Grape Seed Extract Mitigates Acute Stress-Induced Neuroinflammation and Oxidative Damage in Female Mice: Evidence for Gut–Brain Axis Modulation

Grape Seed Extract Mitigates Acute Stress-Induced Neuroinflammation and Oxidative Damage in Female Mice: Evidence for Gut–Brain Axis Modulation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Grape Seed Extract Mitigates Acute Stress-Induced Neuroinflammation and Oxidative Damage in Female Mice: Evidence for Gut–Brain Axis Modulation Rafaela Xavier, Marina Rigotti, Renata L. Oliveira, Laura F. Finger, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8950236/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Short-term stress is known to trigger oxidative and neuroinflammatory responses that contribute to the onset and progression of major depressive disorder (MDD). Phenolic compounds, such as grape seed extract (GSE), have gained attention for their ability to modulate these biological pathways. This study aimed to evaluate whether GSE (20 or 40 mg/kg, oral route) exerts antidepressant-like effects and mitigates stress-induced biochemical alterations in female mice exposed to the acute restraint stress (ARS) model. Female mice were pretreated with GSE and subsequently subjected to ARS. Behavioral outcomes were assessed using the tail suspension test (TST) and open field test (OFT). Plasma corticosterone levels, reactive species (RS) production in the prefrontal cortex, hippocampus, and small intestine, and mRNA expression of inflammatory mediators (NF-κB, IL-1β, IFN-γ) in brain and gut tissues were quantified through standard biochemical and molecular analyses. GSE pretreatment significantly prevented the ARS-induced increase in immobility time in the TST, without affecting locomotor activity in the OFT. ARS exposure elevated corticosterone concentrations and RS generation across central and peripheral tissues; both effects were attenuated by GSE. Additionally, GSE downregulated stress-induced expression of pro-inflammatory cytokines in neural and intestinal samples, indicating suppression of key inflammatory pathways. These findings demonstrate that GSE exerts antidepressant-like, antioxidant, and anti-inflammatory effects by modulating interconnected redox and cytokine signaling pathways. Importantly, this study provides novel evidence that GSE acts along the gut–brain axis, mitigating corticosterone-driven oxidative and inflammatory responses. These results highlight GSE as a promising natural compound for the prevention and management of stress-related neuropsychiatric disorders. depression grape seed extract corticosterone antioxidant neuroinflammation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Grapes ( Vitis vinifera ) are among the most widely consumed fruits globally, and they are a rich source of bioactive compounds, particularly polyphenols with potent antioxidant activity. Grape seed extract (GSE) contains over 90% polyphenols, including both flavonoid and non-flavonoid constituents [ 1 ]. It is primarily composed of flavan-3-ol derivatives, such as catechin and epicatechin, in the form of monomers, dimers, trimers, and oligomers [ 2 ]. As a natural co-product derived from grape, GSE has gained attention as a sustainable source of bioactive compounds with multiple therapeutic properties [ 3 , 4 ] Given the strong interplay between chronic inflammation and pathological processes such as cancer, neurodegeneration, and mood disorders, the antioxidant and anti-inflammatory effects of GSE have broad translational relevance. Its unique phytochemical composition underlies diverse pharmacological actions, particularly in the prevention and management of neurodegenerative and mood disorders [ 5 – 8 ] These properties are particularly important since oxidative and neuroinflammatory processes are key mechanisms driving major depressive disorder (MDD), often triggered by acute stress [ 9 , 10 ]. MDD is a multifactorial psychiatric condition characterized by persistent low mood, anhedonia, and disturbances in sleep, appetite, energy, and cognition [ 11 ]. Its complex etiology involves the interplay between neuroinflammation, oxidative stress, and neuroendocrine dysregulation, which together impair neurotransmission and synaptic plasticity [ 12 ]. According to the World Health Organization (WHO, 2025), MDD affects women almost twice as often as men, underscoring the importance of investigating sex-specific mechanisms and therapeutic responses [ 13 ]. In this context, experimental studies have demonstrated that females show greater sensitivity to stress-induced neuroendocrine and inflammatory alterations, which may contribute to their increased vulnerability to MDD [ 13 – 15 ] Exposure to stress activates the hypothalamic–pituitary–adrenal (HPA) axis, leading to the excessive release of glucocorticoids, mainly cortisol, from the adrenal cortex. Sustained glucocorticoid elevation promotes receptor resistance and disrupts the negative feedback regulation of the HPA axis [ 12 ]. This dysregulation has profound metabolic and neurobiological consequences, including enhanced mitochondrial activity and overproduction of reactive oxygen species (ROS). Elevated ROS levels activate microglia and astrocytes, triggering the release of proinflammatory cytokines and mediators that perpetuate neuroinflammation and oxidative imbalance within the central nervous system (CNS) [ 16 ] Previous studies have shown that GSE exerts neuroprotective effects by modulating pathways associated with neuroinflammation and oxidative stress. Sun [ 1 ] demonstrated that GSE administration reduced hippocampal oxidative stress and neuroinflammation in prenatally stressed female rats, accompanied by attenuation of depressive-like behaviors. Similarly, Jiang [ 17 ] reported that GSE pretreatment mitigated depressive behavior and suppressed the expression of inflammatory markers such as interleukin-1β (IL-1β) and nuclear factor kappa B (NF-κB) in mice challenged with lipopolysaccharide. In vitro , GSE reestablished redox balance and suppressed NLRP3-mediated inflammation induced by the tryptophan catabolite quinolinic acid in a glial microenvironment. Collectively, these findings indicate that the antidepressant-like effects of GSE are closely linked to its ability to modulate oxidative and inflammatory signaling pathways. Given this background, the present study aims to evaluate the potential antidepressant-like effects of GSE in female Swiss mice subjected to the acute restraint stress (ARS) model. By assessing behavioral, oxidative, and inflammatory parameters, this study seeks to elucidate the mechanisms through which GSE may modulate HPA axis dysfunction and exert neuroprotective and anti-inflammatory actions in stress-induced depressive-like states. 2. Materials and methods 2.1. Animals Experiments were conducted using female Swiss mice, aged between 4 and 6 weeks (25–30 g), obtained from the Central Animal Facility of the Federal University of Pelotas (UFPel). Animals were housed in groups of seven per cage (n = 7) under standard environmental conditions (22 ± 1°C; 12 h light/dark cycle) with free access to food and water. All experimental procedures were performed between 08:00 a.m. and 06:00 p.m., in accordance with the guidelines of the UFPel Animal Ethics Committee (CEUA/UFPel, protocol no. 131/2023). 2.2. Grape Seed Extract The GSE was purchased from Xi’an Herbspirit Technology Co., Ltd. (Batch No. XC20230310, Shaanxi, P.R. China). The phenolic characterization and composition of the extract were previously described by Rigotti et. al [ 7 ]. For animal use, the extract was diluted in distilled water to final concentrations of 20 or 40 mg/kg and filtered using a sterile syringe filter (polyethersulfone, 0.22 µm pore size). The extract doses and pretreatment period were established based on the previous study by Jiang et. al [ 17 ]. Animals received daily intragastric (i.g.) administration of GSE or vehicle (distilled water) for seven consecutive days at doses of 20 or 40 mg/kg. 2.3. Acute Restraint Stress (ARS) The animals were submitted to physical restraint as previously reported by Domingues et. al [ 18 ]. Mice were subjected to immobilization for 4 hours using an individual rodent restraint device made of fenestrated Plexiglas, restraining physical movement. During the period of exposure to stress, the animals were deprived of water and food. After the 4-hours period, the animals were returned to their respective home cages. 2.4. Experimental Design The experimental design is illustrated in Fig. 1 . This study aimed to investigate the potential of GSE to prevent ARS-induced depressive-like behavior. Animals were randomly assigned to six experimental groups (n = 7 per group): G1: Non-stressed Control (No stress + vehicle) G2: GSE 20 mg/kg per se (No stress + GSE 20) G3: GSE 40 mg/kg per se (No stress + GSE 40) G4: ARS-induced (ARS + vehicle) G5: GSE 20 mg/kg (ARS + GSE 20) G6: GSE 40 mg/kg (ARS + GSE 40) Animals received daily intragastric (i.g.) administration of GSE or vehicle (distilled water) for seven consecutive days at doses of 20 or 40 mg/kg. On the eighth day, mice were subjected to 4 hours of ARS. On the ninth day, behavioral assessments were performed using the Open Field Test (OFT) and the Tail Suspension Test (TST). Following behavioral testing, animals were anesthetized with isoflurane (inhalation) for cardiac puncture and blood collection to determine the plasma corticosterone levels. The prefrontal cortex, hippocampi, and small intestinal tissues were also collected for subsequent biochemical and molecular analyses. 2.5. Behavioral Tests 2.5.1. Open Field Test (OFT) The OFT was conducted prior to other behavioral assessments, following the procedure described by Walsh and Cummins [ 19 ]. This test measures behavioral changes in rodents exposed to novel environments and helps to confirm that depression-like behavior is not due to general motor activity alterations (Santos et al., 2011). Each mouse was individually placed in the center of an open field box (30 × 30 × 15 cm) divided into nine equal quadrants and observed for 5 minutes. The locomotor activity was quantified by the number of quadrants crossed, while the exploratory behavior, by the number of rearing events. 2.5.2. Tail Suspension Test (TST) The total immobility time during the TST was measured as described by Steru et. al [ 20 ] Mice were individually suspended 50 cm above the floor using adhesive tape placed approximately 1 cm from the tip of the tail. The immobility time, defined as the absence of escape-oriented movements, was recorded during the last 4 minutes of a 6-minute session. The test was conducted manually by a blind observer to the experimental conditions. 2.6. Biochemical Analyses 2.6.1. Tissue Preparation After behavioral tests, animals were anesthetized with isoflurane inhalation, and blood was collected by cardiac puncture into heparinized tubes. Samples were centrifuged at 3.500 rpm for 10 minutes, and the plasma was used for corticosterone quantification. Following blood collection, animals were euthanized by decapitation, and the prefrontal cortex, hippocampi and small intestine were rapidly dissected and kept on ice until homogenization in 50 mM Tris-HCl buffer (pH 7.4; 1:10 w/v). The homogenates were centrifuged at 2.500 ×g for 10 minutes at 4°C, and the supernatant (S1 fraction) was used for reactive species (RS) assay. For gene expression analysis, a separate group of animals was used; their prefrontal cortex, hippocampi, and small intestinal samples were stored in Trizol reagent at − 80°C for subsequent qRT-PCR analysis. 2.6.2. Plasma Corticosterone Levels Corticosterone levels were determined according to Zenker and Bernstein [ 21 ] Briefly, heparinized blood was centrifuged at 3.500 rpm for 10 minutes to obtain plasma. To 200 µL of plasma, 800 µL of distilled water and 2 mL of chloroform were added, mixed for 15 seconds, and centrifuged at 2.500 rpm for 5 minutes. The aqueous phase was discarded, and the chloroform phase was retained. Then, 1 mL of 0.1 M NaOH was added, mixed for 15 seconds, and centrifuged again. One milliliter of the chloroform phase was transferred to a new tube, mixed with 3 mL of fluorescence reagent, and centrifuged once more. The chloroform phase was then incubated for 2 hours before spectrofluorometric reading (excitation = 247 nm; emission = 540 nm; slit = 5 nm). Plasma corticosterone levels were expressed as ng/mL. 2.6.3. Reactive Species (RS) RS quantification in prefrontal cortex, hippocampi, and small intestine of pretreated mice followed the method described by Loetchutinat et. al [ 22 ]. Briefly, 10 µL of 1 mM DCFH-DA (2’,7’-dichlorodihydrofluorescein diacetate) were incubated with 10 µL of tissue homogenate and 2.990 µL of 10 mM Tris-HCl buffer (pH 7.4). The oxidation of DCFH-DA to fluorescent DCF was used as an indicator of intracellular RS. Fluorescence intensity was measured at 480 nm excitation and 520 nm emission, and results were expressed as fluorescence units per mg of protein. 2.6.4. Protein Quantification Protein content was determined by the Bradford [ 23 ] method using bovine serum albumin (1 mg/mL) as the standard. After sample homogenization, 5 µL of homogenate were incubated with 45 µL of distilled water and 2.5 mL of Coomassie Brilliant Blue reagent for 10 minutes, and absorbance was read at 595 nm using a spectrophotometer. 2.7. RNA Extraction and Gene Expression Analysis by qRT-PCR Total mRNA was extracted from the cortex, hippocampi, and small intestine using TRIzol followed by mRNA quantification. The cDNA synthesis was performed using a High-Capacity cDNA Reverse Transcription kit according to the manufacturer’s protocol. The amplification was made with the GoTaq® qPCR Master Mix using the Agilent AriaMX real-time PCR. Gene expressions were normalized using GAPDH primer as a reference gene. The 2ΔΔCT (Delta–Delta Comparative Threshold) method was used to normalize the fold change in gene expression. The genes analyzed are shown in Table 1 . Based on the comparable behavioral and biochemical efficacy observed for both GSE doses (20 and 40 mg/kg), qRT-PCR analyses were conducted only in samples from the 20 mg/kg group to prioritize the lower effective dose. Table 1 Primer sequences used. Gene Sequence 5’-3’ GAPDH F: GGGTGAGGCCGGTGCTGAG R: TGGGGGTAGGAACACGGAAGG IL-1β F: GCTGAAAGCTCTCCACCTCAATG R: TGTCGTTGCTTGGTTCTCCTTG INF-γ F: GCGTCATTGAATCACACCTG R: TGAGCTCATTGAATGCTTGG NF-κB F: GCTTTCGCAGGAGCATTAAC R: CCGAAGCAGGAGCTATCAAC 2.8. Statistical Analysis Data were analyzed using two-way ANOVA followed by Tukey’s post hoc test, performed with GraphPad Prism 8.0 software (San Diego, CA, USA). Results are expressed as mean ± standard error of the mean (S.E.M), and values < 0.05 (p < 0.05) were considered statiscally significant. 3. Results 3.1 GSE attenuated ARS‑induced depressive‑like behavior without altering locomotor and exploratory activity. The effect of GSE pretreatment on immobility time in the TST is shown in Fig. 2 . The two-way ANOVA followed by Tukey’s post hoc test revealed that mice subjected to ARS exhibited a significant increase in immobility time compared to the non-stressed control group, indicating depressive-like behavior. Pretreatment with GSE at both doses (20 and 40 mg/kg) significantly attenuated the ARS-induced increase in immobility time, demonstrating an antidepressant-like effect. Notably, GSE per se did not increase immobility time in the TST and exhibited even lower values than those observed in the non-stressed control group (ANOVA: F (2,36) = 14.22, p = < 0.001). The data analysis of OFT showed no changes in the number of rearings (Fig. 3 A) (ANOVA: F (2,36) = 0.1297, p = 0.88) and crossings (Fig. 3 B) (ANOVA: F (2,36) = 4.089, p = 0.03) after the different pretreatments in mice. 3.3 GSE attenuated changes in corticosterone levels caused by ARS-induction. The two-way ANOVA followed by Tukey's post-hoc test revealed that ARS increased circulating corticosterone levels of mice, when compared to the non-stressed control group. Pretreatment with GSE at both doses (20 and 40 mg/kg) normalized these levels (Fig. 4 ). GSE per se did not change the circulating corticosterone levels in mice. (ANOVA: F (2,36) = 3.904, p = 0.03). 3.4 GSE reduced oxidative damage in the prefrontal cortex, hippocampi, and small intestine of stressed mice Figure 5 illustrates RS levels in the prefrontal cortex, hippocampi, and small intestine of mice. ARS increased RS levels in hippocampi (Fig. 5 A), prefrontal cortex (Fig. 5 B) and in the small intestine (Fig. 5 C) of mice, when compared to the non-stressed control group. Pretreatment with GSE at both doses (20 and 40 mg/kg) significantly reduced the production of RS caused by ARS in the cerebral structures and small intestine (Fig. 5 ). GSE per se did not increase RS levels in the prefrontal cortex, hippocampi, or small intestine, displaying values lower than those observed in the non-stressed control group. (ANOVA: F (2,36) = 5.999, p = 0.006 for prefrontal cortex; ANOVA: F (2,36) = 13.77, p < 0.001 for hippocampi; ANOVA: F (2,36) = 27.85, p < 0.001 for small intestine). 3.5 GSE reduced levels of IL-1β, INF-γ and NF-κB in the prefrontal cortices, hippocampi and small intestine of stressed mice Figure 6 presents the alterations of inflammatory and oxidative genes in the RNA sequencing analysis in the brain structures and small intestine of mice. ARS increased IL-1β expression in the prefrontal cortex (Fig. 6 A), hippocampi (Fig. 6 D) and small intestine (Fig. 6 G), when compared to the non-stressed control group. Pretreatment with GSE at dose of 20 mg/kg significantly normalized the mRNA expression levels of IL-1β in the prefrontal cortex, hippocampi and small intestine of stressed mice. No changes in the mRNA expression levels of IL-1β were observed after per se pretreatment with GSE in the brain structures and small intestine (ANOVA: F (1,8) = 0.2241, p = 0.65 for prefrontal cortex; ANOVA: F (1,8) = 26.3, p < 0.001 for hippocampi; ANOVA: F (1,8) = 135.00, p < 0.001 for small intestine). Interferon-gamma (INF-γ) expressions in the prefrontal cortex, hippocampi and small intestine of mice are shown in Fig. 6 B, 6 E and 6 H, respectively. ARS increased INF-γ expression in the prefrontal cortex (Fig. 6 B), hippocampi (Fig. 6 E) and small intestine (Fig. 6 H), when compared to the non-stressed control group. Pretreatment with GSE at dose of 20 mg/kg normalized the mRNA expression levels of INF-γ in the prefrontal cortex, hippocampi and small intestine of stressed mice. No changes in the INF-γ expression were observed after per se pretreatment with GSE in the evaluated structures (ANOVA: F (1,8) = 169.5, p < 0.001 for prefrontal cortex; ANOVA: F (1,8) = 23.65, p = 0.001 for hippocampi; ANOVA: F (1,8) = 8.518, p = 0.02 for small intestine). ARS increased the mRNA expression levels of NF-κB in the prefrontal cortex (Fig. 6 C), hippocampi (Fig. 6 F) and small intestine (Fig. 6 I), when compared to the non-stressed control. Pretreatment with GSE at dose of 20 mg/kg normalized this increase in the structures evaluated. GSE per se did not change the mRNA expression levels of NF-κB in the prefrontal cortex, hippocampi of mice (ANOVA: F (1,8) = 9.885, p = 0.01 for prefrontal cortex; ANOVA: F (1,8) = 14.89, p = 0.005 for hippocampi; ANOVA: F (1,8) = 3.763, p = 0.0884 for small intestine). 4. Discussion The present study demonstrates, for the first time, that the pretreatment with GSE effectively reverses the behavioral alterations induced by restraint stress in the TST, without impairing locomotion in the OFT. These findings indicate that the antidepressant-like effects of GSE are likely related to its ability to modulate the HPA axis, oxidative stress, and neuroinflammatory responses. In fact, GSE administration markedly reduced RS levels in the prefrontal cortex, hippocampi, and small intestine of stressed mice, concomitant with a decrease in plasma corticosterone concentrations. Moreover, GSE downregulated the mRNA expression of the proinflammatory cytokines INF-γ, IL-1β, and NF-κB in these same tissues. Overall, these results suggest that the behavioral improvements elicited by GSE are closely associated with its capacity to attenuate oxidative stress and neuroinflammation triggered by immobilization stress. Our research group, in agreement with previous studies [ 18 , 24 , 25 ], has characterized the ARS paradigm as a reliable model of stress-induced depressive-like pathology, which encompasses both emotional and physical components and disrupts the brain’s intracellular redox balance. Consistent with our findings, animals exposed to ARS exhibited a marked increase in immobility time in the TST, reflecting a depressive-like phenotype. Pretreatment with GSE significantly reduced this immobility time, in line with previous findings by Jiang et. al [ 17 ], who reported that GSE at 20 and 40 mg/kg decreased immobility in an LPS-induced depressive-like behavior model. Furthermore, no alterations in the locomotor activity were observed in the OFT in either study, confirming that GSE behavioral effects were not due to changes in general activity. The brain is highly susceptible to fluctuations in glucocorticoid levels, and even brief episodes of stress can elicit adverse neurobiological responses [ 26 ]. Short-term HPA axis hyperactivation may disrupt neuronal homeostasis, particularly in prefrontal and hippocampal circuits involved in emotional and cognitive regulation [ 27 ]. In humans, cortisol represents the main glucocorticoid released during stress [ 28 ], whereas corticosterone serves as the principal equivalent in rodents, making its quantification a reliable biomarker of HPA axis activation [ 29 ]. Here, GSE pretreatment reduced plasma corticosterone levels in stressed mice, suggesting that its antidepressant-like mechanism involves modulation of HPA axis activity. It is well established that elevated corticosterone levels are closely linked to oxidative damage in the brain [ 16 , 30 , 31 ]. Excessive activation of glucocorticoid receptors disrupts mitochondrial function, leading to an imbalance between RS generation and endogenous antioxidant defenses. This imbalance promotes lipid peroxidation, protein oxidation, and DNA damage, ultimately impairing neuronal integrity and synaptic plasticity[ 16 ]. Brain regions with high glucocorticoid receptor density, such as the hippocampus and prefrontal cortex, are particularly vulnerable to these effects, contributing to the neurobiological alterations observed in stress-related mood disorders [ 26 ]. In the present study, ARS increased corticosterone levels and RS generation in the hippocampus, prefrontal cortex, and small intestine, confirming the close association between glucocorticoid elevation and oxidative stress. Conversely, GSE pretreatment significantly reduced RS levels in all analyzed regions, reinforcing its antioxidant potential. These results align with those of Jiang et. al [NO_PRINTED_FORM] [ 1 ], who observed similar antioxidant and neuroprotective effects of GSE in the hippocampus of prenatally stressed female rats. Importantly, this study extends previous findings by demonstrating for the first time that GSE also attenuates oxidative stress in the prefrontal cortex and small intestine of female mice, highlighting its protective effects on both central and peripheral stress-sensitive tissues. Oxidative stress is a key modulator of inflammatory responses, establishing a reciprocal relationship with neuroinflammation [ 32 ]. Although distinct, these processes are mechanistically interconnected and mutually amplified. During oxidative injury, damaged cellular components act as danger-associated molecular patterns (DAMPs), which activate innate immune receptors and trigger inflammatory signaling in the brain [ 33 ]. These cascades stimulate the TLR4/NF-κB pathway, leading to the upregulation of proinflammatory cytokines such as IL-1β [ 34 ]. Once activated, NF-κB induces the expression of cytokines and enzymes that generate reactive oxygen and nitrogen species, thereby perpetuating oxidative damage and neurotoxicity [ 33 ] This self-sustaining cycle contributes to the overproduction of neurotoxic mediators and cytokines, ultimately promoting neuronal dysfunction and depressive-like behaviors. In a previous study, Rigotti et. al [ 7 ], investigated the anti-inflammatory potential of the same GSE used here through in silico network pharmacology and molecular docking analyses. Chemical characterization by HPLC-DAD identified six phenolic compounds, with catechin and rutin as the predominant constituents. Computational screening revealed strong interactions between these molecules and key targets within the TLR4 signaling pathway, particularly AKT1 and MAPK8, which regulate NF-κB activation. Corroborating these findings, the present study demonstrated that ARS increased NF-κB and IL-1β mRNA expression, whereas GSE pretreatment significantly reduced both markers in the hippocampus, prefrontal cortex, and small intestine, indicating effective modulation of the TLR4/NF-κB axis in central and peripheral tissues. Additionally, ARS induced significant upregulation of IFN-γ mRNA expression, further supporting the activation of neuroimmune pathways during stress. GSE pretreatment markedly reduced IFN-γ expression in the same regions, indicating a systemic anti-inflammatory effect. These results are consistent with previous evidence that central IFN-γ administration promotes microglial activation, suppresses hippocampal neurogenesis, and induces depressive-like behavior and cognitive deficits [ 35 ]. Together, these data suggest that IFN-γ serves as a crucial neuroimmune mediator linking peripheral inflammation to CNS dysfunction in depression and that GSE may exert its antidepressant-like effects, at least in part, by suppressing IFN-γ–driven neuroinflammatory signaling. Although neurotransmitter imbalances are a central feature of depressive disorders, growing evidence indicates that stress-induced dysregulation of the HPA axis, oxidative stress, and neuroinflammatory signaling represents upstream mechanisms that critically shape monoaminergic and glutamatergic neurotransmission [ 36 – 39 ]. Acute stress exposure triggers glucocorticoid release and inflammatory cascades that precede and modulate neurotransmitter alterations, contributing to the emergence of depressive-like phenotypes [ 40 ]. In this context, the present study was designed to investigate these early mechanistic drivers rather than downstream neurotransmitter levels. By demonstrating that GSE attenuates HPA axis hyperactivation, redox imbalance, and neuroinflammatory responses while preventing depressive-like behavior, our findings provide mechanistic insight into how GSE may preserve neurotransmission indirectly. Nevertheless, future studies incorporating direct neurochemical analyses will be important to further elucidate the impact of GSE on specific neurotransmitter systems Rigotti et. al [ 7 ] also proposed that GSE modulates the microbiota–gut–brain axis by attenuating intestinal oxidative and inflammatory signaling. Oxidative stress may compromise intestinal barrier integrity, facilitating bacterial lipopolysaccharide translocation and activation of TLR4 receptors, thereby amplifying NF-κB–mediated inflammation. The analyses of intestinal tissues in the present study are particularly relevant, as they provide mechanistic insight into how GSE may protect intestinal integrity and modulate the microbiota–gut–brain axis, a key pathway implicated in depression [ 41 ]. However, some limitations of the present study should be acknowledged. The absence of microbiota composition analysis limits the understanding of whether changes in intestinal microbial populations directly mediate the observed protective effects of GSE. Likewise, the lack of evaluation of enzymatic antioxidant markers such as superoxide dismutase (SOD), catalase (CAT), and reduced glutathione (GSH) restricts a more comprehensive interpretation of the oxidative mechanisms involved in GSE’s action. In addition, the absence of a positive control group limits direct comparisons with established interventions, thereby constraining the contextualization of GSE’s efficacy relative to known protective agents. Finally, the amygdala was not assessed in the present study; given its central role in emotional regulation and stress-related behaviors, future investigations should include this brain region to provide a more complete neurobiological characterization of GSE’s effects. Future studies integrating microbiota profiling and metabolomic approaches could provide deeper insights into the metabolic and microbial pathways modulated by GSE, elucidating its role in the microbiota–gut–brain axis with greater precision Collectively, this study provides in vivo evidence that GSE exerts anti-inflammatory and neuroprotective effects, at least in part, through the modulation of the TLR4/NF-κB signaling axis and IFN-γ expression, contributing to the attenuation of neuroinflammation associated with depressive disorders. 5. Conclusion In summary, this study demonstrates for the first time that GSE attenuates behavioral, oxidative, and inflammatory alterations induced by acute stress in female mice. The extract modulated HPA axis activity and suppressed redox and cytokine signaling in both brain and intestinal tissues, indicating a systemic protective effect. These results support GSE as a multi-target natural compound capable of modulating the HPA axis and gut–brain inflammatory crosstalk, suggesting its potential as a nutraceutical or adjuvant for stress-related mood disorders. Declarations Conflict of Interest The authors declare no conflict of interest. Ethical approval All procedures were approved by the Ethics Committee on Animal Use of the Federal University of Pelotas (CEUA/UFPel, protocol number 131/2023). Acknowledgements The authors are thankful to CNPq and FAPERGS/ L.S. also thank CNPq for your PQ fellowships, This study was partially financed by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior, Brazil (CAPES), Finance Code 001. Copyright and Licensing All figures and schemes in this manuscript are original, drawn/produced by the authors, and have not been previously published. No material from other publications was reused. No copyrighted images, photographs, or illustrations from third-party sources were included. Data Access All data generated or analyzed in this study are available from the corresponding author upon reasonable request. No publicly accessible repository was used due to the nature of the dataset and institutional restrictions. Funding This research received no external funding. Author Contributions R.X, M.R., C.S.B and L.S. conceived the study. R.X and L.N.P. performed the behavioral tests and the biochemical assessments. M.R., L.F.F. and C.S.B contributed to characterization. F.S.S.S., F.K.S, S.L.L and T.V.C. performed the qRT-PCR analyses. R.X and R.L.O. analyzed the data. R.X, R.L.O. and L.S. wrote the manuscript. All authors revised and approved the final version. References Sun Q, Jia N, Ren F, Li X (2021) Grape seed proanthocyanidins improves depression-like behavior by alleviating oxidative stress and NLRP3 activation in the hippocampus of prenatally-stressed female offspring rats. J Histotechnol 44:90–98. https://doi.org/10.1080/01478885.2020.1861907 Qi Q, Chu M, Yu X et al (2023) Anthocyanins and Proanthocyanidins: Chemical Structures, Food Sources, Bioactivities, and Product Development. Food Reviews Int 39:4581–4609 Rasines-Perea Z, Teissedre P-L (2017) Grape Polyphenols’ Effects in Human Cardiovascular Diseases and Diabetes. Molecules 22:68. https://doi.org/10.3390/molecules22010068 Manca ML, Casula E, Marongiu F et al (2020) From waste to health: sustainable exploitation of grape pomace seed extract to manufacture antioxidant, regenerative and prebiotic nanovesicles within circular economy. Sci Rep 10:14184. https://doi.org/10.1038/s41598-020-71191-8 Abdou HM, Abd H-T, Abd Elkader E et al Neurotoxicity and neuroinflammatory effects of bisphenol A in male rats: the neuroprotective role of grape seed proanthocyanidins. https://doi.org/10.1007/s11356-021-16311-1/Published Cerbaro AF, Rodrigues VSB, Rigotti M et al (2020) Grape seed proanthocyanidins improves mitochondrial function and reduces oxidative stress through an increase in sirtuin 3 expression in EA.hy926 cells in high glucose condition. Mol Biol Rep 47:3319–3330. https://doi.org/10.1007/s11033-020-05401-x Rigotti M, Finger LF, dos Santos JM et al (2025) Exploring the Anti-Inflammatory Effects of Grape Seed Extract on Depressive Disorder: A Preclinical and Network Pharmacology Approach. J Pharm Innov 20. https://doi.org/10.1007/s12247-025-10034-3 Sanna RS, Muthangi S, Chandrasekhar CS, Devi SA (2019) Grape seed proanthocyanidin extract and insulin prevents cognitive decline in type 1 diabetic rat by impacting Bcl-2 and Bax in the prefrontal cortex. Metab Brain Dis 34:103–117. https://doi.org/10.1007/s11011-018-0320-5 Chiba S, Numakawa T, Ninomiya M et al (2012) Chronic restraint stress causes anxiety- and depression-like behaviors, downregulates glucocorticoid receptor expression, and attenuates glutamate release induced by brain-derived neurotrophic factor in the prefrontal cortex. Prog Neuropsychopharmacol Biol Psychiatry 39:112–119. https://doi.org/10.1016/j.pnpbp.2012.05.018 Seo JS, Wei J, Qin L et al (2017) Cellular and molecular basis for stress-induced depression. Mol Psychiatry 22:1440–1447. https://doi.org/10.1038/mp.2016.118 Casaril AM, Domingues M, Bampi SR et al (2019) The selenium-containing compound 3-((4-chlorophenyl)selanyl)-1-methyl-1H-indole reverses depressive-like behavior induced by acute restraint stress in mice: modulation of oxido-nitrosative stress and inflammatory pathway. Psychopharmacology 236:2867–2880. https://doi.org/10.1007/s00213-018-5151-x Kouba BR, de Araujo Borba L, Borges de Souza P et al (2024) Role of Inflammatory Mechanisms in Major Depressive Disorder: From Etiology to Potential Pharmacological Targets. Cells 13 Kokras N, Krokida S, Varoudaki TZ, Dalla C (2021) Do corticosterone levels predict female depressive-like behavior in rodents? J Neurosci Res 99:324–331 Goel N, Workman JL, Lee TT et al (2014) Sex Differences in the HPA Axis. Comprehensive Physiology. Wiley, pp 1121–1155 Bangasser DA, Cuarenta A (2021) Sex differences in anxiety and depression: circuits and mechanisms. Nat Rev Neurosci 22:674–684. https://doi.org/10.1038/s41583-021-00513-0 Spiers JG, Chen H-JC, Sernia C, Lavidis NA (2015) Activation of the hypothalamic-pituitary-adrenal stress axis induces cellular oxidative stress. Front Neurosci 8. https://doi.org/10.3389/fnins.2014.00456 Jiang X, Liu J, Lin Q et al (2017) Proanthocyanidin prevents lipopolysaccharide-induced depressive-like behavior in mice via neuroinflammatory pathway. Brain Res Bull 135:40–46. https://doi.org/10.1016/j.brainresbull.2017.09.010 Domingues M, Casaril AM, Birmann PT et al (2019) Effects of a selanylimidazopyridine on the acute restraint stress-induced depressive- and anxiety-like behaviors and biological changes in mice. Behav Brain Res 366:96–107. https://doi.org/10.1016/j.bbr.2019.03.021 Walsh RN, Cummins RA (1976) The Open-Field Test. A Critical Review Steru L, Chermat R, Thierry B, Simon P (1985) The tail suspension test: A new method for screening antidepressants in mice Zenker N, Bernstein DE, THE ESTIMATION OF SMALL AMOUNTS OF CORTICOSTERONE IN RAT PLASMA* Loetchutinat C, Kothan S, Dechsupa S et al (2005) Spectrofluorometric determination of intracellular levels of reactive oxygen species in drug-sensitive and drug-resistant cancer cells using the 2′,7′-dichlorofluorescein diacetate assay. Radiat Phys Chem 72:323–331. https://doi.org/10.1016/j.radphyschem.2004.06.011 Bradford MM (1976) A Rapid and Sensitive Method for the Quantitation of Microgram Quantities. of Protein Utilizing the Principle of Protein-Dye Binding Birmann PT, Domingues M, Casaril AM et al (2021) A pyrazole-containing selenium compound modulates neuroendocrine, oxidative stress, and behavioral responses to acute restraint stress in mice. Behav Brain Res 396. https://doi.org/10.1016/j.bbr.2020.112874 Chmielarz P, Kreiner G, Kuśmierczyk J et al (2016) Depressive-like immobility behavior and genotype × stress interactions in male mice of selected strains. Stress 19:206–213. https://doi.org/10.3109/10253890.2016.1150995 Torres DJ, Alfulaij N, Berry MJ (2021) Stress and the Brain: An Emerging Role for Selenium. Front Neurosci 15 Lupien SJ, Lepage M (2001) Stress, memory, and the hippocampus: can’t live with it, can’t live without it. Behav Brain Res 127:137–158. https://doi.org/https://doi.org/10.1016/S0166-4328(01)00361-8 Menke A (2024) The HPA Axis as Target for Depression. Curr Neuropharmacol 22:904–915. https://doi.org/10.2174/1570159X21666230811141557 Lupien SJ, Juster R-P, Raymond C, Marin M-F (2018) The effects of chronic stress on the human brain: From neurotoxicity, to vulnerability, to opportunity. Front Neuroendocrinol 49:91–105. https://doi.org/https://doi.org/10.1016/j.yfrne.2018.02.001 McIntosh LJ, Sapolsky RM (1996) Glucocorticoids Increase the Accumulation of Reactive Oxygen Species and Enhance Adriamycin-Induced Toxicity in Neuronal Culture. Exp Neurol 141:201–206. https://doi.org/https://doi.org/10.1006/exnr.1996.0154 De Bosscher K, Vanden Berghe W, Haegeman G (2003) The Interplay between the Glucocorticoid Receptor and Nuclear Factor-κB or Activator Protein-1: Molecular Mechanisms for Gene Repression. Endocr Rev 24:488–522. https://doi.org/10.1210/er.2002-0006 Teleanu DM, Niculescu A-G, Lungu II et al (2022) An Overview of Oxidative Stress, Neuroinflammation, and Neurodegenerative Diseases. Int J Mol Sci 23. https://doi.org/10.3390/ijms23115938 Jazvinšćak Jembrek M, Oršolić N, Karlović D, Peitl V (2023) Flavonols in Action: Targeting Oxidative Stress and Neuroinflammation in Major Depressive Disorder. Int J Mol Sci 24. https://doi.org/10.3390/ijms24086888 Rethorst CD, Bernstein I, Trivedi MH (2014) Inflammation, Obesity, and Metabolic Syndrome in Depression. J Clin Psychiatry 75:e1428–e1432. https://doi.org/10.4088/JCP.14m09009 Ren H, Lin F, Wu L et al (2023) The prevalence and the effect of interferon -γ in the comorbidity of rheumatoid arthritis and depression. Behav Brain Res 439:114237. https://doi.org/https://doi.org/10.1016/j.bbr.2022.114237 Sanacora G, Treccani G, Popoli M (2012) Towards a glutamate hypothesis of depression. Neuropharmacology 62:63–77. https://doi.org/10.1016/j.neuropharm.2011.07.036 Popoli M, Yan Z, McEwen BS, Sanacora G (2012) The stressed synapse: the impact of stress and glucocorticoids on glutamate transmission. Nat Rev Neurosci 13:22–37. https://doi.org/10.1038/nrn3138 Musazzi L, Racagni G, Popoli M (2011) Stress, glucocorticoids and glutamate release: Effects of antidepressant drugs. Neurochem Int 59:138–149. https://doi.org/10.1016/j.neuint.2011.05.002 Mahar I, Bambico FR, Mechawar N, Nobrega JN (2014) Stress, serotonin, and hippocampal neurogenesis in relation to depression and antidepressant effects. Neurosci Biobehav Rev 38:173–192. https://doi.org/10.1016/j.neubiorev.2013.11.009 Menke A (2024) The HPA Axis as Target for Depression. Curr Neuropharmacol 22:904–915. https://doi.org/10.2174/1570159X21666230811141557 Shandilya S, Kumar S, Kumar Jha N et al (2022) Interplay of gut microbiota and oxidative stress: Perspective on neurodegeneration and neuroprotection. J Adv Res 38:223–244. https://doi.org/https://doi.org/10.1016/j.jare.2021.09.005 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 12 Apr, 2026 Reviewers agreed at journal 25 Mar, 2026 Reviewers agreed at journal 24 Mar, 2026 Reviewers invited by journal 24 Feb, 2026 Editor assigned by journal 24 Feb, 2026 Submission checks completed at journal 24 Feb, 2026 First submitted to journal 23 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8950236","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":596857927,"identity":"730fea1b-0693-4e89-b9bc-54967d42fb91","order_by":0,"name":"Rafaela Xavier","email":"","orcid":"","institution":"Federal University of Pelotas","correspondingAuthor":false,"prefix":"","firstName":"Rafaela","middleName":"","lastName":"Xavier","suffix":""},{"id":596857928,"identity":"d63359d9-7edf-429e-a4b0-0d6a83c4011b","order_by":1,"name":"Marina Rigotti","email":"","orcid":"","institution":"University of Caxias do Sul, Caxias do Sul","correspondingAuthor":false,"prefix":"","firstName":"Marina","middleName":"","lastName":"Rigotti","suffix":""},{"id":596857929,"identity":"34e54409-6686-48a2-8eaa-17090d3f37d5","order_by":2,"name":"Renata L. Oliveira","email":"","orcid":"","institution":"Federal University of Pelotas","correspondingAuthor":false,"prefix":"","firstName":"Renata","middleName":"L.","lastName":"Oliveira","suffix":""},{"id":596857930,"identity":"60a1883b-d9f8-442d-ae97-3110f3e8f4bd","order_by":3,"name":"Laura F. Finger","email":"","orcid":"","institution":"University of Caxias do Sul, Caxias do Sul","correspondingAuthor":false,"prefix":"","firstName":"Laura","middleName":"F.","lastName":"Finger","suffix":""},{"id":596857931,"identity":"ea3f4ee7-9007-40cf-a7d8-ca24f3e33135","order_by":4,"name":"Lauren N. Pujol","email":"","orcid":"","institution":"Federal University of Pelotas","correspondingAuthor":false,"prefix":"","firstName":"Lauren","middleName":"N.","lastName":"Pujol","suffix":""},{"id":596857932,"identity":"cc3c0d91-40a5-4f49-af5d-04db9244f327","order_by":5,"name":"Fernanda S. S. Sousa","email":"","orcid":"","institution":"Federal University of Pelotas","correspondingAuthor":false,"prefix":"","firstName":"Fernanda","middleName":"S. S.","lastName":"Sousa","suffix":""},{"id":596857933,"identity":"facff762-6806-4964-930a-8546f4cb6677","order_by":6,"name":"Suzana L. Lanius","email":"","orcid":"","institution":"Federal University of Pelotas","correspondingAuthor":false,"prefix":"","firstName":"Suzana","middleName":"L.","lastName":"Lanius","suffix":""},{"id":596857934,"identity":"cd7c11ca-a311-4c1c-bd16-887b360924e0","order_by":7,"name":"Tiago V. Collares","email":"","orcid":"","institution":"Federal University of Pelotas","correspondingAuthor":false,"prefix":"","firstName":"Tiago","middleName":"V.","lastName":"Collares","suffix":""},{"id":596857936,"identity":"9b37c00b-be18-4b63-955a-46d274e09b05","order_by":8,"name":"Fabiana K. Seixas","email":"","orcid":"","institution":"Federal University of Pelotas","correspondingAuthor":false,"prefix":"","firstName":"Fabiana","middleName":"K.","lastName":"Seixas","suffix":""},{"id":596857937,"identity":"35d1c932-06bf-4ed3-87de-92e7dcddb933","order_by":9,"name":"Catia S. Branco","email":"","orcid":"","institution":"University of Caxias do Sul, Caxias do Sul","correspondingAuthor":false,"prefix":"","firstName":"Catia","middleName":"S.","lastName":"Branco","suffix":""},{"id":596857938,"identity":"d2271f71-fcd5-4d5f-a739-e891a56a74e3","order_by":10,"name":"Lucielli Savegnago","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABLklEQVRIiWNgGAWjYBACPiA+wFBgwYMQYm9gYIaxmbFoYQNrMZBA0sJzgLAWBqAWJCGJBAJaJJIfHvhgICEj337G8OHXHXZ2/ZJvDD8XVNgw8Ld3JzAX7sGiJc3g4AygwwzO5Bgby55JTp45O8dYesaZNAaJM2c3MM94hkVLDsNhHpAWhrQ0ack25mSD2zkG0rxth4Guzd3ADPQYVi1/gFrk+5+l/5Zsq082uHnG+DdBLeAQu5F8jPFj22E7gxs8Zvht4XlmcLAH5LAbjw9LM7YdT5DsSSuz5jmTxgPyy+EZmFr42ZMff/hRYWMv35/Y+PFnW7U9P/vhzbd5Kmzk+Nt7Nz4uwNSCApiBEZrYwMBhAOKAI5eABgYGxh8MDPbAFPOAkMJRMApGwSgYWQAAvKJlous6sNoAAAAASUVORK5CYII=","orcid":"","institution":"Federal University of Pelotas","correspondingAuthor":true,"prefix":"","firstName":"Lucielli","middleName":"","lastName":"Savegnago","suffix":""}],"badges":[],"createdAt":"2026-02-23 19:38:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8950236/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8950236/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":103515974,"identity":"e085d783-620a-478e-b22b-c95a525807b0","added_by":"auto","created_at":"2026-02-26 14:25:44","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":142252,"visible":true,"origin":"","legend":"\u003cp\u003eExperimental design. GSE: Grape seed extract; ARS: Acute restraint stress; OFT: Open field test; TST: Tail suspension test.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8950236/v1/c93389f09de3aad07b36f259.png"},{"id":103515982,"identity":"b6d90702-01cb-4c49-b936-1618f20b0be3","added_by":"auto","created_at":"2026-02-26 14:25:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":24563,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of pretreatment with GSE (20 and 40 mg/kg) in female mice subjected to ARS on the tail suspension test (TST). Data are expressed as mean ± standard error of the mean (SEM, n = 7). ***p \u0026lt; 0.001 when compared with the control group, and ###p \u0026lt; 0.001 when compared with the ARS group. Statistical analyses were performed using two-way ANOVA followed by Tukey’s post hoc test.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8950236/v1/972235e9ade47ea66990fdd8.png"},{"id":103515981,"identity":"d88cb60a-aa84-4d45-88f9-6ca33e6b6154","added_by":"auto","created_at":"2026-02-26 14:25:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":42845,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of pretreatment with GSE (20 and 40 mg/kg) in female mice subjected to ARS on the OFT parameters of rearings (A) and crossings (B). Data are expressed as mean ± standard error of the mean (SEM, n = 7). Statistical analyses were performed using two-way ANOVA followed by Tukey’s post hoc test.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8950236/v1/d4ecd72f8a04e2de7e53c146.png"},{"id":103515983,"identity":"4d5342a9-da39-4d4c-b2e8-510bdeb1833e","added_by":"auto","created_at":"2026-02-26 14:25:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":23923,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of pretreatment with GSE (20 and 40 mg/kg) in female mice subjected to ARS on the corticosterone levels on blood plasma. Data are expressed as mean ± standard error of the mean (SEM, n = 7). **p \u0026lt; 0.01 when compared with the control group, and ##p \u0026lt; 0.01 when compared with the ARS group. Statistical analyses were performed using two-way ANOVA followed by Tukey’s post hoc test.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8950236/v1/06d034e363afef96bcaa1065.png"},{"id":103516074,"identity":"1b4f3da2-5844-42d5-9b37-b51eef10a2fe","added_by":"auto","created_at":"2026-02-26 14:26:05","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":42525,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of pretreatment with GSE (20 and 40 mg/kg) in female mice subjected to ARS on the reactive species test (RS) on prefrontal cortex (A), hippocampi (B) and small intestine (C). Data are expressed as mean ± standard error of the mean (SEM, n = 7). ***p \u0026lt; 0.001 when compared with the control group; ###p \u0026lt; 0.001 when compared with the ARS group. Statistical analyses were performed using two-way ANOVA followed by Tukey’s post hoc test.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8950236/v1/423a4001cd0ea6b45ab18dea.png"},{"id":103515801,"identity":"48a8f4c5-2fef-4b8d-96f9-56e3119f9e2f","added_by":"auto","created_at":"2026-02-26 14:25:04","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":96090,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of pretreatment with GSE (20 mg/kg) on the relative expression of pro-inflammatory genes in different regions of female mice subjected to ARS on prefrontal cortex (A, B, and C) hippocampi (D, E and F) and small intestine (G, H and I) Data are expressed as mean ± standard error of the mean (SEM, n = 3). *p \u0026lt; 0.05, ***p \u0026lt; 0.001 when compared with the control group; #p \u0026lt; 0.05, ##p \u0026lt; 0.01 and ###p \u0026lt; 0.001 when compared with the ARS group. Statistical analyses were performed using two-way ANOVA followed by Tukey’s post hoc test.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8950236/v1/bfaa174ebe952f143b7c7aef.png"},{"id":103515984,"identity":"0c9fe8c4-5343-44b1-9cea-940db9b8314c","added_by":"auto","created_at":"2026-02-26 14:25:49","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":273264,"visible":true,"origin":"","legend":"\u003cp\u003eGraphical Abstract.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8950236/v1/17b7642837691f770ce1fe0d.png"},{"id":103516897,"identity":"26795923-683d-4bbc-b057-530739b8b161","added_by":"auto","created_at":"2026-02-26 14:30:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1435988,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8950236/v1/6bfadab1-9df9-4ceb-add2-6e7de9352a70.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Grape Seed Extract Mitigates Acute Stress-Induced Neuroinflammation and Oxidative Damage in Female Mice: Evidence for Gut–Brain Axis Modulation","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eGrapes (\u003cem\u003eVitis vinifera\u003c/em\u003e) are among the most widely consumed fruits globally, and they are a rich source of bioactive compounds, particularly polyphenols with potent antioxidant activity. Grape seed extract (GSE) contains over 90% polyphenols, including both flavonoid and non-flavonoid constituents [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It is primarily composed of flavan-3-ol derivatives, such as catechin and epicatechin, in the form of monomers, dimers, trimers, and oligomers [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAs a natural co-product derived from grape, GSE has gained attention as a sustainable source of bioactive compounds with multiple therapeutic properties [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] Given the strong interplay between chronic inflammation and pathological processes such as cancer, neurodegeneration, and mood disorders, the antioxidant and anti-inflammatory effects of GSE have broad translational relevance. Its unique phytochemical composition underlies diverse pharmacological actions, particularly in the prevention and management of neurodegenerative and mood disorders [\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] These properties are particularly important since oxidative and neuroinflammatory processes are key mechanisms driving major depressive disorder (MDD), often triggered by acute stress [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMDD is a multifactorial psychiatric condition characterized by persistent low mood, anhedonia, and disturbances in sleep, appetite, energy, and cognition [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Its complex etiology involves the interplay between neuroinflammation, oxidative stress, and neuroendocrine dysregulation, which together impair neurotransmission and synaptic plasticity [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. According to the World Health Organization (WHO, 2025), MDD affects women almost twice as often as men, underscoring the importance of investigating sex-specific mechanisms and therapeutic responses [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In this context, experimental studies have demonstrated that females show greater sensitivity to stress-induced neuroendocrine and inflammatory alterations, which may contribute to their increased vulnerability to MDD [\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eExposure to stress activates the hypothalamic\u0026ndash;pituitary\u0026ndash;adrenal (HPA) axis, leading to the excessive release of glucocorticoids, mainly cortisol, from the adrenal cortex. Sustained glucocorticoid elevation promotes receptor resistance and disrupts the negative feedback regulation of the HPA axis [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. This dysregulation has profound metabolic and neurobiological consequences, including enhanced mitochondrial activity and overproduction of reactive oxygen species (ROS). Elevated ROS levels activate microglia and astrocytes, triggering the release of proinflammatory cytokines and mediators that perpetuate neuroinflammation and oxidative imbalance within the central nervous system (CNS) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/p\u003e \u003cp\u003ePrevious studies have shown that GSE exerts neuroprotective effects by modulating pathways associated with neuroinflammation and oxidative stress. Sun [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] demonstrated that GSE administration reduced hippocampal oxidative stress and neuroinflammation in prenatally stressed female rats, accompanied by attenuation of depressive-like behaviors. Similarly, Jiang [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] reported that GSE pretreatment mitigated depressive behavior and suppressed the expression of inflammatory markers such as interleukin-1β (IL-1β) and nuclear factor kappa B (NF-κB) in mice challenged with lipopolysaccharide. \u003cem\u003eIn vitro\u003c/em\u003e, GSE reestablished redox balance and suppressed NLRP3-mediated inflammation induced by the tryptophan catabolite quinolinic acid in a glial microenvironment. Collectively, these findings indicate that the antidepressant-like effects of GSE are closely linked to its ability to modulate oxidative and inflammatory signaling pathways.\u003c/p\u003e \u003cp\u003eGiven this background, the present study aims to evaluate the potential antidepressant-like effects of GSE in female Swiss mice subjected to the acute restraint stress (ARS) model. By assessing behavioral, oxidative, and inflammatory parameters, this study seeks to elucidate the mechanisms through which GSE may modulate HPA axis dysfunction and exert neuroprotective and anti-inflammatory actions in stress-induced depressive-like states.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Animals\u003c/h2\u003e \u003cp\u003eExperiments were conducted using female Swiss mice, aged between 4 and 6 weeks (25\u0026ndash;30 g), obtained from the Central Animal Facility of the Federal University of Pelotas (UFPel). Animals were housed in groups of seven per cage (n\u0026thinsp;=\u0026thinsp;7) under standard environmental conditions (22\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C; 12 h light/dark cycle) with free access to food and water. All experimental procedures were performed between 08:00 a.m. and 06:00 p.m., in accordance with the guidelines of the UFPel Animal Ethics Committee (CEUA/UFPel, protocol no. 131/2023).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Grape Seed Extract\u003c/h2\u003e \u003cp\u003eThe GSE was purchased from Xi\u0026rsquo;an Herbspirit Technology Co., Ltd. (Batch No. XC20230310, Shaanxi, P.R. China). The phenolic characterization and composition of the extract were previously described by Rigotti et. al [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. For animal use, the extract was diluted in distilled water to final concentrations of 20 or 40 mg/kg and filtered using a sterile syringe filter (polyethersulfone, 0.22 \u0026micro;m pore size). The extract doses and pretreatment period were established based on the previous study by Jiang et. al [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Animals received daily intragastric (i.g.) administration of GSE or vehicle (distilled water) for seven consecutive days at doses of 20 or 40 mg/kg.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Acute Restraint Stress (ARS)\u003c/h2\u003e \u003cp\u003eThe animals were submitted to physical restraint as previously reported by Domingues et. al [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Mice were subjected to immobilization for 4 hours using an individual rodent restraint device made of fenestrated Plexiglas, restraining physical movement. During the period of exposure to stress, the animals were deprived of water and food. After the 4-hours period, the animals were returned to their respective home cages.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Experimental Design\u003c/h2\u003e \u003cp\u003eThe experimental design is illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. This study aimed to investigate the potential of GSE to prevent ARS-induced depressive-like behavior. Animals were randomly assigned to six experimental groups (n\u0026thinsp;=\u0026thinsp;7 per group):\u003c/p\u003e \u003cp\u003e \u003cul\u003e \u003cli\u003e \u003cp\u003eG1: Non-stressed Control (No stress\u0026thinsp;+\u0026thinsp;vehicle)\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eG2: GSE 20 mg/kg \u003cem\u003eper se\u003c/em\u003e (No stress\u0026thinsp;+\u0026thinsp;GSE 20)\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eG3: GSE 40 mg/kg \u003cem\u003eper se\u003c/em\u003e (No stress\u0026thinsp;+\u0026thinsp;GSE 40)\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eG4: ARS-induced (ARS\u0026thinsp;+\u0026thinsp;vehicle)\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eG5: GSE 20 mg/kg (ARS\u0026thinsp;+\u0026thinsp;GSE 20)\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eG6: GSE 40 mg/kg (ARS\u0026thinsp;+\u0026thinsp;GSE 40)\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003c/p\u003e \u003cp\u003eAnimals received daily intragastric (i.g.) administration of GSE or vehicle (distilled water) for seven consecutive days at doses of 20 or 40 mg/kg. On the eighth day, mice were subjected to 4 hours of ARS. On the ninth day, behavioral assessments were performed using the Open Field Test (OFT) and the Tail Suspension Test (TST). Following behavioral testing, animals were anesthetized with isoflurane (inhalation) for cardiac puncture and blood collection to determine the plasma corticosterone levels. The prefrontal cortex, hippocampi, and small intestinal tissues were also collected for subsequent biochemical and molecular analyses.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Behavioral Tests\u003c/h2\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e2.5.1. Open Field Test (OFT)\u003c/h2\u003e \u003cp\u003eThe OFT was conducted prior to other behavioral assessments, following the procedure described by Walsh and Cummins [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. This test measures behavioral changes in rodents exposed to novel environments and helps to confirm that depression-like behavior is not due to general motor activity alterations (Santos et al., 2011). Each mouse was individually placed in the center of an open field box (30 \u0026times; 30 \u0026times; 15 cm) divided into nine equal quadrants and observed for 5 minutes. The locomotor activity was quantified by the number of quadrants crossed, while the exploratory behavior, by the number of rearing events.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.5.2. Tail Suspension Test (TST)\u003c/h2\u003e \u003cp\u003eThe total immobility time during the TST was measured as described by Steru et. al [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] Mice were individually suspended 50 cm above the floor using adhesive tape placed approximately 1 cm from the tip of the tail. The immobility time, defined as the absence of escape-oriented movements, was recorded during the last 4 minutes of a 6-minute session. The test was conducted manually by a blind observer to the experimental conditions.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Biochemical Analyses\u003c/h2\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e2.6.1. Tissue Preparation\u003c/h2\u003e \u003cp\u003eAfter behavioral tests, animals were anesthetized with isoflurane inhalation, and blood was collected by cardiac puncture into heparinized tubes. Samples were centrifuged at 3.500 rpm for 10 minutes, and the plasma was used for corticosterone quantification. Following blood collection, animals were euthanized by decapitation, and the prefrontal cortex, hippocampi and small intestine were rapidly dissected and kept on ice until homogenization in 50 mM Tris-HCl buffer (pH 7.4; 1:10 w/v). The homogenates were centrifuged at 2.500 \u0026times;g for 10 minutes at 4\u0026deg;C, and the supernatant (S1 fraction) was used for reactive species (RS) assay. For gene expression analysis, a separate group of animals was used; their prefrontal cortex, hippocampi, and small intestinal samples were stored in Trizol reagent at \u0026minus;\u0026thinsp;80\u0026deg;C for subsequent qRT-PCR analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e2.6.2. Plasma Corticosterone Levels\u003c/h2\u003e \u003cp\u003eCorticosterone levels were determined according to Zenker and Bernstein [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] Briefly, heparinized blood was centrifuged at 3.500 rpm for 10 minutes to obtain plasma. To 200 \u0026micro;L of plasma, 800 \u0026micro;L of distilled water and 2 mL of chloroform were added, mixed for 15 seconds, and centrifuged at 2.500 rpm for 5 minutes. The aqueous phase was discarded, and the chloroform phase was retained. Then, 1 mL of 0.1 M NaOH was added, mixed for 15 seconds, and centrifuged again. One milliliter of the chloroform phase was transferred to a new tube, mixed with 3 mL of fluorescence reagent, and centrifuged once more. The chloroform phase was then incubated for 2 hours before spectrofluorometric reading (excitation\u0026thinsp;=\u0026thinsp;247 nm; emission\u0026thinsp;=\u0026thinsp;540 nm; slit\u0026thinsp;=\u0026thinsp;5 nm). Plasma corticosterone levels were expressed as ng/mL.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003e2.6.3. Reactive Species (RS)\u003c/h2\u003e \u003cp\u003eRS quantification in prefrontal cortex, hippocampi, and small intestine of pretreated mice followed the method described by Loetchutinat et. al [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Briefly, 10 \u0026micro;L of 1 mM DCFH-DA (2\u0026rsquo;,7\u0026rsquo;-dichlorodihydrofluorescein diacetate) were incubated with 10 \u0026micro;L of tissue homogenate and 2.990 \u0026micro;L of 10 mM Tris-HCl buffer (pH 7.4). The oxidation of DCFH-DA to fluorescent DCF was used as an indicator of intracellular RS. Fluorescence intensity was measured at 480 nm excitation and 520 nm emission, and results were expressed as fluorescence units per mg of protein.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003e2.6.4. Protein Quantification\u003c/h2\u003e \u003cp\u003eProtein content was determined by the Bradford [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] method using bovine serum albumin (1 mg/mL) as the standard. After sample homogenization, 5 \u0026micro;L of homogenate were incubated with 45 \u0026micro;L of distilled water and 2.5 mL of Coomassie Brilliant Blue reagent for 10 minutes, and absorbance was read at 595 nm using a spectrophotometer.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.7. RNA Extraction and Gene Expression Analysis by qRT-PCR\u003c/h2\u003e \u003cp\u003eTotal mRNA was extracted from the cortex, hippocampi, and small intestine using TRIzol followed by mRNA quantification. The cDNA synthesis was performed using a High-Capacity cDNA Reverse Transcription kit according to the manufacturer\u0026rsquo;s protocol. The amplification was made with the GoTaq\u0026reg; qPCR Master Mix using the Agilent AriaMX real-time PCR. Gene expressions were normalized using GAPDH primer as a reference gene. The 2ΔΔCT (Delta\u0026ndash;Delta Comparative Threshold) method was used to normalize the fold change in gene expression. The genes analyzed are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003eBased on the comparable behavioral and biochemical efficacy observed for both GSE doses (20 and 40 mg/kg), qRT-PCR analyses were conducted only in samples from the 20 mg/kg group to prioritize the lower effective dose.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence 5\u0026rsquo;-3\u0026rsquo;\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGAPDH\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGGTGAGGCCGGTGCTGAG\u003c/p\u003e \u003cp\u003eR: TGGGGGTAGGAACACGGAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIL-1β\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCTGAAAGCTCTCCACCTCAATG\u003c/p\u003e \u003cp\u003eR: TGTCGTTGCTTGGTTCTCCTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eINF-γ\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCGTCATTGAATCACACCTG\u003c/p\u003e \u003cp\u003eR: TGAGCTCATTGAATGCTTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNF-κB\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCTTTCGCAGGAGCATTAAC\u003c/p\u003e \u003cp\u003eR: CCGAAGCAGGAGCTATCAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Statistical Analysis\u003c/h2\u003e \u003cp\u003e Data were analyzed using two-way ANOVA followed by Tukey\u0026rsquo;s post hoc test, performed with GraphPad Prism 8.0 software (San Diego, CA, USA). Results are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (S.E.M), and values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) were considered statiscally significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.1 GSE attenuated ARS‑induced depressive‑like behavior without altering locomotor and exploratory activity.\u003c/h2\u003e \u003cp\u003eThe effect of GSE pretreatment on immobility time in the TST is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The two-way ANOVA followed by Tukey\u0026rsquo;s post hoc test revealed that mice subjected to ARS exhibited a significant increase in immobility time compared to the non-stressed control group, indicating depressive-like behavior. Pretreatment with GSE at both doses (20 and 40 mg/kg) significantly attenuated the ARS-induced increase in immobility time, demonstrating an antidepressant-like effect. Notably, GSE \u003cem\u003eper se\u003c/em\u003e did not increase immobility time in the TST and exhibited even lower values than those observed in the non-stressed control group (ANOVA: F\u003csub\u003e(2,36)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;14.22, p\u0026thinsp;=\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe data analysis of OFT showed no changes in the number of rearings (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA) (ANOVA: F\u003csub\u003e(2,36)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.1297, p\u0026thinsp;=\u0026thinsp;0.88) and crossings (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB) (ANOVA: F\u003csub\u003e(2,36)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;4.089, p\u0026thinsp;=\u0026thinsp;0.03) after the different pretreatments in mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.3 GSE attenuated changes in corticosterone levels caused by ARS-induction.\u003c/h2\u003e \u003cp\u003eThe two-way ANOVA followed by Tukey's post-hoc test revealed that ARS increased circulating corticosterone levels of mice, when compared to the non-stressed control group. Pretreatment with GSE at both doses (20 and 40 mg/kg) normalized these levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). GSE \u003cem\u003eper se\u003c/em\u003e did not change the circulating corticosterone levels in mice. (ANOVA: F\u003csub\u003e(2,36)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;3.904, p\u0026thinsp;=\u0026thinsp;0.03).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.4 GSE reduced oxidative damage in the prefrontal cortex, hippocampi, and small intestine of stressed mice\u003c/h2\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e illustrates RS levels in the prefrontal cortex, hippocampi, and small intestine of mice. ARS increased RS levels in hippocampi (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), prefrontal cortex (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB) and in the small intestine (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC) of mice, when compared to the non-stressed control group. Pretreatment with GSE at both doses (20 and 40 mg/kg) significantly reduced the production of RS caused by ARS in the cerebral structures and small intestine (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). GSE \u003cem\u003eper se\u003c/em\u003e did not increase RS levels in the prefrontal cortex, hippocampi, or small intestine, displaying values lower than those observed in the non-stressed control group. (ANOVA: F\u003csub\u003e(2,36)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;5.999, p\u0026thinsp;=\u0026thinsp;0.006 for prefrontal cortex; ANOVA: F\u003csub\u003e(2,36)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;13.77, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for hippocampi; ANOVA: F\u003csub\u003e(2,36)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;27.85, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for small intestine).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.5 \u003cem\u003eGSE reduced levels of IL-1β, INF-γ and NF-κB in the prefrontal cortices, hippocampi and small intestine of stressed mice\u003c/em\u003e\u003c/p\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e presents the alterations of inflammatory and oxidative genes in the RNA sequencing analysis in the brain structures and small intestine of mice. ARS increased IL-1β expression in the prefrontal cortex (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA), hippocampi (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD) and small intestine (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG), when compared to the non-stressed control group. Pretreatment with GSE at dose of 20 mg/kg significantly normalized the mRNA expression levels of IL-1β in the prefrontal cortex, hippocampi and small intestine of stressed mice. No changes in the mRNA expression levels of IL-1β were observed after \u003cem\u003eper se\u003c/em\u003e pretreatment with GSE in the brain structures and small intestine (ANOVA: F\u003csub\u003e(1,8)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.2241, p\u0026thinsp;=\u0026thinsp;0.65 for prefrontal cortex; ANOVA: F\u003csub\u003e(1,8)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;26.3, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for hippocampi; ANOVA: F\u003csub\u003e(1,8)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;135.00, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for small intestine).\u003c/p\u003e \u003cp\u003eInterferon-gamma (INF-γ) expressions in the prefrontal cortex, hippocampi and small intestine of mice are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eH, respectively. ARS increased \u003cem\u003eINF-γ\u003c/em\u003e expression in the prefrontal cortex (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB), hippocampi (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE) and small intestine (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eH), when compared to the non-stressed control group. Pretreatment with GSE at dose of 20 mg/kg normalized the mRNA expression levels of \u003cem\u003eINF-γ\u003c/em\u003e in the prefrontal cortex, hippocampi and small intestine of stressed mice. No changes in the \u003cem\u003eINF-γ\u003c/em\u003e expression were observed after \u003cem\u003eper se\u003c/em\u003e pretreatment with GSE in the evaluated structures (ANOVA: F\u003csub\u003e(1,8)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;169.5, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for prefrontal cortex; ANOVA: F\u003csub\u003e(1,8)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;23.65, p\u0026thinsp;=\u0026thinsp;0.001 for hippocampi; ANOVA: F\u003csub\u003e(1,8)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;8.518, p\u0026thinsp;=\u0026thinsp;0.02 for small intestine).\u003c/p\u003e \u003cp\u003eARS increased the mRNA expression levels of NF-κB in the prefrontal cortex (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC), hippocampi (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF) and small intestine (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eI), when compared to the non-stressed control. Pretreatment with GSE at dose of 20 mg/kg normalized this increase in the structures evaluated. GSE \u003cem\u003eper se\u003c/em\u003e did not change the mRNA expression levels of NF-κB in the prefrontal cortex, hippocampi of mice (ANOVA: F\u003csub\u003e(1,8)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;9.885, p\u0026thinsp;=\u0026thinsp;0.01 for prefrontal cortex; ANOVA: F\u003csub\u003e(1,8)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;14.89, p\u0026thinsp;=\u0026thinsp;0.005 for hippocampi; ANOVA: F\u003csub\u003e(1,8)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;3.763, p\u0026thinsp;=\u0026thinsp;0.0884 for small intestine).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe present study demonstrates, for the first time, that the pretreatment with GSE effectively reverses the behavioral alterations induced by restraint stress in the TST, without impairing locomotion in the OFT. These findings indicate that the antidepressant-like effects of GSE are likely related to its ability to modulate the HPA axis, oxidative stress, and neuroinflammatory responses. In fact, GSE administration markedly reduced RS levels in the prefrontal cortex, hippocampi, and small intestine of stressed mice, concomitant with a decrease in plasma corticosterone concentrations. Moreover, GSE downregulated the mRNA expression of the proinflammatory cytokines INF-γ, IL-1β, and NF-κB in these same tissues. Overall, these results suggest that the behavioral improvements elicited by GSE are closely associated with its capacity to attenuate oxidative stress and neuroinflammation triggered by immobilization stress.\u003c/p\u003e \u003cp\u003eOur research group, in agreement with previous studies [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], has characterized the ARS paradigm as a reliable model of stress-induced depressive-like pathology, which encompasses both emotional and physical components and disrupts the brain\u0026rsquo;s intracellular redox balance. Consistent with our findings, animals exposed to ARS exhibited a marked increase in immobility time in the TST, reflecting a depressive-like phenotype. Pretreatment with GSE significantly reduced this immobility time, in line with previous findings by Jiang et. al [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], who reported that GSE at 20 and 40 mg/kg decreased immobility in an LPS-induced depressive-like behavior model. Furthermore, no alterations in the locomotor activity were observed in the OFT in either study, confirming that GSE behavioral effects were not due to changes in general activity.\u003c/p\u003e \u003cp\u003eThe brain is highly susceptible to fluctuations in glucocorticoid levels, and even brief episodes of stress can elicit adverse neurobiological responses [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Short-term HPA axis hyperactivation may disrupt neuronal homeostasis, particularly in prefrontal and hippocampal circuits involved in emotional and cognitive regulation [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In humans, cortisol represents the main glucocorticoid released during stress [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], whereas corticosterone serves as the principal equivalent in rodents, making its quantification a reliable biomarker of HPA axis activation [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Here, GSE pretreatment reduced plasma corticosterone levels in stressed mice, suggesting that its antidepressant-like mechanism involves modulation of HPA axis activity.\u003c/p\u003e \u003cp\u003eIt is well established that elevated corticosterone levels are closely linked to oxidative damage in the brain [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Excessive activation of glucocorticoid receptors disrupts mitochondrial function, leading to an imbalance between RS generation and endogenous antioxidant defenses. This imbalance promotes lipid peroxidation, protein oxidation, and DNA damage, ultimately impairing neuronal integrity and synaptic plasticity[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Brain regions with high glucocorticoid receptor density, such as the hippocampus and prefrontal cortex, are particularly vulnerable to these effects, contributing to the neurobiological alterations observed in stress-related mood disorders [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the present study, ARS increased corticosterone levels and RS generation in the hippocampus, prefrontal cortex, and small intestine, confirming the close association between glucocorticoid elevation and oxidative stress. Conversely, GSE pretreatment significantly reduced RS levels in all analyzed regions, reinforcing its antioxidant potential. These results align with those of Jiang et. al [NO_PRINTED_FORM] [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], who observed similar antioxidant and neuroprotective effects of GSE in the hippocampus of prenatally stressed female rats. Importantly, this study extends previous findings by demonstrating for the first time that GSE also attenuates oxidative stress in the prefrontal cortex and small intestine of female mice, highlighting its protective effects on both central and peripheral stress-sensitive tissues.\u003c/p\u003e \u003cp\u003eOxidative stress is a key modulator of inflammatory responses, establishing a reciprocal relationship with neuroinflammation [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Although distinct, these processes are mechanistically interconnected and mutually amplified. During oxidative injury, damaged cellular components act as danger-associated molecular patterns (DAMPs), which activate innate immune receptors and trigger inflammatory signaling in the brain [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. These cascades stimulate the TLR4/NF-κB pathway, leading to the upregulation of proinflammatory cytokines such as IL-1β [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Once activated, NF-κB induces the expression of cytokines and enzymes that generate reactive oxygen and nitrogen species, thereby perpetuating oxidative damage and neurotoxicity [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] This self-sustaining cycle contributes to the overproduction of neurotoxic mediators and cytokines, ultimately promoting neuronal dysfunction and depressive-like behaviors.\u003c/p\u003e \u003cp\u003eIn a previous study, Rigotti et. al [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], investigated the anti-inflammatory potential of the same GSE used here through \u003cem\u003ein silico\u003c/em\u003e network pharmacology and molecular docking analyses. Chemical characterization by HPLC-DAD identified six phenolic compounds, with catechin and rutin as the predominant constituents. Computational screening revealed strong interactions between these molecules and key targets within the TLR4 signaling pathway, particularly AKT1 and MAPK8, which regulate NF-κB activation. Corroborating these findings, the present study demonstrated that ARS increased NF-κB and IL-1β mRNA expression, whereas GSE pretreatment significantly reduced both markers in the hippocampus, prefrontal cortex, and small intestine, indicating effective modulation of the TLR4/NF-κB axis in central and peripheral tissues.\u003c/p\u003e \u003cp\u003eAdditionally, ARS induced significant upregulation of IFN-γ mRNA expression, further supporting the activation of neuroimmune pathways during stress. GSE pretreatment markedly reduced IFN-γ expression in the same regions, indicating a systemic anti-inflammatory effect. These results are consistent with previous evidence that central IFN-γ administration promotes microglial activation, suppresses hippocampal neurogenesis, and induces depressive-like behavior and cognitive deficits [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Together, these data suggest that IFN-γ serves as a crucial neuroimmune mediator linking peripheral inflammation to CNS dysfunction in depression and that GSE may exert its antidepressant-like effects, at least in part, by suppressing IFN-γ\u0026ndash;driven neuroinflammatory signaling.\u003c/p\u003e \u003cp\u003eAlthough neurotransmitter imbalances are a central feature of depressive disorders, growing evidence indicates that stress-induced dysregulation of the HPA axis, oxidative stress, and neuroinflammatory signaling represents upstream mechanisms that critically shape monoaminergic and glutamatergic neurotransmission [\u003cspan additionalcitationids=\"CR37 CR38\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Acute stress exposure triggers glucocorticoid release and inflammatory cascades that precede and modulate neurotransmitter alterations, contributing to the emergence of depressive-like phenotypes [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In this context, the present study was designed to investigate these early mechanistic drivers rather than downstream neurotransmitter levels. By demonstrating that GSE attenuates HPA axis hyperactivation, redox imbalance, and neuroinflammatory responses while preventing depressive-like behavior, our findings provide mechanistic insight into how GSE may preserve neurotransmission indirectly. Nevertheless, future studies incorporating direct neurochemical analyses will be important to further elucidate the impact of GSE on specific neurotransmitter systems\u003c/p\u003e \u003cp\u003eRigotti et. al [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] also proposed that GSE modulates the microbiota\u0026ndash;gut\u0026ndash;brain axis by attenuating intestinal oxidative and inflammatory signaling. Oxidative stress may compromise intestinal barrier integrity, facilitating bacterial lipopolysaccharide translocation and activation of TLR4 receptors, thereby amplifying NF-κB\u0026ndash;mediated inflammation. The analyses of intestinal tissues in the present study are particularly relevant, as they provide mechanistic insight into how GSE may protect intestinal integrity and modulate the microbiota\u0026ndash;gut\u0026ndash;brain axis, a key pathway implicated in depression [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHowever, some limitations of the present study should be acknowledged. The absence of microbiota composition analysis limits the understanding of whether changes in intestinal microbial populations directly mediate the observed protective effects of GSE. Likewise, the lack of evaluation of enzymatic antioxidant markers such as superoxide dismutase (SOD), catalase (CAT), and reduced glutathione (GSH) restricts a more comprehensive interpretation of the oxidative mechanisms involved in GSE\u0026rsquo;s action. In addition, the absence of a positive control group limits direct comparisons with established interventions, thereby constraining the contextualization of GSE\u0026rsquo;s efficacy relative to known protective agents. Finally, the amygdala was not assessed in the present study; given its central role in emotional regulation and stress-related behaviors, future investigations should include this brain region to provide a more complete neurobiological characterization of GSE\u0026rsquo;s effects. Future studies integrating microbiota profiling and metabolomic approaches could provide deeper insights into the metabolic and microbial pathways modulated by GSE, elucidating its role in the microbiota\u0026ndash;gut\u0026ndash;brain axis with greater precision\u003c/p\u003e \u003cp\u003eCollectively, this study provides \u003cem\u003ein vivo\u003c/em\u003e evidence that GSE exerts anti-inflammatory and neuroprotective effects, at least in part, through the modulation of the TLR4/NF-κB signaling axis and IFN-γ expression, contributing to the attenuation of neuroinflammation associated with depressive disorders.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn summary, this study demonstrates for the first time that GSE attenuates behavioral, oxidative, and inflammatory alterations induced by acute stress in female mice. The extract modulated HPA axis activity and suppressed redox and cytokine signaling in both brain and intestinal tissues, indicating a systemic protective effect. These results support GSE as a multi-target natural compound capable of modulating the HPA axis and gut\u0026ndash;brain inflammatory crosstalk, suggesting its potential as a nutraceutical or adjuvant for stress-related mood disorders.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll procedures were approved by the Ethics Committee on Animal Use of the Federal University of Pelotas (CEUA/UFPel, protocol number 131/2023).\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors are thankful to CNPq and FAPERGS/ L.S. also thank CNPq for your PQ fellowships, This study was partially financed by the Coordena\u0026ccedil;\u0026atilde;o de Aperfei\u0026ccedil;oamento de Pessoal de N\u0026iacute;vel Superior, Brazil (CAPES), Finance Code 001.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCopyright and Licensing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll figures and schemes in this manuscript are original, drawn/produced by the authors, and have not been previously published. No material from other publications was reused. No copyrighted images, photographs, or illustrations from third-party sources were included.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eData Access\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed in this study are available from the corresponding author upon reasonable request. No publicly accessible repository was used due to the nature of the dataset and institutional restrictions.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research received no external funding.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eR.X, M.R., C.S.B and L.S. conceived the study. R.X and L.N.P. performed the behavioral tests and the biochemical assessments. M.R., L.F.F. and C.S.B contributed to characterization. F.S.S.S., F.K.S, S.L.L and T.V.C. performed the qRT-PCR analyses. R.X and R.L.O. analyzed the data. R.X, R.L.O. and L.S. wrote the manuscript. All authors revised and approved the final version.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSun Q, Jia N, Ren F, Li X (2021) Grape seed proanthocyanidins improves depression-like behavior by alleviating oxidative stress and NLRP3 activation in the hippocampus of prenatally-stressed female offspring rats. J Histotechnol 44:90\u0026ndash;98. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/01478885.2020.1861907\u003c/span\u003e\u003cspan address=\"10.1080/01478885.2020.1861907\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQi Q, Chu M, Yu X et al (2023) Anthocyanins and Proanthocyanidins: Chemical Structures, Food Sources, Bioactivities, and Product Development. Food Reviews Int 39:4581\u0026ndash;4609\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRasines-Perea Z, Teissedre P-L (2017) Grape Polyphenols\u0026rsquo; Effects in Human Cardiovascular Diseases and Diabetes. Molecules 22:68. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/molecules22010068\u003c/span\u003e\u003cspan address=\"10.3390/molecules22010068\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManca ML, Casula E, Marongiu F et al (2020) From waste to health: sustainable exploitation of grape pomace seed extract to manufacture antioxidant, regenerative and prebiotic nanovesicles within circular economy. Sci Rep 10:14184. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-020-71191-8\u003c/span\u003e\u003cspan address=\"10.1038/s41598-020-71191-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdou HM, Abd H-T, Abd Elkader E et al Neurotoxicity and neuroinflammatory effects of bisphenol A in male rats: the neuroprotective role of grape seed proanthocyanidins. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11356-021-16311-1/Published\u003c/span\u003e\u003cspan address=\"10.1007/s11356-021-16311-1/Published\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCerbaro AF, Rodrigues VSB, Rigotti M et al (2020) Grape seed proanthocyanidins improves mitochondrial function and reduces oxidative stress through an increase in sirtuin 3 expression in EA.hy926 cells in high glucose condition. Mol Biol Rep 47:3319\u0026ndash;3330. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11033-020-05401-x\u003c/span\u003e\u003cspan address=\"10.1007/s11033-020-05401-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRigotti M, Finger LF, dos Santos JM et al (2025) Exploring the Anti-Inflammatory Effects of Grape Seed Extract on Depressive Disorder: A Preclinical and Network Pharmacology Approach. J Pharm Innov 20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12247-025-10034-3\u003c/span\u003e\u003cspan address=\"10.1007/s12247-025-10034-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanna RS, Muthangi S, Chandrasekhar CS, Devi SA (2019) Grape seed proanthocyanidin extract and insulin prevents cognitive decline in type 1 diabetic rat by impacting Bcl-2 and Bax in the prefrontal cortex. Metab Brain Dis 34:103\u0026ndash;117. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11011-018-0320-5\u003c/span\u003e\u003cspan address=\"10.1007/s11011-018-0320-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChiba S, Numakawa T, Ninomiya M et al (2012) Chronic restraint stress causes anxiety- and depression-like behaviors, downregulates glucocorticoid receptor expression, and attenuates glutamate release induced by brain-derived neurotrophic factor in the prefrontal cortex. Prog Neuropsychopharmacol Biol Psychiatry 39:112\u0026ndash;119. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pnpbp.2012.05.018\u003c/span\u003e\u003cspan address=\"10.1016/j.pnpbp.2012.05.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeo JS, Wei J, Qin L et al (2017) Cellular and molecular basis for stress-induced depression. Mol Psychiatry 22:1440\u0026ndash;1447. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/mp.2016.118\u003c/span\u003e\u003cspan address=\"10.1038/mp.2016.118\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCasaril AM, Domingues M, Bampi SR et al (2019) The selenium-containing compound 3-((4-chlorophenyl)selanyl)-1-methyl-1H-indole reverses depressive-like behavior induced by acute restraint stress in mice: modulation of oxido-nitrosative stress and inflammatory pathway. Psychopharmacology 236:2867\u0026ndash;2880. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00213-018-5151-x\u003c/span\u003e\u003cspan address=\"10.1007/s00213-018-5151-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKouba BR, de Araujo Borba L, Borges de Souza P et al (2024) Role of Inflammatory Mechanisms in Major Depressive Disorder: From Etiology to Potential Pharmacological Targets. Cells 13\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKokras N, Krokida S, Varoudaki TZ, Dalla C (2021) Do corticosterone levels predict female depressive-like behavior in rodents? J Neurosci Res 99:324\u0026ndash;331\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoel N, Workman JL, Lee TT et al (2014) Sex Differences in the HPA Axis. Comprehensive Physiology. Wiley, pp 1121\u0026ndash;1155\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBangasser DA, Cuarenta A (2021) Sex differences in anxiety and depression: circuits and mechanisms. Nat Rev Neurosci 22:674\u0026ndash;684. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41583-021-00513-0\u003c/span\u003e\u003cspan address=\"10.1038/s41583-021-00513-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpiers JG, Chen H-JC, Sernia C, Lavidis NA (2015) Activation of the hypothalamic-pituitary-adrenal stress axis induces cellular oxidative stress. Front Neurosci 8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fnins.2014.00456\u003c/span\u003e\u003cspan address=\"10.3389/fnins.2014.00456\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang X, Liu J, Lin Q et al (2017) Proanthocyanidin prevents lipopolysaccharide-induced depressive-like behavior in mice via neuroinflammatory pathway. Brain Res Bull 135:40\u0026ndash;46. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.brainresbull.2017.09.010\u003c/span\u003e\u003cspan address=\"10.1016/j.brainresbull.2017.09.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDomingues M, Casaril AM, Birmann PT et al (2019) Effects of a selanylimidazopyridine on the acute restraint stress-induced depressive- and anxiety-like behaviors and biological changes in mice. Behav Brain Res 366:96\u0026ndash;107. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbr.2019.03.021\u003c/span\u003e\u003cspan address=\"10.1016/j.bbr.2019.03.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWalsh RN, Cummins RA (1976) The Open-Field Test. A Critical Review\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSteru L, Chermat R, Thierry B, Simon P (1985) The tail suspension test: A new method for screening antidepressants in mice\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZenker N, Bernstein DE, THE ESTIMATION OF SMALL AMOUNTS OF CORTICOSTERONE IN RAT PLASMA*\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLoetchutinat C, Kothan S, Dechsupa S et al (2005) Spectrofluorometric determination of intracellular levels of reactive oxygen species in drug-sensitive and drug-resistant cancer cells using the 2\u0026prime;,7\u0026prime;-dichlorofluorescein diacetate assay. Radiat Phys Chem 72:323\u0026ndash;331. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.radphyschem.2004.06.011\u003c/span\u003e\u003cspan address=\"10.1016/j.radphyschem.2004.06.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBradford MM (1976) A Rapid and Sensitive Method for the Quantitation of Microgram Quantities. of Protein Utilizing the Principle of Protein-Dye Binding\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBirmann PT, Domingues M, Casaril AM et al (2021) A pyrazole-containing selenium compound modulates neuroendocrine, oxidative stress, and behavioral responses to acute restraint stress in mice. Behav Brain Res 396. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbr.2020.112874\u003c/span\u003e\u003cspan address=\"10.1016/j.bbr.2020.112874\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChmielarz P, Kreiner G, Kuśmierczyk J et al (2016) Depressive-like immobility behavior and genotype \u0026times; stress interactions in male mice of selected strains. Stress 19:206\u0026ndash;213. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3109/10253890.2016.1150995\u003c/span\u003e\u003cspan address=\"10.3109/10253890.2016.1150995\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTorres DJ, Alfulaij N, Berry MJ (2021) Stress and the Brain: An Emerging Role for Selenium. Front Neurosci 15\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLupien SJ, Lepage M (2001) Stress, memory, and the hippocampus: can\u0026rsquo;t live with it, can\u0026rsquo;t live without it. Behav Brain Res 127:137\u0026ndash;158. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/S0166-4328(01)00361-8\u003c/span\u003e\u003cspan address=\"10.1016/S0166-4328(01)00361-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMenke A (2024) The HPA Axis as Target for Depression. Curr Neuropharmacol 22:904\u0026ndash;915. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2174/1570159X21666230811141557\u003c/span\u003e\u003cspan address=\"10.2174/1570159X21666230811141557\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLupien SJ, Juster R-P, Raymond C, Marin M-F (2018) The effects of chronic stress on the human brain: From neurotoxicity, to vulnerability, to opportunity. Front Neuroendocrinol 49:91\u0026ndash;105. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.yfrne.2018.02.001\u003c/span\u003e\u003cspan address=\"10.1016/j.yfrne.2018.02.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcIntosh LJ, Sapolsky RM (1996) Glucocorticoids Increase the Accumulation of Reactive Oxygen Species and Enhance Adriamycin-Induced Toxicity in Neuronal Culture. Exp Neurol 141:201\u0026ndash;206. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1006/exnr.1996.0154\u003c/span\u003e\u003cspan address=\"10.1006/exnr.1996.0154\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Bosscher K, Vanden Berghe W, Haegeman G (2003) The Interplay between the Glucocorticoid Receptor and Nuclear Factor-κB or Activator Protein-1: Molecular Mechanisms for Gene Repression. Endocr Rev 24:488\u0026ndash;522. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1210/er.2002-0006\u003c/span\u003e\u003cspan address=\"10.1210/er.2002-0006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeleanu DM, Niculescu A-G, Lungu II et al (2022) An Overview of Oxidative Stress, Neuroinflammation, and Neurodegenerative Diseases. Int J Mol Sci 23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms23115938\u003c/span\u003e\u003cspan address=\"10.3390/ijms23115938\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJazvinšćak Jembrek M, Oršolić N, Karlović D, Peitl V (2023) Flavonols in Action: Targeting Oxidative Stress and Neuroinflammation in Major Depressive Disorder. Int J Mol Sci 24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms24086888\u003c/span\u003e\u003cspan address=\"10.3390/ijms24086888\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRethorst CD, Bernstein I, Trivedi MH (2014) Inflammation, Obesity, and Metabolic Syndrome in Depression. J Clin Psychiatry 75:e1428\u0026ndash;e1432. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4088/JCP.14m09009\u003c/span\u003e\u003cspan address=\"10.4088/JCP.14m09009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen H, Lin F, Wu L et al (2023) The prevalence and the effect of interferon -γ in the comorbidity of rheumatoid arthritis and depression. Behav Brain Res 439:114237. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.bbr.2022.114237\u003c/span\u003e\u003cspan address=\"10.1016/j.bbr.2022.114237\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanacora G, Treccani G, Popoli M (2012) Towards a glutamate hypothesis of depression. Neuropharmacology 62:63\u0026ndash;77. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neuropharm.2011.07.036\u003c/span\u003e\u003cspan address=\"10.1016/j.neuropharm.2011.07.036\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePopoli M, Yan Z, McEwen BS, Sanacora G (2012) The stressed synapse: the impact of stress and glucocorticoids on glutamate transmission. Nat Rev Neurosci 13:22\u0026ndash;37. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrn3138\u003c/span\u003e\u003cspan address=\"10.1038/nrn3138\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMusazzi L, Racagni G, Popoli M (2011) Stress, glucocorticoids and glutamate release: Effects of antidepressant drugs. Neurochem Int 59:138\u0026ndash;149. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neuint.2011.05.002\u003c/span\u003e\u003cspan address=\"10.1016/j.neuint.2011.05.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMahar I, Bambico FR, Mechawar N, Nobrega JN (2014) Stress, serotonin, and hippocampal neurogenesis in relation to depression and antidepressant effects. Neurosci Biobehav Rev 38:173\u0026ndash;192. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neubiorev.2013.11.009\u003c/span\u003e\u003cspan address=\"10.1016/j.neubiorev.2013.11.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMenke A (2024) The HPA Axis as Target for Depression. Curr Neuropharmacol 22:904\u0026ndash;915. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2174/1570159X21666230811141557\u003c/span\u003e\u003cspan address=\"10.2174/1570159X21666230811141557\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShandilya S, Kumar S, Kumar Jha N et al (2022) Interplay of gut microbiota and oxidative stress: Perspective on neurodegeneration and neuroprotection. J Adv Res 38:223\u0026ndash;244. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.jare.2021.09.005\u003c/span\u003e\u003cspan address=\"10.1016/j.jare.2021.09.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"neurochemical-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nere","sideBox":"Learn more about [Neurochemical Research](https://www.springer.com/journal/11064)","snPcode":"11064","submissionUrl":"https://submission.nature.com/new-submission/11064/3","title":"Neurochemical Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"depression, grape seed extract, corticosterone, antioxidant, neuroinflammation","lastPublishedDoi":"10.21203/rs.3.rs-8950236/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8950236/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eShort-term stress is known to trigger oxidative and neuroinflammatory responses that contribute to the onset and progression of major depressive disorder (MDD). Phenolic compounds, such as grape seed extract (GSE), have gained attention for their ability to modulate these biological pathways. This study aimed to evaluate whether GSE (20 or 40 mg/kg, oral route) exerts antidepressant-like effects and mitigates stress-induced biochemical alterations in female mice exposed to the acute restraint stress (ARS) model. Female mice were pretreated with GSE and subsequently subjected to ARS. Behavioral outcomes were assessed using the tail suspension test (TST) and open field test (OFT). Plasma corticosterone levels, reactive species (RS) production in the prefrontal cortex, hippocampus, and small intestine, and mRNA expression of inflammatory mediators (NF-κB, IL-1β, IFN-γ) in brain and gut tissues were quantified through standard biochemical and molecular analyses. GSE pretreatment significantly prevented the ARS-induced increase in immobility time in the TST, without affecting locomotor activity in the OFT. ARS exposure elevated corticosterone concentrations and RS generation across central and peripheral tissues; both effects were attenuated by GSE. Additionally, GSE downregulated stress-induced expression of pro-inflammatory cytokines in neural and intestinal samples, indicating suppression of key inflammatory pathways. These findings demonstrate that GSE exerts antidepressant-like, antioxidant, and anti-inflammatory effects by modulating interconnected redox and cytokine signaling pathways. Importantly, this study provides novel evidence that GSE acts along the gut\u0026ndash;brain axis, mitigating corticosterone-driven oxidative and inflammatory responses. These results highlight GSE as a promising natural compound for the prevention and management of stress-related neuropsychiatric disorders.\u003c/p\u003e","manuscriptTitle":"Grape Seed Extract Mitigates Acute Stress-Induced Neuroinflammation and Oxidative Damage in Female Mice: Evidence for Gut–Brain Axis Modulation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-26 14:05:02","doi":"10.21203/rs.3.rs-8950236/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2026-04-12T09:39:04+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"255898688887944530304179304024466802098","date":"2026-03-25T08:23:07+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"80599974876455552141643809869795635513","date":"2026-03-24T18:51:04+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-02-24T18:18:41+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-24T18:08:05+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-24T10:54:30+00:00","index":"","fulltext":""},{"type":"submitted","content":"Neurochemical Research","date":"2026-02-23T19:21:33+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"neurochemical-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nere","sideBox":"Learn more about [Neurochemical Research](https://www.springer.com/journal/11064)","snPcode":"11064","submissionUrl":"https://submission.nature.com/new-submission/11064/3","title":"Neurochemical Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"99fa4d00-a23c-43a0-a343-d112c20e3659","owner":[],"postedDate":"February 26th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-02-26T14:05:02+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-26 14:05:02","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8950236","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8950236","identity":"rs-8950236","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}