of Liverpool, Institute of Infection, Veterinary and Ecological Sciences,, Liverpool, L69 7BE, UK Thank you for the positive comments regarding the manuscript and for your helpful suggestions for improvements and discussion points. We have addressed each point raised, below and have submitted an updated manuscript version in which the changes have been made. The authors determined these novel media's viability over 30 days by measuring PAO1 biofilm formation at 0, 10, 20, and 30 days. While it is nice to show that the media sustain similar levels of biofilm growth regardless of whether the media is freshly prepared, this might not be the best indicator of media stability over long periods. Instead, it would have been nice to see the authors conduct LCMS analyses to determine the stability of each of the chemical components at 0 and 30 days and detect if any possible degradation had occurred. Also, it is important to determine whether the growth of P. aeruginosa in the stored media displays any altered metabolism, physiology, or spatial organization. We agree both that LCMS would offer a more complete determination of chemical stability and that investigation of bacterial metabolism, physiology and spatial organisation would be desirable. We have added a sentence to the discussion, highlighting the need for further studies into media stability. These studies are underway in our lab. Additionally, instead of hand-picking a short list of four genes, it would have greatly strengthened the supporting case for these novel media by RNA-seq analysis. For example, comparing the entire transcriptional profile of P. aeruginosa grown in new media (fresh and stored at 4° C) to the transcriptional profile of cells grown in SCFM2 and in vivo samples would confirm the similarity of these preclinical models to the infection and healthy environments. I also understand that these experiments can be addressed in the future and are out of the scope of this study, which aimed to introduce these novel media for upper and lower respiratory tracts; however, I recommend that authors address this in the discussion section. I recommend authors include these studies and discuss the key benefits of using the novel HSM, CFSM, HLM, and CFLM media over the other versions available. We completely agree and these studies have already begun. The large RNAseq dataset will require careful analysis. We feel that the space and word count needed to describe those data fully would make the current manuscript overly lengthy. As the reviewers suggest, we have instead mentioned the need for these investigations in the discussion. In the section titled “Airway mimicking media is stable for at least 30 days at 4° C,” the wording of the first sentence leads to some confusion. At first glance, it appears to imply that PAO1 was cultured for 30 days, although the authors meant to say that PAO1 was cultured in media that had been stored for 30 days. The authors may want to re-write this sentence to avoid confusion. Sorry for this confusion, we have now reworded the sentence. In Tables 3, 8, and 12, please use a consistent format for the concentration units μg/L or μg/l. We have now used μg/l throughout. In Figure 5, the legend below the chart is redundant, as it shows the same data as the labels on the X-axis. I would recommend removing this legend to simplify the readers' view. This figure has been reworked and the legend removed. In Figure 6, standard deviation bars and significance labels would help the reader understand which relationships are significant without having to reference the text. Standard deviation bars and significance labels have now been added to these graphs and we have described ANOVA summary statistics in the main text. There are studies on the evolution of P. aeruginosa in TSB, SCFM, and SCFM2 by Schick A, Kassen R (2018) 1 , Azimi et al., 2020 2 , and Flynn et al., 2016 3 , showing the emergence of various morphotypes in the populations that authors may want to include. Thank you for highlighting this. Reference to these studies has been added to our discussion. The emergence of the observed morphotypes and phenotypes in this study is similar to what is observed as a result of evolving P. aeruginosa in other preclinical infection models are not unique to novel developed media. I suggest that authors include previous studies, discussing how future studies of genetic and phenotypic adaptation to the developed media are required. Thus, future analysis can confirm the unique adaptive traits observed in this study, similar to upper and lower CF respiratory infections. Thank you for this suggestion. We have added the three references mentioned in the previous comment, alongside some discussion of the need to deconvolute those phenotypes that are adaptive for different respiratory environments from those that are merely adaptive to different modes of growth. In Table 14, I believe the title is somewhat of a misnomer. The table shows when each morphotype appears and whether it is maintained in the populations. I would consider re-titling this table to reflect the prevalence of each morphotype over the evolution period. We have re-titled this table. Unfortunately, these data were captured as presence/absence for each morphotype, at each time point. We don’t, therefore, have information on relative or absolute morphotype abundance over time. View more View less Competing Interests No competing interests were disclosed. reply Respond Report a concern Azimi S and Vanderwoude J. Peer Review Report For: Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health [version 2; peer review: 2 approved] . F1000Research 2022, 11 :1007 ( https://doi.org/10.5256/f1000research.137340.r152082) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/11-1007/v1#referee-response-152082 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2022 Friman V. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 25 Oct 2022 | for Version 1 Ville-Petri Friman , Department of Biology, University of York, York, UK 0 Views copyright © 2022 Friman V. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions This is a very nice manuscript describing four new synthetic media mimicking growth conditions in the human lung. The main advancement is the development of both CF and healthy lung media and the addition of host-derived antimicrobials and stimulators (bile salts and polyamines) of bacterial signalling systems that are not included in commonly used SCFM2 medium. To some extent, this comparison falls a bit short as not all measurements are performed in SCFM2 and developed media. Moreover, the gene expression analysis relies on the expression of a few marker genes instead of whole genome transcriptomics, which could have revealed further interesting differences and allowed linking data with available transcriptomics data from CF lungs. Nevertheless, these are small omissions and could perhaps just be discussed briefly in the discussion. My main concern is the statistical analysis that could be improved a bit. I would suggest using full factorial analysis to clearly show if growth in the media is different for the two studied strains and if there are any interesting interactions between strain identity and specific media. These statistics should be properly reported in the text or supplementary tables including test statistics, error, and degrees of freedom. I would suggest: Use Repeated Measures Anova or GLMMs for analysing time-dependent data in Figure 1. Include strain identity in the model in Figures 2-3 to statistically compare if strains grew differently in these media. Figure 4: Which bacteria were grown in these media before the measurements? Or is this data averaged over both bacteria? Needs a little bit more information. Figure 5: Could also analyse the effect of time for each media and across all media to show that no change in biofilm formation was observed. I would reconsider naming this measure as ‘Stability of biofilm formation’ as this is what you measure instead of media stability, which could be understood as a measure of degradation of its components. Just to avoid confusion. Figure 6: I think the results here are much more nuanced than described in the results text. For example, the expression of algU is clearly different from other marker genes and there is no clear increase in its expression relative to growth in LB media (in contrast to what is said in the results text). Here, factorial Anova (or GLMM) would be powerful to show significant interactions between different media, studied strains, and developed media. Figure 7 and Table 14: Do you have quantitative data for colony morphotype frequencies during the experiment? Data is now quite descriptive. Out of interest, did you specifically test the effect of freezing (-80°C) for media composition? Are a suitable application and appropriate end-users identified? Yes If applicable, is the statistical analysis and its interpretation appropriate? Partly Are the 3Rs implications of the work described accurately? Yes Is the rationale for developing the new method (or application) clearly explained? Yes Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Yes If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Microbiology I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (1) Author Response 30 Nov 2022 DILEM RUHLUEL, University of Liverpool, Institute of Infection, Veterinary and Ecological Sciences,, Liverpool, L69 7BE, UK Thank you for the helpful comments and suggestions for alternative data analysis. We have addressed each point raised, below and have submitted a revised manuscript in which the indicated changes have been made. To some extent, [the phenotypic] comparison falls a bit short as not all measurements are performed in SCFM2 and developed media. Moreover, the gene expression analysis relies on the expression of a few marker genes instead of whole genome transcriptomics, which could have revealed further interesting differences and allowed linking data with available transcriptomics data from CF lungs. Nevertheless, these are small omissions and could perhaps just be discussed briefly in the discussion. We agree that transcriptomic data would represent an important validation dataset for these media. We have now added some discussion of this point to the manuscript and hope to be able to report these data shortly. We agree, also, that it would be preferable to have SCFM2 data for all phenotypic comparisons. Where these are absent, we have now referenced studies conducted by others, in which SCFM2 was used. My main concern is the statistical analysis that could be improved a bit. I would suggest using full factorial analysis to clearly show if growth in the media is different for the two studied strains and if there are any interesting interactions between strain identity and specific media. These statistics should be properly reported in the text or supplementary tables including test statistics, error, and degrees of freedom. I would suggest: Use Repeated Measures Anova or GLMMs for analysing time-dependent data in Figure 1. We were cautious of over-interpreting these data, particularly when comparing between strains, as PAO1 and LESB65 have considerable differences in growth profile, even in standard laboratory media. However, we agree with the reviewer that comparisons of relative growth between media would be informative. We have now included empirical area under the curve (AUC_e) values for both strains, in all four media. These were determined from the original growth data in Figure 1. Two-way ANOVA analysis (alpha 0.05) of the AUC_e values shows that both strain and media type are significant variables (p < 0.0001, with 3 df for media type, p = 0.0084, with 1 df for strain). Sidak’s multiple comparison testing demonstrates the success of PAO1 in the CF media, relative to in healthy sinus and lung media. P values and a description of the findings have been added to the manuscript text and the AUC_e values are presented in Figure 1C. Include strain identity in the model in Figures 2-3 to statistically compare if strains grew differently in these media. We have done as suggested and provide updated figures, analysis and text in the revised manuscript. Strain was found to be a significant variable in both biofilm assays. We have reported summary statistics and pairwise comparisons in the text. Briefly, for crystal violet assays, PAO1 formed attached biofilms more readily than LESB65 in all airway niche media bar HLM (p 0.9999 in HLM in two-way ANOVA with Sidak’s multiple comparisons test). In resazurin assays, PAO1 biofilm formation differed significantly from that of LESB65 in HLM (p = 0.0001) and HSM (p < 0.0001) but not in the other media tested. Figure 4: Which bacteria were grown in these media before the measurements? Or is this data averaged over both bacteria? Needs a little bit more information. This was done with PAO1. We have added this info to the figure legend and the text in the results section. Figure 5: Could also analyse the effect of time for each media and across all media to show that no change in biofilm formation was observed. We have re-analysed with an ordinary two-way ANOVA. Media is a significant factor (P<0.0001), whilst media storage time is not (P=0.4174). No individual pairwise comparisons between timepoints proved significant for any of the four media. We have reported the ANOVA summary statistics in the text, as suggested. I would reconsider naming this measure as ‘Stability of biofilm formation’ as this is what you measure instead of media stability, which could be understood as a measure of degradation of its components. Just to avoid confusion. The title has been changed, as suggested. Figure 6: I think the results here are much more nuanced than described in the results text. For example, the expression of algU is clearly different from other marker genes and there is no clear increase in its expression relative to growth in LB media (in contrast to what is said in the results text). Here, factorial Anova (or GLMM) would be powerful to show significant interactions between different media, studied strains, and developed media. Apologies, our interpretation of these data was overly simplistic. We have now performed two-way ANOVA for each gene, to assess the contribution of strain and media type to observed differences. We have reported these in the manuscript, along with updated graphs and data descriptions. Briefly, strain was found to be a significant variable for mexB and PA2382 expression (p < 0.0001 for both), whilst media type was a significant variable for mexB (p = 0.0308) and PA2911 (p = 0.0462) expression. In Dunnett’s multiple comparison test, with LB set as the control group for each strain, significant differences in gene expression were identified for mexB with LESB65 grown in HSM (p = 0.0249) or CFSM (p = 0.0201) and for PA2382 with PAO1 grown in CFSM (p = 0.0243) or CFLM (p = 0.0273). We agree that algU is clearly different from the other genes and have acknowledged this in the manuscript text. Figure 7 and Table 14: Do you have quantitative data for colony morphotype frequencies during the experiment? Data is now quite descriptive. Unfortunately not. We plated a proportion of the total growth at each transfer and then recorded the different colony morphotypes as present or absent, rather than a quantitative measure. Out of interest, did you specifically test the effect of freezing (-80°C) for media composition? Only in the same way as reported for the 4°C storage, i.e. we confirmed that the media would still support biofilm growth. We’ve added to the discussion that LCMS could provide additional useful data on media stability under different conditions. View more View less Competing Interests No competing interests were disclosed. reply Respond Report a concern Friman VP. Peer Review Report For: Development of liquid culture media mimicking the conditions of sinuses and lungs in cystic fibrosis and health [version 2; peer review: 2 approved] . F1000Research 2022, 11 :1007 ( https://doi.org/10.5256/f1000research.137340.r151644) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/11-1007/v1#referee-response-151644 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "Development of liquid culture media mimicking...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/11-1007/v2" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/11-1007/v2&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/11-1007/v2" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Ruhluel D et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/11-1007/v2/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/11-1007", templates : { twitter : "Development of liquid culture media mimicking the conditions.... Ruhluel D et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/11-1007/v2" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/125074/141209") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "141209"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "150246": 0, "152082": 43, "152083": 0, "150099": 0, "152081": 0, "149718": 0, "149719": 0, "156986": 22, "149722": 0, "156987": 0, "149723": 0, "150395": 0, "149720": 0, "149721": 0, "151644": 37, "151645": 0, "152573": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "7f5b234a-d848-4b05-97ea-6fcdbe596a6b"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "[email protected]", infoEmail: "[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00