Fecal microbiota transfer from celiac patients induces immune and histopathological changes mirroring celiac disease in a rat model

Fecal microbiota transfer from celiac patients induces immune and histopathological changes mirroring celiac disease in a rat model | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Fecal microbiota transfer from celiac patients induces immune and histopathological changes mirroring celiac disease in a rat model Rugiyya Samadzade, Salih Macin, Babek Alibayov, Zeynep Celik, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6700857/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Celiac disease (CD) is a chronic autoimmune disorder triggered by gluten ingestion in genetically predisposed individuals, leading to intestinal inflammation and villous atrophy. Emerging evidence suggests that gut microbiota may play a pivotal role in CD pathogenesis. This study aimed to evaluate the immunological and histopathological effects of fecal microbiota transfer (FMT) from CD patients and healthy individuals into a rat model. After antibiotic-induced microbiota depletion, Wistar albino rats received FMT for three weeks, followed by histological and molecular analyses. Rats colonized with microbiota from CD patients exhibited significant weight loss (p 20 per high-power field), and villous atrophy with crypt hyperplasia, closely resembling CD-associated mucosal damage. Notably, histopathological analysis revealed a striking similarity between the duodenal biopsies of CD patients and the intestinal tissue of rats receiving FMT from CD donors. Additionally, proinflammatory cytokine levels, including IL-15, IL-21, TNF-α, and IFN-α mRNA expression in the duodenum, were significantly upregulated (p < 0.001). Serum levels of IL-17 and IFN-γ were also markedly elevated (p < 0.001) in these animals compared to controls. A strong correlation was observed between the severity of histopathological changes and cytokine expression, reinforcing the role of dysbiotic gut microbiota in CD-associated inflammation. These findings provide experimental evidence linking microbiota alterations to CD pathogenesis and suggest that modulating the gut microbiome may represent a potential therapeutic avenue for CD management. Biological sciences/Microbiology Health sciences/Gastroenterology celiac disease fecal microbiota transfer gut microbiota intestinal inflammation cytokines Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Celiac disease (CD) is an autoimmune disorder triggered by the ingestion of gluten, a protein found in wheat, barley, and rye, in genetically predisposed individuals. This condition leads to chronic inflammation and villous atrophy in the small intestine, resulting in malabsorption and various gastrointestinal symptoms such as diarrhea, weight loss, and abdominal pain (Lebwohl et al., 2018). Although traditionally classified as an enteropathy, CD is now recognized as a multisystem disease due to its numerous extraintestinal manifestations. These manifestations can affect various organs and systems, making CD a complex condition with a broad spectrum of symptoms. The incidence and prevalence of celiac disease (CD) have risen globally, influenced by increased awareness and the development of rapid diagnostic methods. The prevalence of CD varies significantly by gender, age, and geographic region, and it can indeed be diagnosed at any age (Itzlinger et al., 2018). The cellular immune response is pivotal in the pathogenesis of CD. In individuals with CD who are not adhering to a gluten-free diet, the majority of CD4 + T cells in the small intestinal mucosa are activated and secrete various proinflammatory mediators such as Interferon Alpha (IFN-α), Interferon Gamma (IFN-γ), Tumor Necrosis Factor Alpha (TNF-α), and various interleukins (IL-2, IL-6, IL-15, IL-21, IL-22, IL-23, IL-26) as well as Transforming Growth Factor Beta (TGF-β) plays a significant role in the pathogenesis of several inflammatory conditions, including inflammatory bowel disease (IBD) and other chronic inflammatory states (Caio et al., 2019; Dunne et al., 2020). Celiac disease exhibits a highly variable clinical presentation, encompassing both gastrointestinal and extraintestinal symptoms (Bul et al., 2016). The diagnosis of celiac disease (CD) involves a comprehensive approach that includes medical history, physical examination, serological tests, endoscopic evaluation, and genetic testing for Human Leukocyte Antigen (HLA) markers. The first serological test typically performed for diagnosing celiac disease is the measurement of anti-tissue transglutaminase IgA (tTG-IgA) and total IgA levels. This approach is widely recommended due to its high sensitivity and specificity in detecting CD (Al-Toma et al., 2019; Husby et al., 2020). The primary treatment for CD is a strict, lifelong gluten-free diet (GFD). This dietary regimen is essential for alleviating symptoms, promoting mucosal healing, and preventing complications associated with the disease (Silvester et al., 2017). Recent studies have increasingly highlighted the significant role of intestinal microbiota in the pathogenesis of CD (Olivares et al., 2018). CD patients often exhibit higher levels of gram-negative bacteria and lower levels of gram-positive bacteria, such as Bifidobacterium. This altered microbiota composition is linked to increased intestinal permeability and inflammation, which are hallmarks of CD (Di Cagno et al., 2015). Some studies suggest that changes in the gut microbiota precede the development of CD, indicating that dysbiosis could be a predisposing factor rather than a consequence of the disease (Green et al., 2015). Fecal microbiota transplantation (FMT) is a therapeutic procedure that involves the transfer of stool from a healthy donor into the intestinal tract of a patient suffering from dysbiosis, with the primary goal of restoring a healthy microbiota. This procedure can be administered using various methods, including nasoduodenal/nasojejunal probes, enemas, gastroscopy, jejunoscopy, or colonoscopy (Wang et al., 2019). FMT treatment has gained significant attention for its efficacy in treating recurrent Clostridioides difficile infections (CDI) and is now recommended in international clinical guidelines. It has shown success rates of 80–90% in treating recurrent CDI, making it a highly effective treatment option. There is growing interest in using FMT for IBD, including ulcerative colitis (UC) and Crohn's disease (CD), and some studies have shown promising results, particularly in UC (Cammarota et al., 2017). The study aims to explore the role of intestinal microbiota in the pathogenesis of CD. To achieve this, stool samples from celiac patients and healthy donors transplanted into rats. The subsequent immunological and histopathological changes in the rats assessed to understand the impact of the microbiota on CD development. Materials and Methods Human samples All samples collected at Gastroenterology Unit of Selçuk University Faculty of Medicine. We applied criterion-based sampling to include both healthy individuals and patients with CD. Participants had no history of HIV, HBV, or HCV infections, had not taken antibiotics or undergone surgical treatment in the past three months, and did not use alcohol or drugs. Additionally, they were screened for gluten intolerance and metabolic diseases. The study was approved by the Ethics Committee of the Faculty of Medicine, Selçuk University (No: 2022/10 ) and conducted in accordance with the Declaration of Helsinki . Written informed consent was obtained from all participants. After meeting the inclusion criteria, we collected stool samples from all participants (Table 1 ) and biopsy samples only from CD patients for histological examination. All patients were adults with an average age of 39 years. They were newly CD diagnosed cases and had not yet initiated treatment. Biopsy samples were immediately snap-frozen in liquid nitrogen and stored until further use. Stool samples were screened for potential infectious agents, including Entamoeba spp. , Entamoeba histolytica , Helicobacter pylori , Salmonella spp. , Shigella , Cryptosporidium , adenovirus, and rotavirus. The evaluation involved direct microscopic examination, serological testing, and conventional culture methods. Only stool samples that tested negative for infectious agents were deemed suitable and stored at -80°C until fecal transfer. Table 1 Details of patient used in the study. ID Diagnosis Age Gender Level of cytokines (ng/ml β-Actin (ng/ml) IL-17 (ng/ml) IFN-γ (ng/ml) CD1 CD 43 Male 1.437 1.242 1.137 CD2 CD 31 Male 1.487 1.217 1.598 CD3 CD 48 Female 1.448 1.053 1.252 CD4 CD 19 Female 1.488 1.227 1.374 CD5 CD 38 Male 1.477 1.175 1.405 CD6 CD 64 Male 1.484 1.347 1.425 CD7 CD 49 Male 1.445 1.266 1.199 CD8 CD 38 Female 1.493 1.25 1.199 CD9 CD 22 Male 1.468 1.318 1.482 CD10 CD 43 Female 1.431 1.369 1.149 N1 Normal 45 Male 0.166 0.223 0.134 N2 Normal 30 Male 0.266 0.065 0.319 N3 Normal 51 Female 0.258 0.159 0.396 N4 Normal 20 Female 0.263 0.214 0.387 N5 Normal 36 Male 0.235 0.742 0.313 N6 Normal 61 Male 0.193 0.958 0.107 N7 Normal 50 Male 0.262 0.369 0.084 N8 Normal 40 Female 0.297 0.385 0.117 N9 Normal 21 Male 0.212 0.278 0.417 N10 Normal 40 Female 0.179 0.319 0.358 Animals A total of 26 Wistar albino rats were used in the study. This sample size is typical for ensuring statistical significance while maintaining ethical standards in animal research. The rats were obtained from the Selçuk University Experimental Medicine Research and Application Center (SUDAM) and they were maintained under a controlled 12-hour light/dark cycle, which is a standard practice to regulate their circadian rhythms and ensure consistent experimental conditions. The rats had ad libitum access to standard water and food, ensuring they received adequate nutrition and hydration throughout the study. During the burn wound procedure, the rats were individually housed. This practice helps to prevent interference from other animals and reduces stress, which can affect the outcomes of the experiment. The rats were acclimatized for approximately 12 weeks at the SUDAM before the initiation of the experiment. This acclimatization period is crucial for allowing the animals to adapt to their new environment, which can help in stabilizing their physiological and behavioral parameters. To enhance the efficacy of FMT, a specific antibiotic regimen was employed to deplete the intestinal microbiota. Vancomycin and metronidazole were administered via oral gavage once daily for three weeks, while ampicillin and neomycin were provided in the drinking water at the same frequency. The rats were weighed at three distinct time points: before the initiation of antibiotic treatment (BAT), during the antibiotic treatment but prior to fecal transfer (BFT), and after the fecal transfer (AFT). Throughout the antibiotic treatment period, no adverse effects or mortality were observed. The study complied with ethical guidelines and was approved by the Animal Experiments Ethics Committee of Selçuk University (No: 2022/12 ). It was conducted in accordance with the ARRIVE guidelines , and all experiments were performed in accordance with relevant guidelines and regulations. Fecal sample preparation and transfer to animals Stool samples were thawed in a biosafety cabinet and processed individually. For each 10 g stool sample, 20 cc of 0.9% phosphate-buffered saline (PBS) and L-cysteine were added to protect anaerobic bacteria. The mixture was vortexed, filtered through a wire strainer, and then centrifuged at 5000 × g for 20 minutes to concentrate the bacterial content. The supernatant was collected, and aliquots were prepared in 1 mg insulin syringes for transfer. The fecal suspensions were stored in anaerobic jars at -80°C until use. The FMT was administered to rats via oral gavage at a volume of 200 µL per rat, 5 days a week for 3 weeks. The rats were divided into three groups: the CDR group 10 rats received feces from patients with CD, the HDR group 10 rats received feces from healthy donors, and the control group 6 rats received phosphate-buffered saline (PBS). Following the FMT procedure, a one-week waiting period was observed before the rats were euthanized for analysis. The entire process was conducted without causing harm or distress to the animals. Animal sacrifice On the 50th day of the experiment, 26 rats were humanely euthanized by cervical dislocation under general anesthesia. To minimize pain and distress, anesthesia was induced via intraperitoneal administration of 10 mg/kg rompun (Xylazinbio 2%, Bioveta, Czech Republic) and 70 mg/kg ketamine (Ketasol 10%, Richter Pharma Ag, Austria). Following euthanasia, the rats were dissected using standard necropsy procedures. Certain tissue sections were rapidly frozen in liquid nitrogen for RNA extraction. Meanwhile, segments of the duodenum (both the proximal D1-Bulbus and the distal D2-Distal), ileum, and colon were preserved in 10% formaldehyde for histological analysis. In addition, for microbiological analyses, duodenum sections were placed in sterile eppendorf tubes and transported to the laboratory with a nitrogen tank. Histological Examination The duodenum, ileum, and colon were fixed for 36 hours, embedded in paraffin, and sectioned into slices with a thickness of 4–5 µm. These slices were then stained using Hematoxylin-Eosin (HE) and examined under a binocular light microscope (Olympus BX51, Japan). Images of the stained tissue sections were captured with a digital camera (Olympus EP50, Japan). The degree of intestinal damage was assessed using the Marsh-Oberhuber scoring system (Oberhuber et al., 1999; Marsh, 1992). The pathology results of CD patients were retrospectively reviewed using electronic records. The histopathological findings of these celiac donor patients were then compared with those observed in recipient rats. RNA isolation and quantitative RT-PCR Duodenum tissue samples from rats in all three groups were collected, placed in sterile Eppendorf tubes, and stored at -80°C until analysis. Before processing, the samples were brought to room temperature. The tissue was cut into small pieces, and approximately 25–50 mg of tissue was homogenized in 1 ml of miRNA Extractor for 30 seconds using a homogenizer, following the manufacturer's instructions (SK 8811, BIO BASIC, Canada). We assessed the integrity and quantity of the RNA samples using Bio-Rad T100 Thermal Cycler (Bio-Rad Laboratories, America) and on average, 2 µg of total RNA was used for subsequent steps. The reverse transcription was carried out using the ABM OneScript Plus cDNA Synthesis Kit (G236, Applied Biological Materials Inc., Canada). The synthesized cDNA was then used for quantitative Real-Time PCR (qRT-PCR) with primers listed in Table 2 . Real-Time PCR was performed following the protocol for the BlasTaq™ 2X qPCR MasterMix (G291, Applied Biological Materials Inc., Canada). All genes were normalized to expression of the housekeeping gene Gapdh and fold changes in expression of relevant genes were quantified using the ΔΔCt method. Table 2 List of primers used in this study for qRT-PCR analysis. Target Gene Primer Sequence IL-15 F : TGTGGGCATCTGAATCCACTT R : TTCCCAGACCATGCACAACC IL- 21 F : TGCCTGCTAAGAGGACAGGA R : AGCCACAACGTGAGAAGTCC TNF-α F : GGCTTTCGGAACTCACTGGA R : CCCGTAGGGCGATTACAGTC IFN-α F : GTGGAAGGATTAGGACCAAACAGA R : CCTTCTCCAAAGGGAACCCAA Gapdh* F : ATGACTCTACCCACGGCAAG R : CTGGAAGATGGTGATGGGTT F*-Forward primer R*- Reverse primer Gapdh*-Glycealdehyde-3-phosphate dehydrogenase For DNA amplification, the PCR mix was loaded into the LightCycler® 96 Instrument (Roche Diagnostics, Basel, Sweden), and thermal cycling was conducted according to the manufacturer's protocol. Measurement of IFN-γ, IL-17, and β-actin Serum Levels Blood samples were collected from rats and transported to the microbiology laboratory, where they were centrifuged at 3,000 rpm in 20 minutes. The serum portion of the blood was then carefully transferred into pre-labeled Eppendorf tubes. Measurements were performed using the following ELISA kits from Bioassay Technology Laboratory (Shanghai, China): BT LAB Rat IL-17 (Catalog number: E0115Ra), BT LAB Rat IFN-γ (Catalog number: E0103Ra), and BT LAB Rat β-actin (Catalog number: E1488Ra) and read on a Allsheng | AMR-100 Elisa Reader (Hangzhou Allsheng Instruments, China). Statistical Analysis All statistical analyses were conducted using Prism version 10.1.1 (GraphPad, San Diego, CA, USA). Data are presented as mean ± standard deviation, median [range], frequency (n), and percentage (%). Changes in animal weights over time were assessed using repeated-measures ANOVA, followed by Bonferroni correction for pairwise comparisons. Histopathological findings between celiac and healthy donor rats were compared using the Mann-Whitney U test. The agreement between histopathological classifications of CD patients and rats was evaluated with the weighted kappa coefficient. Additionally, data from RT-PCR and ELISA analyses were assessed using the t-test. A p-value of less than 0.05 was considered statistically significant. Results A total of 10 patients, 7 (70%) male and 3 (30%) female, aged 19–74, who met the criteria and were diagnosed with celiac disease, and 20 individuals, 7 (70%) male and 3 (30%) female, who did not have any acute health problems, were included in this study. The average age of celiac patients and healthy donors included in the study was 34.95. The weights of the rats in all three groups, measured after three weighing procedures (before antibiotic treatment, before fecal transfer and after fecal transfer), were compared statistically (mean ± standard deviation). According to the results, the weights of the control group rats that received feces transfer from healthy donors and PBS transfer were found to increase in accordance with their weekly development as a result of three weighings, which was found to be statistically significant ( p < 001 ). It was found that the patient group rats increased their weight after the first and second weighing, while they lost weight after the last weighing, which was statistically significant ( p < 001 ) (Fig. 1 ). When the animals were necropsied, no pathological lesions were observed in the duodenums of rats that received fecal transfer from healthy donors and the control group rats. However, visible pathological lesions were observed in the duodenum of rats that underwent fecal transfer from CD donors (Fig. 2 ). Following histopathological examinations, it was determined that the villus-crypt ratio in the duodenum of the control group rats that received phosphate buffered saline transfer was normal, there was no massification in the villi, and the intraepithelial lymphocyte increase was within certain limits (0–9) (Fig. 3 A, B). The villi-crypt ratio in the duodenum of rats in the group that received fecal transfer from healthy donors was found to be normal and there was no atrophy in the villi. However, it was found that there was a slight increase ( 10 – 15 ) in the number of duodenal intraepithelial lymphocytes in the rats in this group (Fig. 3 C, D). An increase in the number of intraepithelial lymphocytes (> 20), a decrease in the villus-crypt ratio of varying severity, and villous massing were observed in the duodenums of rats in the group that received fecal transfer from individuals with celiac disease (Fig. 4 A-H). Histological examinations of fecal-transferred animals were conducted using the Marsh-Oberhuber classification (Oberhuber et al., 1999; Marsh, 1992). The results showed that animals transferred with human CD samples developed visible changes, including alterations in the villus-to-crypt ratio. These are signs of the development of celiac disease (Table 3 ). Table 3 Histological examinations of fecal-transferred animals using the Marsh-Oberhuber classification. 0 1 2 3a 3b 3c 4 C1 X C2 X C3 X C4 X C5 X C6 X HDR1 X HDR2 X HDR3 X HDR4 X HDR5 X HDR6 X HDR7 X HDR8 X HDR9 X HDR10 X CDR1 x CDR2 X CDR3 x CDR4 X CDR5 x CDR6 X CDR7 X CDR8 X CDR9 X CDR10 X Histopathological results of celiac patients and rats that underwent fecal transfer from these patients were compared (Table 4 ). According to the results, Marsh Type 1 scoring was observed in 4 (80%) of the rats to which the feces of 5 patients compatible with Marsh Type 1 were transferred. Although 5 of the patients had Marsh Type 3 scoring, 4 of the rats that received fecal transfer from the same patients had Marsh Type 3 scoring. Although there were no patients in the CD group pathologically suitable for Marsh Type 2, Marsh Type 2 scoring was performed in 1 (20%) of the rats in the patient group. In general, when the histopathological results of CD were compared with the histopathological results of the patient group rats, a moderate level of agreement (66.7%) was found (Table 5 ). Table 4 Comparison of histopathological results between celiac patients and the CDR group of rats. Patient histopathology Histopathology of the Transferred Rat CD1 3b CDR1 3b CD2 1 CDR2 1 CD3 1 CDR3 1 CD4 3b CDR4 3b CD5 3a CDR5 3a CD6 1 CDR6 1 CD7 3a CDR7 3a CD8 1 CDR8 1 CD9 3a CDR9 3a CD10 1 CDR10 1 Table 5 Statistical comparison of histopathological results between CD patients and CDR rats. Histopathology (Human) 1 2 3 Total Weighted kappa Histopathology (rats) 1 4 (80) 0 (0) 0 (0) 4 2 1 ( 20 ) 0 (0) 1 ( 20 ) 2 0.667 3 0 (0) 0 (0) 4 (80) 4 Total 5 0 5 10 The mRNA expression levels of proinflammatory cytokines; IL-15 and IL-21 in rats that underwent stool transfer from celiac patients were found to be significantly higher compared to rats that underwent stool transfer from healthy donors and the control group rats ( p < 0.001 ). (Fig. 5 A, B). The mRNA expression levels of proinflammatory cytokines; IL-15 and IL-21 in rats that received stool transfer from healthy donors were similar to the mRNA expression levels of the control group rats. The mRNA expression levels of proinflammatory cytokines; TNF-α and IFN-α in rats that underwent stool transfer from celiac patients were found to be significantly higher compared to rats that underwent stool transfer from healthy donors and the control group rats ( p < 0.001 ). The mRNA expression levels of proinflammatory cytokines, TNF-α and IFN-α, in rats that received stool transfer from healthy donors were similar to the mRNA expression levels of the control group rats (Fig. 5 C, D). The ELISA results showed that serum levels of proinflammatory cytokines (IL-17, IFN-γ) and β-actin were significantly elevated in the CDR group rats compared to those receiving stool transplants from healthy donors (p < 0.001) (Fig. 6A-C). In contrast, the levels of IFN-γ and β-actin in rats that received stool transfers from healthy donors were comparable to those of the control group. However, the IL-17 serum levels in the CDR were significantly higher than in the control group rats (p < 0.001). The IFN-γ and β-actin levels in the CDR serum were approximately three times higher than those in the other groups. However, the IFN-γ and β-actin production levels in the HDR and control groups were similar, with no significant statistical differences. Discussion The pathogenesis of CD is significantly influenced by the intestinal microbiota, particularly through the mechanism of inflammation resulting from dysbiosis. Dysbiosis refers to an imbalance in the gut microbiota, characterized by a reduction in beneficial species and an overgrowth of potentially pathogenic microorganisms (Marasco et al., 2016; De Angelis et al., 2016). FMT is a medical procedure that involves the transplantation of stool from a healthy donor into the intestine of a recipient. This procedure aims to restore the balance of the gut microbiota, which can have therapeutic benefits for various diseases, including CD (Bokoliya et al., 2021; Porcari et al., 2023). In the present study, we investigated the role of intestinal microbiota in the pathogenesis of CD using an experimental animal model. Rats that underwent fecal transfer from CD patients exhibited a significant increase in the number of intraepithelial lymphocytes, exceeding 20 per high power field. This is a hallmark of CD specific damage and indicates an immune response within the duodenal epithelium. There was a notable reduction in the villus-crypt ratio in these rats, which varied in severity. This reduction is indicative of villous atrophy and crypt hyperplasia, common features in CD pathology. The presence of villous massing was observed, which further supports the occurrence of structural changes in the duodenal mucosa due to CD. The case described by Beurden et al. (2016) demonstrates the potential of FMT as a treatment for patients with RCD II and concurrent Clostridium difficile infection, leading to significant histological and symptomatic improvement, as evidenced by the transition from Marsh 3a to Marsh 0. In contrast, rats that received fecal transfers from healthy donors or PBS did not exhibit these pathological changes. Their duodenal sections maintained normal histological architecture, with no significant increase in intraepithelial lymphocytes, stable villus-crypt ratios, and absence of villous massing. During CD damage of the intestinal mucosa results in impaired absorption of various nutrients, which can cause a range of health issues. Similar to Carlson, 2020 data, our findings indicate that animals lose weight after receiving fecal transfers from celiac disease patients and subsequently develop signs of CD. The findings demonstrated that the weights of rats receiving healthy fecal transplants and those in the control group consistently increased. This key observation underscores the importance of investigating weight changes in future studies, particularly for the diagnosis and treatment of CD. Proinflammatory cytokines play a central role in both innate and adaptive immune responses in the pathogenesis of celiac disease. Tye-Din et al., 2018 found that in CD the expression levels of several proinflammatory cytokines, such as IL-15, IL-21, TNF-α, and IFN-α, are elevated in duodenal tissue, while serum levels of proinflammatory cytokines like IL-17 and IFN-γ also increased. To assess the impact of cytokines, we investigated their expression and production. Our findings showed that mRNA levels of proinflammatory cytokines (IL-15, IL-21, TNF-α, IFN-α) were heightened in duodenal tissue, and serum levels of proinflammatory cytokines (IL-17, IFN-γ) were elevated. IL-15 is a major proinflammatory cytokine released in high levels by intestinal epithelial cells during active CD and plays a critical role in the pathogenesis of the disease. Research on CD pathogenesis has shown that overexpression of IL-15 leads to epithelial damage by increasing the number of inflammatory cells in the small intestine. Furthermore, IL-15 induces IFN-γ production by stimulating intraepithelial lymphocytes (IELs), contributing to the inflammatory milieu (Vorobjova et al., 2019). We observed that IL-15 mRNA levels were higher in the small intestinal mucosa of CDR compatre to HDR. Research has demonstrated that IL-15 mRNA overexpression in active celiac disease contributes to the increased presence of inflammatory cells, which play a critical role in epithelial damage (Di Sabatino et al., 2006; Pagliari et al., 2013, 2015). IL-15 is upregulated in the intestinal mucosa of CD patients, acting on various cell types to disrupt immune homeostasis and promote inflammation (Abadie et al. 2011; 2014; Di Sabatino et al. 2006, 2016). Borrelli et al. (2016) analyzed duodenal biopsies from 76 active CD patients, 90 potential CD patients (identified by disease-related positive serology), and 58 controls for IL-21 expression. Their findings indicated that IL-21 expression was significantly lower in potential CD patients compared to those with active CD. These results underscore the critical role of IL-21 in the progression of mucosal damage in active CD (Borrelli et al., 2016). The results showed that the duodenal IL-21 mRNA expression was significantly higher in the CDR compared to those that received fecal transfer from healthy donors or PBS transfer. This suggests that IL-21 plays a role in the pathological process of CD and that its expression is modulated by the gut microbiota. TNF-α is a proinflammatory cytokine secreted by Th1 cells, playing a crucial role in the pathogenesis of mucosal damage in celiac disease. Elevated levels of TNF-α have been observed in the intestinal mucosa of celiac patients, contributing to the inflammatory response and tissue damage (Manavalan et al., 2010; Piatek-Guziewicz et al. 2017). Our results indicated that duodenal TNF-α mRNA levels were significantly higher in the CDR group rats compared to HDR and the control group (p < 0.001). Similiar data we found on IFN-α relative expression. The mechanisms underlying the elevated levels of IFN-α in CD are not yet fully understood, and further research is needed to explore the role of viral infections in their development. In active CD studies have demonstrated that activated T cells produce IFN-γ, a proinflammatory cytokine (Di Sabatino et al., 2016). In their study on adult CD, Manavalan et al. (2010) observed that serum IFN-γ levels in active celiac patients (n = 18) were significantly higher than those in the control group (n = 16) (p < 0.005) (Manavalan et al., 2010). Our results demonstrated that serum levels of IL-17, IFN-γ, and β-actin in the CDR rats were significantly elevated compared to those in the rats that underwent fecal transfer from healthy donors or control group (p < 0.001). Monteleone et al. (2010) investigated IL-17A RNA expression levels by analyzing biopsy samples from 27 adults with active CD, 19 treated CD patients, and 26 healthy controls. Their results demonstrated that IL-17A RNA expression levels were significantly elevated in active CD patients compared to treated patients and controls (p < 0.001). Additionally, IL-17A protein expression levels, measured by the ELISA method, were found to be higher in the active patient group (Monteleone et al., 2010). In conclusion, the findings underscore the critical role of intestinal microbiota in CD pathogenesis, highlighting how microbial imbalance can trigger immune modulation and inflammation, even in the absence of genetic predisposition. This opens avenues for microbiota-targeted therapies in managing CD. The study findings indicating elevated mRNA and serum levels of proinflammatory cytokines in rats receiving fecal transfer from CD patients suggest that these cytokines could serve as novel noninvasive biomarkers for diagnosing and monitoring celiac disease. This conclusion is supported by several studies highlighting the role of inflammatory cytokines in CD pathogenesis and their potential as diagnostic markers. However, extensive clinical studies are necessary to confirm these findings and establish their clinical utility. Declarations Author Contribution ContributionsConceptualization: R.S., S.M., H.K., and D.F. Experimental investigation: R.S. and D.F. Bioinformatics and statistical analysis: M.K.K. Writing—original draft: R.S. Writing—review and editing: R.S., S.M., B.A., and D.F. Pathological assessment: Z.C. and M.B.A. Data curation: R.S. Figure preparation: R.S. Funding acquisition: R.S. and D.F. All authors contributed to data interpretation, discussed the results, and provided critical feedback on the manuscript. Acknowledgement R.S. received funding from Selçuk Üniversitesi Bilimsel Araştırmalar Koordinatörlüğü under Grant Number 22212019, partially supported by Selçuk University. Data Availability All data generated and analyzed during this study are available from the corresponding author upon reasonable request. References Lebwohl, B., Sanders, D. S. & Green, P. H. R. Coeliac disease. Lancet 391 , 70–81 (2018). Itzlinger, A., Branchi, F., Elli, L. & Schumann, M. Gluten-free diet in celiac disease forever and for all? Nutrients 10 (11), 1796 (2018). Caio, G. et al. Celiac disease: a comprehensive current review. BMC Med. 17 , 142 (2019). Dunne, M. R., Byrne, G., Chirdo, F. G. & Feighery, C. Coeliac disease pathogenesis: The uncertainties of a well-known immune mediated disorder. Front. Immunol. 11 , 1374 (2020). Van Kalleveen, M., de Meij, T. & Plötz, F. B. Clinical spectrum of paediatric coeliac disease: a 10-year single-centre experience. Eur. J. Pediatr. 177 , 593–602 (2018). Bul, V., Sleesman, B. & Boulay, B. Celiac disease presenting as profound diarrhea and weight loss—a celiac crisis. Am. J. Case Rep. 5 , 559–561 (2016). Al-Toma, A. et al. European Society for the Study of Coeliac Disease (ESsCD) guideline for coeliac disease and other gluten-related disorders. United Eur. Gastroenterol. J. 7 (5), 583–613 (2019). Husby, S. et al. European Society Paediatric Gastroenterology, Hepatology and Nutrition Guidelines for Diagnosing Coeliac Disease 2020. J. Pediatr. Gastroenterol. Nutr. 70 , 141–156 (2020). Silvester, J. A. et al. Tests for serum transglutaminase and endomysial antibodies do not detect most patients with celiac disease and persistent villous atrophy on gluten-free diets: a meta-analysis. Gastroenterology 153 , 689–701e1 (2017). Olivares, M. et al. Gut microbiota trajectory in early life may predict development of celiac disease. Microbiome 6 , 36 (2018). Cenit, M. C., Codoñer-Franch, P. & Sanz, Y. Gut microbiota and risk of developing celiac disease. J. Clin. Gastroenterol. 50 , 148–152 (2016). Green, P. H., Lebwohl, B. & Greywoode, R. Celiac disease. J. Allergy Clin. Immunol. 135 , 1099–1106 (2015). Wang, J. W. et al. Fecal microbiota transplantation: review and update. J. Formos. Med. Assoc. 118 (1), S23–S31 (2019). Webb, B. J. et al. Fecal microbiota transplantation for recurrent Clostridium difficile infection in hematopoietic stem cell transplant recipients. Transpl. Infect. Dis. 18 (4), 628–633 (2016). Oberhuber, G., Granditsch, G. & Vogelsang, H. The histopathology of coeliac disease: time for a standardized report scheme for pathologists. Eur. J. Gastroenterol. Hepatol. 11 , 1185–1194 (1999). Marsh, M. N. Grains of truth: evolutionary changes in small intestinal mucosa in response to environmental antigen challenge. Gut 31 (1), 111–114 (1990). Marasco, G. et al. Gut microbiota and celiac disease. Dig. Dis. Sci. 61 , 1461–1472 (2016). De Angelis, M. et al. Salivary and fecal microbiota and metabolome of celiac children under gluten-free diet. Int. J. Food Microbiol. 19 , 125–132 (2016). Bokoliya, S. C., Dorsett, Y., Panier, H. & Zhou, Y. Procedures for fecal microbiota transplantation in murine microbiome studies. Front. Cell. Infect. Microbiol. 21 , 711055 (2021). Porcari, S. et al. Key determinants of success in fecal microbiota transplantation: from microbiome to clinic. Cell. Host Microbe . 10 , 712–733 (2023). Beurden, Y. H. V. et al. Serendipity in refractory celiac disease: full recovery of duodenal villi and clinical symptoms after fecal microbiota transfer. J. Gastrointestin Liver Dis. 25 , 385–388 (2016). Carlson, P. E. Regulatory considerations for fecal microbiota transplantation products. Cell. Host Microbe . 12 , 173–175 (2020). Tye-Din, J. A., Galipeau, H. J. & Agardh, D. Celiac disease: a review of current concepts in pathogenesis, prevention, and novel therapies. Front. Pediatr. 21 , 350 (2018). Vorobjova, T. et al. Celiac disease in children, particularly with accompanying type 1 diabetes, is characterized by substantial changes in the blood cytokine balance, which may reflect inflammatory processes in the small intestinal mucosa. J. Immunol. Res. 12 , 6179243 (2019). Di Sabatino, A. et al. Epithelium-derived interleukin 15 regulates intraepithelial lymphocyte Th1 cytokine production, cytotoxicity, and survival in coeliac disease. Gut 55 , 469–477 (2006). Di Sabatino, A. et al. Innate and adaptive immunity in self-reported nonceliac gluten sensitivity versus celiac disease. Dig. Liver Dis. 48 , 745–752 (2016). Pagliari, D. et al. The role of IL-15 in gastrointestinal diseases: a bridge between innate and adaptive immune response. Cytokine Growth Factor. Rev. 24 , 455–466 (2013). Pagliari, D. et al. The interaction among microbiota, immunity, and genetic and dietary factors is the condicio sine qua non celiac disease can develop. J. Immunol. Res. 2015 , 123653 (2015). Borrelli, M. et al. In the intestinal mucosa of children with potential celiac disease, IL-21 and IL-17A are less expressed than in active disease. Am. J. Gastroenterol. 111 , 134–144 (2016). Manavalan, J. S. et al. Serum cytokine elevations in celiac disease: association with disease presentation. Hum. Immunol. 71 , 50–57 (2010). Piatek-Guziewicz, A. et al. World J. Gastroenterol. ; 23 :7849. (2017). Abadie, V. et al. Annu. Rev. Immunol. ; 29 :493–425. (2011). Monteleone, I. et al. J. Immunol. ; 184 :2211–2218. (2010). Velikova, T. et al. J Immunol. Res (2019). Discepolo, V. et al. Int. J. Mol. Sci. ; 8 :2708. (2021). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6700857","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":473132501,"identity":"ae2cff8f-9d65-4198-9d26-4d2de196c407","order_by":0,"name":"Rugiyya Samadzade","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABCUlEQVRIiWNgGAWjYFACNoYDUJYBiCMHYh14QIoWY7CWBAJaYACsJbEBxMSnxXxGWuJhnoo6ed32w5s//CizSZ8fdvgh0BY7Od0G7FpkbqQdOMxz5rDhtjNpBYY959JyN95OMwBqSTY2O4Bdi4REesNh3rYDjNsO5Bgk8LYdzt04OwGk5UDiNrxa/tXZbzv/xuDg37b/6Yaz0z8Q0AJ0GG8Dc+K2GzmGzUDrEuSlcwjYwvMs4eCcY4eTt914Vswscy7ZcIN0TsGBBAM8fmFPM/7wpqbOdtv55M0f35TZycvPTt/84UOFnRwuLSDAxIPMMwCrNMCtHAQYfyDz5Bvwqx4Fo2AUjIKRBwCl62nIx69ZFgAAAABJRU5ErkJggg==","orcid":"","institution":"Selcuk University","correspondingAuthor":true,"prefix":"","firstName":"Rugiyya","middleName":"","lastName":"Samadzade","suffix":""},{"id":473132502,"identity":"505ad93f-c657-42e0-9415-00764120b732","order_by":1,"name":"Salih Macin","email":"","orcid":"","institution":"Selcuk University","correspondingAuthor":false,"prefix":"","firstName":"Salih","middleName":"","lastName":"Macin","suffix":""},{"id":473132503,"identity":"9fca9c58-5c5d-43ce-84d9-dea9117725f8","order_by":2,"name":"Babek Alibayov","email":"","orcid":"","institution":"State Agency for Science and Higher Education, Baku, Azerbaijan","correspondingAuthor":false,"prefix":"","firstName":"Babek","middleName":"","lastName":"Alibayov","suffix":""},{"id":473132504,"identity":"cfc3bf3d-e210-414e-a71b-58c621e0ffac","order_by":3,"name":"Zeynep Celik","email":"","orcid":"","institution":"Selcuk University","correspondingAuthor":false,"prefix":"","firstName":"Zeynep","middleName":"","lastName":"Celik","suffix":""},{"id":473132505,"identity":"6ddad8df-169c-4b81-9975-e18e7db52ea0","order_by":4,"name":"Mehmet Burak Ates","email":"","orcid":"","institution":"Selcuk University","correspondingAuthor":false,"prefix":"","firstName":"Mehmet","middleName":"Burak","lastName":"Ates","suffix":""},{"id":473132506,"identity":"0fb6c814-45bf-443e-a838-8c481251ae2c","order_by":5,"name":"Muslu Kazım Korez","email":"","orcid":"","institution":"Selcuk University","correspondingAuthor":false,"prefix":"","firstName":"Muslu","middleName":"Kazım","lastName":"Korez","suffix":""},{"id":473132507,"identity":"3d944b02-b6c1-4c96-a770-3f4b80d05ba9","order_by":6,"name":"Huseyin Korkmaz","email":"","orcid":"","institution":"Selcuk University","correspondingAuthor":false,"prefix":"","firstName":"Huseyin","middleName":"","lastName":"Korkmaz","suffix":""},{"id":473132508,"identity":"5ad30540-42bd-4ec3-b744-67ec49908d3d","order_by":7,"name":"Duygu Findik","email":"","orcid":"","institution":"Selcuk University","correspondingAuthor":false,"prefix":"","firstName":"Duygu","middleName":"","lastName":"Findik","suffix":""}],"badges":[],"createdAt":"2025-05-19 16:38:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6700857/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6700857/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":85384718,"identity":"1c124583-ec42-4160-bfb9-449c6c95cc70","added_by":"auto","created_at":"2025-06-25 09:39:24","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1026705,"visible":true,"origin":"","legend":"\u003cp\u003eGraph showing change in body weight of animals during the experiment (p-value \u0026lt; 001).\u003c/p\u003e","description":"","filename":"Fig.1Samadzadeetal.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6700857/v1/631e0e255479050b61f00cc9.jpeg"},{"id":85384729,"identity":"0ab44158-3071-4176-9f29-71da4d320435","added_by":"auto","created_at":"2025-06-25 09:39:25","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5577703,"visible":true,"origin":"","legend":"\u003cp\u003eThe appearance of lesions detected in the duodenum of rats that underwent fecal transfer from CD.\u003c/p\u003e","description":"","filename":"Fig.2Samadzadeetal.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6700857/v1/f68306d5f586bf4e209839af.jpeg"},{"id":85385517,"identity":"ce55a55c-368c-48cb-985d-c13b40cc48d2","added_by":"auto","created_at":"2025-06-25 09:47:27","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":11549162,"visible":true,"origin":"","legend":"\u003cp\u003eHistopathology of the small intestine. H\u0026amp;E-stained tissue sections of the duodenum. Control group: (A) Normal villus-to-crypt ratio (4:1) in the duodenum (indicated by orange and green arrows). (B) Intraepithelial lymphocytes count within normal limits (mean: 4–6, \u0026lt;30 per 100 enterocytes) in the duodenum. Healthy donor feces transfer group: (C) Normal villus-to-crypt ratio (orange and green arrows) in the duodenum. (D) Intraepithelial lymphocytes count within normal limits (mean: 7–9, \u0026lt;30 per 100 enterocytes) in the duodenum. 20X magnification\u003c/p\u003e","description":"","filename":"Fig.3Samadzadeetal.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6700857/v1/05c3b5f80c8ad00375692477.jpeg"},{"id":85384741,"identity":"91ef95e3-a96a-416e-b8e9-3a3070fe033b","added_by":"auto","created_at":"2025-06-25 09:39:27","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":12160411,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative examples of hematoxylin/eosin staining of duodenum sections from CDR rats (original magnification ×20): (A,C,E,G) Villous atrophy (blue arrows) and decreased villus-to-crypt ratio (orange and green arrows) in the duodenum. (F) Increased intraepithelial lymphocyte count (mean: 30–40) in the duodenum.\u003c/p\u003e","description":"","filename":"Fig.4Samadzadeetal.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6700857/v1/d831fe1f6bb93b505b7dab95.jpeg"},{"id":85384728,"identity":"9ce11edf-3968-4d28-8638-797256f4283e","added_by":"auto","created_at":"2025-06-25 09:39:25","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":6554759,"visible":true,"origin":"","legend":"\u003cp\u003eRelative quantification of (A) IL-15, (B) IL-21, (C) TNF-α and (D) IFN-α in HDR, CDR, and control group rats.\u003c/p\u003e","description":"","filename":"Fig.5Samadzadeetal.png","url":"https://assets-eu.researchsquare.com/files/rs-6700857/v1/c735c10f8db2515dfc8e0396.png"},{"id":85384732,"identity":"fcc953cc-ee93-46b2-804c-ad98e3fb4cd4","added_by":"auto","created_at":"2025-06-25 09:39:26","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1048585,"visible":true,"origin":"","legend":"\u003cp\u003eSerum levels of (A) IL-17, (B) IFN-γ, and (C) β-actin in the HDR, CDR, and control group rats were measured and compared.\u003c/p\u003e","description":"","filename":"Fig.6Samadzadeetal.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6700857/v1/bfe9258bda67a7f9a267d773.jpeg"},{"id":91043307,"identity":"599c6a8c-2c6e-49e1-9fa9-846162f083b8","added_by":"auto","created_at":"2025-09-11 04:46:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":42044219,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6700857/v1/8a26f144-3679-462f-8e54-b714a109da30.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Fecal microbiota transfer from celiac patients induces immune and histopathological changes mirroring celiac disease in a rat model","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCeliac disease (CD) is an autoimmune disorder triggered by the ingestion of gluten, a protein found in wheat, barley, and rye, in genetically predisposed individuals. This condition leads to chronic inflammation and villous atrophy in the small intestine, resulting in malabsorption and various gastrointestinal symptoms such as diarrhea, weight loss, and abdominal pain (Lebwohl et al., 2018). Although traditionally classified as an enteropathy, CD is now recognized as a multisystem disease due to its numerous extraintestinal manifestations. These manifestations can affect various organs and systems, making CD a complex condition with a broad spectrum of symptoms. The incidence and prevalence of celiac disease (CD) have risen globally, influenced by increased awareness and the development of rapid diagnostic methods. The prevalence of CD varies significantly by gender, age, and geographic region, and it can indeed be diagnosed at any age (Itzlinger et al., 2018).\u003c/p\u003e \u003cp\u003eThe cellular immune response is pivotal in the pathogenesis of CD. In individuals with CD who are not adhering to a gluten-free diet, the majority of CD4\u003csup\u003e+\u003c/sup\u003e T cells in the small intestinal mucosa are activated and secrete various proinflammatory mediators such as Interferon Alpha (IFN-α), Interferon Gamma (IFN-γ), Tumor Necrosis Factor Alpha (TNF-α), and various interleukins (IL-2, IL-6, IL-15, IL-21, IL-22, IL-23, IL-26) as well as Transforming Growth Factor Beta (TGF-β) plays a significant role in the pathogenesis of several inflammatory conditions, including inflammatory bowel disease (IBD) and other chronic inflammatory states (Caio et al., 2019; Dunne et al., 2020).\u003c/p\u003e \u003cp\u003eCeliac disease exhibits a highly variable clinical presentation, encompassing both gastrointestinal and extraintestinal symptoms (Bul et al., 2016). The diagnosis of celiac disease (CD) involves a comprehensive approach that includes medical history, physical examination, serological tests, endoscopic evaluation, and genetic testing for Human Leukocyte Antigen (HLA) markers. The first serological test typically performed for diagnosing celiac disease is the measurement of anti-tissue transglutaminase IgA (tTG-IgA) and total IgA levels. This approach is widely recommended due to its high sensitivity and specificity in detecting CD (Al-Toma et al., 2019; Husby et al., 2020). The primary treatment for CD is a strict, lifelong gluten-free diet (GFD). This dietary regimen is essential for alleviating symptoms, promoting mucosal healing, and preventing complications associated with the disease (Silvester et al., 2017).\u003c/p\u003e \u003cp\u003eRecent studies have increasingly highlighted the significant role of intestinal microbiota in the pathogenesis of CD (Olivares et al., 2018). CD patients often exhibit higher levels of gram-negative bacteria and lower levels of gram-positive bacteria, such as Bifidobacterium. This altered microbiota composition is linked to increased intestinal permeability and inflammation, which are hallmarks of CD (Di Cagno et al., 2015). Some studies suggest that changes in the gut microbiota precede the development of CD, indicating that dysbiosis could be a predisposing factor rather than a consequence of the disease (Green et al., 2015).\u003c/p\u003e \u003cp\u003eFecal microbiota transplantation (FMT) is a therapeutic procedure that involves the transfer of stool from a healthy donor into the intestinal tract of a patient suffering from dysbiosis, with the primary goal of restoring a healthy microbiota. This procedure can be administered using various methods, including nasoduodenal/nasojejunal probes, enemas, gastroscopy, jejunoscopy, or colonoscopy (Wang et al., 2019). FMT treatment has gained significant attention for its efficacy in treating recurrent \u003cem\u003eClostridioides difficile\u003c/em\u003e infections (CDI) and is now recommended in international clinical guidelines. It has shown success rates of 80\u0026ndash;90% in treating recurrent CDI, making it a highly effective treatment option. There is growing interest in using FMT for IBD, including ulcerative colitis (UC) and Crohn's disease (CD), and some studies have shown promising results, particularly in UC (Cammarota et al., 2017).\u003c/p\u003e \u003cp\u003eThe study aims to explore the role of intestinal microbiota in the pathogenesis of CD. To achieve this, stool samples from celiac patients and healthy donors transplanted into rats. The subsequent immunological and histopathological changes in the rats assessed to understand the impact of the microbiota on CD development.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eHuman samples\u003c/h2\u003e \u003cp\u003eAll samples collected at Gastroenterology Unit of Sel\u0026ccedil;uk University Faculty of Medicine. We applied criterion-based sampling to include both healthy individuals and patients with CD. Participants had no history of HIV, HBV, or HCV infections, had not taken antibiotics or undergone surgical treatment in the past three months, and did not use alcohol or drugs. Additionally, they were screened for gluten intolerance and metabolic diseases.\u003c/p\u003e \u003cp\u003eThe study was approved by the Ethics Committee of the Faculty of Medicine, Sel\u0026ccedil;uk University (No:\u003cb\u003e2022/10\u003c/b\u003e) and conducted in accordance with the \u003cb\u003eDeclaration of Helsinki\u003c/b\u003e. Written informed consent was obtained from all participants.\u003c/p\u003e \u003cp\u003eAfter meeting the inclusion criteria, we collected stool samples from all participants (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) and biopsy samples only from CD patients for histological examination. All patients were adults with an average age of 39 years. They were newly CD diagnosed cases and had not yet initiated treatment. Biopsy samples were immediately snap-frozen in liquid nitrogen and stored until further use. Stool samples were screened for potential infectious agents, including \u003cem\u003eEntamoeba spp.\u003c/em\u003e, \u003cem\u003eEntamoeba histolytica\u003c/em\u003e, \u003cem\u003eHelicobacter pylori\u003c/em\u003e, \u003cem\u003eSalmonella spp.\u003c/em\u003e, \u003cem\u003eShigella\u003c/em\u003e, \u003cem\u003eCryptosporidium\u003c/em\u003e, adenovirus, and rotavirus. The evaluation involved direct microscopic examination, serological testing, and conventional culture methods. Only stool samples that tested negative for infectious agents were deemed suitable and stored at -80\u0026deg;C until fecal transfer.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDetails of patient used in the study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDiagnosis\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAge\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGender\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eLevel of cytokines (ng/ml\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eβ-Actin (ng/ml)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eIL-17 (ng/ml)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eIFN-γ (ng/ml)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.437\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.242\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.137\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.487\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.217\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.598\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.448\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.053\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.252\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.488\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.227\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.374\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.477\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.175\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.405\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.484\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.347\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.425\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.445\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.266\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.199\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.493\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.199\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.468\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.318\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.482\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.431\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.369\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.149\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNormal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.166\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.223\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.134\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNormal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.266\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.065\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.319\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNormal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.258\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.159\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.396\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNormal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.263\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.214\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.387\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNormal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.235\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.742\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.313\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNormal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.193\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.958\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.107\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNormal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.262\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.369\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.084\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNormal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.297\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.385\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.117\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNormal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.212\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.278\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.417\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNormal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.179\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.319\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.358\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eAnimals\u003c/h3\u003e\n\u003cp\u003eA total of 26 Wistar albino rats were used in the study. This sample size is typical for ensuring statistical significance while maintaining ethical standards in animal research. The rats were obtained from the Sel\u0026ccedil;uk University Experimental Medicine Research and Application Center (SUDAM) and they were maintained under a controlled 12-hour light/dark cycle, which is a standard practice to regulate their circadian rhythms and ensure consistent experimental conditions. The rats had ad libitum access to standard water and food, ensuring they received adequate nutrition and hydration throughout the study. During the burn wound procedure, the rats were individually housed. This practice helps to prevent interference from other animals and reduces stress, which can affect the outcomes of the experiment. The rats were acclimatized for approximately 12 weeks at the SUDAM before the initiation of the experiment. This acclimatization period is crucial for allowing the animals to adapt to their new environment, which can help in stabilizing their physiological and behavioral parameters.\u003c/p\u003e \u003cp\u003eTo enhance the efficacy of FMT, a specific antibiotic regimen was employed to deplete the intestinal microbiota. Vancomycin and metronidazole were administered via oral gavage once daily for three weeks, while ampicillin and neomycin were provided in the drinking water at the same frequency. The rats were weighed at three distinct time points: before the initiation of antibiotic treatment (BAT), during the antibiotic treatment but prior to fecal transfer (BFT), and after the fecal transfer (AFT). Throughout the antibiotic treatment period, no adverse effects or mortality were observed.\u003c/p\u003e \u003cp\u003eThe study complied with ethical guidelines and was approved by the Animal Experiments Ethics Committee of Sel\u0026ccedil;uk University (No: \u003cb\u003e2022/12\u003c/b\u003e). It was conducted in accordance with the \u003cb\u003eARRIVE guidelines\u003c/b\u003e, and all experiments were performed in accordance with relevant guidelines and regulations.\u003c/p\u003e\n\u003ch3\u003eFecal sample preparation and transfer to animals\u003c/h3\u003e\n\u003cp\u003eStool samples were thawed in a biosafety cabinet and processed individually. For each 10 g stool sample, 20 cc of 0.9% phosphate-buffered saline (PBS) and L-cysteine were added to protect anaerobic bacteria. The mixture was vortexed, filtered through a wire strainer, and then centrifuged at 5000 \u0026times; g for 20 minutes to concentrate the bacterial content. The supernatant was collected, and aliquots were prepared in 1 mg insulin syringes for transfer. The fecal suspensions were stored in anaerobic jars at -80\u0026deg;C until use.\u003c/p\u003e \u003cp\u003eThe FMT was administered to rats via oral gavage at a volume of 200 \u0026micro;L per rat, 5 days a week for 3 weeks. The rats were divided into three groups: the CDR group 10 rats received feces from patients with CD, the HDR group 10 rats received feces from healthy donors, and the control group 6 rats received phosphate-buffered saline (PBS). Following the FMT procedure, a one-week waiting period was observed before the rats were euthanized for analysis. The entire process was conducted without causing harm or distress to the animals.\u003c/p\u003e\n\u003ch3\u003eAnimal sacrifice\u003c/h3\u003e\n\u003cp\u003eOn the 50th day of the experiment, 26 rats were humanely euthanized by cervical dislocation under general anesthesia. To minimize pain and distress, anesthesia was induced via intraperitoneal administration of 10 mg/kg rompun (Xylazinbio 2%, Bioveta, Czech Republic) and 70 mg/kg ketamine (Ketasol 10%, Richter Pharma Ag, Austria). Following euthanasia, the rats were dissected using standard necropsy procedures. Certain tissue sections were rapidly frozen in liquid nitrogen for RNA extraction. Meanwhile, segments of the duodenum (both the proximal D1-Bulbus and the distal D2-Distal), ileum, and colon were preserved in 10% formaldehyde for histological analysis. In addition, for microbiological analyses, duodenum sections were placed in sterile eppendorf tubes and transported to the laboratory with a nitrogen tank.\u003c/p\u003e\n\u003ch3\u003eHistological Examination\u003c/h3\u003e\n\u003cp\u003eThe duodenum, ileum, and colon were fixed for 36 hours, embedded in paraffin, and sectioned into slices with a thickness of 4\u0026ndash;5 \u0026micro;m. These slices were then stained using Hematoxylin-Eosin (HE) and examined under a binocular light microscope (Olympus BX51, Japan). Images of the stained tissue sections were captured with a digital camera (Olympus EP50, Japan). The degree of intestinal damage was assessed using the Marsh-Oberhuber scoring system (Oberhuber et al., 1999; Marsh, 1992).\u003c/p\u003e \u003cp\u003eThe pathology results of CD patients were retrospectively reviewed using electronic records. The histopathological findings of these celiac donor patients were then compared with those observed in recipient rats.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eRNA isolation and quantitative RT-PCR\u003c/h2\u003e \u003cp\u003eDuodenum tissue samples from rats in all three groups were collected, placed in sterile Eppendorf tubes, and stored at -80\u0026deg;C until analysis. Before processing, the samples were brought to room temperature. The tissue was cut into small pieces, and approximately 25\u0026ndash;50 mg of tissue was homogenized in 1 ml of miRNA Extractor for 30 seconds using a homogenizer, following the manufacturer's instructions (SK 8811, BIO BASIC, Canada). We assessed the integrity and quantity of the RNA samples using Bio-Rad T100 Thermal Cycler (Bio-Rad Laboratories, America) and on average, 2 \u0026micro;g of total RNA was used for subsequent steps.\u003c/p\u003e \u003cp\u003eThe reverse transcription was carried out using the ABM OneScript Plus cDNA Synthesis Kit (G236, Applied Biological Materials Inc., Canada). The synthesized cDNA was then used for quantitative Real-Time PCR (qRT-PCR) with primers listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Real-Time PCR was performed following the protocol for the BlasTaq\u0026trade; 2X qPCR MasterMix (G291, Applied Biological Materials Inc., Canada). All genes were normalized to expression of the housekeeping gene \u003cem\u003eGapdh\u003c/em\u003e and fold changes in expression of relevant genes were quantified using the ΔΔCt method.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of primers used in this study for qRT-PCR analysis.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget Gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIL-15\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eF\u003c/b\u003e: TGTGGGCATCTGAATCCACTT\u003c/p\u003e \u003cp\u003e\u003cb\u003eR\u003c/b\u003e: TTCCCAGACCATGCACAACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIL- 21\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eF\u003c/b\u003e: TGCCTGCTAAGAGGACAGGA\u003c/p\u003e \u003cp\u003e\u003cb\u003eR\u003c/b\u003e: AGCCACAACGTGAGAAGTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTNF-α\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eF\u003c/b\u003e: GGCTTTCGGAACTCACTGGA\u003c/p\u003e \u003cp\u003e\u003cb\u003eR\u003c/b\u003e: CCCGTAGGGCGATTACAGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eIFN-α\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eF\u003c/b\u003e: GTGGAAGGATTAGGACCAAACAGA\u003c/p\u003e \u003cp\u003e\u003cb\u003eR\u003c/b\u003e: CCTTCTCCAAAGGGAACCCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGapdh*\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eF\u003c/b\u003e: ATGACTCTACCCACGGCAAG\u003c/p\u003e \u003cp\u003e\u003cb\u003eR\u003c/b\u003e: CTGGAAGATGGTGATGGGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003eF*-Forward primer R*- Reverse primer\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003eGapdh*-Glycealdehyde-3-phosphate dehydrogenase\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e For DNA amplification, the PCR mix was loaded into the LightCycler\u0026reg; 96 Instrument (Roche Diagnostics, Basel, Sweden), and thermal cycling was conducted according to the manufacturer's protocol.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMeasurement of IFN-γ, IL-17, and β-actin Serum Levels\u003c/h3\u003e\n\u003cp\u003eBlood samples were collected from rats and transported to the microbiology laboratory, where they were centrifuged at 3,000 rpm in 20 minutes. The serum portion of the blood was then carefully transferred into pre-labeled Eppendorf tubes. Measurements were performed using the following ELISA kits from Bioassay Technology Laboratory (Shanghai, China): BT LAB Rat IL-17 (Catalog number: E0115Ra), BT LAB Rat IFN-γ (Catalog number: E0103Ra), and BT LAB Rat β-actin (Catalog number: E1488Ra) and read on a Allsheng | AMR-100 Elisa Reader (Hangzhou Allsheng Instruments, China).\u003c/p\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eAll statistical analyses were conducted using Prism version 10.1.1 (GraphPad, San Diego, CA, USA). Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation, median [range], frequency (n), and percentage (%). Changes in animal weights over time were assessed using repeated-measures ANOVA, followed by Bonferroni correction for pairwise comparisons. Histopathological findings between celiac and healthy donor rats were compared using the Mann-Whitney U test. The agreement between histopathological classifications of CD patients and rats was evaluated with the weighted kappa coefficient. Additionally, data from RT-PCR and ELISA analyses were assessed using the t-test. A p-value of less than 0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eA total of 10 patients, 7 (70%) male and 3 (30%) female, aged 19\u0026ndash;74, who met the criteria and were diagnosed with celiac disease, and 20 individuals, 7 (70%) male and 3 (30%) female, who did not have any acute health problems, were included in this study. The average age of celiac patients and healthy donors included in the study was 34.95.\u003c/p\u003e \u003cp\u003eThe weights of the rats in all three groups, measured after three weighing procedures (before antibiotic treatment, before fecal transfer and after fecal transfer), were compared statistically (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation). According to the results, the weights of the control group rats that received feces transfer from healthy donors and PBS transfer were found to increase in accordance with their weekly development as a result of three weighings, which was found to be statistically significant (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;001\u003c/em\u003e). It was found that the patient group rats increased their weight after the first and second weighing, while they lost weight after the last weighing, which was statistically significant (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;001\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWhen the animals were necropsied, no pathological lesions were observed in the duodenums of rats that received fecal transfer from healthy donors and the control group rats. However, visible pathological lesions were observed in the duodenum of rats that underwent fecal transfer from CD donors (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFollowing histopathological examinations, it was determined that the villus-crypt ratio in the duodenum of the control group rats that received phosphate buffered saline transfer was normal, there was no massification in the villi, and the intraepithelial lymphocyte increase was within certain limits (0\u0026ndash;9) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe villi-crypt ratio in the duodenum of rats in the group that received fecal transfer from healthy donors was found to be normal and there was no atrophy in the villi. However, it was found that there was a slight increase (\u003cspan additionalcitationids=\"CR11 CR12 CR13 CR14\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e) in the number of duodenal intraepithelial lymphocytes in the rats in this group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, D).\u003c/p\u003e \u003cp\u003eAn increase in the number of intraepithelial lymphocytes (\u0026gt;\u0026thinsp;20), a decrease in the villus-crypt ratio of varying severity, and villous massing were observed in the duodenums of rats in the group that received fecal transfer from individuals with celiac disease (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-H).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHistological examinations of fecal-transferred animals were conducted using the Marsh-Oberhuber classification (Oberhuber et al., 1999; Marsh, 1992). The results showed that animals transferred with human CD samples developed visible changes, including alterations in the villus-to-crypt ratio. These are signs of the development of celiac disease (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eHistological examinations of fecal-transferred animals using the Marsh-Oberhuber classification.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3a\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3b\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3c\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eC1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eC2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eC3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eC4\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eC5\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eC6\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHDR1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHDR2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHDR3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHDR4\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHDR5\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHDR6\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHDR7\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHDR8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHDR9\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHDR10\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCDR1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCDR2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCDR3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCDR4\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCDR5\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCDR6\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCDR7\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCDR8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCDR9\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCDR10\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eHistopathological results of celiac patients and rats that underwent fecal transfer from these patients were compared (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). According to the results, Marsh Type 1 scoring was observed in 4 (80%) of the rats to which the feces of 5 patients compatible with Marsh Type 1 were transferred. Although 5 of the patients had Marsh Type 3 scoring, 4 of the rats that received fecal transfer from the same patients had Marsh Type 3 scoring. Although there were no patients in the CD group pathologically suitable for Marsh Type 2, Marsh Type 2 scoring was performed in 1 (20%) of the rats in the patient group. In general, when the histopathological results of CD were compared with the histopathological results of the patient group rats, a moderate level of agreement (66.7%) was found (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComparison of histopathological results between celiac patients and the CDR group of rats.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003ePatient histopathology\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eHistopathology of the Transferred Rat\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCDR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCDR2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCDR3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCDR4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCDR5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCDR6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCDR7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCDR8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCDR9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCDR10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eStatistical comparison of histopathological results between CD patients and CDR rats.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"7\" nameend=\"c7\" namest=\"c1\"\u003e \u003cp\u003eHistopathology (Human)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eWeighted kappa\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e\u003cb\u003eHistopathology\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(rats)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e4 (80)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0 (0)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e0 (0)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0 (0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.667\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0 (0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0 (0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4 (80)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe mRNA expression levels of proinflammatory cytokines; IL-15 and IL-21 in rats that underwent stool transfer from celiac patients were found to be significantly higher compared to rats that underwent stool transfer from healthy donors and the control group rats (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e). (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, B). The mRNA expression levels of proinflammatory cytokines; IL-15 and IL-21 in rats that received stool transfer from healthy donors were similar to the mRNA expression levels of the control group rats.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe mRNA expression levels of proinflammatory cytokines; TNF-α and IFN-α in rats that underwent stool transfer from celiac patients were found to be significantly higher compared to rats that underwent stool transfer from healthy donors and the control group rats (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.001\u003c/em\u003e). The mRNA expression levels of proinflammatory cytokines, TNF-α and IFN-α, in rats that received stool transfer from healthy donors were similar to the mRNA expression levels of the control group rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, D).\u003c/p\u003e \u003cp\u003eThe ELISA results showed that serum levels of proinflammatory cytokines (IL-17, IFN-γ) and β-actin were significantly elevated in the CDR group rats compared to those receiving stool transplants from healthy donors (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;6A-C). In contrast, the levels of IFN-γ and β-actin in rats that received stool transfers from healthy donors were comparable to those of the control group. However, the IL-17 serum levels in the CDR were significantly higher than in the control group rats (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). The IFN-γ and β-actin levels in the CDR serum were approximately three times higher than those in the other groups. However, the IFN-γ and β-actin production levels in the HDR and control groups were similar, with no significant statistical differences.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe pathogenesis of CD is significantly influenced by the intestinal microbiota, particularly through the mechanism of inflammation resulting from dysbiosis. Dysbiosis refers to an imbalance in the gut microbiota, characterized by a reduction in beneficial species and an overgrowth of potentially pathogenic microorganisms (Marasco et al., 2016; De Angelis et al., 2016). FMT is a medical procedure that involves the transplantation of stool from a healthy donor into the intestine of a recipient. This procedure aims to restore the balance of the gut microbiota, which can have therapeutic benefits for various diseases, including CD (Bokoliya et al., 2021; Porcari et al., 2023).\u003c/p\u003e \u003cp\u003eIn the present study, we investigated the role of intestinal microbiota in the pathogenesis of CD using an experimental animal model. Rats that underwent fecal transfer from CD patients exhibited a significant increase in the number of intraepithelial lymphocytes, exceeding 20 per high power field. This is a hallmark of CD specific damage and indicates an immune response within the duodenal epithelium. There was a notable reduction in the villus-crypt ratio in these rats, which varied in severity. This reduction is indicative of villous atrophy and crypt hyperplasia, common features in CD pathology. The presence of villous massing was observed, which further supports the occurrence of structural changes in the duodenal mucosa due to CD. The case described by Beurden et al. (2016) demonstrates the potential of FMT as a treatment for patients with RCD II and concurrent \u003cem\u003eClostridium difficile\u003c/em\u003e infection, leading to significant histological and symptomatic improvement, as evidenced by the transition from Marsh 3a to Marsh 0.\u003c/p\u003e \u003cp\u003eIn contrast, rats that received fecal transfers from healthy donors or PBS did not exhibit these pathological changes. Their duodenal sections maintained normal histological architecture, with no significant increase in intraepithelial lymphocytes, stable villus-crypt ratios, and absence of villous massing.\u003c/p\u003e \u003cp\u003eDuring CD damage of the intestinal mucosa results in impaired absorption of various nutrients, which can cause a range of health issues. Similar to Carlson, 2020 data, our findings indicate that animals lose weight after receiving fecal transfers from celiac disease patients and subsequently develop signs of CD. The findings demonstrated that the weights of rats receiving healthy fecal transplants and those in the control group consistently increased. This key observation underscores the importance of investigating weight changes in future studies, particularly for the diagnosis and treatment of CD.\u003c/p\u003e \u003cp\u003eProinflammatory cytokines play a central role in both innate and adaptive immune responses in the pathogenesis of celiac disease. Tye-Din et al., 2018 found that in CD the expression levels of several proinflammatory cytokines, such as IL-15, IL-21, TNF-α, and IFN-α, are elevated in duodenal tissue, while serum levels of proinflammatory cytokines like IL-17 and IFN-γ also increased. To assess the impact of cytokines, we investigated their expression and production. Our findings showed that mRNA levels of proinflammatory cytokines (IL-15, IL-21, TNF-α, IFN-α) were heightened in duodenal tissue, and serum levels of proinflammatory cytokines (IL-17, IFN-γ) were elevated. IL-15 is a major proinflammatory cytokine released in high levels by intestinal epithelial cells during active CD and plays a critical role in the pathogenesis of the disease. Research on CD pathogenesis has shown that overexpression of IL-15 leads to epithelial damage by increasing the number of inflammatory cells in the small intestine. Furthermore, IL-15 induces IFN-γ production by stimulating intraepithelial lymphocytes (IELs), contributing to the inflammatory milieu (Vorobjova et al., 2019). We observed that IL-15 mRNA levels were higher in the small intestinal mucosa of CDR compatre to HDR. Research has demonstrated that IL-15 mRNA overexpression in active celiac disease contributes to the increased presence of inflammatory cells, which play a critical role in epithelial damage (Di Sabatino et al., 2006; Pagliari et al., 2013, 2015). IL-15 is upregulated in the intestinal mucosa of CD patients, acting on various cell types to disrupt immune homeostasis and promote inflammation (Abadie et al. 2011; 2014; Di Sabatino et al. 2006, 2016).\u003c/p\u003e \u003cp\u003eBorrelli et al. (2016) analyzed duodenal biopsies from 76 active CD patients, 90 potential CD patients (identified by disease-related positive serology), and 58 controls for IL-21 expression. Their findings indicated that IL-21 expression was significantly lower in potential CD patients compared to those with active CD. These results underscore the critical role of IL-21 in the progression of mucosal damage in active CD (Borrelli et al., 2016). The results showed that the duodenal IL-21 mRNA expression was significantly higher in the CDR compared to those that received fecal transfer from healthy donors or PBS transfer. This suggests that IL-21 plays a role in the pathological process of CD and that its expression is modulated by the gut microbiota.\u003c/p\u003e \u003cp\u003eTNF-α is a proinflammatory cytokine secreted by Th1 cells, playing a crucial role in the pathogenesis of mucosal damage in celiac disease. Elevated levels of TNF-α have been observed in the intestinal mucosa of celiac patients, contributing to the inflammatory response and tissue damage (Manavalan et al., 2010; Piatek-Guziewicz et al. 2017). Our results indicated that duodenal TNF-α mRNA levels were significantly higher in the CDR group rats compared to HDR and the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Similiar data we found on IFN-α relative expression. The mechanisms underlying the elevated levels of IFN-α in CD are not yet fully understood, and further research is needed to explore the role of viral infections in their development.\u003c/p\u003e \u003cp\u003eIn active CD studies have demonstrated that activated T cells produce IFN-γ, a proinflammatory cytokine (Di Sabatino et al., 2016). In their study on adult CD, Manavalan et al. (2010) observed that serum IFN-γ levels in active celiac patients (n\u0026thinsp;=\u0026thinsp;18) were significantly higher than those in the control group (n\u0026thinsp;=\u0026thinsp;16) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.005) (Manavalan et al., 2010). Our results demonstrated that serum levels of IL-17, IFN-γ, and β-actin in the CDR rats were significantly elevated compared to those in the rats that underwent fecal transfer from healthy donors or control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Monteleone et al. (2010) investigated IL-17A RNA expression levels by analyzing biopsy samples from 27 adults with active CD, 19 treated CD patients, and 26 healthy controls. Their results demonstrated that IL-17A RNA expression levels were significantly elevated in active CD patients compared to treated patients and controls (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Additionally, IL-17A protein expression levels, measured by the ELISA method, were found to be higher in the active patient group (Monteleone et al., 2010).\u003c/p\u003e \u003cp\u003eIn conclusion, the findings underscore the critical role of intestinal microbiota in CD pathogenesis, highlighting how microbial imbalance can trigger immune modulation and inflammation, even in the absence of genetic predisposition. This opens avenues for microbiota-targeted therapies in managing CD. The study findings indicating elevated mRNA and serum levels of proinflammatory cytokines in rats receiving fecal transfer from CD patients suggest that these cytokines could serve as novel noninvasive biomarkers for diagnosing and monitoring celiac disease. This conclusion is supported by several studies highlighting the role of inflammatory cytokines in CD pathogenesis and their potential as diagnostic markers. However, extensive clinical studies are necessary to confirm these findings and establish their clinical utility.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eContributionsConceptualization: R.S., S.M., H.K., and D.F. Experimental investigation: R.S. and D.F. Bioinformatics and statistical analysis: M.K.K. Writing\u0026mdash;original draft: R.S. Writing\u0026mdash;review and editing: R.S., S.M., B.A., and D.F. Pathological assessment: Z.C. and M.B.A. Data curation: R.S. Figure preparation: R.S. Funding acquisition: R.S. and D.F. All authors contributed to data interpretation, discussed the results, and provided critical feedback on the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eR.S. received funding from Sel\u0026ccedil;uk \u0026Uuml;niversitesi Bilimsel Araştırmalar Koordinat\u0026ouml;rl\u0026uuml;ğ\u0026uuml; under Grant Number 22212019, partially supported by Sel\u0026ccedil;uk University.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eAll data generated and analyzed during this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLebwohl, B., Sanders, D. S. \u0026amp; Green, P. H. R. Coeliac disease. \u003cem\u003eLancet\u003c/em\u003e \u003cb\u003e391\u003c/b\u003e, 70\u0026ndash;81 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eItzlinger, A., Branchi, F., Elli, L. \u0026amp; Schumann, M. Gluten-free diet in celiac disease forever and for all? \u003cem\u003eNutrients\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e (11), 1796 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCaio, G. et al. Celiac disease: a comprehensive current review. \u003cem\u003eBMC Med.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e, 142 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDunne, M. R., Byrne, G., Chirdo, F. G. \u0026amp; Feighery, C. Coeliac disease pathogenesis: The uncertainties of a well-known immune mediated disorder. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 1374 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Kalleveen, M., de Meij, T. \u0026amp; Pl\u0026ouml;tz, F. B. Clinical spectrum of paediatric coeliac disease: a 10-year single-centre experience. \u003cem\u003eEur. J. Pediatr.\u003c/em\u003e \u003cb\u003e177\u003c/b\u003e, 593\u0026ndash;602 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBul, V., Sleesman, B. \u0026amp; Boulay, B. Celiac disease presenting as profound diarrhea and weight loss\u0026mdash;a celiac crisis. \u003cem\u003eAm. J. Case Rep.\u003c/em\u003e \u003cb\u003e5\u003c/b\u003e, 559\u0026ndash;561 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAl-Toma, A. et al. European Society for the Study of Coeliac Disease (ESsCD) guideline for coeliac disease and other gluten-related disorders. \u003cem\u003eUnited Eur. Gastroenterol. J.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e (5), 583\u0026ndash;613 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHusby, S. et al. European Society Paediatric Gastroenterology, Hepatology and Nutrition Guidelines for Diagnosing Coeliac Disease 2020. \u003cem\u003eJ. Pediatr. Gastroenterol. Nutr.\u003c/em\u003e \u003cb\u003e70\u003c/b\u003e, 141\u0026ndash;156 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSilvester, J. A. et al. Tests for serum transglutaminase and endomysial antibodies do not detect most patients with celiac disease and persistent villous atrophy on gluten-free diets: a meta-analysis. \u003cem\u003eGastroenterology\u003c/em\u003e \u003cb\u003e153\u003c/b\u003e, 689\u0026ndash;701e1 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOlivares, M. et al. Gut microbiota trajectory in early life may predict development of celiac disease. \u003cem\u003eMicrobiome\u003c/em\u003e \u003cb\u003e6\u003c/b\u003e, 36 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCenit, M. C., Codo\u0026ntilde;er-Franch, P. \u0026amp; Sanz, Y. Gut microbiota and risk of developing celiac disease. \u003cem\u003eJ. Clin. Gastroenterol.\u003c/em\u003e \u003cb\u003e50\u003c/b\u003e, 148\u0026ndash;152 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGreen, P. H., Lebwohl, B. \u0026amp; Greywoode, R. Celiac disease. \u003cem\u003eJ. Allergy Clin. Immunol.\u003c/em\u003e \u003cb\u003e135\u003c/b\u003e, 1099\u0026ndash;1106 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, J. W. et al. Fecal microbiota transplantation: review and update. \u003cem\u003eJ. Formos. Med. Assoc.\u003c/em\u003e \u003cb\u003e118\u003c/b\u003e (1), S23\u0026ndash;S31 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWebb, B. J. et al. Fecal microbiota transplantation for recurrent \u003cem\u003eClostridium difficile\u003c/em\u003e infection in hematopoietic stem cell transplant recipients. \u003cem\u003eTranspl. Infect. Dis.\u003c/em\u003e \u003cb\u003e18\u003c/b\u003e (4), 628\u0026ndash;633 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOberhuber, G., Granditsch, G. \u0026amp; Vogelsang, H. The histopathology of coeliac disease: time for a standardized report scheme for pathologists. \u003cem\u003eEur. J. Gastroenterol. Hepatol.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 1185\u0026ndash;1194 (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarsh, M. N. Grains of truth: evolutionary changes in small intestinal mucosa in response to environmental antigen challenge. \u003cem\u003eGut\u003c/em\u003e \u003cb\u003e31\u003c/b\u003e (1), 111\u0026ndash;114 (1990).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarasco, G. et al. Gut microbiota and celiac disease. \u003cem\u003eDig. Dis. Sci.\u003c/em\u003e \u003cb\u003e61\u003c/b\u003e, 1461\u0026ndash;1472 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Angelis, M. et al. Salivary and fecal microbiota and metabolome of celiac children under gluten-free diet. \u003cem\u003eInt. J. Food Microbiol.\u003c/em\u003e \u003cb\u003e19\u003c/b\u003e, 125\u0026ndash;132 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBokoliya, S. C., Dorsett, Y., Panier, H. \u0026amp; Zhou, Y. Procedures for fecal microbiota transplantation in murine microbiome studies. \u003cem\u003eFront. Cell. Infect. Microbiol.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e, 711055 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePorcari, S. et al. Key determinants of success in fecal microbiota transplantation: from microbiome to clinic. \u003cem\u003eCell. Host Microbe\u003c/em\u003e. \u003cb\u003e10\u003c/b\u003e, 712\u0026ndash;733 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeurden, Y. H. V. et al. Serendipity in refractory celiac disease: full recovery of duodenal villi and clinical symptoms after fecal microbiota transfer. \u003cem\u003eJ. Gastrointestin Liver Dis.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 385\u0026ndash;388 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarlson, P. E. Regulatory considerations for fecal microbiota transplantation products. \u003cem\u003eCell. Host Microbe\u003c/em\u003e. \u003cb\u003e12\u003c/b\u003e, 173\u0026ndash;175 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTye-Din, J. A., Galipeau, H. J. \u0026amp; Agardh, D. Celiac disease: a review of current concepts in pathogenesis, prevention, and novel therapies. \u003cem\u003eFront. Pediatr.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e, 350 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVorobjova, T. et al. Celiac disease in children, particularly with accompanying type 1 diabetes, is characterized by substantial changes in the blood cytokine balance, which may reflect inflammatory processes in the small intestinal mucosa. \u003cem\u003eJ. Immunol. Res.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 6179243 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDi Sabatino, A. et al. Epithelium-derived interleukin 15 regulates intraepithelial lymphocyte Th1 cytokine production, cytotoxicity, and survival in coeliac disease. \u003cem\u003eGut\u003c/em\u003e \u003cb\u003e55\u003c/b\u003e, 469\u0026ndash;477 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDi Sabatino, A. et al. Innate and adaptive immunity in self-reported nonceliac gluten sensitivity versus celiac disease. \u003cem\u003eDig. Liver Dis.\u003c/em\u003e \u003cb\u003e48\u003c/b\u003e, 745\u0026ndash;752 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePagliari, D. et al. The role of IL-15 in gastrointestinal diseases: a bridge between innate and adaptive immune response. \u003cem\u003eCytokine Growth Factor. Rev.\u003c/em\u003e \u003cb\u003e24\u003c/b\u003e, 455\u0026ndash;466 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePagliari, D. et al. The interaction among microbiota, immunity, and genetic and dietary factors is the \u003cem\u003econdicio sine qua non\u003c/em\u003e celiac disease can develop. \u003cem\u003eJ. Immunol. Res.\u003c/em\u003e \u003cb\u003e2015\u003c/b\u003e, 123653 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBorrelli, M. et al. In the intestinal mucosa of children with potential celiac disease, IL-21 and IL-17A are less expressed than in active disease. \u003cem\u003eAm. J. Gastroenterol.\u003c/em\u003e \u003cb\u003e111\u003c/b\u003e, 134\u0026ndash;144 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManavalan, J. S. et al. Serum cytokine elevations in celiac disease: association with disease presentation. \u003cem\u003eHum. Immunol.\u003c/em\u003e \u003cb\u003e71\u003c/b\u003e, 50\u0026ndash;57 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePiatek-Guziewicz, A. et al. \u003cem\u003eWorld J. Gastroenterol.\u003c/em\u003e ;\u003cb\u003e23\u003c/b\u003e:7849. (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbadie, V. et al. \u003cem\u003eAnnu. Rev. Immunol.\u003c/em\u003e ;\u003cb\u003e29\u003c/b\u003e:493\u0026ndash;425. (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMonteleone, I. et al. \u003cem\u003eJ. Immunol.\u003c/em\u003e ;\u003cb\u003e184\u003c/b\u003e:2211\u0026ndash;2218. (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVelikova, T. et al. \u003cem\u003eJ Immunol. Res\u003c/em\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDiscepolo, V. et al. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e ;\u003cb\u003e8\u003c/b\u003e:2708. (2021).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"celiac disease, fecal microbiota transfer, gut microbiota, intestinal inflammation, cytokines","lastPublishedDoi":"10.21203/rs.3.rs-6700857/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6700857/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCeliac disease (CD) is a chronic autoimmune disorder triggered by gluten ingestion in genetically predisposed individuals, leading to intestinal inflammation and villous atrophy. Emerging evidence suggests that gut microbiota may play a pivotal role in CD pathogenesis. This study aimed to evaluate the immunological and histopathological effects of fecal microbiota transfer (FMT) from CD patients and healthy individuals into a rat model. After antibiotic-induced microbiota depletion, Wistar albino rats received FMT for three weeks, followed by histological and molecular analyses.\u003c/p\u003e \u003cp\u003eRats colonized with microbiota from CD patients exhibited significant weight loss (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), increased intraepithelial lymphocyte infiltration (\u0026gt;\u0026thinsp;20 per high-power field), and villous atrophy with crypt hyperplasia, closely resembling CD-associated mucosal damage. Notably, histopathological analysis revealed a striking similarity between the duodenal biopsies of CD patients and the intestinal tissue of rats receiving FMT from CD donors. Additionally, proinflammatory cytokine levels, including IL-15, IL-21, TNF-α, and IFN-α mRNA expression in the duodenum, were significantly upregulated (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Serum levels of IL-17 and IFN-γ were also markedly elevated (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) in these animals compared to controls.\u003c/p\u003e \u003cp\u003eA strong correlation was observed between the severity of histopathological changes and cytokine expression, reinforcing the role of dysbiotic gut microbiota in CD-associated inflammation. These findings provide experimental evidence linking microbiota alterations to CD pathogenesis and suggest that modulating the gut microbiome may represent a potential therapeutic avenue for CD management.\u003c/p\u003e","manuscriptTitle":"Fecal microbiota transfer from celiac patients induces immune and histopathological changes mirroring celiac disease in a rat model","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-25 09:39:14","doi":"10.21203/rs.3.rs-6700857/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f2fd4315-2539-44f1-894a-cd66d48ed837","owner":[],"postedDate":"June 25th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":50246503,"name":"Biological sciences/Microbiology"},{"id":50246504,"name":"Health sciences/Gastroenterology"}],"tags":[],"updatedAt":"2025-09-11T04:38:29+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-25 09:39:14","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6700857","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6700857","identity":"rs-6700857","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}