Investigation of the significance and role of androgen receptor expression in basal/squamous type urothelial carcinoma cell line J82 cells

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Urothelial carcinoma is a prevalent malignancy that exhibits a distinct sex disparity, with a higher incidence in males. Among the various molecular subtypes, the basal/squamous subtype is associated with poor prognosis and therapeutic resistance. Androgen receptor (AR) signaling has been implicated in the pathogenesis of urothelial carcinoma; however, its precise role remains unclear, particularly in basal/squamous-type urothelial carcinoma. The present study sought to ascertain the functional role of AR in Ba/Sq-type UC by employing J82 cells, a prominent cell line representing this subtype. J82 cells stably expressing the AR (J82-FLAG-AR) were established via retroviral transduction. Gene and protein expression analyses were conducted using quantitative real-time polymerase chain reaction (qRT-PCR) and western blotting, respectively, following dihydrotestosterone (DHT) treatment. A series of experiments were conducted to investigate the interaction between the androgen receptor (AR) and enhancer of zeste homolog 2 (EZH2), as well as their impact on cell proliferation and p21 expression. The results indicated that AR expression in J82 cells led to a decrease in the expression of epithelial markers (CLDN1, CLDN4) and an increase in the expression of the luminal marker GATA3 and cyclin-dependent kinase inhibitor p21. DHT treatment suppressed the proliferation of J82-FLAG-AR cells, accompanied by the upregulation of p21. Co-immunoprecipitation demonstrated the interaction of AR with EZH2, and combined treatment with DHT and the EZH2 inhibitor GSK126 further elevated p21 expression. However, this combination did not enhance the antiproliferative effect beyond that of DHT alone. AR expression in basal/squamous-type urothelial carcinoma cells promotes p21-mediated growth inhibition while simultaneously reducing epithelial markers, suggesting a dual role in suppressing proliferation and potentially promoting epithelial-mesenchymal transition. These findings contribute to our understanding of AR's complex role of AR in UC, and provide insights into potential therapeutic strategies targeting AR.
Full text 74,581 characters · extracted from preprint-html · click to expand
Investigation of the significance and role of androgen receptor expression in basal/squamous type urothelial carcinoma cell line J82 cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Investigation of the significance and role of androgen receptor expression in basal/squamous type urothelial carcinoma cell line J82 cells Ryotaro Sakai, Hiroki Shimada, Shuko Hata, Atsushi Yokoyama, Yasuhiro Nakamura This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7001562/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Urothelial carcinoma is a prevalent malignancy that exhibits a distinct sex disparity, with a higher incidence in males. Among the various molecular subtypes, the basal/squamous subtype is associated with poor prognosis and therapeutic resistance. Androgen receptor (AR) signaling has been implicated in the pathogenesis of urothelial carcinoma; however, its precise role remains unclear, particularly in basal/squamous-type urothelial carcinoma. The present study sought to ascertain the functional role of AR in Ba/Sq-type UC by employing J82 cells, a prominent cell line representing this subtype. J82 cells stably expressing the AR (J82-FLAG-AR) were established via retroviral transduction. Gene and protein expression analyses were conducted using quantitative real-time polymerase chain reaction (qRT-PCR) and western blotting, respectively, following dihydrotestosterone (DHT) treatment. A series of experiments were conducted to investigate the interaction between the androgen receptor (AR) and enhancer of zeste homolog 2 (EZH2), as well as their impact on cell proliferation and p21 expression. The results indicated that AR expression in J82 cells led to a decrease in the expression of epithelial markers (CLDN1, CLDN4) and an increase in the expression of the luminal marker GATA3 and cyclin-dependent kinase inhibitor p21. DHT treatment suppressed the proliferation of J82-FLAG-AR cells, accompanied by the upregulation of p21. Co-immunoprecipitation demonstrated the interaction of AR with EZH2, and combined treatment with DHT and the EZH2 inhibitor GSK126 further elevated p21 expression. However, this combination did not enhance the antiproliferative effect beyond that of DHT alone. AR expression in basal/squamous-type urothelial carcinoma cells promotes p21-mediated growth inhibition while simultaneously reducing epithelial markers, suggesting a dual role in suppressing proliferation and potentially promoting epithelial-mesenchymal transition. These findings contribute to our understanding of AR's complex role of AR in UC, and provide insights into potential therapeutic strategies targeting AR. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction The incidence of urothelial carcinoma, the seventh most prevalent form of cancer worldwide, has increased. This carcinoma is also known to be four times more prevalent in men than in women[ 1 ]; however, the reasons for this disparity remain largely unknown[ 2 , 3 ]. In particular, molecular subtyping of urothelial carcinoma by transcriptome analysis has been used for diagnosis and therapeutic options. Urothelial carcinoma is characterized by the presence of several molecular subtypes, including the luminal, stroma-rich, basal/squamous, and neuroendocrine subtypes[ 4 ]. The basal/squamous type in the pathologic classification is known to have a poor prognosis and is difficult to treat[ 5 , 6 ]. The progression of urothelial carcinoma has been suggested to be related to sex hormones. Androgens and estrogen have been implicated in the growth and progression of urothelial carcinoma via androgen and estrogen receptors, respectively[ 7 , 8 ]. The androgen receptor (AR) is a prime transcription factor involved in the development and progression of prostate cancer[ 9 – 12 ]. Activation of AR via its cognate ligand, androgen, leads to its translocation to the nucleus and, as a chromatin-binding nuclear receptor (NR), binding to DNA elements known as AR response elements[ 13 , 14 ]. AR has been implicated in cancer progression in urothelial cancer and is considered a predictor of patient prognosis and a therapeutic target[ 15 , 16 ]. However, AR expression is often reported to be negative in high-grade urothelial carcinoma[ 17 ], and many aspects of the relationship between AR and tumor growth or progression in urothelial carcinoma remain unclear. Therefore, in this study, we investigated the significance and function of AR expression in basal/squamous-type urothelial carcinoma using J82 cells, a basal/squamous-type urothelial carcinoma cell line[ 18 ]. 2. Materials and Methods 2.1. Cell culture and Transfection Human urothelial carcinoma cell lines used in this study were the J82 (RRID:CVCL_0359) respectively (American Type Cell Culture Collection (Manassas, VA, USA). All the cells were grown at 37°C in a humidified 5% CO 2 incubator in phenol red-free RPMI-1640 medium (Nacalai Tesque, Kyoto, Japan) containing 10% fetal bovine serum (FBS; Nichirei Bioscience, Japan) and 1% penicillin-streptomycin. To establish AR cDNA-expressing J82 cells, cells were infected with a retrovirus carrying an AR cDNA-expressing cassette and then selected with RPMI 1640 medium containing 2 µg/mL puromycin. Lipofectamine 2000 (Invitrogen) was used for transfection according to the manufacturer’s instructions. AR cDNA-expressing retroviruses were generated using PLAT-A (RRID:CVCL_B489) cells. PLAT-A cells were kindly provided by Dr. Toshio Kitamura (University of Tokyo). For dihydrotestosterone (DHT) treatment, the culture medium was replaced with phenol red-free RPMI-1640 medium containing 5% charcoal-stripped FBS. The cells were maintained for approximately 24 h in medium and subsequently exposed to DHT (100 and 1000 nM) or vehicle (ethanol) for the indicated time. 2.2. Plasmid for AR cDNA expression Full-length human AR complementary DNA (cDNA) were amplified by polymerase chain reaction (PCR) from an LNCaP cell cDNA library and cloned in-frame into the pQCXIP-FLAG vector. 2.3. Quantitative RT-PCR After incubating J82 cells treated with DHT, GSK126, ethanol, or DMSO, total RNA was extracted using the RNeasy Mini kit (Qiagen, Hilden, Germany). cDNA was synthesized using the ReverTra Ace qPCR RT Master Mix (Toyobo, Osaka, Japan). Quantitative RT-PCR was carried out using Quant Studio3 (Applied Biosystems, USA) and THUNDERBIRD Next SYBR qPCR Mix (Toyobo). The primer sequences used in this study were as follows: ribosomal protein L13a (RPL13A) forward 5’- CCTGGAGGAGAAGAGGAAAG − 3’ and reverse 5’- TTGAGGACCTCTGTGTATTT − 3’[ 19 ],Claudin1 (CLDN1) forward 5- CGATGAGGTGCAGAAGATGA − 3’ and reverse 5’- CCAGTGAAGAGAGCCTGACC − 3’, Claudin4 (CLDN4) forward 5’- CTGGAGACTGATCCCCTCTG − 3’ and reverse 5’- ACCCTCCCAGGCTCATTAGT − 3’, GATA3 forward 5- CTCATTAAGCCCAAGCGAAG − 3’ and reverse 5’- GTCTGACAGTTCGCACAGGA − 3’, p21 forward 5’- CTTTCTAGGAGGGAGACAC − 3’ and reverse 5’- GTTCCGCTGCTAATCAAAG − 3, p16 forward 5’- GCACCGAATAGTTACGGTCGG − 3’ and reverse 5’- CACCAGCGTGTCCAGGAAGC − 3’. cDNA of known concentrations of target genes and the housekeeping gene RPL13A were used to generate standard curves for real-time quantitative PCR to determine the quantity of target cDNA transcripts. The mRNA levels in each case are represented as the ratio of RPL13A. 2.4. Immunoprecipitation and Western blotting The protein content of J82 cells was extracted using RIPA buffer (Nacalai Tesque, Kyoto, Japan) with a Protease Inhibitor Cocktail (Nacalai Tesque, Kyoto, Japan), and protein concentration was determined using a Protein Assay BCA Kit (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan). Lysates of J82 cells transfected with FLAG-AR were prepared in TNE buffer (20-mM Tris-HCl pH 7.9, 150-mM NaCl, 2-mM EDTA, 1% NP-40, and protease inhibitor). The extracts were incubated with FLAG M2 beads (Sigma-Aldrich) at 4°C. The immunoprecipitants were washed and boiled with Laemmli sample buffer. Proteins were resolved by SDS-PAGE (10% acrylamide gel) and transferred onto polyvinylidene fluoride (PVDF) membranes. After blocking with Bullet-blocking One (Nacalai Tesque, Kyoto, Japan) for 5 min at room temperature, the membranes were incubated overnight at 4°C with primary antibody. The dilutions of primary antibodies used in this study were as follows: FLAG (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan), 1:10000; GAPDH (Proteintech, Tokyo, Japan), 1:20000; p21 (Proteintech, Tokyo, Japan), 1:10000; EZH2 (Proteintech, Tokyo, Japan), 1:10000. The membranes were washed and incubated for 1 h with horseradish peroxidase-conjugated goat anti-mouse or rabbit IgG (GE Healthcare, Buckinghamshire, UK) at room temperature. Immunoreactivity was visualized using chemiluminescence (Immobilon Forte Western HRP Substrate, Millipore, USA). 2.5. Cell proliferation assays For the cell proliferation assay, J82 cells were treated with dihydrotestosterone (DHT) and GSK126 in a 96-well plate. For the DHT and GSK126 treatments, we incubated the cells in RPMI-1640 medium supplemented with dextran-coated charcoal-stripped fetal bovine serum (FBS) and 1% penicillin-streptomycin for 48 h. Cell proliferation was evaluated using a WST-8 colorimetric assay (cell counting kit-8; Dojindo, Kumamoto, Japan). 2.6. Statistical analysis Statistical analysis was performed using JMP Pro 18.0.0 software (SAS Institute, Inc., Cary, NC, USA). Data obtained from the proliferation assay and quantitative RT-PCR study were analyzed using Tukey’s post-hoc test. Statistical significance was set at P < 0.05. 3. Results 3.1. The establishment of AR-expressing J82 urothelial carcinoma cell lines. First, we established AR-expressing J82 (J82-FLAG-AR) cells to investigate the role of AR in basal/squamous-type urothelial carcinoma. We generated J82-FLAG-AR cells using retroviral vector, at the same time, we also generated control J82-FLAG cells using empty vector. We then confirmed AR protein expression in J82-FLAG-AR cells by western blotting (Fig. 1 ). 3.2. The expression of several cell-type markers in J82-FLAG-AR cells. The results of several cell type marker gene expression analyses in J82-FLAG-AR cells are summarized in Fig. 2 . We investigated CLDN1 and CLDN4 as epithelial markers, GATA3 as a luminal marker, p21 ( CDKN1A ) and p16 as senescent markers in J82-FLAG-AR cells after DHT treatment. CLDN1 treatment significantly suppressed in J82-FLAG-AR cells CLDN4 expression was significantly suppressed in J82-FLAG-AR cells following DHT treatment. GATA3 expression is significantly elevated in J82-FLAG-AR cells. p21 expression was significantly elevated in J82-FLAG-AR cells following DHT treatment. p16 did not significantly change in J82-FLAG-AR cells. In addition, p21 protein levels were increased in J82-FLAG-AR cells after DHT treatment. 3.3. The results of cell proliferation assay demonstrated decreased in J82-FLAG-AR cells by DHT treatment. Next, we investigated the proliferation of J82-FLAG-AR cells after DHT treatment. The results of the cell proliferation assay in the J82-FLAG-AR cells are shown in Fig. 3 . The proliferation of the J82-FLAG-AR cells was significantly suppressed by DHT treatment. 3.4. AR interacted with enhancer of zeste homolog 2 (EZH2) in J82-FLAG-AR cells. J82 cells suppressed cell proliferation via AR expression and p21 expression. AR interacts with EZH2 in prostate cancer. We demonstrated that AR interacts with EZH2 in J82-FLAG-AR cells (Fig. 4 ). 3.5. p21 mRNA expression level increased in J82-FLAG-AR cells by DHT and EZH2 inhibitor treatment. We then investigated the effects of EZH2 inhibitor in J82-FLAG-AR cells. We examined p21 mRNA expression and cell proliferation in J82-FLAG-AR cells treated with DHT and the EZH2 inhibitor GSK126. p21 mRNA expression was significantly increased in J82-FLAG-AR cells after treatment with 1 µM DHT and 10 µM GSK126, compared with treatment with 1 µM DHT or 10 µM GSK126 (Fig. 5 A). The proliferation of J82-FLAG-AR cells was significantly suppressed by treatment with DHT, DHT, and GSK126. However, it did not change between by1 µM DHT treatment and the 1 µM DHT and 1 µM GSK126 treatment (Fig. 5 B). 4. Discussion Establishment of the J82-FLAG-AR cell line, a urothelial carcinoma cell line that stably expresses AR, has facilitated elucidation of the role of AR expression in urothelial carcinoma cells. AR alters the expression of various markers in J82 cells. These results also suggested that AR suppresses cell proliferation. J82-FLAG-AR cells, which are J82 cells stably expressing AR, showed altered gene expression compared to that in J82 cells. First, CLDN1 and CLDN4 were reduced in J82-FLAG-AR cells upon DHT treatment (Fig. 2 A, B). CLDN1 and CLDN4 are epithelial markers that are related to EMT in cancer cells[ 20 , 21 ]. Since a decrease in epithelial markers leads to cell migration and invasion, it has been suggested that AR may promote cancer progression. A previous report using experiments with UMUC3 cells expressing AR showed that AR expression increased the migration and invasion of UMUC3 cells[ 22 ]. GATA3 expression was increased in J82-FLAG-AR cells (Fig. 2 C). GATA3 is a luminal-type marker[ 23 , 24 ], and the results suggest that J82-FLAG-AR cells are closer to luminal cells than J82 cells. The changes observed in CLDN1 , CLDN4 , and GATA3 in J82 cells are thought to be due to the stable expression of AR; however, there is limited evidence that these genes are AR target genes, and further investigation is expected. The p21 ( CDKN1A ) and p16 ( CDKN2A ) genes are known markers of cellular senescence[ 25 , 26 ]. In J82-FLAG-AR cells, p21 expression increased with DHT treatment, whereas p16 expression did not change. This shows that p21 gene expression increases through a different pathway to cellular senescence. It has been reported that p21 is a target gene of AR[ 27 ], and it was suggested that the same is true for J82 cells. p21 is an inhibitor of cyclin-dependent kinase (CDK) and functions in stopping the cell cycle[ 28 ]. The proliferation of J82-FLAG-AR cells was inhibited by DHT treatment, which is suggested to be due to the expression of p21. To better understand the significance of AR expression in urothelial carcinoma, we investigated the transcriptional activity of ARs. AR is a nuclear receptor, and its transcriptional activity is regulated by transcriptional cofactors[ 29 , 30 ]. Although many transcription co-factors for AR have been identified to date, this study focused on EZH2. EZH2 is a component of the polycomb complex, transcriptional repressor complex, and co-repressor that suppresses transcription[ 31 , 32 ]. EZH2 interacts with AR and inhibits transcription. Co-immunoprecipitation (IP) -western blotting also showed that AR and EZH2 interacted in J82 cells. Therefore, EZH2 may also affect the transcriptional activity of AR in J82 cells. EZH2 inhibitors are used as anti-tumor drugs for several tumors[ 31 , 32 ]. J82-FLAG-AR cells were treated with both DHT and GSK126, an EZH2 inhibitor, and p21 gene expression increased (Fig. 5 A). These results support the hypothesis that the transcriptional activation of AR and inhibition of EZH2 act in concert to regulate the expression of p21. GSK126 increased p21 gene expression in J82-FLAG-AR cells in cooperation with DHT, but there was no significant difference in cell proliferation between the DHT-treated group and the DHT- and GSK126-treated groups (Fig. 5 B). GSK126 had a strong inhibitory effect on cell proliferation, and in cell proliferation experiments, it was added at low concentrations. GSK126 has a strong inhibitory effect on cell proliferation; thus, it was administered at low concentrations in cell proliferation assays. This may explain why no additive effect was observed with DHT, as the dose of GSK126 used was not sufficient to amplify the antiproliferative effect. In this study, we investigated the significance of AR expression in basal/squamous urothelial carcinoma using J82 cells. Taken together, AR expression induced p21 expression in J82 cells, suggesting that it may inhibit cell proliferation. Simultaneously, AR expression appears to reduce epithelial markers, indicating a possible role in promoting migration and invasion. Future studies should aim to better elucidate how AR suppresses tumor growth and potentially facilitates cancer cell migration and invasion in basal/squamous urothelial carcinoma. Declarations Acknowledgments This study was conducted in cooperation with the common equipment room of Tohoku Medical and Pharmaceutical University Faculty of Medicine. We would like to thank Editage (www.editage.com) for English language editing. Author Contributions R.S., H.S. and Y.N. designed the study and wrote the manuscript. H.S. and S.H. performed statistical analyses. All authors contributed to data collection, data analysis, and interpretation and reviewed and approved the final version of the manuscript. R.S. and H.S. contributed equally to this work. Funding This work was supported by JSPS KAKENHI Grant Number 23K15769, 19K07420, and 23K15769. Ethics approval Not applicable. Competing interests The authors declare no competing interests. References Richters A, Aben KKH, Kiemeney LALM. The Global Burden of Urinary Bladder Cancer: An Update. World J Urol. 2020;38:1895–904. 10.1007/S00345-019-02984-4/FIGURES/6 . Dobruch J, Daneshmand S, Fisch M, Lotan Y, Noon AP, Resnick MJ, Shariat SF, Zlotta AR, Boorjian SA. Gender and Bladder Cancer: A Collaborative Review of Etiology, Biology, and Outcomes. Eur Urol. 2016;69:300–10. 10.1016/J.EURURO.2015.08.037 . Gul ZG, Liaw CW, Mehrazin R. Gender Differences in Incidence, Diagnosis, Treatments, and Outcomes in Clinically Localized Bladder and Renal Cancer. Urology. 2021;151:176–81. 10.1016/J.UROLOGY.2020.05.067 . Kamoun A, de Reyniès A, Allory Y, Sjödahl G, Robertson AG, Seiler R, Hoadley KA, Groeneveld CS, Al-Ahmadie H, Choi W, et al. A Consensus Molecular Classification of Muscle-Invasive Bladder Cancer. Eur Urol. 2020;77:420–33. 10.1016/J.EURURO.2019.09.006 . Weinstein JN, Akbani R, Broom BM, Wang W, Verhaak RGW, McConkey D, Lerner S, Morgan M, Creighton CJ, Smith C, et al. Comprehensive Molecular Characterization of Urothelial Bladder Carcinoma. Nature. 2014;507:315–22. 10.1038/NATURE12965 . Choi W, Porten S, Kim S, Willis D, Plimack ER, Hoffman-Censits J, Roth B, Cheng T, Tran M, Lee IL, et al. Identification of Distinct Basal and Luminal Subtypes of Muscle-Invasive Bladder Cancer with Different Sensitivities to Frontline Chemotherapy. Cancer Cell. 2014;25:152–65. 10.1016/J.CCR.2014.01.009 . Goto T, Miyamoto H. The Role of Estrogen Receptors in Urothelial Cancer. Front Endocrinol (Lausanne). 2021;12:643870. 10.3389/FENDO.2021.643870 . Ide H, Miyamoto H. Sex Hormone Receptor Signaling in Bladder Cancer: A Potential Target for Enhancing the Efficacy of Conventional Non-Surgical Therapy. Cells 2021. 2021;10:1169. 10.3390/CELLS10051169 . Lempiäinen JK, Manjur ABMK, Malinen M, Ketola K, Niskanen EA, Palvimo JJ. BCOR-Coupled H2A Monoubiquitination Represses a Subset of Androgen Receptor Target Genes Regulating Prostate Cancer Proliferation. Oncogene. 2020;39:2391–407. 10.1038/S41388-020-1153-3 . Shen MM, Abate-Shen C. Molecular Genetics of Prostate Cancer: New Prospects for Old Challenges. Genes Dev. 2010;24:1967–2000. 10.1101/GAD.1965810 . Matsumoto T, Sakari M, Okada M, Yokoyama A, Takahashi S, Kouzmenko A, Kato S. The Androgen Receptor in Health and Disease. Annu Rev Physiol. 2013;75:201–24. 10.1146/ANNUREV-PHYSIOL-030212-183656 . Watson PA, Arora VK, Sawyers CL. Emerging Mechanisms of Resistance to Androgen Receptor Inhibitors in Prostate Cancer. Nat Rev Cancer. 2015;15:701–11. 10.1038/NRC4016 . Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schütz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, et al. Nuclear Receptor Superfamily: Second Decade Cell. 1995;83:835–9. 10.1016/0092-8674(95)90199-X . Lubahn DB, Joseph DR, Sullivan PM, Willard HF, French FS, Wilson EM. Cloning of Human Androgen Receptor Complementary DNA and Localization to the X Chromosome. Science. 1988;240:327–30. 10.1126/SCIENCE.3353727 . Tripathi A, Gupta S. Androgen Receptor in Bladder Cancer: A Promising Therapeutic Target. Asian J Urol. 2020;7:284. 10.1016/J.AJUR.2020.05.011 . Chen J, Huang C-P, Quan C, Zu X, Ou Z, Tsai Y-C, Messing E, Yeh S, Chang C. The Androgen Receptor in Bladder Cancer. Nat Rev Urol. 2023;20:560–74. 10.1038/s41585-023-00761-y . Hata S, Ise K, Azmahani A, Konosu-Fukaya S, McNamara KM, Fujishima F, Shimada K, Mitsuzuka K, Arai Y, Sasano H, et al. Expression of AR, 5αR1 and 5αR2 in Bladder Urothelial Carcinoma and Relationship to Clinicopathological Factors. Life Sci. 2017;190:15–20. 10.1016/J.LFS.2017.09.029 . Eray A, Erkek-özhan S. Classification of Bladder Cancer Cell Lines According to Regulon Activity. Turkish J Biology. 2021;45:656. 10.3906/BIY-2107-72 . Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. Accurate Normalization of Real-Time Quantitative RT-PCR Data by Geometric Averaging of Multiple Internal Control Genes. Genome Biol. 2002;3:RESEARCH0034. 10.1186/gb-2002-3-7-research0034 . Dhawan P, Singh AB, Sharma A. Claudin Family of Proteins and Cancer: An Overview. J Oncol 2010, 2010 , 541957. 10.1155/2010/541957 Li J. Targeting Claudins in Cancer: Diagnosis, Prognosis and Therapy. Am J Cancer Res. 2021;11:3406. Luna-Velez MV, Dijkstra JJ, Heuschkel MA, Smit FP, van de Zande G, Smeets D, Sedelaar JPM, Vermeulen M, Verhaegh GW, Schalken JA. Androgen Receptor Signalling Confers Clonogenic and Migratory Advantages in Urothelial Cell Carcinoma of the Bladder. Mol Oncol. 2021;15:1882–900. 10.1002/1878-0261.12957 . Kouros-Mehr H, Slorach EM, Sternlicht MD, Werb Z. GATA-3 Maintains the Differentiation of the Luminal Cell Fate in the Mammary Gland. Cell. 2006;127:1041–55. 10.1016/J.CELL.2006.09.048 . Warrick JI, Walter V, Yamashita H, Chung E, Shuman L, Amponsa VO, Zheng Z, Chan W, Whitcomb TL, Yue F et al. FOXA1, GATA3 and PPARɣ Cooperate to Drive Luminal Subtype in Bladder Cancer: A Molecular Analysis of Established Human Cell Lines. Scientific Reports 2016 6:1 2016, 6 , 1–15. 10.1038/srep38531 Gorgoulis V, Adams PD, Alimonti A, Bennett DC, Bischof O, Bishop C, Campisi J, Collado M, Evangelou K, Ferbeyre G, et al. Cellular Senescence: Defining a Path Forward. Cell. 2019;179:813–27. 10.1016/J.CELL.2019.10.005 . Yan J, Chen S, Yi Z, Zhao R, Zhu J, Ding S, Wu J. The Role of P21 in Cellular Senescence and Aging-Related Diseases. Mol Cells. 2024;47:100113. 10.1016/J.MOCELL.2024.100113 . Lu S, Liu M, Epner DE, Tsai SY, Tsai MJ. Androgen Regulation of the Cyclin-Dependent Kinase Inhibitor P21 Gene through an Androgen Response Element in the Proximal Promoter. Mol Endocrinol. 1999;13:376–84. 10.1210/MEND.13.3.0254 . Harper JW, Elledge SJ, Keyomarsi K, Dynlacht B, Tsai LH, Zhang P, Dobrowolski S, Bai C, Connell-Crowley L, Swindell E, et al. Inhibition of Cyclin-Dependent Kinases by P21. Mol Biol Cell. 1995;6:387–400. 10.1091/MBC.6.4.387 . Shiota M, Yokomizo A, Fujimoto N, Naito S. Androgen Receptor Cofactors in Prostate Cancer: Potential Therapeutic Targets of Castration-Resistant Prostate Cancer. Curr Cancer Drug Targets. 2011;11:870–81. 10.2174/156800911796798904 . Li X, Xiong H, Mou X, Huang C, Thomas ER, Yu W, Jiang Y, Chen Y. Androgen Receptor Cofactors: A Potential Role in Understanding Prostate Cancer. Biomed Pharmacother. 2024;173:116338. 10.1016/J.BIOPHA.2024.116338 . Duan R, Du W, Guo W. EZH2: A Novel Target for Cancer Treatment. J Hematol Oncol. 2020;13:1–12. 10.1186/S13045-020-00937-8/TABLES/2 . Liu Y, Yang Q. The Roles of EZH2 in Cancer and Its Inhibitors. Med Oncol. 2023;40:167. 10.1007/S12032-023-02025-6 . Additional Declarations No competing interests reported. Supplementary Files Supplementaryfile.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7001562","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":501942599,"identity":"beff7546-b3ce-4bdc-9a0c-3a86ee92200a","order_by":0,"name":"Ryotaro Sakai","email":"","orcid":"","institution":"Tohoku Medical and Pharmaceutical University","correspondingAuthor":false,"prefix":"","firstName":"Ryotaro","middleName":"","lastName":"Sakai","suffix":""},{"id":501942602,"identity":"abb62e69-4d17-4d44-8463-e5f67ca07d9b","order_by":1,"name":"Hiroki Shimada","email":"","orcid":"","institution":"Tohoku Medical and Pharmaceutical University","correspondingAuthor":false,"prefix":"","firstName":"Hiroki","middleName":"","lastName":"Shimada","suffix":""},{"id":501942604,"identity":"c8b5f96b-9870-4564-a4f6-342e3334ffef","order_by":2,"name":"Shuko Hata","email":"","orcid":"","institution":"Tohoku Medical and Pharmaceutical University","correspondingAuthor":false,"prefix":"","firstName":"Shuko","middleName":"","lastName":"Hata","suffix":""},{"id":501942605,"identity":"9ea7e0b8-819f-48df-a354-f6595e7a7fc0","order_by":3,"name":"Atsushi Yokoyama","email":"","orcid":"","institution":"Tohoku University Graduate School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Atsushi","middleName":"","lastName":"Yokoyama","suffix":""},{"id":501942607,"identity":"ae020330-0ac2-4b2d-85cf-ecf5c29f0873","order_by":4,"name":"Yasuhiro Nakamura","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABD0lEQVRIiWNgGAWjYBADAwb2BgZmBoYEhBBjAyEtPIdJ1iKRjKYFp9Ljx59JMO6wM+af+f7g44KKtMQGsbPHJBhq7BiYZ2O3xuBMjpkE45lkM4nbyczGM87kJDZI56VJMBxLZmCccwC7lgM5bNJ/25htGG4ns0nztlUk7r8NNISB7QAD4wzsrjQ4/xzosLZ6G/mbhyFaGqRBWv7h0XIjAeiwtsNmBjeYQVpyIFoY23BrkbzxxtiCse24seGZZGNjnjNpxkC/JFsk9iXz4PIL3/n0hzcY26oN5x0/+PAxT0WybIN07sEbH77ZyRniCDEFLCbxgKOHx3AGVh0M8lhM4oFKSWDXMgpGwSgYBSMOAACn/1j5zQsFEQAAAABJRU5ErkJggg==","orcid":"","institution":"Tohoku Medical and Pharmaceutical University","correspondingAuthor":true,"prefix":"","firstName":"Yasuhiro","middleName":"","lastName":"Nakamura","suffix":""}],"badges":[],"createdAt":"2025-06-29 08:38:08","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7001562/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7001562/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":89602791,"identity":"39584ad0-4d17-496d-9a6c-acac3b08a36d","added_by":"auto","created_at":"2025-08-21 18:50:41","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":246737,"visible":true,"origin":"","legend":"\u003cp\u003eEstablishment of J82 in AR stable expression confirmed by western blot analysis\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7001562/v1/9fd2d5126a644eae67fa731d.jpeg"},{"id":89603206,"identity":"fad48131-1d15-4fda-9a30-b2ae4b05fe8c","added_by":"auto","created_at":"2025-08-21 18:58:41","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":436475,"visible":true,"origin":"","legend":"\u003cp\u003eA several cell-type marker genes expression analyses in J82-FLAG-AR cells with 1 µM DHT treatment or ethanol (EtOH) for 24 hours. (A), CLDN1, epithelial marker mRNA expression. (B), CLDN4, epithelial marker mRNA expression. (C), GATA3, luminal-type marker mRNA expression. (D), p21, senescence marker mRNA expression. (E), p16, senescence marker mRNA expression. (F), p21 protein expression in J82-FLAG and J82-FLAG-AR cells with DHT or EtOH treatment for 24 hours. β-actin protein expression as internal control. Values are mean ± standard error(n=3). *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.005, ****p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7001562/v1/762a9c01640f62a6f56406cb.jpg"},{"id":89602790,"identity":"9e66f5bf-fd4a-4add-9817-5850365e6b86","added_by":"auto","created_at":"2025-08-21 18:50:41","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":29468,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of DHT treatment on cell proliferation in J82-FLAG and J82-FLAG-AR cells. (A), Cell proliferation of J82-FLAG cells with 1 µM DHT treatment for 48 hours. (B), Cell proliferation of J82-FLAG-AR cells with 1 µM DHT treatment for 48 hours.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7001562/v1/1699a997fa13694905a478fc.png"},{"id":89603207,"identity":"604f18e2-2037-4ca3-a1a7-2ec9da7203a5","added_by":"auto","created_at":"2025-08-21 18:58:41","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":236872,"visible":true,"origin":"","legend":"\u003cp\u003eDetection of protein-protein interaction between AR and EZH2 by co-IP-western blotting.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7001562/v1/f689a8aa67f4990e0528a6bd.jpeg"},{"id":89603208,"identity":"96380663-a16b-40c8-83f8-0e66c2b32f3a","added_by":"auto","created_at":"2025-08-21 18:58:41","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":317062,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of DHT and GSK126 treatment on p21 mRNA expression and cell proliferation in J82-FLAG-AR cells. (A), p21 mRNA expression in J82-FLAG and J82-FLAG-AR cells with 1 µM DHT and 10 µM GSK126 each condition. (B), cell proliferation in J82-FLAG and J82-FLAG-AR cells with 1 µM DHT and 1 µM GSK126 each condition for 48 hours. Values are mean ± standard error(n=3). *p\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7001562/v1/6e67a84e08935dacb7d7967c.jpeg"},{"id":96965976,"identity":"093b8c21-3d1f-495e-b4a7-d982f45d7f5c","added_by":"auto","created_at":"2025-11-28 06:38:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1937000,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7001562/v1/886022bc-c46a-4f11-ad9c-ed250f14aa18.pdf"},{"id":89602805,"identity":"304653c3-d4cb-468e-b785-868397eae203","added_by":"auto","created_at":"2025-08-21 18:50:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":6817491,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfile.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7001562/v1/dda7f2ebb5745eab85a5161a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Investigation of the significance and role of androgen receptor expression in basal/squamous type urothelial carcinoma cell line J82 cells","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eThe incidence of urothelial carcinoma, the seventh most prevalent form of cancer worldwide, has increased. This carcinoma is also known to be four times more prevalent in men than in women[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]; however, the reasons for this disparity remain largely unknown[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In particular, molecular subtyping of urothelial carcinoma by transcriptome analysis has been used for diagnosis and therapeutic options. Urothelial carcinoma is characterized by the presence of several molecular subtypes, including the luminal, stroma-rich, basal/squamous, and neuroendocrine subtypes[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The basal/squamous type in the pathologic classification is known to have a poor prognosis and is difficult to treat[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The progression of urothelial carcinoma has been suggested to be related to sex hormones. Androgens and estrogen have been implicated in the growth and progression of urothelial carcinoma via androgen and estrogen receptors, respectively[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The androgen receptor (AR) is a prime transcription factor involved in the development and progression of prostate cancer[\u003cspan additionalcitationids=\"CR10 CR11\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Activation of AR via its cognate ligand, androgen, leads to its translocation to the nucleus and, as a chromatin-binding nuclear receptor (NR), binding to DNA elements known as AR response elements[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. AR has been implicated in cancer progression in urothelial cancer and is considered a predictor of patient prognosis and a therapeutic target[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. However, AR expression is often reported to be negative in high-grade urothelial carcinoma[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], and many aspects of the relationship between AR and tumor growth or progression in urothelial carcinoma remain unclear.\u003c/p\u003e\u003cp\u003eTherefore, in this study, we investigated the significance and function of AR expression in basal/squamous-type urothelial carcinoma using J82 cells, a basal/squamous-type urothelial carcinoma cell line[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Cell culture and Transfection\u003c/h2\u003e\u003cp\u003eHuman urothelial carcinoma cell lines used in this study were the J82 (RRID:CVCL_0359) respectively (American Type Cell Culture Collection (Manassas, VA, USA). All the cells were grown at 37\u0026deg;C in a humidified 5% CO\u003csub\u003e2\u003c/sub\u003e incubator in phenol red-free RPMI-1640 medium (Nacalai Tesque, Kyoto, Japan) containing 10% fetal bovine serum (FBS; Nichirei Bioscience, Japan) and 1% penicillin-streptomycin. To establish AR cDNA-expressing J82 cells, cells were infected with a retrovirus carrying an AR cDNA-expressing cassette and then selected with RPMI 1640 medium containing 2 \u0026micro;g/mL puromycin. Lipofectamine 2000 (Invitrogen) was used for transfection according to the manufacturer\u0026rsquo;s instructions. AR cDNA-expressing retroviruses were generated using PLAT-A (RRID:CVCL_B489) cells. PLAT-A cells were kindly provided by Dr. Toshio Kitamura (University of Tokyo). For dihydrotestosterone (DHT) treatment, the culture medium was replaced with phenol red-free RPMI-1640 medium containing 5% charcoal-stripped FBS. The cells were maintained for approximately 24 h in medium and subsequently exposed to DHT (100 and 1000 nM) or vehicle (ethanol) for the indicated time.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Plasmid for AR cDNA expression\u003c/h2\u003e\u003cp\u003eFull-length human AR complementary DNA (cDNA) were amplified by polymerase chain reaction (PCR) from an LNCaP cell cDNA library and cloned in-frame into the pQCXIP-FLAG vector.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. Quantitative RT-PCR\u003c/h2\u003e\u003cp\u003eAfter incubating J82 cells treated with DHT, GSK126, ethanol, or DMSO, total RNA was extracted using the RNeasy Mini kit (Qiagen, Hilden, Germany). cDNA was synthesized using the ReverTra Ace qPCR RT Master Mix (Toyobo, Osaka, Japan). Quantitative RT-PCR was carried out using Quant Studio3 (Applied Biosystems, USA) and THUNDERBIRD Next SYBR qPCR Mix (Toyobo). The primer sequences used in this study were as follows: ribosomal protein L13a (RPL13A) forward 5\u0026rsquo;- CCTGGAGGAGAAGAGGAAAG \u0026minus;\u0026thinsp;3\u0026rsquo; and reverse 5\u0026rsquo;- TTGAGGACCTCTGTGTATTT \u0026minus;\u0026thinsp;3\u0026rsquo;[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e],Claudin1 (CLDN1) forward 5- CGATGAGGTGCAGAAGATGA \u0026minus;\u0026thinsp;3\u0026rsquo; and reverse 5\u0026rsquo;- CCAGTGAAGAGAGCCTGACC \u0026minus;\u0026thinsp;3\u0026rsquo;, Claudin4 (CLDN4) forward 5\u0026rsquo;- CTGGAGACTGATCCCCTCTG \u0026minus;\u0026thinsp;3\u0026rsquo; and reverse 5\u0026rsquo;- ACCCTCCCAGGCTCATTAGT \u0026minus;\u0026thinsp;3\u0026rsquo;, GATA3 forward 5- CTCATTAAGCCCAAGCGAAG \u0026minus;\u0026thinsp;3\u0026rsquo; and reverse 5\u0026rsquo;- GTCTGACAGTTCGCACAGGA \u0026minus;\u0026thinsp;3\u0026rsquo;, p21 forward 5\u0026rsquo;- CTTTCTAGGAGGGAGACAC \u0026minus;\u0026thinsp;3\u0026rsquo; and reverse 5\u0026rsquo;- GTTCCGCTGCTAATCAAAG \u0026minus;\u0026thinsp;3, p16 forward 5\u0026rsquo;- GCACCGAATAGTTACGGTCGG \u0026minus;\u0026thinsp;3\u0026rsquo; and reverse 5\u0026rsquo;- CACCAGCGTGTCCAGGAAGC \u0026minus;\u0026thinsp;3\u0026rsquo;. cDNA of known concentrations of target genes and the housekeeping gene RPL13A were used to generate standard curves for real-time quantitative PCR to determine the quantity of target cDNA transcripts. The mRNA levels in each case are represented as the ratio of RPL13A.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. Immunoprecipitation and Western blotting\u003c/h2\u003e\u003cp\u003eThe protein content of J82 cells was extracted using RIPA buffer (Nacalai Tesque, Kyoto, Japan) with a Protease Inhibitor Cocktail (Nacalai Tesque, Kyoto, Japan), and protein concentration was determined using a Protein Assay BCA Kit (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan). Lysates of J82 cells transfected with FLAG-AR were prepared in TNE buffer (20-mM Tris-HCl pH 7.9, 150-mM NaCl, 2-mM EDTA, 1% NP-40, and protease inhibitor). The extracts were incubated with FLAG M2 beads (Sigma-Aldrich) at 4\u0026deg;C. The immunoprecipitants were washed and boiled with Laemmli sample buffer. Proteins were resolved by SDS-PAGE (10% acrylamide gel) and transferred onto polyvinylidene fluoride (PVDF) membranes. After blocking with Bullet-blocking One (Nacalai Tesque, Kyoto, Japan) for 5 min at room temperature, the membranes were incubated overnight at 4\u0026deg;C with primary antibody. The dilutions of primary antibodies used in this study were as follows: FLAG (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan), 1:10000; GAPDH (Proteintech, Tokyo, Japan), 1:20000; p21 (Proteintech, Tokyo, Japan), 1:10000; EZH2 (Proteintech, Tokyo, Japan), 1:10000. The membranes were washed and incubated for 1 h with horseradish peroxidase-conjugated goat anti-mouse or rabbit IgG (GE Healthcare, Buckinghamshire, UK) at room temperature. Immunoreactivity was visualized using chemiluminescence (Immobilon Forte Western HRP Substrate, Millipore, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5. Cell proliferation assays\u003c/h2\u003e\u003cp\u003eFor the cell proliferation assay, J82 cells were treated with dihydrotestosterone (DHT) and GSK126 in a 96-well plate. For the DHT and GSK126 treatments, we incubated the cells in RPMI-1640 medium supplemented with dextran-coated charcoal-stripped fetal bovine serum (FBS) and 1% penicillin-streptomycin for 48 h. Cell proliferation was evaluated using a WST-8 colorimetric assay (cell counting kit-8; Dojindo, Kumamoto, Japan).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6. Statistical analysis\u003c/h2\u003e\u003cp\u003eStatistical analysis was performed using JMP Pro 18.0.0 software (SAS Institute, Inc., Cary, NC, USA). Data obtained from the proliferation assay and quantitative RT-PCR study were analyzed using Tukey\u0026rsquo;s post-hoc test. Statistical significance was set at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e3.1. The establishment of AR-expressing J82 urothelial carcinoma cell lines.\u003c/h2\u003e\u003cp\u003eFirst, we established AR-expressing J82 (J82-FLAG-AR) cells to investigate the role of AR in basal/squamous-type urothelial carcinoma. We generated J82-FLAG-AR cells using retroviral vector, at the same time, we also generated control J82-FLAG cells using empty vector. We then confirmed AR protein expression in J82-FLAG-AR cells by western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e3.2. The expression of several cell-type markers in J82-FLAG-AR cells.\u003c/h2\u003e\u003cp\u003eThe results of several cell type marker gene expression analyses in J82-FLAG-AR cells are summarized in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. We investigated \u003cem\u003eCLDN1\u003c/em\u003e and \u003cem\u003eCLDN4\u003c/em\u003e as epithelial markers, \u003cem\u003eGATA3\u003c/em\u003e as a luminal marker, p21 (\u003cem\u003eCDKN1A\u003c/em\u003e) and p16 as senescent markers in J82-FLAG-AR cells after DHT treatment. \u003cem\u003eCLDN1\u003c/em\u003e treatment significantly suppressed in J82-FLAG-AR cells \u003cem\u003eCLDN4\u003c/em\u003e expression was significantly suppressed in J82-FLAG-AR cells following DHT treatment. \u003cem\u003eGATA3\u003c/em\u003e expression is significantly elevated in J82-FLAG-AR cells. p21 expression was significantly elevated in J82-FLAG-AR cells following DHT treatment. p16 did not significantly change in J82-FLAG-AR cells. In addition, \u003cem\u003ep21\u003c/em\u003e protein levels were increased in J82-FLAG-AR cells after DHT treatment.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e3.3. The results of cell proliferation assay demonstrated decreased in J82-FLAG-AR cells by DHT treatment.\u003c/h2\u003e\u003cp\u003eNext, we investigated the proliferation of J82-FLAG-AR cells after DHT treatment. The results of the cell proliferation assay in the J82-FLAG-AR cells are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. The proliferation of the J82-FLAG-AR cells was significantly suppressed by DHT treatment.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e3.4. AR interacted with enhancer of zeste homolog 2 (EZH2) in J82-FLAG-AR cells.\u003c/h2\u003e\u003cp\u003eJ82 cells suppressed cell proliferation via AR expression and p21 expression. AR interacts with EZH2 in prostate cancer. We demonstrated that AR interacts with EZH2 in J82-FLAG-AR cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e3.5. p21 mRNA expression level increased in J82-FLAG-AR cells by DHT and EZH2 inhibitor treatment.\u003c/h2\u003e\u003cp\u003eWe then investigated the effects of EZH2 inhibitor in J82-FLAG-AR cells. We examined p21 mRNA expression and cell proliferation in J82-FLAG-AR cells treated with DHT and the EZH2 inhibitor GSK126. p21 mRNA expression was significantly increased in J82-FLAG-AR cells after treatment with 1 \u0026micro;M DHT and 10 \u0026micro;M GSK126, compared with treatment with 1 \u0026micro;M DHT or 10 \u0026micro;M GSK126 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). The proliferation of J82-FLAG-AR cells was significantly suppressed by treatment with DHT, DHT, and GSK126. However, it did not change between by1 \u0026micro;M DHT treatment and the 1 \u0026micro;M DHT and 1 \u0026micro;M GSK126 treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eEstablishment of the J82-FLAG-AR cell line, a urothelial carcinoma cell line that stably expresses AR, has facilitated elucidation of the role of AR expression in urothelial carcinoma cells. AR alters the expression of various markers in J82 cells. These results also suggested that AR suppresses cell proliferation.\u003c/p\u003e\u003cp\u003eJ82-FLAG-AR cells, which are J82 cells stably expressing AR, showed altered gene expression compared to that in J82 cells. First, \u003cem\u003eCLDN1\u003c/em\u003e and \u003cem\u003eCLDN4\u003c/em\u003e were reduced in J82-FLAG-AR cells upon DHT treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, B). \u003cem\u003eCLDN1\u003c/em\u003e and \u003cem\u003eCLDN4\u003c/em\u003e are epithelial markers that are related to EMT in cancer cells[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Since a decrease in epithelial markers leads to cell migration and invasion, it has been suggested that AR may promote cancer progression. A previous report using experiments with UMUC3 cells expressing AR showed that AR expression increased the migration and invasion of UMUC3 cells[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. GATA3 expression was increased in J82-FLAG-AR cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). GATA3 is a luminal-type marker[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], and the results suggest that J82-FLAG-AR cells are closer to luminal cells than J82 cells. The changes observed in \u003cem\u003eCLDN1\u003c/em\u003e, \u003cem\u003eCLDN4\u003c/em\u003e, and \u003cem\u003eGATA3\u003c/em\u003e in J82 cells are thought to be due to the stable expression of AR; however, there is limited evidence that these genes are AR target genes, and further investigation is expected.\u003c/p\u003e\u003cp\u003eThe p21 (\u003cem\u003eCDKN1A\u003c/em\u003e) and p16 (\u003cem\u003eCDKN2A\u003c/em\u003e) genes are known markers of cellular senescence[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In J82-FLAG-AR cells, p21 expression increased with DHT treatment, whereas p16 expression did not change. This shows that p21 gene expression increases through a different pathway to cellular senescence. It has been reported that p21 is a target gene of AR[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], and it was suggested that the same is true for J82 cells. p21 is an inhibitor of cyclin-dependent kinase (CDK) and functions in stopping the cell cycle[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The proliferation of J82-FLAG-AR cells was inhibited by DHT treatment, which is suggested to be due to the expression of p21.\u003c/p\u003e\u003cp\u003eTo better understand the significance of AR expression in urothelial carcinoma, we investigated the transcriptional activity of ARs. AR is a nuclear receptor, and its transcriptional activity is regulated by transcriptional cofactors[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Although many transcription co-factors for AR have been identified to date, this study focused on EZH2. EZH2 is a component of the polycomb complex, transcriptional repressor complex, and co-repressor that suppresses transcription[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. EZH2 interacts with AR and inhibits transcription. Co-immunoprecipitation (IP) -western blotting also showed that AR and EZH2 interacted in J82 cells. Therefore, EZH2 may also affect the transcriptional activity of AR in J82 cells. EZH2 inhibitors are used as anti-tumor drugs for several tumors[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. J82-FLAG-AR cells were treated with both DHT and GSK126, an EZH2 inhibitor, and p21 gene expression increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). These results support the hypothesis that the transcriptional activation of AR and inhibition of EZH2 act in concert to regulate the expression of p21. GSK126 increased p21 gene expression in J82-FLAG-AR cells in cooperation with DHT, but there was no significant difference in cell proliferation between the DHT-treated group and the DHT- and GSK126-treated groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). GSK126 had a strong inhibitory effect on cell proliferation, and in cell proliferation experiments, it was added at low concentrations. GSK126 has a strong inhibitory effect on cell proliferation; thus, it was administered at low concentrations in cell proliferation assays. This may explain why no additive effect was observed with DHT, as the dose of GSK126 used was not sufficient to amplify the antiproliferative effect.\u003c/p\u003e\u003cp\u003eIn this study, we investigated the significance of AR expression in basal/squamous urothelial carcinoma using J82 cells. Taken together, AR expression induced p21 expression in J82 cells, suggesting that it may inhibit cell proliferation. Simultaneously, AR expression appears to reduce epithelial markers, indicating a possible role in promoting migration and invasion. Future studies should aim to better elucidate how AR suppresses tumor growth and potentially facilitates cancer cell migration and invasion in basal/squamous urothelial carcinoma.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was conducted in cooperation with the common equipment room of Tohoku Medical and Pharmaceutical University Faculty of Medicine.\u003c/p\u003e\n\u003cp\u003eWe would like to thank Editage (www.editage.com) for English language editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;R.S., H.S. and Y.N. designed the study and wrote the manuscript. H.S. and S.H. performed statistical analyses. All authors contributed to data collection, data analysis, and interpretation and reviewed and approved the final version of the manuscript. R.S. and H.S. contributed equally to this work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by JSPS KAKENHI Grant Number 23K15769, 19K07420, and 23K15769.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eRichters A, Aben KKH, Kiemeney LALM. The Global Burden of Urinary Bladder Cancer: An Update. World J Urol. 2020;38:1895\u0026ndash;904. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/S00345-019-02984-4/FIGURES/6\u003c/span\u003e\u003cspan address=\"10.1007/S00345-019-02984-4/FIGURES/6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDobruch J, Daneshmand S, Fisch M, Lotan Y, Noon AP, Resnick MJ, Shariat SF, Zlotta AR, Boorjian SA. Gender and Bladder Cancer: A Collaborative Review of Etiology, Biology, and Outcomes. Eur Urol. 2016;69:300\u0026ndash;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.EURURO.2015.08.037\u003c/span\u003e\u003cspan address=\"10.1016/J.EURURO.2015.08.037\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGul ZG, Liaw CW, Mehrazin R. Gender Differences in Incidence, Diagnosis, Treatments, and Outcomes in Clinically Localized Bladder and Renal Cancer. Urology. 2021;151:176\u0026ndash;81. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.UROLOGY.2020.05.067\u003c/span\u003e\u003cspan address=\"10.1016/J.UROLOGY.2020.05.067\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKamoun A, de Reyni\u0026egrave;s A, Allory Y, Sj\u0026ouml;dahl G, Robertson AG, Seiler R, Hoadley KA, Groeneveld CS, Al-Ahmadie H, Choi W, et al. A Consensus Molecular Classification of Muscle-Invasive Bladder Cancer. Eur Urol. 2020;77:420\u0026ndash;33. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.EURURO.2019.09.006\u003c/span\u003e\u003cspan address=\"10.1016/J.EURURO.2019.09.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWeinstein JN, Akbani R, Broom BM, Wang W, Verhaak RGW, McConkey D, Lerner S, Morgan M, Creighton CJ, Smith C, et al. Comprehensive Molecular Characterization of Urothelial Bladder Carcinoma. Nature. 2014;507:315\u0026ndash;22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/NATURE12965\u003c/span\u003e\u003cspan address=\"10.1038/NATURE12965\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChoi W, Porten S, Kim S, Willis D, Plimack ER, Hoffman-Censits J, Roth B, Cheng T, Tran M, Lee IL, et al. Identification of Distinct Basal and Luminal Subtypes of Muscle-Invasive Bladder Cancer with Different Sensitivities to Frontline Chemotherapy. Cancer Cell. 2014;25:152\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.CCR.2014.01.009\u003c/span\u003e\u003cspan address=\"10.1016/J.CCR.2014.01.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGoto T, Miyamoto H. The Role of Estrogen Receptors in Urothelial Cancer. Front Endocrinol (Lausanne). 2021;12:643870. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/FENDO.2021.643870\u003c/span\u003e\u003cspan address=\"10.3389/FENDO.2021.643870\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIde H, Miyamoto H. Sex Hormone Receptor Signaling in Bladder Cancer: A Potential Target for Enhancing the Efficacy of Conventional Non-Surgical Therapy. Cells 2021. 2021;10:1169. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/CELLS10051169\u003c/span\u003e\u003cspan address=\"10.3390/CELLS10051169\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLempi\u0026auml;inen JK, Manjur ABMK, Malinen M, Ketola K, Niskanen EA, Palvimo JJ. BCOR-Coupled H2A Monoubiquitination Represses a Subset of Androgen Receptor Target Genes Regulating Prostate Cancer Proliferation. Oncogene. 2020;39:2391\u0026ndash;407. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/S41388-020-1153-3\u003c/span\u003e\u003cspan address=\"10.1038/S41388-020-1153-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShen MM, Abate-Shen C. Molecular Genetics of Prostate Cancer: New Prospects for Old Challenges. Genes Dev. 2010;24:1967\u0026ndash;2000. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/GAD.1965810\u003c/span\u003e\u003cspan address=\"10.1101/GAD.1965810\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMatsumoto T, Sakari M, Okada M, Yokoyama A, Takahashi S, Kouzmenko A, Kato S. The Androgen Receptor in Health and Disease. Annu Rev Physiol. 2013;75:201\u0026ndash;24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1146/ANNUREV-PHYSIOL-030212-183656\u003c/span\u003e\u003cspan address=\"10.1146/ANNUREV-PHYSIOL-030212-183656\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWatson PA, Arora VK, Sawyers CL. Emerging Mechanisms of Resistance to Androgen Receptor Inhibitors in Prostate Cancer. Nat Rev Cancer. 2015;15:701\u0026ndash;11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/NRC4016\u003c/span\u003e\u003cspan address=\"10.1038/NRC4016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMangelsdorf DJ, Thummel C, Beato M, Herrlich P, Sch\u0026uuml;tz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, et al. Nuclear Receptor Superfamily: Second Decade Cell. 1995;83:835\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0092-8674(95)90199-X\u003c/span\u003e\u003cspan address=\"10.1016/0092-8674(95)90199-X\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLubahn DB, Joseph DR, Sullivan PM, Willard HF, French FS, Wilson EM. Cloning of Human Androgen Receptor Complementary DNA and Localization to the X Chromosome. Science. 1988;240:327\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/SCIENCE.3353727\u003c/span\u003e\u003cspan address=\"10.1126/SCIENCE.3353727\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTripathi A, Gupta S. Androgen Receptor in Bladder Cancer: A Promising Therapeutic Target. Asian J Urol. 2020;7:284. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.AJUR.2020.05.011\u003c/span\u003e\u003cspan address=\"10.1016/J.AJUR.2020.05.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen J, Huang C-P, Quan C, Zu X, Ou Z, Tsai Y-C, Messing E, Yeh S, Chang C. The Androgen Receptor in Bladder Cancer. Nat Rev Urol. 2023;20:560\u0026ndash;74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41585-023-00761-y\u003c/span\u003e\u003cspan address=\"10.1038/s41585-023-00761-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHata S, Ise K, Azmahani A, Konosu-Fukaya S, McNamara KM, Fujishima F, Shimada K, Mitsuzuka K, Arai Y, Sasano H, et al. Expression of AR, 5αR1 and 5αR2 in Bladder Urothelial Carcinoma and Relationship to Clinicopathological Factors. Life Sci. 2017;190:15\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.LFS.2017.09.029\u003c/span\u003e\u003cspan address=\"10.1016/J.LFS.2017.09.029\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEray A, Erkek-\u0026ouml;zhan S. Classification of Bladder Cancer Cell Lines According to Regulon Activity. Turkish J Biology. 2021;45:656. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3906/BIY-2107-72\u003c/span\u003e\u003cspan address=\"10.3906/BIY-2107-72\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. Accurate Normalization of Real-Time Quantitative RT-PCR Data by Geometric Averaging of Multiple Internal Control Genes. Genome Biol. 2002;3:RESEARCH0034. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/gb-2002-3-7-research0034\u003c/span\u003e\u003cspan address=\"10.1186/gb-2002-3-7-research0034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDhawan P, Singh AB, Sharma A. Claudin Family of Proteins and Cancer: An Overview. \u003cem\u003eJ Oncol\u003c/em\u003e 2010, \u003cem\u003e2010\u003c/em\u003e, 541957. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2010/541957\u003c/span\u003e\u003cspan address=\"10.1155/2010/541957\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi J. Targeting Claudins in Cancer: Diagnosis, Prognosis and Therapy. Am J Cancer Res. 2021;11:3406.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLuna-Velez MV, Dijkstra JJ, Heuschkel MA, Smit FP, van de Zande G, Smeets D, Sedelaar JPM, Vermeulen M, Verhaegh GW, Schalken JA. Androgen Receptor Signalling Confers Clonogenic and Migratory Advantages in Urothelial Cell Carcinoma of the Bladder. Mol Oncol. 2021;15:1882\u0026ndash;900. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/1878-0261.12957\u003c/span\u003e\u003cspan address=\"10.1002/1878-0261.12957\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKouros-Mehr H, Slorach EM, Sternlicht MD, Werb Z. GATA-3 Maintains the Differentiation of the Luminal Cell Fate in the Mammary Gland. Cell. 2006;127:1041\u0026ndash;55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.CELL.2006.09.048\u003c/span\u003e\u003cspan address=\"10.1016/J.CELL.2006.09.048\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWarrick JI, Walter V, Yamashita H, Chung E, Shuman L, Amponsa VO, Zheng Z, Chan W, Whitcomb TL, Yue F et al. FOXA1, GATA3 and PPARɣ Cooperate to Drive Luminal Subtype in Bladder Cancer: A Molecular Analysis of Established Human Cell Lines. \u003cem\u003eScientific Reports 2016 6:1\u003c/em\u003e 2016, \u003cem\u003e6\u003c/em\u003e, 1\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/srep38531\u003c/span\u003e\u003cspan address=\"10.1038/srep38531\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGorgoulis V, Adams PD, Alimonti A, Bennett DC, Bischof O, Bishop C, Campisi J, Collado M, Evangelou K, Ferbeyre G, et al. Cellular Senescence: Defining a Path Forward. Cell. 2019;179:813\u0026ndash;27. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.CELL.2019.10.005\u003c/span\u003e\u003cspan address=\"10.1016/J.CELL.2019.10.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYan J, Chen S, Yi Z, Zhao R, Zhu J, Ding S, Wu J. The Role of P21 in Cellular Senescence and Aging-Related Diseases. Mol Cells. 2024;47:100113. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.MOCELL.2024.100113\u003c/span\u003e\u003cspan address=\"10.1016/J.MOCELL.2024.100113\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLu S, Liu M, Epner DE, Tsai SY, Tsai MJ. Androgen Regulation of the Cyclin-Dependent Kinase Inhibitor P21 Gene through an Androgen Response Element in the Proximal Promoter. Mol Endocrinol. 1999;13:376\u0026ndash;84. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1210/MEND.13.3.0254\u003c/span\u003e\u003cspan address=\"10.1210/MEND.13.3.0254\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHarper JW, Elledge SJ, Keyomarsi K, Dynlacht B, Tsai LH, Zhang P, Dobrowolski S, Bai C, Connell-Crowley L, Swindell E, et al. Inhibition of Cyclin-Dependent Kinases by P21. Mol Biol Cell. 1995;6:387\u0026ndash;400. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1091/MBC.6.4.387\u003c/span\u003e\u003cspan address=\"10.1091/MBC.6.4.387\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShiota M, Yokomizo A, Fujimoto N, Naito S. Androgen Receptor Cofactors in Prostate Cancer: Potential Therapeutic Targets of Castration-Resistant Prostate Cancer. Curr Cancer Drug Targets. 2011;11:870\u0026ndash;81. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2174/156800911796798904\u003c/span\u003e\u003cspan address=\"10.2174/156800911796798904\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi X, Xiong H, Mou X, Huang C, Thomas ER, Yu W, Jiang Y, Chen Y. Androgen Receptor Cofactors: A Potential Role in Understanding Prostate Cancer. Biomed Pharmacother. 2024;173:116338. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/J.BIOPHA.2024.116338\u003c/span\u003e\u003cspan address=\"10.1016/J.BIOPHA.2024.116338\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDuan R, Du W, Guo W. EZH2: A Novel Target for Cancer Treatment. J Hematol Oncol. 2020;13:1\u0026ndash;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/S13045-020-00937-8/TABLES/2\u003c/span\u003e\u003cspan address=\"10.1186/S13045-020-00937-8/TABLES/2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu Y, Yang Q. The Roles of EZH2 in Cancer and Its Inhibitors. Med Oncol. 2023;40:167. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/S12032-023-02025-6\u003c/span\u003e\u003cspan address=\"10.1007/S12032-023-02025-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7001562/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7001562/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eUrothelial carcinoma is a prevalent malignancy that exhibits a distinct sex disparity, with a higher incidence in males. Among the various molecular subtypes, the basal/squamous subtype is associated with poor prognosis and therapeutic resistance. Androgen receptor (AR) signaling has been implicated in the pathogenesis of urothelial carcinoma; however, its precise role remains unclear, particularly in basal/squamous-type urothelial carcinoma. The present study sought to ascertain the functional role of AR in Ba/Sq-type UC by employing J82 cells, a prominent cell line representing this subtype. J82 cells stably expressing the AR (J82-FLAG-AR) were established via retroviral transduction. Gene and protein expression analyses were conducted using quantitative real-time polymerase chain reaction (qRT-PCR) and western blotting, respectively, following dihydrotestosterone (DHT) treatment. A series of experiments were conducted to investigate the interaction between the androgen receptor (AR) and enhancer of zeste homolog 2 (EZH2), as well as their impact on cell proliferation and p21 expression. The results indicated that AR expression in J82 cells led to a decrease in the expression of epithelial markers (CLDN1, CLDN4) and an increase in the expression of the luminal marker GATA3 and cyclin-dependent kinase inhibitor p21. DHT treatment suppressed the proliferation of J82-FLAG-AR cells, accompanied by the upregulation of p21. Co-immunoprecipitation demonstrated the interaction of AR with EZH2, and combined treatment with DHT and the EZH2 inhibitor GSK126 further elevated p21 expression. However, this combination did not enhance the antiproliferative effect beyond that of DHT alone. AR expression in basal/squamous-type urothelial carcinoma cells promotes p21-mediated growth inhibition while simultaneously reducing epithelial markers, suggesting a dual role in suppressing proliferation and potentially promoting epithelial-mesenchymal transition. These findings contribute to our understanding of AR's complex role of AR in UC, and provide insights into potential therapeutic strategies targeting AR.\u003c/p\u003e","manuscriptTitle":"Investigation of the significance and role of androgen receptor expression in basal/squamous type urothelial carcinoma cell line J82 cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-21 18:50:36","doi":"10.21203/rs.3.rs-7001562/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1cb78ca5-30ff-4be9-b43d-0144b05b66e0","owner":[],"postedDate":"August 21st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-02-21T04:08:59+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-21 18:50:36","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7001562","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7001562","identity":"rs-7001562","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00