Levosimendan can effectively reduce myocardial cell apoptosis caused by hypoxia through antioxidant activity

Levosimendan can effectively reduce myocardial cell apoptosis caused by hypoxia through antioxidant activity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Levosimendan can effectively reduce myocardial cell apoptosis caused by hypoxia through antioxidant activity Siqi Zhao, Hong Chang, Qian Sun, Rui Fei, Lei Zhang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7676499/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 10 You are reading this latest preprint version Abstract Levosimendan (LMSD) is a novel positive inotropic drug with unique chemical structure and pharmacological properties. It has multiple effects such as dilating blood vessels and improving myocardial diastolic function, and is widely used in the treatment of cardiovascular diseases such as acute heart failure in clinical practice. During clinical treatment, LMSD seems to have a certain protective effect on hypoxic myocardial cells. Therefore, the aim of this study is to determine the effect of LMSD on hypoxic cardiomyocytes, and to explore its mechanism of action on hypoxic cardiomyocytes, in order to promote its more rational use in clinical treatment. In this study, it was demonstrated through antioxidant experiments that LMSD has certain antioxidant capacity. In addition, adding LMSD to hypoxic cardiomyocytes can effectively reduce intracellular ROS levels and improve mitochondrial membrane potential changes caused by hypoxia. And reduce the Bax/Bcl-2 ratio, thereby reducing the apoptosis of myocardial cells under hypoxic conditions. The decrease in protein and mRNA expression levels of apoptotic protease activating factor‑1 (APAF-1) and Caspase-3 (CASP-3) in hypoxic cardiomyocytes demonstrates that LMSD effectively reduces apoptosis of hypoxic cardiomyocytes. Therefore, this study demonstrates that LMSD may reduce cell apoptosis by inhibiting mitochondrial damage under hypoxic conditions, and reveals the possible mechanism of LMSD's cardioprotective effect. Health sciences/Cardiology Biological sciences/Cell biology Health sciences/Diseases Biological sciences/Drug discovery myocardial ischemia Levosimendan antioxidant apoptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Cardiovascular ischemia (CVD) is a serious disease that poses a significant threat to human health, with high morbidity, disability, and mortality rates. It is more common in elderly people over 50 years old [1-5] . Research has shown that CVD ranks first in the proportion of disease deaths among urban and rural residents in China, with 2 out of every 5 deaths caused by CVD. With the improvement of medical and health standards and the acceleration of aging, the incidence of CVD has been increasing year by year, and there is a trend towards younger age groups [6-10] . In CVD treatment, actively improving cardiovascular ischemia is the main treatment method. In addition to surgical treatment, the effective and rational use of drugs can effectively improve the state of myocardial cells, thereby improving the prognosis of CVD [11-13] . Reactive oxygen species (ROS) are considered one of the important factors causing damage in CVD. During CVD, the main cause of ROS burst in cardiac cells is electron leakage mediated by damage to the electron transport chain in mitochondria and decreased oxidative phosphorylation activity [14-18] . Excessive ROS can induce myocardial cell apoptosis. As a permanent cells, prolonged hypoxia leading to excessive apoptosis of myocardial cells can directly affect the structure and function of the heart, ultimately resulting in disability or even death of patients [19-23] . Therefore, in the clinical treatment process, attention should be paid to the duration of myocardial ischemia and the use of drugs. Among them, Levosimendan (LMSD) is widely used in the treatment of CVD, mainly used 24 h after the occurrence of acute ischemia, which can effectively improve the contraction ability of the heart and improve heart failure [24-29] . However, in the actual clinical drug treatment process, it has been found that the use of LMSD seems to effectively improve the prognosis of CVD patients. Thus, LMSD may be able to improve the state of hypoxic myocardial cells, possibly due to the presence of two cyanide groups in LMSD, which have antioxidant capacity [30-33] . Therefore, in order to explore the role of LMSD in hypoxic myocardial cells, this study measured the antioxidant capacity of LMSD and showed that LMSD has a strong ability to scavenge hydroxyl radicals. And it can effectively improve the ROS content in hypoxic myocardial cells, restore the mitochondrial membrane potential of hypoxic myocardial cells, and ultimately reduce apoptosis of hypoxic myocardial cells. In addition, the decrease in the protein to mRNA ratio of Bax and Bcl-2 in cardiomyocytes, as well as the decrease in the expression levels of apoptotic protein activating factor-1 (APAF-1) and caspase-3 (CASP-3) proteins and mRNA, once again demonstrate that LMSD can inhibit mitochondrial damage under hypoxic conditions and reduce cell apoptosis. Results The antioxidant capacity of LMSD In order to determine the antioxidant capacity of LMSD, common reactive oxygen species such as H 2 O 2 , ·OH, and O 2 - were selected to verify the clearance ability of LMSD. The results of using the corresponding reagent kit indicate that the antioxidant capacity of LMSD increases with increasing concentration. As shown in Figure 1, however, LMSD has different resistance to different types of oxidants. 1 mg/mL LMSD can clear 98.37% of ·OH, slightly weaker to 82.56% for H 2 O 2 , and weakest to 57.69% for O 2 - . 2. The principle of LMSD oxide reaction Through previous research and analysis of complete reaction equations, as shown in equations S1 and S2, cyanide groups can react with hydrogen peroxide to form amides [ 34 ] . Firstly, the cyanide group undergoes electrophilic substitution reaction with water molecules, generating cyanide ions and hydroxide ions. Then, the ·OH in hydrogen peroxide undergoes an electrophilic substitution reaction with cyanide ions, oxidizing the cyanide ions to amides. Therefore, LMSD has a stronger ability to remove H 2 O 2 and ·OH, but a weaker ability to remove O 2 − . This reaction explains the antioxidant capacity of LMSD and its ability to distinguish different oxides, which is consistent with the experimental results mentioned above. CN- + H 2 O → HCN + OH- S1 OH- + HCN → CONH 2 + H 2 O S2 3. The protective ability of LMSD on hypoxic myocardial cells During myocardial infarction, the electron transfer chain of myocardial cell mitochondria is obstructed due to insufficient oxygen supply. Some electrons leak out from NADH dehydrogenase, succinate dehydrogenase, and cytochrome C reductase and are directly transferred to oxygen, resulting in the generation of a large amount of ROS, including H 2 O 2 , O 2 − and ·OH. A large amount of ROS will cause a series of hypoxic stress responses, ultimately leading to apoptosis of myocardial cells and resulting in impaired myocardial function. The damage to mitochondrial membrane potential is most evident in the oxidative stress response caused by hypoxia. Adding LMSD to hypoxic myocardial cells can significantly improve mitochondrial membrane potential. As shown in Fig. 2 a, 2 b, the membrane potential of hypoxic myocardial cells treated with LMSD can recover to 80.79% of that of normal cells. The change in mitochondrial membrane potential is a precursor condition for mitochondrial apoptosis, therefore LMSD can significantly reduce mitochondrial apoptosis. At the same time, the intracellular ROS content significantly decreased compared to the control group, with the 10 µM LMSD treatment group reducing the intracellular ROS content to 4.33%, as shown in Fig. 2 c, 2 d. The above results indicate that LMSD can effectively reduce changes in mitochondrial membrane potential and decrease the production of ROS. To investigate the improvement ability of LMSD on the viability of hypoxic cardiomyocytes, CCK-8 was used to determine the effect of LMSD on the state of hypoxic cardiomyocytes. As shown in Fig. 2 e, adding LMSD to hypoxic cardiomyocytes significantly improved their viability, with the 10 µM LMSD treatment group increasing cell viability to 87.96% of the Blank group. At the same time, the apoptosis status of cells was measured by cell flow cytometry, and the results are shown in Fig. 2 f, 2 g. LMSD can significantly reduce the apoptosis of hypoxic cardiomyocytes. Compared with the late apoptosis rate of 17.8% in the IR group, the addition of 10 µM LMSD reduced the late apoptosis rate to 8.34%. The above results indicate that adding LMSD to hypoxic cardiomyocytes can significantly reduce mitochondrial damage, thereby lowering intracellular ROS levels and ultimately leading to a significant decrease in cardiomyocyte apoptosis. 4. The effect of LMSD on mitochondrial apoptosis. Bcl-2 and Bax belong to the same family and determine whether to initiate apoptosis by regulating mitochondrial membrane permeability. Bax is a pro apoptotic protein, and its dimer opens channels on the mitochondrial membrane, increasing permeability and initiating the apoptotic process. Bcl-2 belongs to the category of proteins that inhibit apoptosis. Bcl-2 forms heterodimers with Bax, which can inhibit Bax from forming dimers and thus reduce mitochondrial apoptosis. [ 35 – 41 ] The expression levels of Bcl-2 and Bax in HL-1 cells treated with different methods were detected by WB, as shown in Figs. 3 a, b, and c. Compared with the Blank group, the expression of Bax increased in the IR group, while the expression of Bcl-2 decreased. After adding LMSD, the expression of Bax was significantly reduced, while the expression of Bcl-2 was significantly increased. Through analysis of the Bax/Bcl-2 ratio, the IR group showed a significant increase compared to the Blank group, while the addition of LMSD resulted in a significant decrease in the Bax/Bcl-2 ratio. In addition, mRNA of HL-1 cells treated with different methods was also detected. As shown in Figs. 3 e, 3 f and 3 g, the results are similar to the WB results. Compared with the Blank group, the IR group showed an increase in Bax expression while Bcl-2 expression decreased, and the Bax/Bcl-2 ratio increased, indicating an increase in mitochondrial apoptosis. Compared to the IR group, the 10 µM LMSD group showed a decrease in Bax expression, an increase in Bcl-2 expression, and a decrease in Bax/Bcl-2 ratio. The above results indicate that hypoxia can lead to mitochondrial apoptosis, and LMSD can reverse mitochondrial apoptosis. The reason for this may be that LMSD clears ROS produced in hypoxic cells, thereby reducing changes in mitochondrial membrane potential and ultimately leading to a decrease in mitochondrial apoptosis. 5. The effect of LMSD on cell apoptosis The above results indicate that LMSD can effectively inhibit mitochondrial apoptosis. Therefore, this study continues to explore the effect of LMSD on mitochondrial pathway induced cell apoptosis. APAF-1 and CASP-3 are important proteins involved in the mitochondrial pathway of cell apoptosis. The apoptotic protease activating factor APAF-1 can form a multimeric complex with cytochrome C released by mitochondria, recruit Caspase-9 precursors from the cytoplasm through the caspase recruitment domain at the amino end of APAF-1, and self cleave and activate them, initiating the caspase cascade reaction and activating downstream CASP3 to complete the cleavage of its corresponding substrate, causing cell apoptosis. Therefore, APAF-1 and CASP3 are important markers of the mitochondrial pathway in cell apoptosis. [ 42 – 49 ] Subsequently, WB detection was continued on the expression levels of APAF-1 and CASP-3 in HL-1 cells from different treatment groups. As shown in Figs. 4 a and 4 b, compared to the Blank group, the expression levels of APAF-1 and CASP-3 increased in the IR group, while the expression levels of APAF-1 and CASP-3 decreased in the hypoxic HL-1 treated with LMSD compared to the IR group. Moreover, the expression levels of APAF-1 and CASP3 were lower in the 10 µM LMSD group compared to the 5 µM LMSD group, indicating that LMSD can effectively reverse mitochondrial pathway apoptosis caused by hypoxia. In addition, this study also validated the mRNA expression levels of APAF-1 and CASP-3 in different treatment groups. As shown in Fig. 4 c, 4 d, similar to the WB results, the expression levels of APAF-1 and CASP-3 were increased in the IR group compared to the Blank group. Compared to the IR group, the LMSD group showed a decrease in the expression levels of APAF-1 and CASP-3 after treatment. The above results indicate that under hypoxic conditions, mitochondrial pathway apoptosis is stimulated, while the addition of LMSD significantly inhibits mitochondrial pathway apoptosis in cells. The reason may be that LMSD inhibits cell apoptosis by clearing ROS produced in hypoxic cells and suppressing mitochondrial apoptosis. Discussion In this study, it was found that LMSD has a certain antioxidant capacity. Through experiments on the removal of three common oxides, it was shown that LMSD has the strongest ability to remove ·OH and the ability to remove O 2 − reaches over 50%. This antioxidant activity may come from the cyanide group carried by LMSD, which has electron withdrawing ability. Subsequently, it was demonstrated in cell experiments that hypoxia can cause damage to HL-1 cardiomyocytes, including changes in mitochondrial membrane potential and an increase in intracellular ROS, which subsequently leads to a decrease in HL-1 cell viability and an increase in apoptosis rate. The addition of LMSD can significantly reverse the damage caused by hypoxia to HL-1, including maintaining mitochondrial membrane potential, reducing intracellular ROS levels, ultimately maintaining HL-1 cell viability in hypoxic environments, and reducing HL-1 apoptosis in hypoxic environments. Subsequently, this study continued to investigate the mechanism by which LMSD reduces apoptosis in hypoxic HL-1 cells. By detecting the protein and mRNA expression of Bax, Bcl-2, APAF-1, and CASP3 in cells, the results showed that Bax/Bcl-2, which is associated with mitochondrial apoptosis, was significantly reduced compared to the IR group, and the downstream expression of APAF-1 and CASP3, which are associated with cell apoptosis, was significantly reduced compared to the IR group. Therefore, it is inferred that LMSD may reduce intracellular ROS levels through its antioxidant capacity, thereby alleviating ROS damage to mitochondria and reducing mitochondrial pathway apoptosis, thereby achieving the protective effect of LSMD on hypoxic HL-1. This study is the first to explain the protective effect of LMSD on hypoxic cardiomyocytes from a molecular perspective. LMSD may reduce myocardial cell apoptosis caused by hypoxia during myocardial infarction, play a cardioprotective role, and may improve the prognosis of patients. Provide theoretical basis for the clinical use of LMSD. Experimental methods and reagents 1. Reagents: Purchase JC-1 mitochondrial membrane potential detection kit and ROS detection kit from Wuhan Servicebio Co., Ltd. Annexin V-EGFP/PI cell Apoptosis Detection Kit. Purchase hydrogen peroxide assay kit and superoxide assay kit from Shanghai Beyotime Co., Ltd. 2. LMSD removes H 2 O 2 The H 2 O 2 scavenging ability was tested using a hydrogen peroxide detection kit. H 2 O 2 reacts with ammonium molybdate to form a stable yellow complex, which exhibits an absorbance peak at 405 nm. Different concentrations of LMSD (0-1.4 mg/mL) were incubated with 2 mM H 2 O 2 at 37°C for 2 hours. After incubation, the concentration of remaining H 2 O 2 is determined according to the instructions of the reagent kit. 3. LMSD clearing ·OH Measure the clearance ability of LMSD towards ·OH using TMB colorimetric method. Add 1 mM FeSO 4 to 2 mM hydrogen peroxide to prepare ·OH, add different concentrations of LMSD (0-1.4 mg/mL) to the prepared ·OH solution, incubate in the dark for 5 min, and then measure the absorbance peak at 652 nm in the solution using a UV spectrophotometer to calculate the concentration of ·OH in the solution. 4. LMSD clears scavenge superoxide anions (O) Use a ROS Assay Kit for Superoxide Anion with DHE to determine the ability of LMSD to O 2 − . Add different concentrations of LMSD (0-1.4 mg/mL) to the working solution. After standing for 10 minutes, measure the absorbance at 550nm using an enzyme-linked immunosorbent assay (ELISA) reader to calculate the remaining O 2 − content in the solution. 5. Cell culture and experimental protocol The HL-1 cells used in this study were sourced from the cell bank of the research center of the Third Hospital of Jilin University. The HL-1 cells in the cell bank of Jilin University Third Hospital were purchased from Shanghai Fuheng Biotechnology Co. HL-1 cardiomyocytes were cultured in DMEM medium containing 10% fetal bovine serum and 1% penicillin/streptomycin, under moist conditions of 37°C and 5% carbon dioxide in an incubator. Cardiomyocytes (HL-1) were subjected to hypoxia treatment and treated at 80–90% cell growth. After replacing the cell culture medium, transfer the cells to an anaerobic incubator with an oxygen concentration of less than 5% to simulate the hypoxic environment of cardiomyocytes. During the processing, the cell experiments were divided into four groups: (i) control group (Blank): cardiomyocytes were cultured under normal conditions; (ii) Hypoxia group (IR): cardiomyocytes cultured under hypoxic conditions; (iii) Low dose administration group (5 µM LMSD): Before culturing cardiomyocytes under hypoxic conditions, they were replaced with a medium containing 5 µM LMSD; (iv) Normal dose administration group (10 µM LMSD): Before culturing cardiomyocytes under hypoxic conditions, they were replaced with a medium containing 10 µM LMSD. 6. Cell viability assay. Measure cell viability using the CCK-8 method. Spread 50% cells in a 96 well plate and culture for 12 h in the culture medium until the cells fully adhere to the wall. After culturing under hypoxic conditions for 24 h, cells were treated differently according to the cell experimental grouping scheme. After further culturing for 24 h, detection reagents were added according to the instructions of the CCK-8 kit, and absorbance values were measured using an enzyme-linked immunosorbent assay (ELISA) reader at a wavelength of 450 nanometers. Finally, cell viability was calculated. 7. Apoptosis measurement Use Annexin V-fluorescent isothiocyanate (FITC)/propidium iodide (PI) assay kit to detect cell apoptosis. According to the cell experiment protocol, collect cells from different treatment groups (3×10 6 cells), process them according to the instructions of the kit, and use flow cytometry to determine the apoptosis of cells under different treatment groups. 8. RT-qPCR Reverse transcription quantitative polymerase chain reaction (RT qPCR). Trizol was used to extract total RNA from cells, and mRNA was transcribed into cDNA using a reverse transcription kit. The reverse transcription process involved heating at 37°C for 15 min, heating at 85°C for 5 s, and cooling at 4°C to obtain cDNA. Use a fluorescent quantitative PCR kit and add each component according to the instructions. The PCR process is shown in Table 1. The expression results of relevant genes were analyzed using the 2 △△Ct method. All primer designs and synthesis were sourced from Shanghai Sangon Bioengineering Technology Service Co., Ltd. The primer sequences are shown in Table 2. Table 1 PCR process Segment 温度 时间 Cycle 1 95℃ 5 min 2 98℃ 30 s Seg. 2–4 40x 3 65℃ 30 s 4 72℃ 45 s 5 72℃ 5 min 6 10℃ Hold Table 2 Primer sequences in the present study Gene Primer sequences (5'-3') Bax forward GGCGATGAACTGGACAACAA Bax reverse CAGTTGAAGTTGCCGTCTGC Bcl-2 forward CACGGTGGTGGAGGAACTCT Bcl-2 reverse TCCACAGAGCGATGTTGTCC APAF-1 forward CAAGGACACAGACGGTGGAA APAF-1 reverse TGAATCGCACTGACCAGCTT Caspase-3 forward CCATCCTTCAGTGGTGGACA Caspase-3 reverse TTGAGGCTGCTGCATAATCG 9. Western blot analysis HL-1 cardiomyocytes after different treatments were extracted using Membrane and Cytosol Protein Extraction Kit, and the supernatant containing protein was collected at 4 ℃. Measure protein concentration using BCA protein concentration assay kit. Then, the extracted protein was denatured at 100 ℃ for 10 min, separated by SDS-PAGE (12% separation gel and 5% stacking gel) electrophoresis, and then transferred to the polyvinylidene fluoride (PVDF) membrane. Seal the PVDF membrane with 5% skim milk at room temperature for 1 hour, then incubate with specific primary antibody and overnight at 4 ℃. After washing three times, incubate the secondary antibody for two hours. After washing three times, add ECL, complete exposure in a chemiluminescence analyzer, and automatically read the grayscale value. The primary antibodies of Bax, Bcl-1, CASP-3, and APAF-1 are all from rabbits, and the secondary antibodies are HRP labeled sheep anti rabbit antibodies. All antibodies were purchased from Servicebio Co., Ltd. 10. Statistical analysis All data are presented as mean ± standard deviation and analyzed using SPSS software version 17.0. The differences between the two groups were evaluated using independent sample t-test. P < 0.05 is considered a statistically significant difference. 11. Experimental License Statement All methods were carried out in accordance with relevant guidelines and regulations. All experimental protocols were approved by the Ethics Committee of Jilin University. Declarations Authors' contributions LZ, RF and HC conceptualized, designed and administrated the present study. SQ Z and QS performed cell experiments, data analysis and interpretation. ZZ and WH performed other cell experiments. SQ Z wrote the manuscript. All authors read and approved the final version of the manuscript. Data availability The datasets used and/or analysed during the current study available from the corresponding author on reasonable request. Competing interests The authors declare no competing interests. Funding Statement No funding. References Berry, C. & Duncker, D. Coronary microvascular dysfunction in Cardiovascular Research: Time to turn on the spotlight! Eur. Heart J. 41 (5), 612–613 (2020). Loosli, J. et al. Temporal trends in the prevalence of cardiovascular and non-cardiovascular comorbidities in patients presenting with acute myocardial infarction: Insights from the AMIS Plus registry. European Heart Journal 44 , ehad655.1412. (2023). Mohebi, R. et al. Cardiovascular Disease Projections in the United States Based on the 2020 Census Estimates. J. Am. Coll. Cardiol. 80 (6), 565–578 (2022). Raleigh, V. & Colombo, F. Cardiovascular disease should be a priority for health systems globally. BMJ 382 , e076576 (2023). Zhang, Y. et al. Superoxide anion-responsive persulfide and all-trans retinoic acid co-donating peptide assemblies attenuate myocardial ischemia-reperfusion injury. Biomaterials 320 , 123276 (2025). Rodrigues, L. P. et al. Multimorbidity patterns and hospitalisation occurrence in adults and older adults aged 50 years or over. Sci. Rep. 12 (1), 11643 (2022). Neumann, J. T. et al. Cardiovascular risk prediction in healthy older people. GeroScience 44 (1), 403–413 (2022). Sigala, E. G. et al. The interplay between sex, lifestyle factors and built environment on 20-year cardiovascular disease incidence; the ATTICA study (2002–2022). Frontiers in Cardiovascular Medicine Volume 11–2024 . (2025). Kaski, J. C. & Tamargo, J. Cardiovascular pharmacotherapy in older people: challenges posed by cardiovascular drug prescription in the elderly. Eur. Heart J. - Cardiovasc. Pharmacotherapy . 6 (5), 277–279 (2020). Forman, D. E. et al. Multimorbidity in Older Adults With Cardiovascular Disease. J. Am. Coll. Cardiol. 71 (19), 2149–2161 (2018). Molaei, A., Emad, M., Wallace, H. A. & Karimi, G. Mas receptor: a potential strategy in the management of ischemic cardiovascular diseases. Cell. Cycle . 22 (13), 1654–1674 (2023). Saglio, G. et al. Evaluation of cardiovascular ischemic event rates in dasatinib-treated patients using standardized incidence ratios. Ann. Hematol. 96 (8), 1303–1313 (2017). Ferdinandy, P. et al. Interaction of Cardiovascular Nonmodifiable Risk Factors, Comorbidities and Comedications With Ischemia/Reperfusion Injury and Cardioprotection by Pharmacological Treatments and Ischemic Conditioning. Pharmacol. Rev. 75 (1), 159–216 (2023). Liao, X. et al. An injectable co-assembled hydrogel blocks reactive oxygen species and inflammation cycle resisting myocardial ischemia-reperfusion injury. Acta Biomater. 149 , 82–95 (2022). Li, X. et al. Nanomedicine-Based Therapeutics for Myocardial Ischemic/Reperfusion Injury. Adv. Healthc. Mater. 12 (20), 2300161 (2023). Xiang, Q., Yi, X., Zhu, X. H. & Wei, X. Regulated cell death in myocardial ischemia–reperfusion injury. Trends Endocrinol. Metabolism . 35 (3), 219–234 (2024). Hu, X. et al. Supramolecular self-assembled nanoparticles camouflaged with neutrophil membrane to mitigate myocardial ischemia/reperfusion (I/R) injury. Chem. Eng. J. 480 , 148138 (2024). Sun, Y. et al. Light-Activated Gold–Selenium Core–Shell Nanocomposites with NIR-II Photoacoustic Imaging Performances for Heart-Targeted Repair. ACS Nano . 16 (11), 18667–18681 (2022). Xie, H. et al. Electron transfer between cytochrome c and microsomal monooxygenase generates reactive oxygen species that accelerates apoptosis. Redox Biol. 53 , 102340 (2022). Mamalis, A., Koo, E., Sckisel, G. D., Siegel, D. M. & Jagdeo, J. Temperature-dependent impact of thermal aminolaevulinic acid photodynamic therapy on apoptosis and reactive oxygen species generation in human dermal fibroblasts. Br. J. Dermatol. 175 (3), 512–519 (2016). Sade, H. & Sarin, A. Reactive oxygen species regulate quiescent T-cell apoptosis via the BH3-only proapoptotic protein BIM. Cell. Death Differ. 11 (4), 416–423 (2004). Giannoni, E. et al. Redox regulation of anoikis: reactive oxygen species as essential mediators of cell survival. Cell. Death Differ. 15 (5), 867–878 (2008). Fei, C., Cai, X. Z., Liu, H. P. & Wang, J. H. GW27-e1146 PICK1 inhibition restores myocardial injury by suppressing reactive oxygen species generation and apoptosis in diabetic rats. Journal of the American College of Cardiology 68 (16, Supplement), C67. (2016). Blaschke, M., Kiwi, A. & Hagl, C. Intermittent therapy with levosimendan in patients with advanced heart failure. European Heart Journal 42 (Supplement_1), (2021). ehab724.0950. Chen, X., Zhang, X., Gross, S., Houser, S. R. & Soboloff J. Acetylation of SERCA2a, Another Target for Heart Failure Treatment? Circulation Research 124 (9), 1285–1287. (2019). Sharkey, S. W., Maron, B. J. & Kloner, R. A. The Case for Takotsubo Cardiomyopathy (Syndrome) as a Variant of Acute Myocardial Infarction. Circulation 138 (9), 855–857 (2018). Kula-Alwar, D. & Prag, H. A. Krieg, T. Targeting Succinate Metabolism in Ischemia/Reperfusion Injury. Circulation 140 (24), 1968–1970 (2019). Vilahur, G. et al. Administration of a soluble ADPase, AZD3366, on top of ticagrelor confers additional cardioprotective benefits to that of ticagrelor alone. European Heart Journal 41 (Supplement_2), ehaa946.3772. (2020). James, M. & Manns, B. N. Inhibition and Effects on Kidney Function and Surrogates of Cardiovascular Risk in Chronic Kidney Disease. Circulation 138 (15), 1515–1518 (2018). Zhang, P. et al. Enzymatic acylation of cyanidin-3-glucoside with fatty acid methyl esters improves stability and antioxidant activity. Food Chem. 343 , 128482 (2021). Timralieva, A. A. et al. Melamine Barbiturate as a Light-Induced Nanostructured Supramolecular Material for a Bioinspired Oxygen and Organic Radical Trap and Stabilization. ACS Omega . 8 (9), 8276–8284 (2023). Fotiou, T. et al. Assessment of the roles of reactive oxygen species in the UV and visible light photocatalytic degradation of cyanotoxins and water taste and odor compounds using C–TiO2. Water Res. 90 , 52–61 (2016). Zhang, Y. et al. Magnesium hexacyanoferrate mitigates sepsis-associated encephalopathy through inhibiting microglial activation and neuronal cuproptosis. Biomaterials 321 , 123279 (2025). Tan, H. et al. Controllable Generation of Reactive Oxygen Species on Cyano-Group-Modified Carbon Nitride for Selective Epoxidation of Styrene. Innov. (Cambridge (Mass)) . 2 (1), 100089 (2021). Salvador-Gallego, R. et al. Bax assembly into rings and arcs in apoptotic mitochondria is linked to membrane pores. EMBO J. 35 (4), 389–401 (2016). Wolf, P. & Schoeniger, A. Pro-apoptotic complexes of BAX and BAK on the outer mitochondrial membrane. Biochim. et Biophys. Acta (BBA) - Mol. Cell. Res. 1869 (10), 119317 (2022). Gahl, R. F. & Dwivedi, P. Bcl-2 proteins bid and bax form a network to permeabilize the mitochondria at the onset of apoptosis. Cell Death Dis. 7 (10), e2424–e2424 (2016). Sovilj, D. et al. Cell-specific modulation of mitochondrial respiration and metabolism by the pro-apoptotic Bcl-2 family members Bax and Bak. Apoptosis 29 (3), 424–438 (2024). Tang, Q. et al. Bim- and Bax-mediated mitochondrial pathway dominates abivertinib-induced apoptosis and ferroptosis. Free Radic. Biol. Med. 180 , 198–209 (2022). Yamazaki, T. & Galluzzi, L. BAX and BAK dynamics control mitochondrial DNA release during apoptosis. Cell. Death Differ. 29 (6), 1296–1298 (2022). Lee, Y. S. et al. BAX-dependent mitochondrial pathway mediates the crosstalk between ferroptosis and apoptosis. Apoptosis 25 (9), 625–631 (2020). Noori, A. R., Hosseini, E. S. & Nikkhah, M. Apoptosome formation upon overexpression of native and truncated Apaf-1 in cell-free and cell-based systems. Arch. Biochem. Biophys. 642 , 46–51 (2018). Ruan, J. et al. Apaf-1 is an evolutionarily conserved DNA sensor that switches the cell fate between apoptosis and inflammation. Cell. Discovery . 11 (1), 4 (2025). Song, X. et al. Cytosolic cytochrome c represses ferroptosis. Cell Metabolism (2025). Shakeri, R. & Kheirollahi, A. Apaf-1: Regulation and function in cell death. Biochimie 135 , 111–125 (2017). Kugler, W. et al. Downregulation of Apaf-1 and caspase-3 by RNA interference in human glioma cells: Consequences for erucylphosphocholine-induced apoptosis. Apoptosis 10 (5), 1163–1174 (2005). Zou, H. et al. Regulation of the Apaf-1/Caspase-9 Apoptosome by Caspase-3 and XIAP*. J. Biol. Chem. 278 (10), 8091–8098 (2003). Hoppe, J., Kilic, M., Hoppe, V. & Sachinidis, A. Formation of caspase-3 complexes and fragmentation of caspase-12 during anisomycin-induced apoptosis in AKR-2B cells without aggregation of Apaf-1. Eur. J. Cell Biol. 81 (10), 567–576 (2002). Bratton, S. B., Lewis, J., Butterworth, M. & Duckett, C. S. XIAP inhibition of caspase-3 preserves its association with the Apaf-1 apoptosome and prevents CD95- and Bax-induced apoptosis. Cell. Death Differ. 9 (9), 881–892 (2002). Additional Declarations No competing interests reported. Supplementary Files supportinformation.pdf Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 04 Feb, 2026 Reviews received at journal 28 Jan, 2026 Reviews received at journal 21 Jan, 2026 Reviewers agreed at journal 16 Jan, 2026 Reviewers agreed at journal 16 Jan, 2026 Reviewers invited by journal 16 Jan, 2026 Editor assigned by journal 17 Dec, 2025 Editor invited by journal 29 Sep, 2025 Submission checks completed at journal 26 Sep, 2025 First submitted to journal 26 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7676499","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":576141206,"identity":"31fc2b45-cc03-4fb7-a890-efb0786d87f2","order_by":0,"name":"Siqi Zhao","email":"","orcid":"","institution":"The Third Bethune Hospital of Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Siqi","middleName":"","lastName":"Zhao","suffix":""},{"id":576141207,"identity":"b1b821ae-6fd0-400d-bce4-95df06159368","order_by":1,"name":"Hong Chang","email":"","orcid":"","institution":"The Third Bethune Hospital of Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Hong","middleName":"","lastName":"Chang","suffix":""},{"id":576141208,"identity":"74fed5b5-7a79-4700-8e64-dbef7425e972","order_by":2,"name":"Qian Sun","email":"","orcid":"","institution":"Changchun Normal University","correspondingAuthor":false,"prefix":"","firstName":"Qian","middleName":"","lastName":"Sun","suffix":""},{"id":576141209,"identity":"7d56f9c9-b5ec-49ce-a85d-134b257ceee4","order_by":3,"name":"Rui Fei","email":"","orcid":"","institution":"The Third Bethune Hospital of Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Rui","middleName":"","lastName":"Fei","suffix":""},{"id":576141210,"identity":"3fe7720e-17cd-4e12-b2be-62572bab13e5","order_by":4,"name":"Lei Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9klEQVRIie3RsYrCMBjA8a8U6hLqjQkp+gqfCL1Frq8SEXSp0EncFApOPkDvLTrd3ONAHcS5Y13chIIibprIuaa6CeY/JAS+H4QEwGR6wYJErRGQei3OsFCHrIJYN4JA2HwhUDxDAPMQ4SFi83i3PWLHk6SMujNouLmwDpGGON7is+1hn7D1PkVJ2iwXNk80hFDhc4p/xF0Ob6Sb5sKxiYZQOjhJciGQhYUik0qCNPRZiRn5WIWgiMAHyIgD9tQjI4oNbX2vtzHXkSAZ/LDz+CuQX7nDctRpusve70FHVPdrOPJ7qNytaQWQI+d/WlSOmkwm01t2BQViSop5lXBrAAAAAElFTkSuQmCC","orcid":"","institution":"The Third Bethune Hospital of Jilin University","correspondingAuthor":true,"prefix":"","firstName":"Lei","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2025-09-22 13:23:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7676499/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7676499/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":100695378,"identity":"4b4737eb-30aa-43db-a887-8f62b023c796","added_by":"auto","created_at":"2026-01-20 14:54:36","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1503511,"visible":true,"origin":"","legend":"","description":"","filename":"Levosimendan.docx","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/084c10b7306367b476f55ee7.docx"},{"id":100695341,"identity":"7630041a-dfd5-4e21-acdc-a99a43abc02d","added_by":"auto","created_at":"2026-01-20 14:53:36","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6541,"visible":true,"origin":"","legend":"","description":"","filename":"59b002a0a7244c09b67f47cf344bef7f.json","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/637c39a10f2466007825059d.json"},{"id":100695735,"identity":"be489369-9698-4b97-9d7a-3cfbbf331e66","added_by":"auto","created_at":"2026-01-20 14:57:36","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":291862,"visible":true,"origin":"","legend":"","description":"","filename":"supportinformation.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/650d4867c8245b7f35ede3de.pdf"},{"id":100695391,"identity":"63b5a161-86e0-4d1e-b115-0b9e19e3fc90","added_by":"auto","created_at":"2026-01-20 14:54:49","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":110055,"visible":true,"origin":"","legend":"","description":"","filename":"59b002a0a7244c09b67f47cf344bef7f1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/10aa600d0b57c2874b4cff75.xml"},{"id":100695395,"identity":"fc18b625-aba4-4311-bde4-613c321b958d","added_by":"auto","created_at":"2026-01-20 14:55:00","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":184208,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/9825bb4e6fe3132551ec3f77.jpeg"},{"id":100695352,"identity":"f6cde71b-56bc-4b1e-816b-e001d6aa36ce","added_by":"auto","created_at":"2026-01-20 14:53:54","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":667296,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/95df31055d7bf5d3a7682172.jpeg"},{"id":100695337,"identity":"849a0a68-aafb-486a-8bb1-7d07b168d031","added_by":"auto","created_at":"2026-01-20 14:53:34","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":262960,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/314583e79ac9f67e584fd7f0.jpeg"},{"id":100695950,"identity":"709cb060-5306-4609-bf46-9e922432f80e","added_by":"auto","created_at":"2026-01-20 14:58:42","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":345670,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/440e3f7e9bd6d8694f3d289a.jpeg"},{"id":100695394,"identity":"96ce42b4-4c72-42cc-8b8a-eb003871bbba","added_by":"auto","created_at":"2026-01-20 14:54:52","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":20678,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/1eea2dd21f505d9e6659d6ba.png"},{"id":100695450,"identity":"a4ccfd1e-9cf7-4b2b-a41e-14650bad90b4","added_by":"auto","created_at":"2026-01-20 14:55:48","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":87473,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/6ac2641441aa618a0aa3364d.png"},{"id":100695390,"identity":"f6c167fc-ab12-4e1f-89e5-06dd54fe8665","added_by":"auto","created_at":"2026-01-20 14:54:49","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":45614,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/9fab9840d33c721e0736cafb.png"},{"id":100695353,"identity":"81536dab-e4c7-40f0-99b2-ae45e06590e8","added_by":"auto","created_at":"2026-01-20 14:53:55","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":45271,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/44d24298aaba8f9fec5f5cfa.png"},{"id":100695411,"identity":"b4831e37-635d-4449-a5e9-c71a206da6dc","added_by":"auto","created_at":"2026-01-20 14:55:14","extension":"xml","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":107515,"visible":true,"origin":"","legend":"","description":"","filename":"59b002a0a7244c09b67f47cf344bef7f1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/71b7e9f6b78e487c9b5b15f2.xml"},{"id":100696013,"identity":"cf43ad4f-deac-4c0d-8e3e-5fe8b749be07","added_by":"auto","created_at":"2026-01-20 14:59:40","extension":"html","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":119570,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/055118e286362da52b42ee3f.html"},{"id":100695351,"identity":"c6bb8ad8-9730-4bd9-966a-9c19ddee29df","added_by":"auto","created_at":"2026-01-20 14:53:54","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":181680,"visible":true,"origin":"","legend":"\u003cp\u003eThe scavenging ability of LMSD on H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (a), O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u003c/sup\u003e (b), and ·OH (c). The data represents the mean SD of 5 independent replicates.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/dc4a0cca73a37c3484084833.png"},{"id":100695354,"identity":"f9e9e0af-74f1-46df-975b-61de8df439f6","added_by":"auto","created_at":"2026-01-20 14:53:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":573653,"visible":true,"origin":"","legend":"\u003cp\u003e(a) Fluorescence images of HL-1 mitochondrial membrane potential after different treatments. J-aggregates polymer (Red), J-aggregates monomer (Green). Scale bar, 200 μm. (b) The proportion of polymer and monomer fluorescence in each group. (c) The ROS content in HL-1 cells after different treatments was labeled with DCFH-DA (Green). Scale bar, 200 μm. (d) Quantitative analysis of DCFH-DA fluorescence intensity in each group. (e) The CCK-8 method was used to determine the viability of HL-1 cells after different treatments. (f) Annexin V-EGFP/propidium iodide (PI) flow cytometry results of HL-1 cells under different treatment conditions. (g) Quantitative statistical results of apoptotic cell ratio. Values are presented as the mean ± standard deviation; n=3; *P\u0026lt;0.05 vs. the IR group; **P\u0026lt;0.01 vs. the IR group; *** P\u0026lt;0.001 vs. the IR group.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/57761d861ad6fe3e1e7741c9.png"},{"id":100695898,"identity":"376ca0e3-9abc-4e19-86ea-c2bb10cd6662","added_by":"auto","created_at":"2026-01-20 14:58:21","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":269642,"visible":true,"origin":"","legend":"\u003cp\u003eRelative protein expression levels and ratios of Bax and Bcl-2. (a) Western blot analysis was used to detect the protein expression levels of Bax and Bcl-2 in HL-1 after different treatments. (b, c) Standardized protein expression levels (relative to β-actin). (d) The relative protein ratio of Bax/Bcl-2 in HL-1 cells. (e, f) Expression of Bax and Bcl-1 genes in HL-1 cells of different treatment groups. (g) The relative gene expression ratio of Bax/Bcl-2 in HL-1 cells. Values are presented as the mean ± standard deviation; n=3; *P\u0026lt;0.05 vs. the IR group; **P\u0026lt;0.01 vs. the IR group; *** P\u0026lt;0.001 vs. the IR group.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/d05026108c8d00c35c2426a9.png"},{"id":100695724,"identity":"e10c0f2a-fc9f-441e-bead-6582b6d4a867","added_by":"auto","created_at":"2026-01-20 14:57:31","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":336235,"visible":true,"origin":"","legend":"\u003cp\u003eRelative protein expression levels and ratios of APAF-1 and CASP3. (a) Western blot analysis was used to detect the protein expression levels of APAF-1 and CASP-3 in HL-1 after different treatments. (b) Standardized protein expression levels (relative to β-actin). (c, d) APAF-1 and CASP-3 gene expression in HL-1 cells of different treatment groups. Values are presented as the mean ± standard deviation; n=3; *P\u0026lt;0.05 vs. the IR group; **P\u0026lt;0.01 vs. the IR group; *** P\u0026lt;0.001 vs. the IR group.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/ee3468d6b13625add350b610.png"},{"id":100857723,"identity":"4792852f-7a5d-409a-8db1-2224572e2251","added_by":"auto","created_at":"2026-01-22 07:21:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2066714,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/6f9abed7-bc01-4803-bedd-f18f2751e1c1.pdf"},{"id":100695349,"identity":"f2bf41f8-2a45-4e84-b39a-4edd6a131aa3","added_by":"auto","created_at":"2026-01-20 14:53:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":291862,"visible":true,"origin":"","legend":"","description":"","filename":"supportinformation.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7676499/v1/1683a02b06ef6376880bd423.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Levosimendan can effectively reduce myocardial cell apoptosis caused by hypoxia through antioxidant activity","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCardiovascular ischemia (CVD) is a serious disease that poses a significant threat to human health, with high morbidity, disability, and mortality rates. It is more common in elderly people over 50 years old \u003csup\u003e[1-5]\u003c/sup\u003e. Research has shown that CVD ranks first in the proportion of disease deaths among urban and rural residents in China, with 2 out of every 5 deaths caused by CVD. With the improvement of medical and health standards and the acceleration of aging, the incidence of CVD has been increasing year by year, and there is a trend towards younger age groups \u003csup\u003e[6-10]\u003c/sup\u003e. In CVD treatment, actively improving cardiovascular ischemia is the main treatment method. In addition to surgical treatment, the effective and rational use of drugs can effectively improve the state of myocardial cells, thereby improving the prognosis of CVD \u003csup\u003e[11-13]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eReactive oxygen species (ROS) are considered one of the important factors causing damage in CVD. During CVD, the main cause of ROS burst in cardiac cells is electron leakage mediated by damage to the electron transport chain in mitochondria and decreased oxidative phosphorylation activity \u003csup\u003e[14-18]\u003c/sup\u003e. Excessive ROS can induce myocardial cell apoptosis. As a permanent cells, prolonged hypoxia leading to excessive apoptosis of myocardial cells can directly affect the structure and function of the heart, ultimately resulting in disability or even death of patients \u003csup\u003e[19-23]\u003c/sup\u003e. Therefore, in the clinical treatment process, attention should be paid to the duration of myocardial ischemia and the use of drugs. Among them, Levosimendan (LMSD) is widely used in the treatment of CVD, mainly used 24 h after the occurrence of acute ischemia, which can effectively improve the contraction ability of the heart and improve heart failure \u003csup\u003e[24-29]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eHowever, in the actual clinical drug treatment process, it has been found that the use of LMSD seems to effectively improve the prognosis of CVD patients. Thus, LMSD may be able to improve the state of hypoxic myocardial cells, possibly due to the presence of two cyanide groups in LMSD, which have antioxidant capacity \u003csup\u003e[30-33]\u003c/sup\u003e. Therefore, in order to explore the role of LMSD in hypoxic myocardial cells, this study measured the antioxidant capacity of LMSD and showed that LMSD has a strong ability to scavenge hydroxyl radicals. And it can effectively improve the ROS content in hypoxic myocardial cells, restore the mitochondrial membrane potential of hypoxic myocardial cells, and ultimately reduce apoptosis of hypoxic myocardial cells. In addition, the decrease in the protein to mRNA ratio of Bax and Bcl-2 in cardiomyocytes, as well as the decrease in the expression levels of apoptotic protein activating factor-1 (APAF-1) and caspase-3 (CASP-3) proteins and mRNA, once again demonstrate that LMSD can inhibit mitochondrial damage under hypoxic conditions and reduce cell apoptosis.\u003c/p\u003e"},{"header":"Results","content":"\u003col\u003e\n \u003cli\u003eThe antioxidant capacity of LMSD\u003c/li\u003e\n\u003c/ol\u003e\n\u003cp\u003eIn order to determine the antioxidant capacity of LMSD, common reactive oxygen species such as H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e,\u0026nbsp;\u0026middot;OH, and O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u003c/sup\u003e were selected to verify the clearance ability of LMSD. The results of using the corresponding reagent kit indicate that the antioxidant capacity of LMSD increases with increasing concentration. As shown in Figure 1, however, LMSD has different resistance to different types of oxidants. 1 mg/mL LMSD can clear 98.37% of\u0026nbsp;\u0026middot;OH, slightly weaker to 82.56% for H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, and weakest to 57.69% for O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e-\u003c/sup\u003e.\u003c/p\u003e\n\u003ch3\u003e2. The principle of LMSD oxide reaction\u003c/h3\u003e\n\u003cp\u003eThrough previous research and analysis of complete reaction equations, as shown in equations S1 and S2, cyanide groups can react with hydrogen peroxide to form amides \u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. Firstly, the cyanide group undergoes electrophilic substitution reaction with water molecules, generating cyanide ions and hydroxide ions. Then, the \u0026middot;OH in hydrogen peroxide undergoes an electrophilic substitution reaction with cyanide ions, oxidizing the cyanide ions to amides. Therefore, LMSD has a stronger ability to remove H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and \u0026middot;OH, but a weaker ability to remove O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e. This reaction explains the antioxidant capacity of LMSD and its ability to distinguish different oxides, which is consistent with the experimental results mentioned above.\u003c/p\u003e \u003cp\u003eCN- + H\u003csub\u003e2\u003c/sub\u003eO \u0026rarr; HCN\u0026thinsp;+\u0026thinsp;OH- S1\u003c/p\u003e \u003cp\u003eOH- + HCN \u0026rarr; CONH\u003csub\u003e2\u003c/sub\u003e\u0026thinsp;+\u0026thinsp;H\u003csub\u003e2\u003c/sub\u003eO S2\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003e3. The protective ability of LMSD on hypoxic myocardial cells\u003c/h3\u003e\n\u003cp\u003eDuring myocardial infarction, the electron transfer chain of myocardial cell mitochondria is obstructed due to insufficient oxygen supply. Some electrons leak out from NADH dehydrogenase, succinate dehydrogenase, and cytochrome C reductase and are directly transferred to oxygen, resulting in the generation of a large amount of ROS, including H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e and \u0026middot;OH. A large amount of ROS will cause a series of hypoxic stress responses, ultimately leading to apoptosis of myocardial cells and resulting in impaired myocardial function. The damage to mitochondrial membrane potential is most evident in the oxidative stress response caused by hypoxia. Adding LMSD to hypoxic myocardial cells can significantly improve mitochondrial membrane potential. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, the membrane potential of hypoxic myocardial cells treated with LMSD can recover to 80.79% of that of normal cells. The change in mitochondrial membrane potential is a precursor condition for mitochondrial apoptosis, therefore LMSD can significantly reduce mitochondrial apoptosis. At the same time, the intracellular ROS content significantly decreased compared to the control group, with the 10 \u0026micro;M LMSD treatment group reducing the intracellular ROS content to 4.33%, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed. The above results indicate that LMSD can effectively reduce changes in mitochondrial membrane potential and decrease the production of ROS. To investigate the improvement ability of LMSD on the viability of hypoxic cardiomyocytes, CCK-8 was used to determine the effect of LMSD on the state of hypoxic cardiomyocytes. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee, adding LMSD to hypoxic cardiomyocytes significantly improved their viability, with the 10 \u0026micro;M LMSD treatment group increasing cell viability to 87.96% of the Blank group. At the same time, the apoptosis status of cells was measured by cell flow cytometry, and the results are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eg. LMSD can significantly reduce the apoptosis of hypoxic cardiomyocytes. Compared with the late apoptosis rate of 17.8% in the IR group, the addition of 10 \u0026micro;M LMSD reduced the late apoptosis rate to 8.34%. The above results indicate that adding LMSD to hypoxic cardiomyocytes can significantly reduce mitochondrial damage, thereby lowering intracellular ROS levels and ultimately leading to a significant decrease in cardiomyocyte apoptosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003e4. The effect of LMSD on mitochondrial apoptosis.\u003c/h3\u003e\n\u003cp\u003eBcl-2 and Bax belong to the same family and determine whether to initiate apoptosis by regulating mitochondrial membrane permeability. Bax is a pro apoptotic protein, and its dimer opens channels on the mitochondrial membrane, increasing permeability and initiating the apoptotic process. Bcl-2 belongs to the category of proteins that inhibit apoptosis. Bcl-2 forms heterodimers with Bax, which can inhibit Bax from forming dimers and thus reduce mitochondrial apoptosis.\u003csup\u003e[\u003cspan additionalcitationids=\"CR36 CR37 CR38 CR39 CR40\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e The expression levels of Bcl-2 and Bax in HL-1 cells treated with different methods were detected by WB, as shown in Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b, and c. Compared with the Blank group, the expression of Bax increased in the IR group, while the expression of Bcl-2 decreased. After adding LMSD, the expression of Bax was significantly reduced, while the expression of Bcl-2 was significantly increased. Through analysis of the Bax/Bcl-2 ratio, the IR group showed a significant increase compared to the Blank group, while the addition of LMSD resulted in a significant decrease in the Bax/Bcl-2 ratio. In addition, mRNA of HL-1 cells treated with different methods was also detected. As shown in Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg, the results are similar to the WB results. Compared with the Blank group, the IR group showed an increase in Bax expression while Bcl-2 expression decreased, and the Bax/Bcl-2 ratio increased, indicating an increase in mitochondrial apoptosis. Compared to the IR group, the 10 \u0026micro;M LMSD group showed a decrease in Bax expression, an increase in Bcl-2 expression, and a decrease in Bax/Bcl-2 ratio. The above results indicate that hypoxia can lead to mitochondrial apoptosis, and LMSD can reverse mitochondrial apoptosis. The reason for this may be that LMSD clears ROS produced in hypoxic cells, thereby reducing changes in mitochondrial membrane potential and ultimately leading to a decrease in mitochondrial apoptosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003e5. The effect of LMSD on cell apoptosis\u003c/h3\u003e\n\u003cp\u003eThe above results indicate that LMSD can effectively inhibit mitochondrial apoptosis. Therefore, this study continues to explore the effect of LMSD on mitochondrial pathway induced cell apoptosis. APAF-1 and CASP-3 are important proteins involved in the mitochondrial pathway of cell apoptosis. The apoptotic protease activating factor APAF-1 can form a multimeric complex with cytochrome C released by mitochondria, recruit Caspase-9 precursors from the cytoplasm through the caspase recruitment domain at the amino end of APAF-1, and self cleave and activate them, initiating the caspase cascade reaction and activating downstream CASP3 to complete the cleavage of its corresponding substrate, causing cell apoptosis. Therefore, APAF-1 and CASP3 are important markers of the mitochondrial pathway in cell apoptosis. \u003csup\u003e[\u003cspan additionalcitationids=\"CR43 CR44 CR45 CR46 CR47 CR48\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/sup\u003e Subsequently, WB detection was continued on the expression levels of APAF-1 and CASP-3 in HL-1 cells from different treatment groups. As shown in Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb, compared to the Blank group, the expression levels of APAF-1 and CASP-3 increased in the IR group, while the expression levels of APAF-1 and CASP-3 decreased in the hypoxic HL-1 treated with LMSD compared to the IR group. Moreover, the expression levels of APAF-1 and CASP3 were lower in the 10 \u0026micro;M LMSD group compared to the 5 \u0026micro;M LMSD group, indicating that LMSD can effectively reverse mitochondrial pathway apoptosis caused by hypoxia. In addition, this study also validated the mRNA expression levels of APAF-1 and CASP-3 in different treatment groups. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed, similar to the WB results, the expression levels of APAF-1 and CASP-3 were increased in the IR group compared to the Blank group. Compared to the IR group, the LMSD group showed a decrease in the expression levels of APAF-1 and CASP-3 after treatment. The above results indicate that under hypoxic conditions, mitochondrial pathway apoptosis is stimulated, while the addition of LMSD significantly inhibits mitochondrial pathway apoptosis in cells. The reason may be that LMSD inhibits cell apoptosis by clearing ROS produced in hypoxic cells and suppressing mitochondrial apoptosis.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, it was found that LMSD has a certain antioxidant capacity. Through experiments on the removal of three common oxides, it was shown that LMSD has the strongest ability to remove ·OH and the ability to remove O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e−\u003c/sup\u003e reaches over 50%. This antioxidant activity may come from the cyanide group carried by LMSD, which has electron withdrawing ability. Subsequently, it was demonstrated in cell experiments that hypoxia can cause damage to HL-1 cardiomyocytes, including changes in mitochondrial membrane potential and an increase in intracellular ROS, which subsequently leads to a decrease in HL-1 cell viability and an increase in apoptosis rate. The addition of LMSD can significantly reverse the damage caused by hypoxia to HL-1, including maintaining mitochondrial membrane potential, reducing intracellular ROS levels, ultimately maintaining HL-1 cell viability in hypoxic environments, and reducing HL-1 apoptosis in hypoxic environments. Subsequently, this study continued to investigate the mechanism by which LMSD reduces apoptosis in hypoxic HL-1 cells. By detecting the protein and mRNA expression of Bax, Bcl-2, APAF-1, and CASP3 in cells, the results showed that Bax/Bcl-2, which is associated with mitochondrial apoptosis, was significantly reduced compared to the IR group, and the downstream expression of APAF-1 and CASP3, which are associated with cell apoptosis, was significantly reduced compared to the IR group. Therefore, it is inferred that LMSD may reduce intracellular ROS levels through its antioxidant capacity, thereby alleviating ROS damage to mitochondria and reducing mitochondrial pathway apoptosis, thereby achieving the protective effect of LSMD on hypoxic HL-1. This study is the first to explain the protective effect of LMSD on hypoxic cardiomyocytes from a molecular perspective. LMSD may reduce myocardial cell apoptosis caused by hypoxia during myocardial infarction, play a cardioprotective role, and may improve the prognosis of patients. Provide theoretical basis for the clinical use of LMSD.\u003c/p\u003e \n\n\n\n\n\n\n"},{"header":"Experimental methods and reagents","content":"\u003cp\u003e1. Reagents: Purchase JC-1 mitochondrial membrane potential detection kit and ROS detection kit from Wuhan Servicebio Co., Ltd. Annexin V-EGFP/PI cell Apoptosis Detection Kit. Purchase hydrogen peroxide assay kit and superoxide assay kit from Shanghai Beyotime Co., Ltd.\u003c/p\u003e\n\u003cp\u003e2. LMSD removes H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e\n\u003cp\u003eThe H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e scavenging ability was tested using a hydrogen peroxide detection kit. H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e reacts with ammonium molybdate to form a stable yellow complex, which exhibits an absorbance peak at 405 nm. Different concentrations of LMSD (0-1.4 mg/mL) were incubated with 2 mM H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C for 2 hours. After incubation, the concentration of remaining H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e is determined according to the instructions of the reagent kit.\u003c/p\u003e\n\u003ch3\u003e3. LMSD clearing \u0026middot;OH\u003c/h3\u003e\n\u003cp\u003eMeasure the clearance ability of LMSD towards \u0026middot;OH using TMB colorimetric method. Add 1 mM FeSO\u003csub\u003e4\u003c/sub\u003e to 2 mM hydrogen peroxide to prepare \u0026middot;OH, add different concentrations of LMSD (0-1.4 mg/mL) to the prepared \u0026middot;OH solution, incubate in the dark for 5 min, and then measure the absorbance peak at 652 nm in the solution using a UV spectrophotometer to calculate the concentration of \u0026middot;OH in the solution.\u003c/p\u003e\n\u003ch3\u003e4. LMSD clears scavenge superoxide anions (O)\u003c/h3\u003e\n\u003cp\u003eUse a ROS Assay Kit for Superoxide Anion with DHE to determine the ability of LMSD to O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e. Add different concentrations of LMSD (0-1.4 mg/mL) to the working solution. After standing for 10 minutes, measure the absorbance at 550nm using an enzyme-linked immunosorbent assay (ELISA) reader to calculate the remaining O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e content in the solution.\u003c/p\u003e\n\u003ch3\u003e5. Cell culture and experimental protocol\u003c/h3\u003e\n\u003cp\u003eThe HL-1 cells used in this study were sourced from the cell bank of the research center of the Third Hospital of Jilin University. The HL-1 cells in the cell bank of Jilin University Third Hospital were purchased from Shanghai Fuheng Biotechnology Co. HL-1 cardiomyocytes were cultured in DMEM medium containing 10% fetal bovine serum and 1% penicillin/streptomycin, under moist conditions of 37\u0026deg;C and 5% carbon dioxide in an incubator.\u003c/p\u003e\n\u003cp\u003eCardiomyocytes (HL-1) were subjected to hypoxia treatment and treated at 80\u0026ndash;90% cell growth. After replacing the cell culture medium, transfer the cells to an anaerobic incubator with an oxygen concentration of less than 5% to simulate the hypoxic environment of cardiomyocytes. During the processing, the cell experiments were divided into four groups: (i) control group (Blank): cardiomyocytes were cultured under normal conditions; (ii) Hypoxia group (IR): cardiomyocytes cultured under hypoxic conditions; (iii) Low dose administration group (5 \u0026micro;M LMSD): Before culturing cardiomyocytes under hypoxic conditions, they were replaced with a medium containing 5 \u0026micro;M LMSD; (iv) Normal dose administration group (10 \u0026micro;M LMSD): Before culturing cardiomyocytes under hypoxic conditions, they were replaced with a medium containing 10 \u0026micro;M LMSD.\u003c/p\u003e\n\u003ch3\u003e6. Cell viability assay.\u003c/h3\u003e\n\u003cp\u003eMeasure cell viability using the CCK-8 method. Spread 50% cells in a 96 well plate and culture for 12 h in the culture medium until the cells fully adhere to the wall. After culturing under hypoxic conditions for 24 h, cells were treated differently according to the cell experimental grouping scheme. After further culturing for 24 h, detection reagents were added according to the instructions of the CCK-8 kit, and absorbance values were measured using an enzyme-linked immunosorbent assay (ELISA) reader at a wavelength of 450 nanometers. Finally, cell viability was calculated.\u003c/p\u003e\n\u003ch3\u003e7. Apoptosis measurement\u003c/h3\u003e\n\u003cp\u003eUse Annexin V-fluorescent isothiocyanate (FITC)/propidium iodide (PI) assay kit to detect cell apoptosis. According to the cell experiment protocol, collect cells from different treatment groups (3\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells), process them according to the instructions of the kit, and use flow cytometry to determine the apoptosis of cells under different treatment groups.\u003c/p\u003e\n\u003ch3\u003e8. RT-qPCR\u003c/h3\u003e\n\u003cp\u003eReverse transcription quantitative polymerase chain reaction (RT qPCR). Trizol was used to extract total RNA from cells, and mRNA was transcribed into cDNA using a reverse transcription kit. The reverse transcription process involved heating at 37\u0026deg;C for 15 min, heating at 85\u0026deg;C for 5 s, and cooling at 4\u0026deg;C to obtain cDNA. Use a fluorescent quantitative PCR kit and add each component according to the instructions. The PCR process is shown in Table\u0026nbsp;1. The expression results of relevant genes were analyzed using the 2\u003csup\u003e△△Ct\u003c/sup\u003e method. All primer designs and synthesis were sourced from Shanghai Sangon Bioengineering Technology Service Co., Ltd. The primer sequences are shown in Table 2.\u003c/p\u003e\n\u003cdiv\u003e\u0026nbsp;\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 1\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003ePCR process\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSegment\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e温度\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e时间\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCycle\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e95℃\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5 min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e98℃\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30 s\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003eSeg. 2\u0026ndash;4 40x\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e65℃\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30 s\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e72℃\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e45 s\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e72℃\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5 min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10℃\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHold\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\u0026nbsp;\u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 2\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003ePrimer sequences in the present study\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer sequences (5\u0026apos;-3\u0026apos;)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBax forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCGATGAACTGGACAACAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBax reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAGTTGAAGTTGCCGTCTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBcl-2 forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCACGGTGGTGGAGGAACTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBcl-2 reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCCACAGAGCGATGTTGTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAPAF-1 forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAAGGACACAGACGGTGGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAPAF-1 reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGAATCGCACTGACCAGCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCaspase-3 forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCATCCTTCAGTGGTGGACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCaspase-3 reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTGAGGCTGCTGCATAATCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003ch3\u003e9. Western blot analysis\u003c/h3\u003e\n\u003cp\u003eHL-1 cardiomyocytes after different treatments were extracted using Membrane and Cytosol Protein Extraction Kit, and the supernatant containing protein was collected at 4 ℃. Measure protein concentration using BCA protein concentration assay kit. Then, the extracted protein was denatured at 100 ℃ for 10 min, separated by SDS-PAGE (12% separation gel and 5% stacking gel) electrophoresis, and then transferred to the polyvinylidene fluoride (PVDF) membrane. Seal the PVDF membrane with 5% skim milk at room temperature for 1 hour, then incubate with specific primary antibody and overnight at 4 ℃. After washing three times, incubate the secondary antibody for two hours. After washing three times, add ECL, complete exposure in a chemiluminescence analyzer, and automatically read the grayscale value. The primary antibodies of Bax, Bcl-1, CASP-3, and APAF-1 are all from rabbits, and the secondary antibodies are HRP labeled sheep anti rabbit antibodies. All antibodies were purchased from Servicebio Co., Ltd.\u003c/p\u003e\n\u003ch3\u003e10. Statistical analysis\u003c/h3\u003e\n\u003cp\u003eAll data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation and analyzed using SPSS software version 17.0. The differences between the two groups were evaluated using independent sample t-test. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 is considered a statistically significant difference.\u003c/p\u003e\n\u003ch3\u003e11. Experimental License Statement\u003c/h3\u003e\n\u003cp\u003eAll methods were carried out in accordance with relevant guidelines and regulations. All experimental protocols were approved by the Ethics Committee of Jilin University.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLZ, RF and HC conceptualized, designed and administrated the present study. SQ Z and QS performed cell experiments, data analysis and interpretation. ZZ and WH performed other cell experiments. SQ Z wrote the manuscript. All authors read and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo funding.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBerry, C. \u0026amp; Duncker, D. Coronary microvascular dysfunction in Cardiovascular Research: Time to turn on the spotlight! \u003cem\u003eEur. Heart J.\u003c/em\u003e \u003cb\u003e41\u003c/b\u003e (5), 612\u0026ndash;613 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLoosli, J. et al. Temporal trends in the prevalence of cardiovascular and non-cardiovascular comorbidities in patients presenting with acute myocardial infarction: Insights from the AMIS Plus registry. \u003cem\u003eEuropean Heart Journal 44\u003c/em\u003e, ehad655.1412. (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohebi, R. et al. Cardiovascular Disease Projections in the United States Based on the 2020 Census Estimates. \u003cem\u003eJ. Am. Coll. Cardiol.\u003c/em\u003e \u003cb\u003e80\u003c/b\u003e (6), 565\u0026ndash;578 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaleigh, V. \u0026amp; Colombo, F. Cardiovascular disease should be a priority for health systems globally. \u003cem\u003eBMJ\u003c/em\u003e \u003cb\u003e382\u003c/b\u003e, e076576 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, Y. et al. Superoxide anion-responsive persulfide and all-trans retinoic acid co-donating peptide assemblies attenuate myocardial ischemia-reperfusion injury. \u003cem\u003eBiomaterials\u003c/em\u003e \u003cb\u003e320\u003c/b\u003e, 123276 (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodrigues, L. P. et al. Multimorbidity patterns and hospitalisation occurrence in adults and older adults aged 50 years or over. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e (1), 11643 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNeumann, J. T. et al. Cardiovascular risk prediction in healthy older people. \u003cem\u003eGeroScience\u003c/em\u003e \u003cb\u003e44\u003c/b\u003e (1), 403\u0026ndash;413 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSigala, E. G. et al. The interplay between sex, lifestyle factors and built environment on 20-year cardiovascular disease incidence; the ATTICA study (2002\u0026ndash;2022). \u003cem\u003eFrontiers in Cardiovascular Medicine Volume 11\u0026ndash;2024\u003c/em\u003e. (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaski, J. C. \u0026amp; Tamargo, J. Cardiovascular pharmacotherapy in older people: challenges posed by cardiovascular drug prescription in the elderly. \u003cem\u003eEur. Heart J. - Cardiovasc. Pharmacotherapy\u003c/em\u003e. \u003cb\u003e6\u003c/b\u003e (5), 277\u0026ndash;279 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eForman, D. E. et al. Multimorbidity in Older Adults With Cardiovascular Disease. \u003cem\u003eJ. Am. Coll. Cardiol.\u003c/em\u003e \u003cb\u003e71\u003c/b\u003e (19), 2149\u0026ndash;2161 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMolaei, A., Emad, M., Wallace, H. A. \u0026amp; Karimi, G. Mas receptor: a potential strategy in the management of ischemic cardiovascular diseases. \u003cem\u003eCell. Cycle\u003c/em\u003e. \u003cb\u003e22\u003c/b\u003e (13), 1654\u0026ndash;1674 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaglio, G. et al. Evaluation of cardiovascular ischemic event rates in dasatinib-treated patients using standardized incidence ratios. \u003cem\u003eAnn. Hematol.\u003c/em\u003e \u003cb\u003e96\u003c/b\u003e (8), 1303\u0026ndash;1313 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerdinandy, P. et al. Interaction of Cardiovascular Nonmodifiable Risk Factors, Comorbidities and Comedications With Ischemia/Reperfusion Injury and Cardioprotection by Pharmacological Treatments and Ischemic Conditioning. \u003cem\u003ePharmacol. Rev.\u003c/em\u003e \u003cb\u003e75\u003c/b\u003e (1), 159\u0026ndash;216 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao, X. et al. An injectable co-assembled hydrogel blocks reactive oxygen species and inflammation cycle resisting myocardial ischemia-reperfusion injury. \u003cem\u003eActa Biomater.\u003c/em\u003e \u003cb\u003e149\u003c/b\u003e, 82\u0026ndash;95 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, X. et al. Nanomedicine-Based Therapeutics for Myocardial Ischemic/Reperfusion Injury. \u003cem\u003eAdv. Healthc. Mater.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e (20), 2300161 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiang, Q., Yi, X., Zhu, X. H. \u0026amp; Wei, X. Regulated cell death in myocardial ischemia\u0026ndash;reperfusion injury. \u003cem\u003eTrends Endocrinol. Metabolism\u003c/em\u003e. \u003cb\u003e35\u003c/b\u003e (3), 219\u0026ndash;234 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu, X. et al. Supramolecular self-assembled nanoparticles camouflaged with neutrophil membrane to mitigate myocardial ischemia/reperfusion (I/R) injury. \u003cem\u003eChem. Eng. J.\u003c/em\u003e \u003cb\u003e480\u003c/b\u003e, 148138 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun, Y. et al. Light-Activated Gold\u0026ndash;Selenium Core\u0026ndash;Shell Nanocomposites with NIR-II Photoacoustic Imaging Performances for Heart-Targeted Repair. \u003cem\u003eACS Nano\u003c/em\u003e. \u003cb\u003e16\u003c/b\u003e (11), 18667\u0026ndash;18681 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie, H. et al. Electron transfer between cytochrome c and microsomal monooxygenase generates reactive oxygen species that accelerates apoptosis. \u003cem\u003eRedox Biol.\u003c/em\u003e \u003cb\u003e53\u003c/b\u003e, 102340 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMamalis, A., Koo, E., Sckisel, G. D., Siegel, D. M. \u0026amp; Jagdeo, J. Temperature-dependent impact of thermal aminolaevulinic acid photodynamic therapy on apoptosis and reactive oxygen species generation in human dermal fibroblasts. \u003cem\u003eBr. J. Dermatol.\u003c/em\u003e \u003cb\u003e175\u003c/b\u003e (3), 512\u0026ndash;519 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSade, H. \u0026amp; Sarin, A. Reactive oxygen species regulate quiescent T-cell apoptosis via the BH3-only proapoptotic protein BIM. \u003cem\u003eCell. Death Differ.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e (4), 416\u0026ndash;423 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGiannoni, E. et al. Redox regulation of anoikis: reactive oxygen species as essential mediators of cell survival. \u003cem\u003eCell. Death Differ.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e (5), 867\u0026ndash;878 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFei, C., Cai, X. Z., Liu, H. P. \u0026amp; Wang, J. H. GW27-e1146 PICK1 inhibition restores myocardial injury by suppressing reactive oxygen species generation and apoptosis in diabetic rats. \u003cem\u003eJournal of the American College of Cardiology 68\u003c/em\u003e (16, Supplement), C67. (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlaschke, M., Kiwi, A. \u0026amp; Hagl, C. Intermittent therapy with levosimendan in patients with advanced heart failure. \u003cem\u003eEuropean Heart Journal\u003c/em\u003e \u003cb\u003e42\u003c/b\u003e (Supplement_1), (2021). ehab724.0950.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, X., Zhang, X., Gross, S., Houser, S. R. \u0026amp; Soboloff J. Acetylation of SERCA2a, Another Target for Heart Failure Treatment? \u003cem\u003eCirculation Research 124\u003c/em\u003e (9), 1285\u0026ndash;1287. (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharkey, S. W., Maron, B. J. \u0026amp; Kloner, R. A. The Case for Takotsubo Cardiomyopathy (Syndrome) as a Variant of Acute Myocardial Infarction. \u003cem\u003eCirculation\u003c/em\u003e \u003cb\u003e138\u003c/b\u003e (9), 855\u0026ndash;857 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKula-Alwar, D. \u0026amp; Prag, H. A. Krieg, T. Targeting Succinate Metabolism in Ischemia/Reperfusion Injury. \u003cem\u003eCirculation\u003c/em\u003e \u003cb\u003e140\u003c/b\u003e (24), 1968\u0026ndash;1970 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVilahur, G. et al. Administration of a soluble ADPase, AZD3366, on top of ticagrelor confers additional cardioprotective benefits to that of ticagrelor alone. \u003cem\u003eEuropean Heart Journal 41\u003c/em\u003e (Supplement_2), ehaa946.3772. (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJames, M. \u0026amp; Manns, B. N. Inhibition and Effects on Kidney Function and Surrogates of Cardiovascular Risk in Chronic Kidney Disease. \u003cem\u003eCirculation\u003c/em\u003e \u003cb\u003e138\u003c/b\u003e (15), 1515\u0026ndash;1518 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, P. et al. Enzymatic acylation of cyanidin-3-glucoside with fatty acid methyl esters improves stability and antioxidant activity. \u003cem\u003eFood Chem.\u003c/em\u003e \u003cb\u003e343\u003c/b\u003e, 128482 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTimralieva, A. A. et al. Melamine Barbiturate as a Light-Induced Nanostructured Supramolecular Material for a Bioinspired Oxygen and Organic Radical Trap and Stabilization. \u003cem\u003eACS Omega\u003c/em\u003e. \u003cb\u003e8\u003c/b\u003e (9), 8276\u0026ndash;8284 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFotiou, T. et al. Assessment of the roles of reactive oxygen species in the UV and visible light photocatalytic degradation of cyanotoxins and water taste and odor compounds using C\u0026ndash;TiO2. \u003cem\u003eWater Res.\u003c/em\u003e \u003cb\u003e90\u003c/b\u003e, 52\u0026ndash;61 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, Y. et al. Magnesium hexacyanoferrate mitigates sepsis-associated encephalopathy through inhibiting microglial activation and neuronal cuproptosis. \u003cem\u003eBiomaterials\u003c/em\u003e \u003cb\u003e321\u003c/b\u003e, 123279 (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan, H. et al. Controllable Generation of Reactive Oxygen Species on Cyano-Group-Modified Carbon Nitride for Selective Epoxidation of Styrene. \u003cem\u003eInnov. (Cambridge (Mass))\u003c/em\u003e. \u003cb\u003e2\u003c/b\u003e (1), 100089 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalvador-Gallego, R. et al. Bax assembly into rings and arcs in apoptotic mitochondria is linked to membrane pores. \u003cem\u003eEMBO J.\u003c/em\u003e \u003cb\u003e35\u003c/b\u003e (4), 389\u0026ndash;401 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWolf, P. \u0026amp; Schoeniger, A. Pro-apoptotic complexes of BAX and BAK on the outer mitochondrial membrane. \u003cem\u003eBiochim. et Biophys. Acta (BBA) - Mol. Cell. Res.\u003c/em\u003e \u003cb\u003e1869\u003c/b\u003e (10), 119317 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGahl, R. F. \u0026amp; Dwivedi, P. Bcl-2 proteins bid and bax form a network to permeabilize the mitochondria at the onset of apoptosis. \u003cem\u003eCell Death Dis.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e (10), e2424\u0026ndash;e2424 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSovilj, D. et al. Cell-specific modulation of mitochondrial respiration and metabolism by the pro-apoptotic Bcl-2 family members Bax and Bak. \u003cem\u003eApoptosis\u003c/em\u003e \u003cb\u003e29\u003c/b\u003e (3), 424\u0026ndash;438 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang, Q. et al. Bim- and Bax-mediated mitochondrial pathway dominates abivertinib-induced apoptosis and ferroptosis. \u003cem\u003eFree Radic. Biol. Med.\u003c/em\u003e \u003cb\u003e180\u003c/b\u003e, 198\u0026ndash;209 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamazaki, T. \u0026amp; Galluzzi, L. BAX and BAK dynamics control mitochondrial DNA release during apoptosis. \u003cem\u003eCell. Death Differ.\u003c/em\u003e \u003cb\u003e29\u003c/b\u003e (6), 1296\u0026ndash;1298 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee, Y. S. et al. BAX-dependent mitochondrial pathway mediates the crosstalk between ferroptosis and apoptosis. \u003cem\u003eApoptosis\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e (9), 625\u0026ndash;631 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoori, A. R., Hosseini, E. S. \u0026amp; Nikkhah, M. Apoptosome formation upon overexpression of native and truncated Apaf-1 in cell-free and cell-based systems. \u003cem\u003eArch. Biochem. Biophys.\u003c/em\u003e \u003cb\u003e642\u003c/b\u003e, 46\u0026ndash;51 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRuan, J. et al. Apaf-1 is an evolutionarily conserved DNA sensor that switches the cell fate between apoptosis and inflammation. \u003cem\u003eCell. Discovery\u003c/em\u003e. \u003cb\u003e11\u003c/b\u003e (1), 4 (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong, X. et al. Cytosolic cytochrome c represses ferroptosis. \u003cem\u003eCell Metabolism\u003c/em\u003e (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShakeri, R. \u0026amp; Kheirollahi, A. Apaf-1: Regulation and function in cell death. \u003cem\u003eBiochimie\u003c/em\u003e \u003cb\u003e135\u003c/b\u003e, 111\u0026ndash;125 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKugler, W. et al. Downregulation of Apaf-1 and caspase-3 by RNA interference in human glioma cells: Consequences for erucylphosphocholine-induced apoptosis. \u003cem\u003eApoptosis\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e (5), 1163\u0026ndash;1174 (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZou, H. et al. Regulation of the Apaf-1/Caspase-9 Apoptosome by Caspase-3 and XIAP*. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cb\u003e278\u003c/b\u003e (10), 8091\u0026ndash;8098 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoppe, J., Kilic, M., Hoppe, V. \u0026amp; Sachinidis, A. Formation of caspase-3 complexes and fragmentation of caspase-12 during anisomycin-induced apoptosis in AKR-2B cells without aggregation of Apaf-1. \u003cem\u003eEur. J. Cell Biol.\u003c/em\u003e \u003cb\u003e81\u003c/b\u003e (10), 567\u0026ndash;576 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBratton, S. B., Lewis, J., Butterworth, M. \u0026amp; Duckett, C. S. XIAP inhibition of caspase-3 preserves its association with the Apaf-1 apoptosome and prevents CD95- and Bax-induced apoptosis. \u003cem\u003eCell. Death Differ.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e (9), 881\u0026ndash;892 (2002).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"myocardial ischemia, Levosimendan, antioxidant, apoptosis","lastPublishedDoi":"10.21203/rs.3.rs-7676499/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7676499/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eLevosimendan (LMSD) is a novel positive inotropic drug with unique chemical structure and pharmacological properties. It has multiple effects such as dilating blood vessels and improving myocardial diastolic function, and is widely used in the treatment of cardiovascular diseases such as acute heart failure in clinical practice. During clinical treatment, LMSD seems to have a certain protective effect on hypoxic myocardial cells. Therefore, the aim of this study is to determine the effect of LMSD on hypoxic cardiomyocytes, and to explore its mechanism of action on hypoxic cardiomyocytes, in order to promote its more rational use in clinical treatment. In this study, it was demonstrated through antioxidant experiments that LMSD has certain antioxidant capacity. In addition, adding LMSD to hypoxic cardiomyocytes can effectively reduce intracellular ROS levels and improve mitochondrial membrane potential changes caused by hypoxia. And reduce the Bax/Bcl-2 ratio, thereby reducing the apoptosis of myocardial cells under hypoxic conditions. The decrease in protein and mRNA expression levels of apoptotic protease activating factor‑1 (APAF-1) and Caspase-3 (CASP-3) in hypoxic cardiomyocytes demonstrates that LMSD effectively reduces apoptosis of hypoxic cardiomyocytes. Therefore, this study demonstrates that LMSD may reduce cell apoptosis by inhibiting mitochondrial damage under hypoxic conditions, and reveals the possible mechanism of LMSD's cardioprotective effect.\u003c/p\u003e","manuscriptTitle":"Levosimendan can effectively reduce myocardial cell apoptosis caused by hypoxia through antioxidant activity","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-20 12:24:45","doi":"10.21203/rs.3.rs-7676499/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"83145971937684660388530226084922705662","date":"2026-02-04T16:57:03+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-28T21:00:26+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-21T17:13:09+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"54228239342676718992043544392355393821","date":"2026-01-16T18:58:00+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"246570220874426119226770115213143756442","date":"2026-01-16T14:53:45+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-01-16T14:14:51+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-17T08:26:37+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-09-29T19:11:23+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-26T13:23:53+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-09-26T13:20:13+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e8dcb20c-4763-46cc-842e-c791607243be","owner":[],"postedDate":"January 20th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":61304107,"name":"Health sciences/Cardiology"},{"id":61304108,"name":"Biological sciences/Cell biology"},{"id":61304109,"name":"Health sciences/Diseases"},{"id":61304110,"name":"Biological sciences/Drug discovery"}],"tags":[],"updatedAt":"2026-01-20T12:24:45+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-20 12:24:45","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7676499","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7676499","identity":"rs-7676499","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}