The mechanism of lncRNA SNHG12 interacting with ELAVL1 to activate PI3K / AKT signaling pathway to promote docetaxel resistance in prostate cancer cells

preprint OA: closed
Full text JSON View at publisher
Full text 83,608 characters · extracted from preprint-html · click to expand
The mechanism of lncRNA SNHG12 interacting with ELAVL1 to activate PI3K / AKT signaling pathway to promote docetaxel resistance in prostate cancer cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The mechanism of lncRNA SNHG12 interacting with ELAVL1 to activate PI3K / AKT signaling pathway to promote docetaxel resistance in prostate cancer cells Cheng Zhao, Wen Li, Baoshou Zheng, Guangming Wang, Zhisong Xiao, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7319081/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective Prostate cancer (PCa) is the second most common cancer type in men worldwide, and docetaxel (DTX) resistance is one of the primary factors contributing to poor prognosis. Long non-coding RNAs (lncRNAs) have been reported to play a critical role in PCa DTX resistance, but the role of lncRNA SNHG12 in PCa DTX resistance remains unclear. Therefore, this study aimed to investigate the effect of SNHG12 on PCa DTX resistance and decipher its underlying mechanism. Methods PC-3 cells were treated with gradient DTX to generate DTX-resistant PC-3 cells (PC-3R), and a PCa tumor-bearing model was established by injecting PC-3R cells into the left dorsum of nude mice. The expression of key genes and proteins was detected by RT-qPCR, Western blot, immunofluorescence, and immunohistochemistry. Cell proliferation and migration were evaluated using CCK-8 assays, colony formation assays, and Transwell migration assays. RNA-protein binding was detected by RIP-qPCR. Results SNHG12 was upregulated in PC-3R cells. Knockdown of SNHG12 inhibited the proliferation and migration of PC-3R cells, as well as tumor growth in nude mice. Treatment with 10 nM DTX alone had no significant effect on PC-3R cell proliferation or migration, but knocking down SNHG12 in combination with DTX treatment significantly suppressed PC-3R cell proliferation, migration, and tumor growth. Additionally, ELAVL1 expression was upregulated in PC-3R cells, and the activation level of the PI3K/AKT signaling pathway was increased in both PC-3R cells and tumor tissues. Treatment with the PI3K activator 740 Y-P attenuated the inhibitory effect of SNHG12 knockdown. Importantly, SNHG12 in PC-3R cells was found to bind to ELAVL1. Mechanistic studies revealed that SNHG12 activated the PI3K/AKT signaling pathway by binding to ELAVL1, thereby inducing PCa DTX resistance. Conclusion Our findings demonstrate that SNHG12 knockdown plays a pivotal role in suppressing DTX resistance in PCa, and unravel its underlying molecular mechanism, thereby providing a potential therapeutic target for developing DTX-sensitizing strategies in PCa treatment. prostate cancer drug resistance docetaxel lncRNA SNHG12 ELAVL1 PI3K/AKT signaling pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Prostate cancer (PCa) ranks as the second most prevalent malignancy in males and represents the eighth leading cause of cancer-related mortality worldwide [1]. Despite substantial therapeutic advances, the prognosis of PCa remains suboptimal [2]. Current clinical interventions primarily include radical prostatectomy, radiotherapy, and chemotherapy [3]. While surgical resection and radiotherapy demonstrate efficacy in localized PCa, advanced cases frequently develop recurrence and metastasis post-treatment [4]. Consequently, adjuvant chemotherapy with docetaxel (DTX), a taxane derivative, has become a cornerstone for advanced PCa management [5]. Regrettably, the emergence of DTX resistance in a significant proportion of patients often culminates in therapeutic failure and poor outcomes [6]. Therefore, elucidating the molecular mechanisms underlying DTX resistance is imperative for developing novel therapeutic targets to improve clinical prognosis. Long non-coding RNAs (lncRNAs) have emerged as critical regulators of transcription, gene expression, and protein function [7]. Small nucleolar RNA host gene 12 (SNHG12), located at chromosome 1p35.3, has been implicated in mediating oncogenic processes including proliferation, metastasis, and invasion across various cancers [8]. Previous studies have identified SNHG12 overexpression in PCa, correlating with aggressive tumor behavior and unfavorable prognosis [9]. Functional studies demonstrate that SNHG12 knockdown suppresses PCa cell proliferation, migration, and invasion [10]. Notably, elevated SNHG12 expression has been mechanistically linked to paclitaxel resistance in non-small cell lung carcinoma [11]. However, the potential involvement of SNHG12 in DTX resistance in PCa remains unexplored. The RNA-binding protein ELAVL1, also known as human antigen R (HuR), typically binds to AU-rich elements (AREs) in the 3′-UTR of target genes to enhance RNA stability [12]. Numerous studies have found that ELAVL1 is upregulated in various cancers and promotes tumorigenesis and progression, including gastric cancer [13], hepatocellular carcinoma [14], and lung cancer [15]. In prostate cancer (PCa), ELAVL1 is also an important regulatory molecule for tumor development [16]. Moreover, high levels of ELAVL1 are associated with docetaxel (DTX) chemotherapy resistance in triple-negative breast cancer [17]. Notably, ELAVL1 can also regulate the malignant progression of non-small cell lung cancer by binding to SNHG12 [18]. However, it is currently unclear whether SNHG12 affects DTX resistance in PCa by binding to ELAVL1. Additionally, the phosphatidylinositol-3-kinase (PI3K)/protein kinase B (AKT) pathway, as an important intracellular signaling pathway, is also associated with the malignant progression of PCa [19]. Importantly, the persistent activation of the PI3K/AKT pathway is also a major cause of DTX resistance in PCa, and inhibiting PI3K/AKT activation can enhance DTX-induced apoptosis [20]. Moreover, the activation of PI3K/AKT is also regulated by ELAVL1 [21]. Therefore, we speculate that ELAVL1 may affect DTX resistance in PCa by regulating the PI3K/AKT signaling pathway. In summary, this study aims to explore the role of SNHG12 in DTX resistance in PCa and elucidate its underlying mechanisms, laying the foundation for the development of new intervention targets for DTX chemotherapy resistance in PCa. Materials and Methods 2.1 Cell Culture, Establishment of Drug-Resistant Cell Lines, Infection and Treatment Human prostate cancer PC-3 cells (BFN60700215) were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences. PC-3 cells were cultured in DMEM medium (11965092, Gibco, USA) supplemented with 10% fetal bovine serum (A5256701, Gibco, USA) and 1% penicillin-streptomycin double-antibody (C0222, Beyotime, China) according to the manufacturer’s instructions. To obtain DTX-resistant PC-3 cells (PC-3R), PC-3 cells were exposed to gradient DTX to induce drug resistance as previously described [22]. Briefly, PC-3 cells were treated with DTX at concentrations of 0.1, 0.2, 0.5, 1, 5, or 10 nM for 30 days. Cell status was continuously monitored during this period; if cells showed death or slow growth, the DTX treatment time was appropriately delayed. PC-3R cells were considered successfully established once they could stably grow in a 10 nM DTX environment. All cell cultures were performed under standard conditions of 37°C and 5% CO₂. In studies exploring the effects of SNHG12 and ELAVL1 on PCa DTX resistance, PC-3R cells with knocked-down SNHG12 or ELAVL1 were constructed using methods referenced from previous studies [23]. In brief, PC-3R cells were infected with lentiviruses for SNHG12 knockdown (sh-SNHG12), ELAVL1 knockdown (sh-ELAVL1), and knockdown control (sh-NC) (MOI = 50, Genepharma, China). PC-3R cells with knocked-down SNHG12 or ELAVL1 were obtained 24 hours later, and transfection efficiency was detected by RT-qPCR and Western blot. Additionally, in studies investigating the PI3K/AKT signaling pathway in PCa DTX resistance, PC-3R cells were treated with the PI3K activator 740 Y-P (HY-P0175, MCE, USA) at a concentration of 50 µM for 24 hours to activate intracellular PI3K signaling. 2.2 Animal Experiments A mouse PCa tumor-bearing model was established as previously described [24]. First, 20 male nude mice (5–6 weeks old, weighing 18–20 g) were purchased from Hunan Slack Jingda Laboratory Animal Co., Ltd. After 1 week of adaptive feeding, the nude mice were randomly divided into 4 groups and treated according to the pre-designed experimental protocol: Model group: Nude mice were subcutaneously injected with 100 µL of PC-3R cell suspension (5×10⁶ cells/mL) into the left dorsum. DTX group: Nude mice were injected with PC-3R cells (same dose as the Model group) into the left dorsum, and on day 3, 10 mg/kg DTX was intraperitoneally injected every 7 days for a total of 25 days. sh-SNHG12 group: Nude mice were subcutaneously injected with 100 µL of PC-3R cells with SNHG12 knockdown (5×10⁶ cells/mL) into the left dorsum. - DTX + sh-SNHG12 group: Nude mice were injected with SNHG12-knockdown PC-3R cells, followed by DTX intervention as in the DTX group. Tumor volume was measured every 7 days after cell injection using the formula: 0.5 × length × width². All nude mice were euthanized 28 days after cell injection, and tumor tissues were isolated for subsequent analysis. All animal procedures were approved by the Animal Ethics Committee of our institution. 2.3 CCK-8 Assay for Cell Proliferation After culturing PC-3 and PC-3R cells, 10 µL of CCK-8 reagent (CA1210, Sorlabio, China) was added to each well, and the plates were incubated at 37°C with 5% CO₂ for 2 hours. The absorbance at 450 nm was measured using a microplate reader. 2.4 Real-Time Quantitative PCR (RT-qPCR) Total RNA was extracted from PC-3 and PC-3R cells using TRIzol™ reagent (15596026CN, Invitrogen, USA). First-strand cDNA was synthesized from RNA using the HiScript III First-Strand cDNA Synthesis Kit (R312-02, Vazyme, China), followed by real-time quantitative PCR with SYBR Green reagent (Q221-01, Vazyme, China). Results were calculated using the 2⁻ΔΔCt method, and primer sequences are listed in Table 1 . Table 1 List of primer sequence information Gene name Primer sequence SNHG12 F: ATGAAATGCAGGGGACCTGG R: TGTAACATGAATCTTAAAGCACAGC β-actin F: CATGTACGTTGCTATCCAGGC R: CTCCTTAATGTCACGCACGAT 2.5 For the colony formation assay 200 PC-3R cells were seeded in a 24-well plate and cultured under conventional conditions at 37℃ with 5% CO₂. During the culture, the medium was changed every 2 days. After 7 days, the culture medium was discarded, and the cells were washed twice with PBS buffer. Subsequently, the cells were fixed with 4% paraformaldehyde for 30 minutes and then stained with 0.2% crystal violet (Y268093-5g, Beyotime, China) for 15 minutes. The number of colonies formed was photographed and counted. 2.6 For the Transwell migration assay The density of PC-3R cells was adjusted to 1×10⁵ cells/mL using serum-free culture medium, and 200 µL of cell suspension was seeded in the Transwell chamber. The lower chamber of the 24-well plate was filled with 200 µL of DMEM culture medium supplemented with 10% fetal bovine serum. After 24 hours of culture, the cells were fixed with 4% paraformaldehyde for 20 minutes, and the non-migrated cells on the upper surface of the chamber were washed away with PBS. The cells were then stained with 1% crystal violet solution (Y268093-5g, Beyotime, China) and observed under an inverted microscope. Three fields of view were selected for counting and photographing. 2.7 For Western blot analysis The total protein was extracted from PC-3, PC-3R cells, and xenografted tumor tissues in nude mice using RIPA buffer containing 1% protease inhibitor and phosphatase inhibitor (20–188, Sigma-Aldrich, USA). The protein concentration was quantified using a BCA protein concentration determination kit (P0010, Beyotime, China). Subsequently, equal amounts of protein were separated by SDS-PAGE and transferred onto a PVDF membrane (IPFL00010, Sigma-Aldrich, USA). The membrane was incubated overnight at 4℃ with diluted primary antibodies: ELAVL1 (1:1000, ab200342, abcam, UK), PI3K (1:1000, PA5-29220, Invitrogen, USA), p-PI3K (1:1000, PA5-104853, Invitrogen, USA), AKT (1:1000, PA5-29169, Invitrogen, USA), p-AKT (1:1000, 44-602G, Invitrogen, USA), β-actin (1:1000, ab18226, abcam, UK). The membrane was then treated with corresponding secondary antibodies at room temperature for 1 hour and visualized using an enhanced chemiluminescence kit (WBULP, Millipore, USA). The protein bands were semi-quantitatively analyzed using ImageJ software. 2.8 Immunofluorescence After culturing PC-3 and PC-3R cells, cells were fixed with 4% paraformaldehyde at room temperature for 30 min and permeabilized with 0.1% Triton X-100 for 10 min. Cells were then incubated overnight at 4°C with ELAVL1 primary antibody (1:200, ab200342, abcam, UK). After washing, corresponding fluorescent secondary antibodies were applied at room temperature for 2 h. Following nuclear staining with DAPI (C0065, Solarbio, China) for 15 min, slides were imaged under a fluorescence microscope, and relative fluorescence intensity was quantified to characterize protein expression levels. 2.9 RNA Immunoprecipitation (RIP) Assay The BeyoRIP™ RIP Kit (P1801S, Beyotime, China) was used for the assay. Briefly, ELAVL1 antibody (1:50, ab200342, abcam, UK) was coupled to A/G magnetic beads, followed by overnight incubation with PC-3 cell lysates at 4°C. After precipitation and washing, RNA was extracted and subjected to RT-qPCR. 2.10 Immunohistochemistry Tumor tissues from nude mice were embedded in paraffin, and 5-µm sections were cut from tissue blocks. Sections were dewaxed and hydrated with sodium citrate buffer, then incubated overnight at 4°C with Ki67 primary antibody (1:100, ab15580, abcam, UK). After washing, sections were incubated with corresponding secondary antibodies at room temperature for 2 h, followed by nuclear staining with DAPI (C0065, Solarbio, China) for 10 min. Images were captured under a fluorescence microscope. 2.11 Statistical Analysis All data are presented as mean ± standard deviation (mean ± SD). Statistical analysis was performed using GraphPad Prism 8.1 software (GraphPad Software Inc, San Diego, CA, USA). Student’s t-test was used for comparisons between two groups, while one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test was used for multiple-group comparisons. A p-value < 0.05 was considered statistically significant. Results 3.1 Establishment of docetaxel-resistant cells and SNHG12 expression profiling In this study, we successfully generated DTX-resistant PC-3 cells (PC-3R) through progressive DTX exposure. To validate the resistance phenotype, both parental PC-3 and PC-3R cells were treated with DTX at gradient concentrations (0, 2.5, 5, 10, 20, 40, and 80 nM). CCK-8 assays revealed that the IC50 values were 4.237 nM for PC-3 cells versus 70.09 nM for PC-3R cells (Fig. 1A), demonstrating a 16.54-fold increase in drug resistance (p < 0.001). Subsequent RT-qPCR analysis showed significantly elevated SNHG12 expression levels in PC-3R cells compared to parental PC-3 cells (Fig. 1B, p < 0.01). These findings suggest a potential association between SNHG12 upregulation and DTX resistance development in PCa. 3.2 Knockdown of SNHG12 Inhibits Docetaxel Resistance in Prostate Cancer Cells Next, to investigate the role of SNHG12 in PCa DTX resistance, we knocked down SNHG12 in PC-3R cells. RT-qPCR results showed that SNHG12 expression in the sh-SNHG12 group was significantly lower than that in the sh-NC group (Fig. 2A), indicating successful construction of PC-3R cells with SNHG12 knockdown. Additionally, we found that 10 nM DTX had no significant effect on the proliferative viability of PC-3R cells, while knocking down SNHG12 significantly suppressed PC-3R cell proliferation. Compared with the DTX group, knocking down SNHG12 further reduced the proliferative viability of PC-3R cells (Fig. 2B). Colony formation assay results showed that treatment with 10 nM DTX did not significantly alter the colony-forming ability of PC-3R cells, whereas SNHG12 knockdown significantly inhibited this ability. Knocking down SNHG12 in DTX-treated cells further decreased colony-forming ability (Fig. 2C). Moreover, knocking down SNHG12 in 10 nM DTX-treated PC-3R cells also reduced cell migration capacity (Fig. 2D). Collectively, these results indicate that SNHG12 knockdown enhances the sensitivity of PCa to DTX. 3.3 Knockdown of SNHG12 Inhibits Docetaxel Resistance in Prostate Cancer Cells via the PI3K/AKT Signaling Pathway Previous studies have shown that persistent activation of the PI3K/AKT pathway can lead to docetaxel (DTX) resistance in PCa [20]. Therefore, we detected the expression of the PI3K/AKT pathway at the cellular level. Western blot results showed that the expressions of p-PI3K/PI3K and p-AKT/AKT in PC-3R cells were significantly higher than those in PC-3 cells (Fig. 3A). Additionally, previous studies have indicated that the activation of the PI3K/AKT signaling pathway is also regulated by SNHG12 [25]. Thus, we investigated whether SNHG12 affects PCa DTX resistance by regulating the PI3K/AKT signaling pathway. We found that treatment with the PI3K activator 740 Y-P weakened the positive effects of the combined intervention of DTX and SNHG12 knockdown, partially upregulating the proliferative viability (Fig. 3B), colony-forming ability (Fig. 3C), and migration ability (Fig. 3D) of PC-3R cells. These results suggest that knocking down SNHG12 inhibits DTX resistance in PCa cells by suppressing the activation of the PI3K/AKT signaling pathway. 3.4 SNHG12 interacts with ELAVL1 to activate the PI3K/AKT signaling pathway. Previous studies have shown that ELAVL1 is an important regulatory molecule in the development of PCa tumors [16], and ELAVL1 can interact with SNHG12 to exert oncogenic effects [18]. Therefore, we explored whether SNHG12 can bind to ELAVL1 in PCa. First, the expression of ELAVL1 was detected by immunofluorescence, and it was found that the expression level of ELAVL1 in PC-3R cells was significantly higher than that in PC-3 cells (Fig. 4A). Second, the RIP-qPCR results showed that ELAVL1 binds to SNHG12 (Fig. 4B). In addition, previous studies have indicated that ELAVL1 is also involved in the activation of the PI3K/AKT pathway [21]. Therefore, to explore whether SNHG12 regulates the activation of the PI3K/AKT signaling pathway by binding to ELAVL1, we knocked down the expression of ELAVL1 in PC-3R cells. The Western blot results showed that the expression of ELAVL1 in the sh-ELAVL1 group was significantly lower than that in the sh-NC group (Fig. 4C), indicating that the PC-3R cells with knocked-down ELAVL1 were successfully constructed. Moreover, we found that the expression of p-PI3K/PI3K and p-AKT/AKT in PC-3R cells was significantly downregulated after knocking down SNHG12 or ELAVL1 (Fig. 4D). The above results indicate that SNHG12 promotes the activation of the PI3K/AKT signaling pathway in PC-3R cells by binding to ELAVL1. 3.5 Knockdown of SNHG12 Inhibits Docetaxel Resistance in Prostate Cancer Finally, we explored the role of SNHG12 in PCa DTX resistance in a nude mouse model. First, we found that both DTX treatment alone and SNHG12 knockdown alone could significantly inhibit the growth of tumor-bearing tissues, and further knockdown of SNHG12 on the basis of DTX treatment could further inhibit the growth of tumor-bearing tissues (Fig. 5A-C). Immunohistochemical results showed that DTX treatment or SNHG12 knockdown significantly inhibited the expression of Ki67 in tumor-bearing tissues; compared with the DTX group, the expression of Ki67 was further downregulated after SNHG12 knockdown (Fig. 5D). In addition, DTX treatment or SNHG12 knockdown also downregulated the expression of p-PI3K/PI3K and p-AKT/AKT in tumor-bearing tissues, and additional knockdown of SNHG12 under DTX exposure could further downregulate the expression of p-PI3K/PI3K and p-AKT/AKT (Fig. 5E). Collectively, the above results indicate that SNHG12 knockdown can inhibit PCa DTX resistance.。 Discussion and Conclusion Prostate cancer (PCa) is a common malignant tumor in men worldwide and severely threatens the life safety of male populations [1]. Currently, docetaxel (DTX) - based adjuvant chemotherapy has been a standard clinical treatment for patients with advanced PCa. However, the acquired resistance to DTX often leads to poor outcomes [6]. In this study, we revealed the key mechanism by which SNHG12 activates the PI3K/AKT signaling pathway through binding with ELAVL1, resulting in DTX resistance in PCa, and emphasized the great potential of SNHG12 for improving DTX resistance in PCa. Increasing evidence indicates that SNHG12 plays a crucial role in the malignant progression of tumors. For example, the study by Sun et al. [26] showed that high - level SNHG12 is associated with poor prognosis in ovarian cancer, and its inhibition can suppress the proliferation and migration of cancer cells. In the study by Wang et al. [27], high - level SNHG12 promoted the proliferation of colorectal cancer cells and inhibited apoptosis. In PCa, SNHG12 is also closely related to poor prognosis and the malignant proliferation and metastasis of cancer cells [9]. Moreover, previous studies have confirmed that high - level SNHG12 is an important cause of paclitaxel resistance in non - small - cell lung cancer [11]. Similar to previous findings, we observed upregulated expression of SNHG12 in PC-3R cells. Additionally, DTX treatment alone had no significant effect on the proliferation and migration of PC-3R cells. Knockdown of SNHG12 significantly inhibited PC-3R cell proliferation and migration, and further suppression of proliferation and migration was observed when SNHG12 knockdown was combined with DTX intervention. Notably, DTX significantly suppressed the growth of tumor xenografts in nude mice, and this inhibitory effect was further enhanced by SNHG12 knockdown. These results indicate heterogeneous effects of DTX on PC-3R growth in vitro and in vivo. We speculate that this may be attributed to the complex in vivo environment and differences in DTX exposure time, which alter the sensitivity of PC-3R cells to DTX. Our study demonstrates that high expression of SNHG12 contributes to docetaxel resistance in prostate cancer (PCa). Previous studies have shown that the PI3K/AKT pathway, as a critical intracellular signaling pathway, not only mediates processes such as cancer cell proliferation, autophagy, and apoptosis but also regulates tumor chemoresistance [28]. Li et al. [29] demonstrated that sustained activation of the PI3K/AKT signaling pathway induces cisplatin resistance in osteosarcoma cells. Okuno et al. [30] reported that inhibiting PI3K/AKT signaling overcomes gemcitabine resistance in pancreatic ductal adenocarcinoma. Additionally, Chappell et al. [31] found that activation of the PI3K/AKT pathway is a key inducer of DTX and doxorubicin resistance in PCa. Consistent with these findings, we observed significantly upregulated expression of p-PI3K/PI3K and p-AKT/AKT in PC-3R cells. Importantly, Li [25] showed that PI3K/AKT signaling activation is regulated by SNHG12. Therefore, we investigated whether SNHG12 influences PCa DTX resistance via the PI3K/AKT pathway. We found that supplementing PC-3R cells with the PI3K activator 740 Y-P partially attenuated the synergistic inhibitory effects of DTX and SNHG12 knockdown, leading to increased cell proliferation, colony-forming ability, and migration. Although previous studies have confirmed that inhibiting PI3K/AKT activation improves PCa DTX resistance [20], our study highlights that SNHG12 knockdown weakens PCa DTX resistance by suppressing PI3K/AKT pathway activation. Previous studies have also shown that SNHG12 regulates downstream gene expression by binding to ELAVL1 [18]. Notably, ELAVL1 has been validated as an oncogene promoting tumor malignancy in PCa [16]. Cai et al. [32] reported that high ELAVL1 expression is a key factor in poor immunotherapy outcomes for PCa. Wei et al. [33] found that high ELAVL1 levels inhibit PCa cell apoptosis, while its knockdown induces cancer cell apoptosis and ferroptosis. Consistent with these findings, we observed upregulated ELAVL1 expression in PC-3R cells. Additionally, in triple-negative breast cancer, ELAVL1 is associated with DTX resistance, and its inhibition enhances DTX-induced apoptosis [17]. Therefore, we investigated whether an SNHG12/ELAVL1 signaling axis regulates PI3K/AKT pathway activation to influence DTX sensitivity in PCa. RIP-qPCR assays confirmed that SNHG12 binds to ELAVL1. Notably, knocking down SNHG12 or ELAVL1 in PC-3R cells suppressed the expression of p-PI3K/PI3K and p-AKT/AKT. Our study demonstrates that SNHG12 activates the PI3K/AKT signaling pathway by binding to ELAVL1, thereby inducing PCa DTX resistance. In summary, our study reveals for the first time that SNHG12 promotes the activation of PI3K / AKT signaling pathway by binding to ELAVL1, which in turn leads to the key mechanism of DTX resistance in PCa. The above findings provide insights into the role of SNHG12 as a potential intervention target in PCa DTX sensitization therapy. However, our research also has shortcomings. First, the reason for the difference in sensitivity of PCa DTX-resistant cells to DTX in vivo and in vitro has not been elucidated. Secondly, further preclinical data are needed to support the clinical application of the above findings. Follow-up research will focus on solving the above problems. Declarations Author Contribution All authors reviewed the manuscript. References BRAY F, LAVERSANNE M, SUNG H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries [J]. CA Cancer J Clin, 2024, 74(3): 229 − 63. CHEN H, PANG B, ZHOU C, et al. Prostate cancer-derived small extracellular vesicle proteins: the hope in diagnosis, prognosis, and therapeutics [J]. J Nanobiotechnology, 2023, 21(1): 480. GRAHAM L S, LIN J K, LAGE D E, et al. Management of Prostate Cancer in Older Adults [J]. Am Soc Clin Oncol Educ Book, 2023, 43: e390396. GOURDIN T. Highlights of recent research focused on the treatment of advanced prostate cancer [J]. Curr Opin Oncol, 2025, 37(3): 218 − 22. LU J, ZOU Q, LI Y, et al. FTH1P8 induces and transmits docetaxel resistance by inhibiting ferroptosis in prostate cancer [J]. Biomed Pharmacother, 2024, 180: 117472. HASHEMI M, ZANDIEH M A, TALEBI Y, et al. Paclitaxel and docetaxel resistance in prostate cancer: Molecular mechanisms and possible therapeutic strategies [J]. Biomed Pharmacother, 2023, 160: 114392. ZHANG Y. LncRNA-encoded peptides in cancer [J]. J Hematol Oncol, 2024, 17(1): 66. TAMANG S, ACHARYA V, ROY D, et al. SNHG12: An LncRNA as a Potential Therapeutic Target and Biomarker for Human Cancer [J]. Front Oncol, 2019, 9: 901. CHENG G, SONG Z, LIU Y, et al. Long noncoding RNA SNHG12 indicates the prognosis of prostate cancer and accelerates tumorigenesis via sponging miR-133b [J]. J Cell Physiol, 2020, 235(2): 1235-46. SONG J, WU X, MA R, et al. Long noncoding RNA SNHG12 promotes cell proliferation and activates Wnt/β-catenin signaling in prostate cancer through sponging microRNA-195 [J]. J Cell Biochem, 2019, 120(8): 13066-75. WANG P, CHEN D, MA H, et al. LncRNA SNHG12 contributes to multidrug resistance through activating the MAPK/Slug pathway by sponging miR-181a in non-small cell lung cancer [J]. Oncotarget, 2017, 8(48): 84086-101. LEBEDEVA S, JENS M, THEIL K, et al. Transcriptome-wide analysis of regulatory interactions of the RNA-binding protein HuR [J]. Mol Cell, 2011, 43(3): 340 − 52. MA S, XU Y, QIN X, et al. RUNX1, FUS, and ELAVL1-induced circPTPN22 promote gastric cancer cell proliferation, migration, and invasion through miR-6788-5p/PAK1 axis-mediated autophagy [J]. Cell Mol Biol Lett, 2024, 29(1): 95. KANZAKI H, CHIBA T, KANEKO T, et al. The RNA-Binding Protein ELAVL1 Regulates Hepatitis B Virus Replication and Growth of Hepatocellular Carcinoma Cells [J]. Int J Mol Sci, 2022, 23(14). MAO G, MU Z, WU D A. Exosomal lncRNA FOXD3-AS1 upregulates ELAVL1 expression and activates PI3K/Akt pathway to enhance lung cancer cell proliferation, invasion, and 5-fluorouracil resistance [J]. Acta Biochim Biophys Sin (Shanghai), 2021, 53(11): 1484-94. CAI Z, XU H, BAI G, et al. ELAVL1 promotes prostate cancer progression by interacting with other m6A regulators [J]. Front Oncol, 2022, 12: 939784. WEI L, ZHANG Q, ZHONG C, et al. Functional inhibition of the RNA-binding protein HuR sensitizes triple-negative breast cancer to chemotherapy [J]. Mol Oncol, 2023, 17(10): 1962-80. HUANG Y, XIA L, TAN X, et al. Molecular mechanism of lncRNA SNHG12 in immune escape of non-small cell lung cancer through the HuR/PD-L1/USP8 axis [J]. Cell Mol Biol Lett, 2022, 27(1): 43. LI M, CHE N, LIU X, et al. Dauricine regulates prostate cancer progression by inhibiting PI3K/AKT-dependent M2 polarization of macrophages [J]. Biochem Pharmacol, 2023, 217: 115838. EBERLEIN C, WILLIAMSON S C, HOPCROFT L, et al. Capivasertib combines with docetaxel to enhance anti-tumour activity through inhibition of AKT-mediated survival mechanisms in prostate cancer [J]. Br J Cancer, 2024, 130(8): 1377-87. MAO G, MU Z, WU D A. Exosomal lncRNA FOXD3-AS1 upregulates ELAVL1 expression and activates PI3K/Akt pathway to enhance lung cancer cell proliferation, invasion, and 5-fluorouracil resistance [J]. Acta Biochimica et Biophysica Sinica, 2021, 53(11): 1484-94. LU X, YANG F, CHEN D, et al. Quercetin reverses docetaxel resistance in prostate cancer via androgen receptor and PI3K/Akt signaling pathways [J]. Int J Biol Sci, 2020, 16(7): 1121-34. BRADY S N, MAGGI L B, JR., WINKELER C L, et al. Nucleophosmin protein expression level, but not threonine 198 phosphorylation, is essential in growth and proliferation [J]. Oncogene, 2009, 28(36): 3209-20. SHI Q, ZHU Y, MA J, et al. Prostate Cancer-associated SPOP mutations enhance cancer cell survival and docetaxel resistance by upregulating Caprin1-dependent stress granule assembly [J]. Mol Cancer, 2019, 18(1): 170. LI Y, GUO S, LIU W, et al. Silencing of SNHG12 Enhanced the Effectiveness of MSCs in Alleviating Ischemia/Reperfusion Injuries via the PI3K/AKT/mTOR Signaling Pathway [J]. Front Neurosci, 2019, 13: 645. SUN D, FAN X H. LncRNA SNHG12 accelerates the progression of ovarian cancer via absorbing miRNA-129 to upregulate SOX4 [J]. Eur Rev Med Pharmacol Sci, 2019, 23(6): 2345-52. WANG J Z, XU C L, WU H, et al. LncRNA SNHG12 promotes cell growth and inhibits cell apoptosis in colorectal cancer cells [J]. Braz J Med Biol Res, 2017, 50(3): e6079. PENG Y, WANG Y, ZHOU C, et al. PI3K/Akt/mTOR Pathway and Its Role in Cancer Therapeutics: Are We Making Headway? [J]. Front Oncol, 2022, 12: 819128. LI H, SHEN X, MA M, et al. ZIP10 drives osteosarcoma proliferation and chemoresistance through ITGA10-mediated activation of the PI3K/AKT pathway [J]. J Exp Clin Cancer Res, 2021, 40(1): 340. OKUNO K, XU C, PASCUAL-SABATER S, et al. Berberine Overcomes Gemcitabine-Associated Chemoresistance through Regulation of Rap1/PI3K-Akt Signaling in Pancreatic Ductal Adenocarcinoma [J]. Pharmaceuticals (Basel), 2022, 15(10). CHAPPELL W H, CANDIDO S, ABRAMS S L, et al. Influences of TP53 and the anti-aging DDR1 receptor in controlling Raf/MEK/ERK and PI3K/Akt expression and chemotherapeutic drug sensitivity in prostate cancer cell lines [J]. Aging (Albany NY), 2020, 12(11): 10194-210. CAI Z, ZHAI X, XU J, et al. ELAVL1 regulates PD-L1 mRNA stability to disrupt the infiltration of CD4-positive T cells in prostate cancer [J]. Neoplasia, 2024, 57: 101049. WEI L, KIM S H, ARMALY A M, et al. RNA-binding protein HuR inhibition induces multiple programmed cell death in breast and prostate cancer [J]. Cell Commun Signal, 2024, 22(1): 580. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7319081","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":499630264,"identity":"ec551abb-4065-4c43-91d8-036a45cb8edc","order_by":0,"name":"Cheng Zhao","email":"","orcid":"","institution":"First Affiliated Hospital of Dali University","correspondingAuthor":false,"prefix":"","firstName":"Cheng","middleName":"","lastName":"Zhao","suffix":""},{"id":499630265,"identity":"58f8edab-c2c1-4856-9cbc-dce3bf9eb95c","order_by":1,"name":"Wen Li","email":"","orcid":"","institution":"First Affiliated Hospital of Dali University","correspondingAuthor":false,"prefix":"","firstName":"Wen","middleName":"","lastName":"Li","suffix":""},{"id":499630266,"identity":"e5652a76-9e26-4941-bda2-39050531b069","order_by":2,"name":"Baoshou Zheng","email":"","orcid":"","institution":"First Affiliated Hospital of Dali University","correspondingAuthor":false,"prefix":"","firstName":"Baoshou","middleName":"","lastName":"Zheng","suffix":""},{"id":499630267,"identity":"96f50622-08c2-438c-8894-1edba7c1b6da","order_by":3,"name":"Guangming Wang","email":"","orcid":"","institution":"First Affiliated Hospital of Dali University","correspondingAuthor":false,"prefix":"","firstName":"Guangming","middleName":"","lastName":"Wang","suffix":""},{"id":499630268,"identity":"0eef2711-fa2d-469d-8e64-cac6e6f5fec0","order_by":4,"name":"Zhisong Xiao","email":"","orcid":"","institution":"First Affiliated Hospital of Dali University","correspondingAuthor":false,"prefix":"","firstName":"Zhisong","middleName":"","lastName":"Xiao","suffix":""},{"id":499630269,"identity":"4279e4ec-a932-4985-9147-1157e2cfe04b","order_by":5,"name":"Yunpeng Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvUlEQVRIiWNgGAWjYBACPiA+8PGfjRwbe/sB4rSwMTAwPpzBlmbMx3MmgWgtzMY8bIcT50k4GBCpRSL3mOQMHub0NgmGBIYfFduI0ZKXJvFBgi23TbrxAGPPmdvEaMkxk5xhwJPbJnMggZmxjUgt0jwJEulsEgkGRGsxNuY5YJBAghaed4kPZzYkGLYBA/kgUX7hZ889cOBjw395+fb2gw9+VBChhUEgB8E+QIR6kDVniFM3CkbBKBgFIxgAAEuQOHkGExibAAAAAElFTkSuQmCC","orcid":"","institution":"First Affiliated Hospital of Dali University","correspondingAuthor":true,"prefix":"","firstName":"Yunpeng","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2025-08-07 13:08:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7319081/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7319081/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":89283745,"identity":"96952b38-d958-4410-8076-f886132e1681","added_by":"auto","created_at":"2025-08-18 10:55:46","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":174245,"visible":true,"origin":"","legend":"\u003cp\u003eConstruction of docetaxel-resistant cells and identification of SNHG12 expression.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7319081/v1/b317ea70e98a16988372a803.png"},{"id":89283748,"identity":"5c663f9f-7aec-4c83-9808-7886a9bd4664","added_by":"auto","created_at":"2025-08-18 10:55:46","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":835421,"visible":true,"origin":"","legend":"\u003cp\u003eKnockdown of SNHG12 inhibits docetaxel resistance in prostate cancer cells.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7319081/v1/4f23f0e46d238124f14279cb.png"},{"id":89283747,"identity":"9d460fcb-8b17-4493-8b5c-862c7d6e9e3f","added_by":"auto","created_at":"2025-08-18 10:55:46","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":635539,"visible":true,"origin":"","legend":"\u003cp\u003eKnockdown of SNHG12 inhibits docetaxel resistance in prostate cancer cells through the PI3K / AKT signaling pathway.\u003c/p\u003e\n\u003cp\u003eA : Western blot was used to detect the expression of p-PI3K / PI3K and p-AKT / AKT in PC-3 and PC-3R cells. B : CCK-8 was used to detect the viability of PC-3R cells ; c : Clone formation assay was used to detect the clone formation ability of PC-3R cells. D : Transwell was used to detect the migration ability of PC-3R cells, and the scale was 100 μm. Compared with PC-3 group, NC group and DTX group, nsP \u0026gt; 0.05, * * * P \u0026lt; 0.001 ; compared with the DTX + sh-SNHG12 group, # # P \u0026lt; 0.01, # # # P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7319081/v1/013af45ed6127d3fe149534a.png"},{"id":89283765,"identity":"a347e8d3-137a-4b80-816d-03b30fcae2b6","added_by":"auto","created_at":"2025-08-18 10:55:47","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":600394,"visible":true,"origin":"","legend":"\u003cp\u003eSNHG12 interacts with ELAVL1 to activate the PI3K / AKT signaling pathway.\u003c/p\u003e\n\u003cp\u003eA : Immunofluorescence was used to detect the expression of ELAVL1 in PC-3 and PC-3R cells, scale : 10 μm ; b : RIP-qPCR was used to detect the enrichment level of ELAVL1 on SNHG12 in PC-3 and PC-3R cells ; c : Western blot was used to detect the transfection efficiency of ELAVL1 ; d : Western blot was used to detect the expression of p-PI3K / PI3K and p-AKT / AKT in PC-3R cells. Compared with PC-3 group, IgG group, NC group and sh-NC group, nsP \u0026gt; 0.05, * * P \u0026lt; 0.01, * * * P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7319081/v1/d779b24e3b9f828edb8fba21.png"},{"id":89283754,"identity":"f2e98966-3fdd-49b0-87f4-2f4944a46f4e","added_by":"auto","created_at":"2025-08-18 10:55:46","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":661948,"visible":true,"origin":"","legend":"\u003cp\u003eKnockdown of SNHG12 inhibits docetaxel resistance in prostate cancer.\u003c/p\u003e\n\u003cp\u003eA : Gross picture of tumor-bearing tissue ; b : Tumor-bearing tissue volume monitoring ; c : Tumor-bearing tissue weight monitoring ; d : Immunohistochemical detection of Ki67 expression in tumor-bearing tissues, scale : 25 μm ; e : Western blot was used to detect the expression of p-PI3K / PI3K and p-AKT / AKT in tumor-bearing tissues. Compared with the Model group, * P \u0026lt; 0.05, * * P \u0026lt; 0.01, * * * P \u0026lt; 0.001 ; compared with the DTX group, # # # P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7319081/v1/980b7cee47033b18d643ccd8.png"},{"id":89519244,"identity":"f54f831e-8405-4765-bea9-11c853aec300","added_by":"auto","created_at":"2025-08-20 21:16:35","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3686920,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7319081/v1/4dc3a3de-d0a1-47ee-b061-cdc63d3f9d8e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The mechanism of lncRNA SNHG12 interacting with ELAVL1 to activate PI3K / AKT signaling pathway to promote docetaxel resistance in prostate cancer cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eProstate cancer (PCa) ranks as the second most prevalent malignancy in males and represents the eighth leading cause of cancer-related mortality worldwide [1]. Despite substantial therapeutic advances, the prognosis of PCa remains suboptimal [2]. Current clinical interventions primarily include radical prostatectomy, radiotherapy, and chemotherapy [3]. While surgical resection and radiotherapy demonstrate efficacy in localized PCa, advanced cases frequently develop recurrence and metastasis post-treatment [4]. Consequently, adjuvant chemotherapy with docetaxel (DTX), a taxane derivative, has become a cornerstone for advanced PCa management [5]. Regrettably, the emergence of DTX resistance in a significant proportion of patients often culminates in therapeutic failure and poor outcomes [6]. Therefore, elucidating the molecular mechanisms underlying DTX resistance is imperative for developing novel therapeutic targets to improve clinical prognosis.\u003c/p\u003e\u003cp\u003eLong non-coding RNAs (lncRNAs) have emerged as critical regulators of transcription, gene expression, and protein function [7]. Small nucleolar RNA host gene 12 (SNHG12), located at chromosome 1p35.3, has been implicated in mediating oncogenic processes including proliferation, metastasis, and invasion across various cancers [8]. Previous studies have identified SNHG12 overexpression in PCa, correlating with aggressive tumor behavior and unfavorable prognosis [9]. Functional studies demonstrate that SNHG12 knockdown suppresses PCa cell proliferation, migration, and invasion [10]. Notably, elevated SNHG12 expression has been mechanistically linked to paclitaxel resistance in non-small cell lung carcinoma [11]. However, the potential involvement of SNHG12 in DTX resistance in PCa remains unexplored.\u003c/p\u003e\u003cp\u003eThe RNA-binding protein ELAVL1, also known as human antigen R (HuR), typically binds to AU-rich elements (AREs) in the 3\u0026prime;-UTR of target genes to enhance RNA stability [12]. Numerous studies have found that ELAVL1 is upregulated in various cancers and promotes tumorigenesis and progression, including gastric cancer [13], hepatocellular carcinoma [14], and lung cancer [15]. In prostate cancer (PCa), ELAVL1 is also an important regulatory molecule for tumor development [16]. Moreover, high levels of ELAVL1 are associated with docetaxel (DTX) chemotherapy resistance in triple-negative breast cancer [17]. Notably, ELAVL1 can also regulate the malignant progression of non-small cell lung cancer by binding to SNHG12 [18]. However, it is currently unclear whether SNHG12 affects DTX resistance in PCa by binding to ELAVL1.\u003c/p\u003e\u003cp\u003eAdditionally, the phosphatidylinositol-3-kinase (PI3K)/protein kinase B (AKT) pathway, as an important intracellular signaling pathway, is also associated with the malignant progression of PCa [19]. Importantly, the persistent activation of the PI3K/AKT pathway is also a major cause of DTX resistance in PCa, and inhibiting PI3K/AKT activation can enhance DTX-induced apoptosis [20]. Moreover, the activation of PI3K/AKT is also regulated by ELAVL1 [21]. Therefore, we speculate that ELAVL1 may affect DTX resistance in PCa by regulating the PI3K/AKT signaling pathway. In summary, this study aims to explore the role of SNHG12 in DTX resistance in PCa and elucidate its underlying mechanisms, laying the foundation for the development of new intervention targets for DTX chemotherapy resistance in PCa.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Cell Culture, Establishment of Drug-Resistant Cell Lines, Infection and Treatment\u003c/h2\u003e\u003cp\u003eHuman prostate cancer PC-3 cells (BFN60700215) were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences. PC-3 cells were cultured in DMEM medium (11965092, Gibco, USA) supplemented with 10% fetal bovine serum (A5256701, Gibco, USA) and 1% penicillin-streptomycin double-antibody (C0222, Beyotime, China) according to the manufacturer\u0026rsquo;s instructions. To obtain DTX-resistant PC-3 cells (PC-3R), PC-3 cells were exposed to gradient DTX to induce drug resistance as previously described [22]. Briefly, PC-3 cells were treated with DTX at concentrations of 0.1, 0.2, 0.5, 1, 5, or 10 nM for 30 days. Cell status was continuously monitored during this period; if cells showed death or slow growth, the DTX treatment time was appropriately delayed. PC-3R cells were considered successfully established once they could stably grow in a 10 nM DTX environment. All cell cultures were performed under standard conditions of 37\u0026deg;C and 5% CO₂.\u003c/p\u003e\u003cp\u003eIn studies exploring the effects of SNHG12 and ELAVL1 on PCa DTX resistance, PC-3R cells with knocked-down SNHG12 or ELAVL1 were constructed using methods referenced from previous studies [23]. In brief, PC-3R cells were infected with lentiviruses for SNHG12 knockdown (sh-SNHG12), ELAVL1 knockdown (sh-ELAVL1), and knockdown control (sh-NC) (MOI\u0026thinsp;=\u0026thinsp;50, Genepharma, China). PC-3R cells with knocked-down SNHG12 or ELAVL1 were obtained 24 hours later, and transfection efficiency was detected by RT-qPCR and Western blot. Additionally, in studies investigating the PI3K/AKT signaling pathway in PCa DTX resistance, PC-3R cells were treated with the PI3K activator 740 Y-P (HY-P0175, MCE, USA) at a concentration of 50 \u0026micro;M for 24 hours to activate intracellular PI3K signaling.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Animal Experiments\u003c/h2\u003e\u003cp\u003eA mouse PCa tumor-bearing model was established as previously described [24]. First, 20 male nude mice (5\u0026ndash;6 weeks old, weighing 18\u0026ndash;20 g) were purchased from Hunan Slack Jingda Laboratory Animal Co., Ltd. After 1 week of adaptive feeding, the nude mice were randomly divided into 4 groups and treated according to the pre-designed experimental protocol:\u003c/p\u003e\u003cp\u003e\u003cul\u003e\u003cli\u003e\u003cp\u003e Model group: Nude mice were subcutaneously injected with 100 \u0026micro;L of PC-3R cell suspension (5\u0026times;10⁶ cells/mL) into the left dorsum.\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003e DTX group: Nude mice were injected with PC-3R cells (same dose as the Model group) into the left dorsum, and on day 3, 10 mg/kg DTX was intraperitoneally injected every 7 days for a total of 25 days.\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003e sh-SNHG12 group: Nude mice were subcutaneously injected with 100 \u0026micro;L of PC-3R cells with SNHG12 knockdown (5\u0026times;10⁶ cells/mL) into the left dorsum.\u003c/p\u003e\u003c/li\u003e\u003cli\u003e\u003cp\u003e- DTX\u0026thinsp;+\u0026thinsp;sh-SNHG12 group: Nude mice were injected with SNHG12-knockdown PC-3R cells, followed by DTX intervention as in the DTX group.\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003c/p\u003e\u003cp\u003eTumor volume was measured every 7 days after cell injection using the formula: 0.5 \u0026times; length \u0026times; width\u0026sup2;. All nude mice were euthanized 28 days after cell injection, and tumor tissues were isolated for subsequent analysis. All animal procedures were approved by the Animal Ethics Committee of our institution.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 CCK-8 Assay for Cell Proliferation\u003c/h2\u003e\u003cp\u003eAfter culturing PC-3 and PC-3R cells, 10 \u0026micro;L of CCK-8 reagent (CA1210, Sorlabio, China) was added to each well, and the plates were incubated at 37\u0026deg;C with 5% CO₂ for 2 hours. The absorbance at 450 nm was measured using a microplate reader.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4 Real-Time Quantitative PCR (RT-qPCR)\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted from PC-3 and PC-3R cells using TRIzol\u0026trade; reagent (15596026CN, Invitrogen, USA). First-strand cDNA was synthesized from RNA using the HiScript III First-Strand cDNA Synthesis Kit (R312-02, Vazyme, China), followed by real-time quantitative PCR with SYBR Green reagent (Q221-01, Vazyme, China). Results were calculated using the 2⁻ΔΔCt method, and primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eList of primer sequence information\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer sequence\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSNHG12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: ATGAAATGCAGGGGACCTGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR: TGTAACATGAATCTTAAAGCACAGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eβ-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: CATGTACGTTGCTATCCAGGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR: CTCCTTAATGTCACGCACGAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5 For the colony formation assay\u003c/h2\u003e\u003cp\u003e200 PC-3R cells were seeded in a 24-well plate and cultured under conventional conditions at 37℃ with 5% CO₂. During the culture, the medium was changed every 2 days. After 7 days, the culture medium was discarded, and the cells were washed twice with PBS buffer. Subsequently, the cells were fixed with 4% paraformaldehyde for 30 minutes and then stained with 0.2% crystal violet (Y268093-5g, Beyotime, China) for 15 minutes. The number of colonies formed was photographed and counted.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6 For the Transwell migration assay\u003c/h2\u003e\u003cp\u003eThe density of PC-3R cells was adjusted to 1\u0026times;10⁵ cells/mL using serum-free culture medium, and 200 \u0026micro;L of cell suspension was seeded in the Transwell chamber. The lower chamber of the 24-well plate was filled with 200 \u0026micro;L of DMEM culture medium supplemented with 10% fetal bovine serum. After 24 hours of culture, the cells were fixed with 4% paraformaldehyde for 20 minutes, and the non-migrated cells on the upper surface of the chamber were washed away with PBS. The cells were then stained with 1% crystal violet solution (Y268093-5g, Beyotime, China) and observed under an inverted microscope. Three fields of view were selected for counting and photographing.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7 For Western blot analysis\u003c/h2\u003e\u003cp\u003eThe total protein was extracted from PC-3, PC-3R cells, and xenografted tumor tissues in nude mice using RIPA buffer containing 1% protease inhibitor and phosphatase inhibitor (20\u0026ndash;188, Sigma-Aldrich, USA). The protein concentration was quantified using a BCA protein concentration determination kit (P0010, Beyotime, China). Subsequently, equal amounts of protein were separated by SDS-PAGE and transferred onto a PVDF membrane (IPFL00010, Sigma-Aldrich, USA). The membrane was incubated overnight at 4℃ with diluted primary antibodies: ELAVL1 (1:1000, ab200342, abcam, UK), PI3K (1:1000, PA5-29220, Invitrogen, USA), p-PI3K (1:1000, PA5-104853, Invitrogen, USA), AKT (1:1000, PA5-29169, Invitrogen, USA), p-AKT (1:1000, 44-602G, Invitrogen, USA), β-actin (1:1000, ab18226, abcam, UK). The membrane was then treated with corresponding secondary antibodies at room temperature for 1 hour and visualized using an enhanced chemiluminescence kit (WBULP, Millipore, USA). The protein bands were semi-quantitatively analyzed using ImageJ software.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8 Immunofluorescence\u003c/h2\u003e\u003cp\u003eAfter culturing PC-3 and PC-3R cells, cells were fixed with 4% paraformaldehyde at room temperature for 30 min and permeabilized with 0.1% Triton X-100 for 10 min. Cells were then incubated overnight at 4\u0026deg;C with ELAVL1 primary antibody (1:200, ab200342, abcam, UK). After washing, corresponding fluorescent secondary antibodies were applied at room temperature for 2 h. Following nuclear staining with DAPI (C0065, Solarbio, China) for 15 min, slides were imaged under a fluorescence microscope, and relative fluorescence intensity was quantified to characterize protein expression levels.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9 RNA Immunoprecipitation (RIP) Assay\u003c/h2\u003e\u003cp\u003eThe BeyoRIP\u0026trade; RIP Kit (P1801S, Beyotime, China) was used for the assay. Briefly, ELAVL1 antibody (1:50, ab200342, abcam, UK) was coupled to A/G magnetic beads, followed by overnight incubation with PC-3 cell lysates at 4\u0026deg;C. After precipitation and washing, RNA was extracted and subjected to RT-qPCR.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.10 Immunohistochemistry\u003c/h2\u003e\u003cp\u003eTumor tissues from nude mice were embedded in paraffin, and 5-\u0026micro;m sections were cut from tissue blocks. Sections were dewaxed and hydrated with sodium citrate buffer, then incubated overnight at 4\u0026deg;C with Ki67 primary antibody (1:100, ab15580, abcam, UK). After washing, sections were incubated with corresponding secondary antibodies at room temperature for 2 h, followed by nuclear staining with DAPI (C0065, Solarbio, China) for 10 min. Images were captured under a fluorescence microscope.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e2.11 Statistical Analysis\u003c/h2\u003e\u003cp\u003eAll data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD). Statistical analysis was performed using GraphPad Prism 8.1 software (GraphPad Software Inc, San Diego, CA, USA). Student\u0026rsquo;s t-test was used for comparisons between two groups, while one-way analysis of variance (ANOVA) followed by Tukey\u0026rsquo;s post-hoc test was used for multiple-group comparisons. A p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\"\u003e\n \u003ch2\u003e3.1 Establishment of docetaxel-resistant cells and SNHG12 expression profiling\u003c/h2\u003e\n \u003cp\u003eIn this study, we successfully generated DTX-resistant PC-3 cells (PC-3R) through progressive DTX exposure. To validate the resistance phenotype, both parental PC-3 and PC-3R cells were treated with DTX at gradient concentrations (0, 2.5, 5, 10, 20, 40, and 80 nM). CCK-8 assays revealed that the IC50 values were 4.237 nM for PC-3 cells versus 70.09 nM for PC-3R cells (Fig.\u0026nbsp;1A), demonstrating a 16.54-fold increase in drug resistance (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Subsequent RT-qPCR analysis showed significantly elevated SNHG12 expression levels in PC-3R cells compared to parental PC-3 cells (Fig.\u0026nbsp;1B, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). These findings suggest a potential association between SNHG12 upregulation and DTX resistance development in PCa.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\"\u003e\n \u003ch2\u003e3.2 Knockdown of SNHG12 Inhibits Docetaxel Resistance in Prostate Cancer Cells\u003c/h2\u003e\n \u003cp\u003eNext, to investigate the role of SNHG12 in PCa DTX resistance, we knocked down SNHG12 in PC-3R cells. RT-qPCR results showed that SNHG12 expression in the sh-SNHG12 group was significantly lower than that in the sh-NC group (Fig.\u0026nbsp;2A), indicating successful construction of PC-3R cells with SNHG12 knockdown. Additionally, we found that 10 nM DTX had no significant effect on the proliferative viability of PC-3R cells, while knocking down SNHG12 significantly suppressed PC-3R cell proliferation. Compared with the DTX group, knocking down SNHG12 further reduced the proliferative viability of PC-3R cells (Fig.\u0026nbsp;2B). Colony formation assay results showed that treatment with 10 nM DTX did not significantly alter the colony-forming ability of PC-3R cells, whereas SNHG12 knockdown significantly inhibited this ability. Knocking down SNHG12 in DTX-treated cells further decreased colony-forming ability (Fig.\u0026nbsp;2C). Moreover, knocking down SNHG12 in 10 nM DTX-treated PC-3R cells also reduced cell migration capacity (Fig.\u0026nbsp;2D). Collectively, these results indicate that SNHG12 knockdown enhances the sensitivity of PCa to DTX.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\"\u003e\n \u003ch2\u003e3.3 Knockdown of SNHG12 Inhibits Docetaxel Resistance in Prostate Cancer Cells via the PI3K/AKT Signaling Pathway\u003c/h2\u003e\n \u003cp\u003ePrevious studies have shown that persistent activation of the PI3K/AKT pathway can lead to docetaxel (DTX) resistance in PCa [20]. Therefore, we detected the expression of the PI3K/AKT pathway at the cellular level. Western blot results showed that the expressions of p-PI3K/PI3K and p-AKT/AKT in PC-3R cells were significantly higher than those in PC-3 cells (Fig. 3A). Additionally, previous studies have indicated that the activation of the PI3K/AKT signaling pathway is also regulated by SNHG12 [25]. Thus, we investigated whether SNHG12 affects PCa DTX resistance by regulating the PI3K/AKT signaling pathway. We found that treatment with the PI3K activator 740 Y-P weakened the positive effects of the combined intervention of DTX and SNHG12 knockdown, partially upregulating the proliferative viability (Fig. 3B), colony-forming ability (Fig. 3C), and migration ability (Fig. 3D) of PC-3R cells. These results suggest that knocking down SNHG12 inhibits DTX resistance in PCa cells by suppressing the activation of the PI3K/AKT signaling pathway.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\"\u003e\n \u003ch2\u003e3.4 SNHG12 interacts with ELAVL1 to activate the PI3K/AKT signaling pathway.\u003c/h2\u003e\n \u003cp\u003ePrevious studies have shown that ELAVL1 is an important regulatory molecule in the development of PCa tumors [16], and ELAVL1 can interact with SNHG12 to exert oncogenic effects [18]. Therefore, we explored whether SNHG12 can bind to ELAVL1 in PCa. First, the expression of ELAVL1 was detected by immunofluorescence, and it was found that the expression level of ELAVL1 in PC-3R cells was significantly higher than that in PC-3 cells (Fig. 4A). Second, the RIP-qPCR results showed that ELAVL1 binds to SNHG12 (Fig. 4B). In addition, previous studies have indicated that ELAVL1 is also involved in the activation of the PI3K/AKT pathway [21]. Therefore, to explore whether SNHG12 regulates the activation of the PI3K/AKT signaling pathway by binding to ELAVL1, we knocked down the expression of ELAVL1 in PC-3R cells. The Western blot results showed that the expression of ELAVL1 in the sh-ELAVL1 group was significantly lower than that in the sh-NC group (Fig. 4C), indicating that the PC-3R cells with knocked-down ELAVL1 were successfully constructed. Moreover, we found that the expression of p-PI3K/PI3K and p-AKT/AKT in PC-3R cells was significantly downregulated after knocking down SNHG12 or ELAVL1 (Fig. 4D). The above results indicate that SNHG12 promotes the activation of the PI3K/AKT signaling pathway in PC-3R cells by binding to ELAVL1.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\"\u003e\n \u003ch2\u003e3.5 Knockdown of SNHG12 Inhibits Docetaxel Resistance in Prostate Cancer\u003c/h2\u003e\n \u003cp\u003eFinally, we explored the role of SNHG12 in PCa DTX resistance in a nude mouse model. First, we found that both DTX treatment alone and SNHG12 knockdown alone could significantly inhibit the growth of tumor-bearing tissues, and further knockdown of SNHG12 on the basis of DTX treatment could further inhibit the growth of tumor-bearing tissues (Fig. 5A-C). Immunohistochemical results showed that DTX treatment or SNHG12 knockdown significantly inhibited the expression of Ki67 in tumor-bearing tissues; compared with the DTX group, the expression of Ki67 was further downregulated after SNHG12 knockdown (Fig. 5D). In addition, DTX treatment or SNHG12 knockdown also downregulated the expression of p-PI3K/PI3K and p-AKT/AKT in tumor-bearing tissues, and additional knockdown of SNHG12 under DTX exposure could further downregulate the expression of p-PI3K/PI3K and p-AKT/AKT (Fig. 5E). Collectively, the above results indicate that SNHG12 knockdown can inhibit PCa DTX resistance.。\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion and Conclusion","content":"\u003cp\u003eProstate cancer (PCa) is a common malignant tumor in men worldwide and severely threatens the life safety of male populations [1]. Currently, docetaxel (DTX) - based adjuvant chemotherapy has been a standard clinical treatment for patients with advanced PCa. However, the acquired resistance to DTX often leads to poor outcomes [6]. In this study, we revealed the key mechanism by which SNHG12 activates the PI3K/AKT signaling pathway through binding with ELAVL1, resulting in DTX resistance in PCa, and emphasized the great potential of SNHG12 for improving DTX resistance in PCa. Increasing evidence indicates that SNHG12 plays a crucial role in the malignant progression of tumors. For example, the study by Sun et al. [26] showed that high - level SNHG12 is associated with poor prognosis in ovarian cancer, and its inhibition can suppress the proliferation and migration of cancer cells. In the study by Wang et al. [27], high - level SNHG12 promoted the proliferation of colorectal cancer cells and inhibited apoptosis. In PCa, SNHG12 is also closely related to poor prognosis and the malignant proliferation and metastasis of cancer cells [9]. Moreover, previous studies have confirmed that high - level SNHG12 is an important cause of paclitaxel resistance in non - small - cell lung cancer [11]. Similar to previous findings, we observed upregulated expression of SNHG12 in PC-3R cells. Additionally, DTX treatment alone had no significant effect on the proliferation and migration of PC-3R cells. Knockdown of SNHG12 significantly inhibited PC-3R cell proliferation and migration, and further suppression of proliferation and migration was observed when SNHG12 knockdown was combined with DTX intervention. Notably, DTX significantly suppressed the growth of tumor xenografts in nude mice, and this inhibitory effect was further enhanced by SNHG12 knockdown. These results indicate heterogeneous effects of DTX on PC-3R growth in vitro and in vivo. We speculate that this may be attributed to the complex in vivo environment and differences in DTX exposure time, which alter the sensitivity of PC-3R cells to DTX. Our study demonstrates that high expression of SNHG12 contributes to docetaxel resistance in prostate cancer (PCa).\u003c/p\u003e\u003cp\u003ePrevious studies have shown that the PI3K/AKT pathway, as a critical intracellular signaling pathway, not only mediates processes such as cancer cell proliferation, autophagy, and apoptosis but also regulates tumor chemoresistance [28]. Li et al. [29] demonstrated that sustained activation of the PI3K/AKT signaling pathway induces cisplatin resistance in osteosarcoma cells. Okuno et al. [30] reported that inhibiting PI3K/AKT signaling overcomes gemcitabine resistance in pancreatic ductal adenocarcinoma. Additionally, Chappell et al. [31] found that activation of the PI3K/AKT pathway is a key inducer of DTX and doxorubicin resistance in PCa. Consistent with these findings, we observed significantly upregulated expression of p-PI3K/PI3K and p-AKT/AKT in PC-3R cells. Importantly, Li [25] showed that PI3K/AKT signaling activation is regulated by SNHG12. Therefore, we investigated whether SNHG12 influences PCa DTX resistance via the PI3K/AKT pathway. We found that supplementing PC-3R cells with the PI3K activator 740 Y-P partially attenuated the synergistic inhibitory effects of DTX and SNHG12 knockdown, leading to increased cell proliferation, colony-forming ability, and migration. Although previous studies have confirmed that inhibiting PI3K/AKT activation improves PCa DTX resistance [20], our study highlights that SNHG12 knockdown weakens PCa DTX resistance by suppressing PI3K/AKT pathway activation.\u003c/p\u003e\u003cp\u003ePrevious studies have also shown that SNHG12 regulates downstream gene expression by binding to ELAVL1 [18]. Notably, ELAVL1 has been validated as an oncogene promoting tumor malignancy in PCa [16]. Cai et al. [32] reported that high ELAVL1 expression is a key factor in poor immunotherapy outcomes for PCa. Wei et al. [33] found that high ELAVL1 levels inhibit PCa cell apoptosis, while its knockdown induces cancer cell apoptosis and ferroptosis. Consistent with these findings, we observed upregulated ELAVL1 expression in PC-3R cells. Additionally, in triple-negative breast cancer, ELAVL1 is associated with DTX resistance, and its inhibition enhances DTX-induced apoptosis [17]. Therefore, we investigated whether an SNHG12/ELAVL1 signaling axis regulates PI3K/AKT pathway activation to influence DTX sensitivity in PCa. RIP-qPCR assays confirmed that SNHG12 binds to ELAVL1. Notably, knocking down SNHG12 or ELAVL1 in PC-3R cells suppressed the expression of p-PI3K/PI3K and p-AKT/AKT. Our study demonstrates that SNHG12 activates the PI3K/AKT signaling pathway by binding to ELAVL1, thereby inducing PCa DTX resistance.\u003c/p\u003e\u003cp\u003eIn summary, our study reveals for the first time that SNHG12 promotes the activation of PI3K / AKT signaling pathway by binding to ELAVL1, which in turn leads to the key mechanism of DTX resistance in PCa. The above findings provide insights into the role of SNHG12 as a potential intervention target in PCa DTX sensitization therapy. However, our research also has shortcomings. First, the reason for the difference in sensitivity of PCa DTX-resistant cells to DTX in vivo and in vitro has not been elucidated. Secondly, further preclinical data are needed to support the clinical application of the above findings. Follow-up research will focus on solving the above problems.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eAll authors reviewed the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003cp\u003e\u003col\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eBRAY F, LAVERSANNE M, SUNG H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries [J]. CA Cancer J Clin, 2024, 74(3): 229\u0026thinsp;\u0026minus;\u0026thinsp;63.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eCHEN H, PANG B, ZHOU C, et al. Prostate cancer-derived small extracellular vesicle proteins: the hope in diagnosis, prognosis, and therapeutics [J]. J Nanobiotechnology, 2023, 21(1): 480.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eGRAHAM L S, LIN J K, LAGE D E, et al. Management of Prostate Cancer in Older Adults [J]. Am Soc Clin Oncol Educ Book, 2023, 43: e390396.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eGOURDIN T. Highlights of recent research focused on the treatment of advanced prostate cancer [J]. Curr Opin Oncol, 2025, 37(3): 218\u0026thinsp;\u0026minus;\u0026thinsp;22.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eLU J, ZOU Q, LI Y, et al. FTH1P8 induces and transmits docetaxel resistance by inhibiting ferroptosis in prostate cancer [J]. Biomed Pharmacother, 2024, 180: 117472.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eHASHEMI M, ZANDIEH M A, TALEBI Y, et al. Paclitaxel and docetaxel resistance in prostate cancer: Molecular mechanisms and possible therapeutic strategies [J]. Biomed Pharmacother, 2023, 160: 114392.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eZHANG Y. LncRNA-encoded peptides in cancer [J]. J Hematol Oncol, 2024, 17(1): 66.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eTAMANG S, ACHARYA V, ROY D, et al. SNHG12: An LncRNA as a Potential Therapeutic Target and Biomarker for Human Cancer [J]. Front Oncol, 2019, 9: 901.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eCHENG G, SONG Z, LIU Y, et al. Long noncoding RNA SNHG12 indicates the prognosis of prostate cancer and accelerates tumorigenesis via sponging miR-133b [J]. J Cell Physiol, 2020, 235(2): 1235-46.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eSONG J, WU X, MA R, et al. Long noncoding RNA SNHG12 promotes cell proliferation and activates Wnt/β-catenin signaling in prostate cancer through sponging microRNA-195 [J]. J Cell Biochem, 2019, 120(8): 13066-75.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eWANG P, CHEN D, MA H, et al. LncRNA SNHG12 contributes to multidrug resistance through activating the MAPK/Slug pathway by sponging miR-181a in non-small cell lung cancer [J]. Oncotarget, 2017, 8(48): 84086-101.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eLEBEDEVA S, JENS M, THEIL K, et al. Transcriptome-wide analysis of regulatory interactions of the RNA-binding protein HuR [J]. Mol Cell, 2011, 43(3): 340\u0026thinsp;\u0026minus;\u0026thinsp;52.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eMA S, XU Y, QIN X, et al. RUNX1, FUS, and ELAVL1-induced circPTPN22 promote gastric cancer cell proliferation, migration, and invasion through miR-6788-5p/PAK1 axis-mediated autophagy [J]. Cell Mol Biol Lett, 2024, 29(1): 95.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eKANZAKI H, CHIBA T, KANEKO T, et al. The RNA-Binding Protein ELAVL1 Regulates Hepatitis B Virus Replication and Growth of Hepatocellular Carcinoma Cells [J]. Int J Mol Sci, 2022, 23(14).\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eMAO G, MU Z, WU D A. Exosomal lncRNA FOXD3-AS1 upregulates ELAVL1 expression and activates PI3K/Akt pathway to enhance lung cancer cell proliferation, invasion, and 5-fluorouracil resistance [J]. Acta Biochim Biophys Sin (Shanghai), 2021, 53(11): 1484-94.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eCAI Z, XU H, BAI G, et al. ELAVL1 promotes prostate cancer progression by interacting with other m6A regulators [J]. Front Oncol, 2022, 12: 939784.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eWEI L, ZHANG Q, ZHONG C, et al. Functional inhibition of the RNA-binding protein HuR sensitizes triple-negative breast cancer to chemotherapy [J]. Mol Oncol, 2023, 17(10): 1962-80.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eHUANG Y, XIA L, TAN X, et al. Molecular mechanism of lncRNA SNHG12 in immune escape of non-small cell lung cancer through the HuR/PD-L1/USP8 axis [J]. Cell Mol Biol Lett, 2022, 27(1): 43.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eLI M, CHE N, LIU X, et al. Dauricine regulates prostate cancer progression by inhibiting PI3K/AKT-dependent M2 polarization of macrophages [J]. Biochem Pharmacol, 2023, 217: 115838.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eEBERLEIN C, WILLIAMSON S C, HOPCROFT L, et al. Capivasertib combines with docetaxel to enhance anti-tumour activity through inhibition of AKT-mediated survival mechanisms in prostate cancer [J]. Br J Cancer, 2024, 130(8): 1377-87.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eMAO G, MU Z, WU D A. Exosomal lncRNA FOXD3-AS1 upregulates ELAVL1 expression and activates PI3K/Akt pathway to enhance lung cancer cell proliferation, invasion, and 5-fluorouracil resistance [J]. Acta Biochimica et Biophysica Sinica, 2021, 53(11): 1484-94.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eLU X, YANG F, CHEN D, et al. Quercetin reverses docetaxel resistance in prostate cancer via androgen receptor and PI3K/Akt signaling pathways [J]. Int J Biol Sci, 2020, 16(7): 1121-34.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eBRADY S N, MAGGI L B, JR., WINKELER C L, et al. Nucleophosmin protein expression level, but not threonine 198 phosphorylation, is essential in growth and proliferation [J]. Oncogene, 2009, 28(36): 3209-20.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eSHI Q, ZHU Y, MA J, et al. Prostate Cancer-associated SPOP mutations enhance cancer cell survival and docetaxel resistance by upregulating Caprin1-dependent stress granule assembly [J]. Mol Cancer, 2019, 18(1): 170.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eLI Y, GUO S, LIU W, et al. Silencing of SNHG12 Enhanced the Effectiveness of MSCs in Alleviating Ischemia/Reperfusion Injuries via the PI3K/AKT/mTOR Signaling Pathway [J]. Front Neurosci, 2019, 13: 645.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eSUN D, FAN X H. LncRNA SNHG12 accelerates the progression of ovarian cancer via absorbing miRNA-129 to upregulate SOX4 [J]. Eur Rev Med Pharmacol Sci, 2019, 23(6): 2345-52.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eWANG J Z, XU C L, WU H, et al. LncRNA SNHG12 promotes cell growth and inhibits cell apoptosis in colorectal cancer cells [J]. Braz J Med Biol Res, 2017, 50(3): e6079.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003ePENG Y, WANG Y, ZHOU C, et al. PI3K/Akt/mTOR Pathway and Its Role in Cancer Therapeutics: Are We Making Headway? [J]. Front Oncol, 2022, 12: 819128.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eLI H, SHEN X, MA M, et al. ZIP10 drives osteosarcoma proliferation and chemoresistance through ITGA10-mediated activation of the PI3K/AKT pathway [J]. J Exp Clin Cancer Res, 2021, 40(1): 340.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eOKUNO K, XU C, PASCUAL-SABATER S, et al. Berberine Overcomes Gemcitabine-Associated Chemoresistance through Regulation of Rap1/PI3K-Akt Signaling in Pancreatic Ductal Adenocarcinoma [J]. Pharmaceuticals (Basel), 2022, 15(10).\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eCHAPPELL W H, CANDIDO S, ABRAMS S L, et al. Influences of TP53 and the anti-aging DDR1 receptor in controlling Raf/MEK/ERK and PI3K/Akt expression and chemotherapeutic drug sensitivity in prostate cancer cell lines [J]. Aging (Albany NY), 2020, 12(11): 10194-210.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eCAI Z, ZHAI X, XU J, et al. ELAVL1 regulates PD-L1 mRNA stability to disrupt the infiltration of CD4-positive T cells in prostate cancer [J]. Neoplasia, 2024, 57: 101049.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eWEI L, KIM S H, ARMALY A M, et al. RNA-binding protein HuR inhibition induces multiple programmed cell death in breast and prostate cancer [J]. Cell Commun Signal, 2024, 22(1): 580.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003c/ol\u003e\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"prostate cancer, drug resistance, docetaxel, lncRNA SNHG12, ELAVL1, PI3K/AKT signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-7319081/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7319081/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e\u003cp\u003eProstate cancer (PCa) is the second most common cancer type in men worldwide, and docetaxel (DTX) resistance is one of the primary factors contributing to poor prognosis. Long non-coding RNAs (lncRNAs) have been reported to play a critical role in PCa DTX resistance, but the role of lncRNA SNHG12 in PCa DTX resistance remains unclear. Therefore, this study aimed to investigate the effect of SNHG12 on PCa DTX resistance and decipher its underlying mechanism.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003ePC-3 cells were treated with gradient DTX to generate DTX-resistant PC-3 cells (PC-3R), and a PCa tumor-bearing model was established by injecting PC-3R cells into the left dorsum of nude mice. The expression of key genes and proteins was detected by RT-qPCR, Western blot, immunofluorescence, and immunohistochemistry. Cell proliferation and migration were evaluated using CCK-8 assays, colony formation assays, and Transwell migration assays. RNA-protein binding was detected by RIP-qPCR.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eSNHG12 was upregulated in PC-3R cells. Knockdown of SNHG12 inhibited the proliferation and migration of PC-3R cells, as well as tumor growth in nude mice. Treatment with 10 nM DTX alone had no significant effect on PC-3R cell proliferation or migration, but knocking down SNHG12 in combination with DTX treatment significantly suppressed PC-3R cell proliferation, migration, and tumor growth. Additionally, ELAVL1 expression was upregulated in PC-3R cells, and the activation level of the PI3K/AKT signaling pathway was increased in both PC-3R cells and tumor tissues. Treatment with the PI3K activator 740 Y-P attenuated the inhibitory effect of SNHG12 knockdown. Importantly, SNHG12 in PC-3R cells was found to bind to ELAVL1. Mechanistic studies revealed that SNHG12 activated the PI3K/AKT signaling pathway by binding to ELAVL1, thereby inducing PCa DTX resistance.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003eOur findings demonstrate that SNHG12 knockdown plays a pivotal role in suppressing DTX resistance in PCa, and unravel its underlying molecular mechanism, thereby providing a potential therapeutic target for developing DTX-sensitizing strategies in PCa treatment.\u003c/p\u003e","manuscriptTitle":"The mechanism of lncRNA SNHG12 interacting with ELAVL1 to activate PI3K / AKT signaling pathway to promote docetaxel resistance in prostate cancer cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-18 10:55:42","doi":"10.21203/rs.3.rs-7319081/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3131f03d-5474-4697-8529-8a07dd350e15","owner":[],"postedDate":"August 18th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-08-20T21:08:26+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-18 10:55:42","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7319081","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7319081","identity":"rs-7319081","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00