The unfolded protein sensor IRE1a is essential for homeostatic dendritic cell maturation

The unfolded protein sensor IRE1a is essential for homeostatic dendritic cell maturation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Biological Sciences - Article The unfolded protein sensor IRE1a is essential for homeostatic dendritic cell maturation Sophie Janssens, Victor Bosteels, Sandra Marechal, Eva Cloots, and 19 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4763670/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted You are reading this latest preprint version Abstract The continuous engulfment of apoptotic cells initiates a homeostatic maturation program in conventional type I dendritic cells (cDC1s), hallmarked by the activation of the transcription factor LXRb, which mediates cholesterol efflux and dampens interferon stimulated gene expression. cDC1s are characterized by a high basal activation of the unfolded protein response (UPR) sensor IRE1, without concomitant induction of a proper UPR gene signature, a finding that has puzzled the field. Here we show that in absence of IRE1, the homeostatic maturation of cDC1s is blocked, while homeostatic maturation of cDC2s remains unaffected. IRE1 activation is strictly dependent on apoptotic cell engulfment and cholesterol influx, explaining its cDC1 subset specific activity. Stimulation of IRE1 endonuclease activity in cDC1s leads to a Regulated IRE1 Dependent Decay (RIDD) response, targeting miRNAs rather than mRNAs. This causes the degradation of miRNA-92a, which targets the cholesterol efflux transporter Abcg1 . Loss of IRE1 leads to defects in cholesterol efflux in mature cDC1s and concomitant cell death, while cDC2s do not show any defects. Blocking miRNA synthesis or enforcing cholesterol efflux by treatment with reconstituted high-density lipoproteins rescues cDC1s from cell death. These data highlight the central role of IRE1 as a sensor of cholesterol influx in the ER, extending IRE1’s function beyond its canonical role in protein folding. Furthermore, they underscore the tight control of cholesterol metabolism during cDC1 maturation, uncovering a second pathway to coordinate cholesterol efflux that acts in parallel to LXRb. Biological sciences/Immunology/Innate immune cells/Dendritic cells/Conventional dendritic cells Biological sciences/Cell biology/Protein folding/Endoplasmic reticulum Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 One sentence summary IRE1 controls homeostatic cDC1 maturation by coordinating cholesterol homeostasis upon apoptotic cell engulfment. Main Inositol Requiring Enzyme 1 (IRE1) is an endonuclease embedded in the ER membrane that together with PKR-like endoplasmic reticulum kinase (PERK) and Activating Transcription Factor 6 (ATF6), coordinates the unfolded protein response (UPR) 1–3 . The UPR is an adaptive response that is typically activated upon accumulation of unfolded proteins in the ER. IRE1 represents the most conserved branch of the UPR and splices X-box binding protein 1 ( Xbp1 ) mRNA to generate the transcription factor XBP1s. XBP1s in turn helps to restore protein homeostasis by inducing the expression of chaperones, redox enzymes and ER-associated degradation (ERAD) components. In addition, IRE1 endonuclease activity targets mRNAs and miRNAs for degradation through a poorly understood process termed regulated IRE1 dependent decay (RIDD) 4–7 . In vivo , IRE1 is typically activated in secretory cells such as goblet cells 8 or plasma cells 9 , or in immune cells that are actively proliferating during a viral infection 10 , underscoring IRE1’s canonical role in protein folding. On the contrary, in type 1 conventional dendritic cells (cDC1s), IRE1 is active in absence of prototypical ER stress and without the induction of typical XBP1s target genes 11–15 . Why and how IRE1 is specifically activated in cDC1s but not in the highly related cDC2 subset remains enigmatic. Loss of XBP1/IRE1 affects gene expression in cDC1s, not cDC2s To gain insights into the function of IRE1 in cDC1s, we performed bulk RNA sequencing (RNA-seq) in different genotypes of the XBP1/IRE1 axis. Loss of XBP1 induces IRE1 hyperactivation and strong activation of RIDD-associated mRNA degradation in cDC1s, not in the closely related cDC2 subset 12,13 . This complicates the interpretation of RNA-seq data, since any gene downregulated in Xbp1 fl/fl Itgax -cre (called XBP1∆DC) cDC1s could either be transcriptionally regulated by XBP1s or targeted for degradation through RIDD 12 . To dissect the functions of XBP1 and IRE1 separately, we compared cDC1s sorted from the spleens of XBP1(/IRE1) fl/fl (WT), XBP1∆DC and a XBP1/IRE1∆DC mouse strains ( Fig. 1a ) . IRE1 can be found as two different paralogues, IRE1a and IRE1b. IRE1a is ubiquitously expressed, while IRE1b expression is limited to epithelial cells lining the mucosal tracts 16 . When referring to IRE1 in this study, we refer to IRE1a, encoded by the gene Ern1 .XBP1∆DC cDC1s have lost Xbp1 mRNA expression and show high RIDD activity, as reflected by downregulation of the prototypic RIDD target gene Bloc1s 17 (Fig. 1b) . XBP1/IRE1∆DC cDC1s do not express Xbp1 nor Ern1 , hence lost RIDD activity, as confirmed by restoration of Bloc1s1 expression ( Fig. 1b ). The two major splenic conventional DC subsets, cDC1s and cDC2s, were sorted (gating strategy Extended Data Fig. 1 ) and processed for bulk RNA-seq analysis. In cDC2s, very few differentially expressed (DE) genes could be identified, revealing that in steady state the XBP1/IRE1 pathway does not play a major role in cDC2s ( Supplementary Table 1 ). On the contrary, in cDC1s many DE genes were uncovered in all 3 pairwise comparisons ( Fig. 1c and Supplementary Table 2 ), which was validated by RT-qPCR ( Extended Data Fig. 2 ). Overall, three major directionalities of DE genes could be distinguished, with representative genes indicated on Fig. 1c and validated by RT-qPCR in Fig. 1b . A first group of genes (indicated in yellow on the rose plot, Fig. 1c ) represents genes that were specifically downregulated in XBP1∆DC cDC1s and comprises classical RIDD targets such as Bloc1s1 , Tapbp or Stim1 in addition to established XBP1 target genes ( Fig. 1d-e, Extended Data Fig. 2, Extended Data Fig. 3a-b) . Loss of XBP1 in cDC1s does not lead to a major loss in XBP1 target gene expression as only a few XBP1 target genes were retrieved as differentially expressed genes (DEGs), all with low fold inductions (e.g. Sec61a1 , Txndc11 , Sec24d ). Of note, several genes previously annotated as XBP1 transcriptional target genes 18 appeared regulated by RIDD rather than by XBP1 based on their restored expression in XBP1/IRE1∆DC cDC1s ( Fig. 1d, Extended Data Fig. 3b ). A second group of genes (indicated in green and blue on the rose plot, Fig. 1c ) is highly upregulated in XBP1∆cDC1s and XBP1/IRE1∆cDC1s and comprises genes that belong to the integrated stress response (ISR) ( Fig. 1d-e, Extended Data Fig. 2, 3d, 4 ), confirming earlier data 13 . Finally,the pink group ( Fig. 1c ) represents genes that were downregulated in absence of XBP1/IRE1. Based on their directionality, they appeared more affected by the loss of IRE1 than by the loss of XBP1s transcriptional activity ( Fig. 1b, c ). To probe the function of the DE genes in this group, we assessed whether particular gene ontology (GO) terms were enriched in this direction. This revealed GO immunological terms such as “negative regulation of inflammation” and “tolerance induction” associated with the pink group of genes (angle 5-6 Extended Data Fig. 5a, Supplementary Table 3 ), comprising well-established DC maturation genes such as Tmem176a , Fsnc1 or Ccr7 19,20 (Extended Data Fig. 3e) . None of these genes were known as IRE1 or XBP1s target genes before. In addition, ingenuity pathway analysis (IPA) highlighted ER associated (GO) terms such as “unfolded protein response”, “superpathway of cholesterol biosynthesis” or “tRNA charging” in the comparison XBP1∆DC vs WT while the comparisons XBP1/IRE1∆DC vs WT, and XBP1∆ vs XBP1/IRE1∆DC additionally retrieved DC specific categories such as “Th1 and Th2 activation pathway”, “dendritic cell maturation”or “graft-versus-host-disease signaling” (Extended Data Fig. 5b) . Overall, the bulk RNA-seq analysis revealed that the absence of the IRE1/XBP1 signaling branch does not affect gene expression in cDC2s, in contrast to cDC1s. In line with our earlier observations 12,13 , the high basal activity of IRE1 in cDC1s was not reflected by strong expression of canonical XBP1 target genes. On the contrary, a large group of DC specific genes appeared downregulated in absence of IRE1 rather than XBP1 and were associated with DC maturation. While we could not rule out the possibility that these genes might be indirectly regulated rather than being direct targets of IRE1 endonuclease activity, it suggested that in cDC1s, IRE1 might hold functions beyond its traditional role in protein folding. IRE1 is essential for homeostatic cDC1 maturation DEG analysis revealed that genes belonging to the homeostatic and common DC maturation program 19 showed decreased expression levels in XBP1/IRE1 deficient cDC1s ( Fig. 2a, Extended Data Fig. 3e, 4 ), which was validated by RT-qPCR ( Extended Data Fig. 2 ). To assess whether the differences in expression of DC maturation genes were reflected by differences in DC maturation, we immunophenotyped the DC compartment in the different genotypes. In line with our previous findings 12,13 , the total number of splenic cDC1s and cDC2s was not altered in XBP1∆DC or XBP1/IRE1∆DC mice ( Fig. 2b ). However, the percentage of mature CCR7 + cDC1s was strongly affected, particularly in XBP1/IRE1∆DC mice (Fig. 2b) , while CCR7 + cDC2s were not affected. To exclude the possibility that the difference in mature cDC1s was due to downregulation of the marker gene Ccr7 , we assessed the percentage of CD86 + cDC1s, as Cd86 was not affected in the RNA-seq analysis ( Fig. 2a ) which confirmed the specific decrease in the mature cDC1 population ( Fig. 2c ). Furthermore, we noticed that the surface expression of CCR7 appeared unaffected in XBP1∆DC and XBP1/IRE1∆DC cDC1s, even though Ccr7 came out as a DE gene (Extended Data Fig. 6a) . This indicated that Ccr7 might not be directly regulated by IRE1, but that the loss of IRE1 in cDC1s is associated with a block in maturation, which is reflected by a general decrease in maturation genes in a bulk RNA-seq dataset. Recently, our lab extensively mapped homeostatic DC maturation pathways in the spleen through CITE-Seq analysis and lineage tracing experiments 20 . This led to the identification of markers that could be used by flow cytometry to distinguish different maturation stages of cDC1s 20 ( Extended Data Fig. 6b ). We used this gating strategy to assess at which point loss of the XBP1/IRE1 signaling branch affected the DC maturation program and found significant loss of the mature CCR7 + cDC1s and the late immature subset (identified as CD62L - CD103 + ESAM + CCR7 - ). On the other hand, the early immature cDC1 subset (CD62L + CD103 - ESAM - CCR7 - )was increased, suggesting that loss of IRE1 led to a reduction of mature cDC1s and an accumulation of the early immature cells ( Fig. 2d) . Signals driving homeostatic DC maturation in steady state conditions have long remained enigmatic 21 . Recently, several labs uncovered an essential role for apoptotic cell (AC) engulfment and cholesterol metabolic pathways at the heart of cDC1 maturation 20,22,23 . We previously noted that injection of exogenous apoptotic thymocytes boosted engulfment in splenic cDC1s and triggered their homeostatic maturation with a peak observed at 12h post- intravenous injection 20 ( Fig. 2e) . In line with the observed defects in the mature cDC1 compartment, injection of ACs in XBP1/IRE1∆DC mice did not lead to a similar increase in cDC1 maturation ( Fig. 2e ). Also, injection of empty non-adjuvanted lipid nanoparticles (eLNPs) 20 , comprising 40% cholesterol ( Fig. 2f left panel), only slightly increased cDC1 maturation in absence of XBP1/IRE1. On the contrary, injection with LNPs coupled to poly(I:C), a potent TLR3 ligand, did induce full cDC1 maturation in XBP1/IRE1∆DC mice, showing that the immunogenic maturation program did not depend on the presence of the IRE1 signaling branch ( Fig. 2f right panel). In summary, these data highlight a function for the ER stress sensor IRE1 in the homeostatic maturation process of cDC1s, not cDC2s. Kinetics experiments further revealed that the process of cDC1 maturation induced by injection of ACs or cholesterol rich eLNPs was strongly impaired in absence of IRE1, while TLR ligand-induced cDC1 maturation appeared largely unaffected. IRE1 is triggered by apoptotic cell engulfment Several labs meanwhile noted that IRE1 shows a higher basal activity in cDC1s compared to cDC2s 11–15 , still the mechanism explaining this subset specific activation of IRE1 has remained enigmatic. A recent study proposed that antigen-derived peptides can engage IRE1 in a TAP1-dependent manner by binding the IRE1 lumenal domain upon their import in the ER 14 . We tested this hypothesis in vivo by monitoring the IRE1 activity in TAP1-deficient cDC1s, by crossing the well-established IRE1 reporter line ERAI 12,24 on TAP1-deficient mice. Unexpectedly, absence of TAP1 did not result in any difference in ERAI activity, suggesting that in vivo TAP1-dependent import of peptides into the ER does not contribute to the cDC1 specific steady state activity of IRE1 ( Extended Data Fig. 6c ). We previously noted that AC engulfment in cDC1s is reflected by changes in endogenous cholesterol levels: cholesterol levels first rise due to the uptake of apoptotic cargo followed by a steep decline once cDC1s start to mature and migrate to the white pulp of the spleen 20 . In steady state conditions, cDC2s do not engulf ACs 20,25–34 and therefore do not show these drastic changes in cholesterol levels 20 . Intrigued by recent data showing IRE1 activation by accumulation of aberrant lipids such as cholesterol at the ER membrane 35–37 , we tested the premise that the selective activation of IRE1 in cDC1s could be explained by their unique capacity to engulf ACs in vivo . A strict correlation could be observed between IRE1 activity, as monitored by ERAI reporter activity 12,13,24 , and intracellular cholesterol content as measured by BODIPY 493/503, which stains all neutral lipids including cholesterol esters ( Extended Data Fig. 6d ). IRE1 activity increases from the early immature to the late immature state and then declines as soon as cells gain CCR7 expression ( Extended Data Fig. 6d ). Injection of exogenous CTV-labeled ACs led to an increase in IRE1 activity specifically in CTV + cDC1s 2h post injection (p.i.), but not in cDC2s ( Fig. 3a ). More detailed examination of the different maturation stages revealed an increase in ERAI signal in all CTV + subsets, which was least prominent in the late immature cDC1s, that already have a high basal IRE1 activity due to engulfment of endogenous (CTV - ) ACs 20 ( Fig. 3a ). We recently generated a Rac1∆DC Rac2 -/- mouse line in which cDC1s are deficient in the engulfment of ACs and therefore have lower levels of neutral lipids and cholesterol esters 20 . We crossed the ERAI reporter to this line and observed that blocking engulfment causes a strong decrease in IRE1 activity in cDC1s, whereas IRE1 activity in cDC2s remains low ( Fig. 3b ). To assess whether the increase in IRE1 activity was due to the engulfment process itself or due to the influx of lipids, we injected inert beads and eLNPs, respectively. Engulfment of inert beads did not induce IRE1 activity while eLNPs did, following a similar pattern as observed upon AC engulfment ( Fig. 3c-d ). Of note, the difference in IRE1 activity between CTV + or LNP + and CTV - or LNP - cDC1s was most prominent in the CCR7 + stage (Fig. 3a, d) . This can be explained by the fact that CTV + CCR7 + cDC1s are still in the early mature state, as reflected by their intermediate expression level of CCR7 (blue dots in Extended Data Fig. 6e ), compared to CTV - CCR7 + cDC1s which consist mainly of late mature cDC1s. From early to late mature cDC1s, IRE1 activity progressively declines ( Extended Data Fig. 6c) , to reach basal levels 12h post-injection of ACs ( Fig. 3e ). Altogether, these data establish that uptake of ACs and more specifically influx of lipids triggers IRE1 endonuclease activity in cDC1s. Furthermore, the engulfment capacity of XBP1/IRE1 deficient cDC1s appeared reduced, especially at 12 hours post-injection (Fig. 3f) . Since the engulfment defect appeared less pronounced at early timepoints, the reduction in the CTV + cDC1 population at later timepoints could also be explained by a specific survival deficit of CTV + mature cDC1s over time in XBP1/IRE1∆DC mice ( Fig. 3f ). In contrast, engulfment of inert latex beads in cDC1s was not hampered by deletion of XBP1/IRE1 neither at the 2 or 12 hours time point ( Fig. 3g ). In summary, these data reveal that lipids derived from ACs are the major trigger for IRE1 activity in steady state cDC1s rather than the import of peptides into the ER. This explains the selective activation of IRE1 in cDC1s 11–13 and is in line with earlier studies showing IRE1 activation by aberrant lipids such as accumulation of cholesterol at the ER membrane 35–41 . Deficiency of XBP1/IRE1 in cDC1s leads to a specific loss of cDC1s that engulfed ACs, potentially explaining why homeostatically matured cDC1s are reduced in XBP1/IRE1∆DC mice. IRE1 controls cholesterol efflux in homeostatic mature cDC1s Earlier studies showed a role for IRE1-dependent RIDD in regulating lipid metabolism 42–44 . Our bulk RNA-seq data in cDC1s confirmed this and showed a specific deficit in cholesterol biosynthesis genes like the transcription factor Srebf2 , or key enzymes in the mevalonate pathway, such as Sqle, Cyp51 and Hsd17b17 upon XBP1-deficiency ( Fig. 4a, Extended Data Fig. 2, Extended Data Fig. 3c ). In IRE1/XBP1 deficient cDC1s, the cholesterol efflux gene Abcg1 and the apolipoproteins Apol7c and Apol10b , genes that we previously noted to be induced specifically in homeostatic mature cDC1s 20 , were downregulated. On the other hand, genes related to cholesterol esterification like Soat2 or genes associated with lipotoxicity such as Chop and Trib3 were upregulated in IRE1/XBP1 deficient cDC1s ( Fig. 4a, Extended Data Fig. 2, Extended Data Fig. 3c) . Since the loss of IRE1 and XBP1 leads to a strong reduction in the number of homeostatic mature cDC1s, we decided to verify whether these genes were affected at single cell level in absence of IRE1 and performed cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq). CITE-Seq was performed on sorted CD64 - CD11c + MHCII + XCR1 + CD172a - cDC1s (65% of total), CD64 - CD11c + MHCII + XCR1 - CD172a + cDC2s (10% of total), CD64 - CD11c + MHCII -/Lo CD135 + CD172a dim pre-DCs (15% of total) and live cells (10% of total) from the spleen of WT (XBP1/IRE1 fl/fl ) and XBP1/IRE1∆DC mice. Unsupervised clustering and UMAP dimensionality reduction yielded several clusters for cDC1s that were annotated based on expression of data-driven marker genes and led to the identification of pre-cDC1s, proliferating cDC1s, early immature cDC1s, late immature cDC1s, early mature cDC1s, Cxcl9+ cDC1s and late mature cDC1s ( Extended Data Fig. 7a ). We recently identified these clusters as consecutive steps in cDC1 maturation, except for the Cxcl9 + cluster which was previously included in the early mature cDC1 cluster 20 . Comparing the relative abundances of each subcluster of cDC1s confirmed the reduction of mature cDC1s in XBP1/IRE1∆DC mice ( Extended Data Fig. 7b ). DE genes (both up and down) could be identified in each cDC1 subcluster, with only a few in the pre-cDC1s and most in the late immature and mature subsets ( Supplementary Table 4 ). Previously identified DE genes with a high logFC (>2) linked to DC maturation (like Ccr7 , Fscn1 , Tmem176a , Tmem176b , Slco5a1 , Nudt17 ) were not differentially expressed anymore in the late mature cDC1s in the CITE-seq analysis, indicating that they were differentially expressed due to a loss of the CCR7 + cDC1 subset in the bulk RNA-seq rather than being directly regulated by IRE1. However, we could still identify DE genes related to cholesterol metabolism and apolipoproteins ( Apol7c, Apoe , Apol10b and Abcg1 ) ( Supplementary Table 4, Extended Data Fig. 7c ), a few remaining DC maturation genes ( Il4i1 , Mical3 , H2-M2 , etc.) and Dnase1l3 , which is related to the degradation of self-DNA. The upregulated genes mainly contained genes related to the ISR pathway ( Atf4, Ddit3, Cars, Yars , …) confirming the findings of the bulk RNA-seq ( Supplementary Table 4 ). One of the top upregulated genes was Cox6a2 , a subunit of the mitochondrial complex IV of the oxidative phophorylation pathway, which was also one of the few upregulated genes in XBP1/IRE1 deficient cDC2s ( Supplementary Table 1 ). Together, the CITEseq data confirmed the specific loss of the CCR7 + mature cDC1 subset and revealed genes important for cholesterol efflux, such as Apoe and Abcg1 and apolipoproteins Apol10b and Apol7c as potential IRE1 target genes. We previously showed that during cDC1 homeostatic maturation, cholesterol efflux is activated to restore cholesterol levels after AC engulfment in an LXR-dependent manner 20 . Based on the gene expression signature obtained in the XBP1/IRE1 CITE-seq data and the activation of IRE1 by ACs and LNPs, we decided to assess the role of the IRE1 branch in regulating cholesterol efflux during cDC1 maturation. RT-qPCR analysis confirmed the decrease in expression of Abcg1 , Apoe , Apol10b and Apol7c most prominently in XBP1/IRE1∆DC cDC1s ( Fig. 4b ). This was reflected by a small increase in BODIPY 493/503 levels (Fig. 4c) , which can be used to monitor the amount of neutral lipids amongst others cholesterol esters. To assess specifically the cholesterol content in the cell, we used an enzymatic assay that detects both free and esterified cholesterol and confirmed the increase in cholesterol levels in mature XBP1/IRE1∆DC cDC1s, while we did not detect any difference in immature cDC1s or in cDC2s ( Fig. 4d ). We previously noted that late during homeostatic cDC1 maturation, likely as a compensatory response to ABCG1-mediated shuttling of cholesterol from the ER 45 , SREBP2-dependent gene transcription becomes reactivated 20 . We observed that SREBP2-target genes Ldlr and Sqle were less induced in XBP1/IRE1∆DC cDC1s, potentially due to the loss of ABCG1 expression and therefore a potential defect in cholesterol export from the ER ( Fig. 4b ). Abcg1 and Apoe are known target genes of the LXR signaling pathway and we previously established a role for LXRß in mediating cholesterol efflux upon AC engulfment in cDC1s 20 . Furthermore, LXRs have been shown to mitigate ER stress by upregulating Lpcat3 , an enzyme that favors the incorporation of polyunsaturated fatty acids into phospholipid 46 . Hence, we were keen to understand if the IRE1 and LXR signaling pathways operated independently from each other or impacted each other (Extended Data Fig. 8a) . We reasoned that if activation of the LXR signaling pathway was upstream of IRE1 (scenario 1), this would be reflected by a loss of IRE1 reporter activity in LXRa/LXRß∆DC mice, hence we crossed ERAI mice onto LXRa/LXRß∆DC mice to assess this. Neither in total cDC1s or cDC2s, neither in any of the previously identified cDC1s states, IRE1 activity was affected by loss of LXRa/LXRß, indicating that activation of IRE1 occurs independently from LXR signaling ( Extended Data Fig. 8b ). Due to the lack of specific LXRß antibodies or reporter assays in vivo , we addressed scenario 2, whether IRE1 would be needed for triggering LXRa/LXRß activation, in an indirect way. We measured the expression of interferon stimulated genes (ISGs) in XBP1/IRE1∆DC cDC1s as we had previously shown that they were induced in LXRa/LXRß deficient cDC1s 20 . Loss of XBP1/IRE1 in cDC1s did not result in increased expression of ISGs, suggesting that the LXRa/LXRß pathway was still active in IRE1 deficient cDC1s ( Extended data Fig. 8c). In conclusion, in the absence of IRE1 and XBP1, the efflux of cholesterol levels after AC engulfment in cDC1s is not properly controlled, leading to enhanced cholesterol levels particularly at the mature state. This indicates that IRE1 plays a crucial role in regulating cholesterol metabolism in maturing cDC1s, likely in an LXR-independent manner ( Extended Data Fig. 8a scenario 3). IRE1 controls cholesterol efflux genes in a RIDD/miRNA-dependent manner Cholesterol efflux genes were downregulated, not stabilized in absence of IRE1 endonuclease activity. This suggested that they were not directly targeted by IRE1-dependent RIDD activity, but that they might be targets of miRNAs that would be regulated by IRE1 ( Fig. 5a, WT ). IRE1 dependent RIDD activity has been previously linked to the degradation of miRNAs, especially in conditions of prolonged ER stress 44,47–49 . To test the hypothesis that IRE1-dependent regulation of cholesterol efflux genes, and hence DC maturation, was controlled by the degradation of miRNAs, we generated IRE1/Dicer deficient conditional knockout mice (IRE1/Dicer∆DC). We postulated that in absence of IRE1, miRNA cleavage is prevented, leading to degradation of cholesterol efflux mRNAs ( Fig. 5a, IRE1∆DC ). In DCs deficient for both IRE1 and Dicer, pre-miRNAs might no longer mature, leading to a restoration of downstream cholesterol efflux genes and cDC1 maturation ( Fig. 5a, IRE1/Dicer∆DC ). In line with this hypothesis, the absence of Dicer on top of IRE1 led to a restoration of homeostatic mature cDC1s (Fig. 5b) . Similarly, we noted a complete restoration of the expression levels of Abcg1 , and a partial restoration of Apoe and Apol10b , while the levels of Apol7c remained unaffected in the absence of Dicer expression (Fig. 5c) . To address whether IRE1 regulates the expression of miRNAs in steady state conditions in cDC1s, we performed small RNA-seq on sorted splenic cDC1s derived from WT, XBP1∆DC and XBP1/IRE1∆DC mice and highlighted in red all significantly DE miRNAs between XBP1/IRE1∆DC and WT cDC1s on a Triwise plot (Fig. 5d, Supplementary Table 5) . Four DE miRNAs were identified that were specifically upregulated in absence of IRE1, hence in absence of RIDD activity ( Fig. 5d ), which were all validated by RT-qPCR ( Fig. 5e ). Interestingly, miR-92a has been previously linked to regulating cholesterol efflux in macrophages by targeting Abca1 50 . Inspection of the sequence of miR-92a revealed a potential IRE1 cleavage site UUGCAC that was present in the stem, rather than the stemloop (Extended Fig. 9) . In none of the other DE miRNAs a potential IRE1 cleavage site could be found (data not shown). To address whether IRE1 could cleave miR-92a, an in vitro cleavage assay was set up with human recombinant IRE1 cytosolic endonuclease domain incubated with RNA oligonucleotides encoding Xbp1 stemloop, miR-92-a-1 or miR-30b, the latter being one of the most abundantly expressed miRNAs in cDC1s (data not shown). Both the Xbp1 stemloop and miR-92a-1 were cleaved by IRE1, while miR-30b remained unaffected ( Fig. 5f ). Altogether, these data indicate that in homeostatic conditions IRE1 can cleave miR-92a-1 through a RIDD-dependent mechanism in cDC1s. Loss of miRNAs by removal of Dicer on top of IRE1 deficiency leads to restoration of Abcg1 expression levels and restores the mature homeostatic cDC1 population. Homeostatic mature cDC1s can be restored by enforcing cholesterol efflux When analyzing the cholesterol metabolic gene signatures in absence of XBP1/IRE1 signaling, we noted that the upregulation of Soat2, encoding the cholesterol esterifying enzyme acetyl-CoA acetyltransferase 51 and the induction of Trib3 and Ddit3 , potentially reflected signs of lipotoxicity ( Fig. 4a, Extended Data Fig. 2c ). To test the hypothesis that the loss of homeostatic mature cDC1s in absence of IRE1 was caused by lipotoxicity, we aimed to restore cholesterol levels by injecting reconstituted high-density lipoprotein (rHDL) into IRE1/XBP1 deficient mice. However, it did not manage to reach the limited amounts of cDC1s in the spleen. Therefore, we established an in vitro system for cDC1s by cultivating bone marrow (BM) cells in presence of FLT3L and on a feeder layer of OP9 fibroblasts expressing the Notch ligand DLL1 (Flt3 Notch cDC1s) 52,53 . This protocol yielded cDC1s with IRE1 activity levels that were comparable to what we noticed in the spleen (Fig. 6a) . Similar to what we had observed in vivo , loss of XBP1 leads to a reduction in CD11c expression, due to activation of RIDD, which is restored by concomitant loss of IRE1 13 ( Fig. 6b ). When analyzing the cDC1s by microscopy, we observed the same aberrant ER structures, as we described before in sorted XBP1∆DC and XBP1/IRE1∆DC cDC1s (Fig. 6c) 12 . Also in vitro , the absence of XBP1/IRE1 led to a defect in cholesterol efflux gene expression (Fig. 6d) , which was reflected by an increase in total cholesterol levels (Fig. 6e) . The effect of XBP1/IRE1 deficiency on cDC1 survival in Flt3 Notch DC cultures becomes prominent from day11 of seeding the BM cells on the OP9 feeder layer onwards, while at day9 the survival of WT versus XBP1/IRE1∆DC cDC1s is still similar (Fig. 6f) . Treatment of XBP1/IRE1∆DC Flt3 Notch cDC1s on day9 for 2 days with rHDL to enforce cholesterol efflux led to a complete restoration of their survival at day11 (Fig. 6f) , supporting the hypothesis that homeostatic mature IRE1-deficient cDC1s die due to accumulation of cholesterol in absence of IRE1. Loss of IRE1 in cDC1s leads to hampered cross-priming We speculated that the loss of homeostatic mature cDC1s in XBP1/IRE1∆DC mice will impact the cross-priming of dead-cell derived antigens. Previous studies from our lab showed that loss of XBP1, but not loss of IRE1 in DCs, leads to decreased cross-presentation in an ex vivo co-culture assay 12 . At the time, we assumed that this was due to activation of canonical RIDD in XBP1-deficient cDC1s which led to degradation of Tapbp and Ergic3 . In XBP1/IRE1∆cDC1s Tapbp and Ergic3 mRNA expression was restored, leading to the restoration in cross-presentation 12 . However, in this type of ex vivo co-culture assays, DCs and T cells are brought in close proximity bypassing any potential deficits in processes like cDC1 migration to the T cell area in the dLN. To take this into account, we assessed the presentation of dead-cell derived antigens by XBP1/IRE1∆DC cDC1s in vivo . We adoptively transferred CTV-labeled CD45.1.2 OT-I cells in CD45.2 acceptor WT and XBP1/IRE1∆DC mice. One day later, we injected apoptotic thymocytes from Act-mOVA mice or wild-type mice as a control. Three days later, we sacrificed the mice and analyzed the proliferation of OT-I cells in the spleen ( Extended Data Fig. 10a ). As expected, injection of mice with WT apoptotic thymocytes, not containing any OVA, did not result in proliferation of OT-I cells, and the percentage and number of OT-I cells remained low. Injection of OVA-containing apoptotic thymocytes led to increased percentage, number and CTV-dilution of OT-I cells. XBP1/IRE1∆DC mice showed a reduced percentage and number of OT-I cells after injection with OVA-ACs compared to WT littermates ( Extended Data Fig. 10b ). Furthermore, the proliferation index, a measure for CTV-dilution, was lower in the XBP1/IRE1∆DC mice compared to WT littermates ( Extended Data Fig. 10c ). These data therefore indicate that in vivo the loss of mature cDC1s in XBP1/IRE1∆DC does affect their capability to prime naïve antigen-specific T cells. In summary, our data establish IRE1 as a sensor of cholesterol influx in cDC1s during AC engulfment. IRE1 regulates cholesterol efflux from cDC1s by regulating the stability of the cholesterol efflux transporter Abcg1 through RIDD-mediated miRNA-92a degradation, while LXRß drives Abcg1 expression. In absence of IRE1, cholesterol might accumulate at the ER, potentially explaining the aberrant ER aggregates. This causes lipotoxicity, leading to a loss of cDC1s that have recently engulfed and matured in XBP1/IRE1∆DC mice and results in defective cross-presentation of dead-cell derived antigens (Extended Fig. 10d ). On the contrary, neither pIC-triggered immunogenic cDC1 maturation nor homeostatic cDC2 maturation depend on IRE1 signaling. These data therefore confirm the previously observed link between AC engulfment, cholesterol metabolism and homeostatic cDC1 maturation and establish a central role for IRE1 in this process. Discussion Here we uncovered an unexpected role for the UPR sensor IRE1 in the homeostatic maturation of cDC1s. We have previously noted that the activity of this endonuclease is high in cDC1s in steady state and appears regulated in a tissue dependent manner 12,13 . By generating mice in which cDC1s are deficient in the engulfment of ACs, we now found that activation of IRE1 in cDC1s is driven by their capacity to engulf ACs. Traditionally, IRE1 activation has been linked to the accumulation of unfolded proteins 54 and a recent study proposed that IRE1 in cDC1s is activated by the import of peptides, resembling unfolded proteins, in the ER through TAP1 14 . However, we found that deletion of TAP1 does not affect the IRE1 activity in splenic cDC1s. Also lipids, such as cholesterol or saturated fatty acids, inducing so-called lipid bilayer stress, can trigger IRE1 both in yeast and in mammals 35–38,41,55 . The pattern of IRE1 activity in cDC1s closely reflects their cholesterol content and, next to ACs, empty LNPs, consisting only of lipids (amongst others 40% cholesterol), can induce IRE1 activation in cDC1s. How cholesterol reaches the ER remains at present unclear, but recent data suggest an important role for endosomal/ER contact sites 56,57 . Hence, our data indicate that the increased influx of cholesterol during the uptake of ACs or LNPs is sensed at the ER membrane and leads to the activation of IRE1. This explains the subset specific activity of IRE1 in cDC1s, which hold a unique capacity to engulf apoptotic cells in steady state 20,25–34 . These data put the ER in a central position in sensing AC engulfment, consistent with its established role in monitoring intracellular cholesterol levels 51 . We propose that IRE1 redirects cellular metabolism, which is needed to adapt cellular homeostasis to the large intracellular influx of metabolites and lipids from engulfed cells. Accordingly, we found an increase in cholesterol levels in IRE1 deficient cDC1s, specifically in the mature subset. We noticed earlier that loss of IRE1 and XBP1 leads to an aberrant ER morphology 12 and speculate that accumulation of (free) cholesterol at the ER might contribute to this phenotype. In macrophages, accumulation of cholesterol at the ER has been established as a key factor driving lipotoxicity and cell death 38,58 . Similarly, we noticed that XBP1/IRE1 deficient cDC1s die both in vivo and in vitro . Treatment of IRE1-deficient DCs with reconstituted HDL, enforcing cholesterol efflux, rescues cDC1 survival. These data highlight the role for IRE1 in regulating cholesterol metabolism in cDC1s, confirming earlier findings in hepatocytes and macrophages 42,59–63 . The loss of mature cDC1s and increase in cholesterol levels was particularly prominent in XBP1/IRED cDC1s, which was in line with the fact that most DC specific genes were affected in and IRE1- rather than a XBP1-dependent manner. So far, IRE1-endonuclease dependent RIDD activity has been observed mostly in (artificial) conditions of XBP1 deficiency or in conditions of high dose drug-induced ER stress, which both induce hyperactivation of IRE1 4,5,7 . In XBP1-deficient hepatocytes, IRE1-dependent RIDD leads to degradation of the triglyceride synthesizing enzyme Dgat2 , which is fully restored upon concomitant deletion of IRE1 42 . While this process appears conserved in XBP1-deficient DCs 12 (and this study) , the role of RIDD in physiological conditions has remained unclear. Along these lines, the pathways that are activated downstream of IRE1 in WT steady state conditions are more relevant. In these conditions, at least in cDC1s, IRE1-dependent endonuclease activity appears to target miRNAs rather than mRNAs. These data are in line with earlier data from the hepatocyte field, where IRE1 has been shown to play a crucial role in preventing hepatic steatosis by controlling the decay of a select group of miRNAs that target PPARa and SIRT1, master regulators of fatty acid oxidation and triglyceride lipolysis 63 . Small RNA-seq in cDC1s revealed that lipid-induced activation of IRE1 in cDC1s leads to the degradation of miR-92a-1 and the stabilization of the cholesterol efflux gene Abcg1 . Previously, our lab found that uptake of apoptotic cells by cDC1s induces activation of LXRb and its target genes Abcg1 and Apoe1 . Our new data suggest that IRE1 acts in parallel of LXRb to ensure transcript stability of Abcg1 by degrading miRNAs. Loss of IRE1 leads to an increase in miR-92a-1 and a decrease in Abcg1 expression, which is restored in absence of Dicer, the RNase that produces mature miRNA 64 . In macrophages, it has been shown that triggering of LXR signaling would mitigate IRE1 activation by promoting the incorporation of polyunsaturated fatty acids in membranes, thereby increasing membrane fluidity 46,65 , and hence decreasing activation of the IRE1/XBP1 axis. In cDC1s, the activation of IRE1 appears to occur independently of LXR signaling in response to apoptotic cell engulfment, and both pathways are needed to control cholesterol. Why DCs need this two-step regulation of cholesterol efflux pathways efflux during homeostatic maturation remains speculative at this point. In summary, we describe an unexpected role for the UPR sensor IRE1 in homeostatic cDC1 maturation. IRE1 is triggered by apoptotic cell engulfment in cDC1s and coordinates downstream metabolic processes, amongst others cholesterol efflux, needed to process apoptotic cargo. IRE1 deficiency leads to a block in homeostatic cDC1 maturation, impeding dead cell derived antigen presentation. Materials and methods Animal models Xbp1 fl/fl (B6.129s6/SvEvTac-XBP-1 tm2Glm ) 60 , Xbp1 fl/fl × Ern1a fl/fl (also called IRE1 fl/fl )(B6;129S4-Ern1 tm2.1Tiw ) 66 , Rac1 fl/fl (Rac1 tm1Djk ) (gift from Prof. Brakebusch, University of Copenhagen, Biotech Research & Innovation Centre, Denmark) x Rac2 -/- (B6.129S6-Rac2 tm1Mddw /J) (gift from Prof. Tybulewicz, The Francis Crick Institute, United Kingdom), Ern1 fl/fl x Dicer fl/fl (B6.Cg-Dicer 1tm1Bdh /J) and LXRa fl/fl x LXRb fl/fl (gift from Prof. Baron, Université Clermont Auvergne, France) were crossed to Itgax -cre (Tg Itgax−cre1-1Reiz , CD11c-Cre) to generate DC-specific knock-outs (XBP1∆DC, XBP1/IRE1∆DC, Rac1∆DCRac2 -/- , Dicer∆DC, IRE1/Dicer∆DC and LXRa/LXRb∆DC mice). Xbp1 fl/fl and Xbp1 fl/fl × Ern1 fl/fl mice were also crossed to Xcr1 -Cre (B6.XCR1 tm3/mtfp CIPHE ) mice (gift from B. Malissen, CIML, France) to generate cDC1-specific knock-outs. ERAI (B6.TG pCAX-F-XBP-1DBD-Venus /J) 24 mice were used to measure IRE1 activity. TAP1 -/- (B6;129S2-Tap1 tm1Arp /J, The Jackson Laboratory, USA), Rac1∆DCRac2 -/- and LXRaLXRb∆DC mice were crossed with ERAI mice. ActmOVA mice (C57BL/6-Tg (CAG-OVAL)916Jen /J) were bought from The Jackson Laboratory (USA). OT-I mice (C57BL/6-Tg (TcraTcrb)1100Mjb /Crl) were bought from Charles River (France) and bred to CD45.1 (B6.SJL-Ptprc a Pepc b /BoyJ) mice, offspring were used for experiments (CD45.1.2 OT-I Tg/+ ). All mice were bred at Ghent University (Belgium) in specific pathogen-free conditions. The Ern1 fl/fl allele does not lead to a full deletion of the IRE1 gene, but to a truncated version in which the endonuclease domain is removed 67 . However, the remaining IRE1 fragment is hardly detectable, so it does represent a full knockout allele 13 . XBP1/IRE1∆DC were generated by backcrossing IRE1∆DC mice onto XBP1∆DC mice for more than 15 generations to obtain equal genetic background. Litters with mice of both sexes at 6 to 14 weeks of age were used for experiments, except donor mice for thymocytes were between 3 to 6 weeks of age. All animal experiments were performed in accordance with institutional guidelines for animal care of the VIB site Ghent–Ghent University Faculty of Sciences. Bone-marrow derived Flt3 Notch DCs Bone marrow (BM) was isolated from tibia and femur of XBP1(/IRE1) fl/fl , XBP1∆DC and XBP1/IRE1∆DC mice. Red blood cells were removed by osmotic lysis. Flt3 Notch DCs were generated as described by Kirkling et al 52 . In brief, BM cells were differentiated in tissue culture medium (TCM: RPMI-1640 medium (Thermo Fisher Scientific) containing 10% fetal calf serum (FCS, Gibco), 1.1 mg/ml β-Mercaptoethanol (Sigma-Aldrich), 2 mM L-alanyl-L-glutamine dipeptide (Thermo Fisher Scientific) and 56 μg/ml Gentamicin (Thermo Fisher Scientific)) supplemented with 250 ng/ml Flt3L (PSF, VIB Protein Core). Cells were cultured at 1x10 6 cells/ml in 24-well (2ml) or 6-well (8ml) plates at 37°C and 5% CO 2 for 3 days. OP9-DLL1 cells (gift from Prof. Tom Taghon, UGent) were cultured in OP9 culture medium (MEMα medium (Thermo Fisher Scientific) containing 20% FCS (Bodinco), 2 mM L-alanyl-L-glutamine dipeptide (Thermo Fisher Scientific) and 56 μg/ml Gentamicin (Thermo Fisher Scientific)). On day 3 of differentiation, half of the volume (i.e., 1 ml or 4 ml, depending on the plate) of BM cells in TCM was transferred to a single well containing a monolayer of OP9 cells in 1 ml (24-well) or 4 ml (6-well) fresh OP9 medium supplemented with 250 ng/ml Flt3L. On day 8 of differentiation, half of the medium was refreshed. Cultures were harvested on day 9 and day 11. The cells were mechanically dislodged from the plates and further processed for flow cytometry or cell sorting. To drive cholesterol efflux, rHDL (see further) was added on day 9 at a concentration of 50 µg/ml and cultures were harvested 2 days later. PBS was used as a control. Engulfment Assay For AC engulfment experiments, 50 million thymocytes were resuspended in 10 ml RPMI 1640 (Thermo Fisher Scientific; 21875-059) supplemented with 10% fetal calf serum (FCS; Bodinco), containing 10 μM dexamethasone (Sigma-Aldrich; D2915), and incubated at 37 °C in a humified atmosphere with 5% CO 2 for 3.5h. Next, to allow tracking of the ACs, the cells were labeled with Cell Proliferation Dye eFluor450 (CTV; Thermo Fisher Scientific; 65-0842-90) according to manufacturer’s protocol. 30-50 million ACs were i.v. injected. At different time points (30min, 2h, 6h and 12h) post-injection, the mice were sacrificed and uptake of CTV-labeled ACs in the spleen was assessed by flow cytometry. To investigate the uptake of beads, mice were i.v. injected with 100 μl 5x diluted 0.5 μm red fluorescent FluoSpheres (580/605) (Thermo Fisher Scientific, F8812). 2h and 12h post-injection, the mice were sacrificed, and the uptake of beads was assessed by flow cytometry. To investigate the uptake of LNPs, mice were i.v. injected with 100 μl Cy5-labeled empty LNPs (eLNPs) or poly(I:C)-coupled LNPs (pIC-LNPs) (homemade; see below). 2h or 8h after injection, the mice were sacrificed and the uptake of LNPs was assessed by flow cytometry. LNP formulation Aqueous solutions of pIC(Invivogen, tlrl-picw) were made by adding 750 μl of a pIC stock solution (1 mg/ml) to 9.25ml 5 mM acetate buffer (pH 4) for pIC-LNPs. For eLNPs, aqueous solutions contained 10 ml5 mM acetate buffer (pH 4). Ethanol solutions (5 ml) consisted of an ionizable lipid (ALC-0315; BroadPharm; BP-25498), 1,2-dimyristoyl-rac-glycero-3-methoxypoly (ethylene glycol)(DMG-PEG; PEG length, 2 kDa) (Avanti lipids; 880151P-1g), cholesterol (Sigma-Aldrich;C8667), dioleoylphosphatidylethanolamine (DOPE; Avanti lipids; 850725P-25mg) andDOPE-Cy5 (Avanti lipids; 810335C-1mg) ( Supplementary Table 6 for LNP composition). LNPs were fabricated by solvent displacement. Hereto, anethanolic solution containing all lipids was added to an aqueous solution containing pIC (orblank) under vigorous mixing on a vortex mixer. To remove ethanol, the formed LNPsuspensions were dialysed overnight against phosphate buffered saline (PBS) using Slide-ALyzer(r) dialysis cassettes (cut-off 3.5 kDa) (Thermo Fisher Scientific; 66107). Subsequently,the dialysed LNP suspensions were concentrated 10X using Amicon Ultra 10K Centrifugal Filters (Millipore; UFC910024). Tissue Sampling and Processing. Mice were euthanized by cervical dislocation or CO 2 . To analyze DCs by flow cytometry, spleens were minced and digested in RPMI 1640 (Thermo Fisher Scientific; 21875-059) supplemented with recombinant DNase I (10 U/ml; Roche; 04 536 282 001) and Liberase TM (0.02 mg/ml; Roche; 05 401 127 001) at 37°C for 30min. To isolate OT-I cells and analyze T cells by flow cytometry, spleens and mesenteric lymph nodes were smashed on a 70 µm filter (Falcon) to obtain single cell suspensions. To dissect the thymus from mice, the mice were euthanized by CO 2 . Thymocytes were obtained by smashing the tissue on a 70 μm filter (Falcon). In all cases, red blood cells were removed by osmotic lysis. The live cells were counted prior to antibody staining, by staining a sample with DAPI (Thermo Fisher Scientific; D3571) or acridine orange/propidium iodide (Logos Biosystems; LB F23001) and counting with the BD FACSVerse (BD Bioscience) or LUNA-FX7 (Logos Biosystems), respectively. Flow Cytometry and Cell Sorting 4 million live cells were stained with fluorescent, and biotin labeled antibodies for staining of surface and intracellular markers. A first staining mixture consisted of Fc block (Polpharma Biologics) to avoid nonspecific binding, CD64-BV711 (X54-5/7.1; BioLegend; 139311) and CCR7-biotin (4B12; BioLegend; 13-1971-85) and was incubated at 4°C for 45min. A second staining step contained all other antibodies against surface markers and was performed at 4°C for 30min. Viable cells were discriminated by Fixable Viability Dye eFluor 506 (Thermo Fisher Scientific; 65-0866-18) or eFluor 780 (Thermo Fisher Scientific; 65-0865-14). Biotinylated antibodies were conjugated to PE-CF594 or AF647 Streptavidin (BD Bioscience; 562284 and Thermo Fisher Scientific; S32357, respectively). In some experiments, cells were stained with BODIPY 493/503 (500 ng/ml; Thermo Fisher Scientific; D3922). The BODIPY 493/503 MFI was corrected by subtracting background fluorescence and normalized on the MFI of B cells, to minimize technical variance caused by the separate staining of different samples. Acquisition and analysis of labeled cell suspensions was performed with BD LSR Fortessa FACSymphony A5 and A3 (BD Biosciences) cytometer equipped with FACSDiva software (BD Bioscience; v8.0.2). Single stained UltraComp eBeads (Thermo Fisher Scientific; 01-2222-42) and cells were prepared to adjust photomultiplier tube voltages to make sure the signal was within detection limits, to reduce fluorescence spill-over and to calculate the compensation matrix. A list of antibodies is provided in Supplementary Table 7 . Cell sorting was performed on FACS ARIAII, ARIAIII and FACSymphony S6 sorter (BD Biosciences). To sort different cDC1 maturation subsets, the total single-cell suspension was enriched prior to staining and cell sorting by depletion of CD3e + , CD19 + , Ly6G + , NK1.1 + , TER119 + and CD64 + cells using biotin-labeled monoclonal antibodies and MagniSort Streptavidin Negative Selection Beads (Thermo Fisher Scientific; MSNB-6002-74). Flt3/Notch DCs were sorted without prior enrichment. Flow cytometry data was preprocessed by the PeacoQC algorithm 68 (code available at https://github.com/saeyslab/PeacoQC). Flow data was analyzed with FlowJo10 software (FlowJo, BD). Microscopy Flt3 Notch XBP1(/IRE1) fl/fl , XBP1∆DC and XBP1/IRE1∆DC were FACS purified and adhered to a fibronectin (Merck, F1141-1mg)-coated ibidi chamber for 2h. The cells were fixed in 4% PFA, permeabilized with 0.5% Triton X-100 (Merck, 10789704001) and blocked with 1% BSA and normal donkey serum. The cells were stained with primary mouse IgG2a anti-KDEL (Enzo Life Sciences, ADI-SPA-827-D, 1/500) overnight. After extensive washing, the cells were stained with secondary donkey anti-mouse IgG (Invivogen, A21202) conjugated to AF488. After extensive washing, the nucleus of the cells was stained with DAPI (Invitrogen, D3571). The cells were visualized on a Zeiss LSM880 FastAiryScan microscope. Cross-priming assay OT-I cells were isolated from the spleen and mesenteric LNs of CD45.1.2 OT-I mice and CTV-labeled according to manufacturer’s protocol (Thermo Fisher Scientific; 65-0842-90). Then the cells were FACS-purified on live cells, CD11c - , MHCII - , CD19 - , CD4 - , CD8a + and CD62L + . Three million cells were adoptively transferred in acceptor mice by i.v. injection. One day later, the acceptor mice were injected with either 20 million apoptotic thymocytes derived from ActmOVA mice or from wild-type mice as negative control. Three days later, the acceptor mice were sacrificed and the spleen was analyzed by flow cytometry. Cholesterol Quantification Assay Distinct DC maturation subsets were sorted in FCS-containing buffer. After sorting, the DCs were washed with PBS and frozen as dry cell pellet at -150°C. Lipid isolation and Cholesterol quantification was performed with the Cholesterol/Cholesteryl Ester Quantitation Kit (Abnova; KA0829) according to manufacturer’s instructions, except that the standard was diluted to range from 12.5 ng/well to 200 ng/well. The extract from at least 30,000 cells was used for the analysis. Total cholesterol (free and esterified) was measured. Fluorescence was measured with the FLUOstar omega (BMG Labtech). In vitro miRNA degradation assay To assay degradation of miRNAs, 50 nM recombinant human IRE1 kinase/RNAse domain (468-977, SignalChem) was incubated with 1000 nM XBP1 stem loop (CUGAGUCCGCAGCACUCAG, IDT), hsa-miR-92a-1 (CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGUAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG, IDT Ultramer) or hsa-miR-30b (ACCAAGUUUCAGUUCAUGUAAACAUCCUACACUCAGCUGUAAUACAUGGAUUGGCUGGGAGGUGGAUGUUUACUUCAGCUGACUU-GGA, IDT Ultramer) for indicated times at 37°C in reaction buffer (20mM HEPES pH7, 50mM NaCl, 1mM DTT, 2mM ATP). After incubation, samples were boiled after adding an equal volume 2x RNA Loading Dye (NEB) and fragments were separated on 15% TBE-Urea Gels (Novex™, ThermoFisher). Fragments were visualized by incubating gels in SybrGold (Invitrogen) and images were acquired using GelDoc XR+ (Bio-Rad). Preparation of reconstituted HDL Isolation of human ApoA-I Human ApoA-I was isolated from human plasma and purified by fast protein liquid chromatography (FPLC). Total HDL was isolated by sequential ultracentrifugation. The first ultracentrifugation step in Beckman 70 Ti rotor at 45,000 rpm for 24 hours at 15°C at a density of 1.063 g/ml allowed to remove all apo B-containing lipoproteins. Then total HDL was recovered after the second ultracentrifugation step at a density of 1.21 g/ml under the same conditions. Total HDL were extensively dialyzed against ammonium buffer (5 mM, pH 7.4) and lyophilized, resuspended, and delipidated completely with methanol/ether (1:4) at -20°C. Precipitated proteins were dried under speed vacuum and ApoA-I was purified by ion-exchange chromatography. After protein solubilization in buffer A (20 mM Tris/6 M urea, pH 8.5) at a concentration > 12mg/ml, ApoA-I was loaded on XK26-40 chromatography column and separated at a flow rate of 3 ml/min in Tris-urea buffer by biologic DuoFlow systems (BioRad, France). The purity of individual ApoA-I-containing fractions detected at 280 nm was assessed on 20% denaturing acrylamide gel revealed with Coomassie blue. Pure fractions were pooled and dialyzed against ammonium buffer (20 mM, pH 7.4) and lyophilized. Preparation of reconstituted HDL Reconstituted HDL (rHDL) particles were prepared by sodium cholate dialysis as previously described 69 . Briefly, human ApoA-I was mixed with L-α phosphatidylcholine (Soy-PC) without or with either L-α phosphatidylethanolamine (Soy-PE; Avanti Polar Lipids, AL, USA), PE at a molar ratio of 1:90 (ApoA-I: Soy-PC). The required amounts of phospholipids in chloroform were mixed and dried under nitrogen gas. To form micelles, sodium cholate (30 mg/ml) was added to the dried lipids at a molar ratio of 1:1 (sodium cholate: phospholipid) in Tris-buffered saline (TBS, pH 7.4) and vortexed every 15 minutes at 4C° until the solution became clear. Then ApoA-I was added to the mixture and incubated for 2h at 4°C. Finally, rHDL particles were dialyzed against TBS for 5 days and against PBS for 3 days and stored at -80°C. All the rHDL concentrations were based on their ApoA-I content, which was measured using Indiko™ Plus clinical chemistry analyzer (Thermo Scientific, US) according to the manufacturer’s instructions. Quality control of rHDL and ApoA-I was performed using non-denaturing TBE 4–20% gradient polyacrylamide gel electrophoresis and staining with Coomassie Brilliant Blue 70 . mRNA Isolation and RT-qPCR Total or CCR7 - and CCR7 + cDC1s and cDC2s (5,000 – 50,000 cells) were sorted directly into RLT Plus buffer (Qiagen; 74034) supplemented with ß-mercaptoethanol (1/100) and stored at -80 °C until further processing. RNA was obtained using the RNeasy Plus Micro Kit (Qiagen; 74034) according to manufacturer’s protocol. For RT-qPCR, complementary DNA was amplified using the Ovation PicoSL WTA System V2 kit (NuGEN; 2210-24), according to manufacturer’s protocol. Pollutants were removed using the MinElute PCR purification kit (Qiagen; 28204), according to manufacturer’s protocol, prior to SYBR Green-based (Bioline; BIO-98020) RT-qPCR (Lightcycler 480, Roche). mRNA expression was analyzed using qbase+ software version 3.2 (Biogazelle). GeNorm was used to select stable housekeeping genes. A list of primer sequences is provided in Supplementary Table 8 . miRNA isolation and RT-qPCR Total or CCR7 - and CCR7 + cDC1s and cDC2s (5,000 – 50,000 cells) were sorted directly into Qiazol buffer (Qiagen; 217084) and stored at -80 °C until further processing. miRNA was obtained using the miRNeasy Micro Kit (Qiagen; 217084) according to manufacturer’s protocol. For RT-qPCR of miRNA, cDNA was generated using the miRCURY LNA RT Kit (Qiagen; 339340), according to manufacturer’s protocol. RT-qPCR reactions were performed using the miRCURY LNA SYBR Green PCR Kit (Qiagen, 339346) and miRCURY LNA miRNA primers (Qiagen) were used. RT-qPCR reactions were performed on a LightCycler 480 (Roche). miRNA expression was analyzed using qbase+ software version 3.2 (Biogazelle). A list of primers is provided in Supplementary Table 9. Quantification and statistical analysis Statistical analyses and data representations were performed using Prism (GraphPad, La Jolla, CA). Data are presented as mean ± standard error of the mean (SEM) as specified in the legend of the figures. In all experiments, distinct samples were measured. However, the expression of different RNAs by RT-qPCR was measured on the same samples. The data distribution and variance characteristics were considered for statistical testing. In case of comparing more than two populations, ordinary one-way (one independent variable) or two-way (two independent variables) ANOVA with correction for multiple testing was used for the statistical analysis. The exact statistical test is mentioned in the legend of the figures. Statistical significance was defined as p < 0.05. Asterisks in graph represent the p-value unless mentioned otherwise. Number of biological replicates is indicated as dots in the figure or as ‘n’ in the legend. The researcher was not blinded. Differential expression in the bulk RNA-seq and small RNA-seq was analyzed by edgeR v3.28.0, using an adjusted p-value set at 0.05 and logFC at 1 to determine significant DE genes and miRNAs. A separate DE analysis was also performed with less strict cut-offs to determine a broader list of affected miRNAs (adjusted p-value 0.5). Differential expression analysis to determine the cluster markers in the CITE-seq analysis was performed using the Wilcoxon Rank Sum test through the Seurat functions FindAllMarkers and FindMarkers. P-value adjustment was accomplished with Bonferroni correction. RNA and ADT markers for the annotated clusters were determined with these cutoffs: min.pct = 0.10, logfc.threshold = 0.25 and return.thresh (adj. P-value) = 0.01. Only positive markers were evaluated. An extra "score" column was calculated to rank the importance of the genes as markers. It was calculated with this function: "pct.1/(pct.2+0.01)*avg_logFC". The markers are ordered according to this score. Differential State analysis to determine the differential markers for each cDC1 subpopulation between DKO and WT was performed using DESeq2 within muscat. P-value adjustment was performed using Benjamini-Hochberg correction at a local level (per cluster). Significant differentially expressed (DE) genes were determined by using these cut-offs: p_adj.loc 0.4. Declarations Data availability All raw sequencing data enclosed in this publication has been deposited in NCBI’s Gene Expression Omnibus 71 and is accessible through GEO Series accession number GSE270655 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE270655). All single-cell datasets provided in this manuscript can be accessed via our online tool: https://www.single-cell.be/Spleen_cDC1_Homeostatic_Maturation_in_Ire1_Xbp1_DKO. Code availability The code used for analyzing the various sequencing data is deposited in a GitHub repository at https://github.com/JanssensLab/Spleen_cDC1_Homeostatic_Maturation_in_Ire1_Xbp1_DKO. An archive of the GitHub repository can be downloaded from Zenodo: https://doi.org/10.5281/zenodo.11263498. Acknowledgements We thank the VIB Flow Core, VIB Single Cell core, VIB BioImaging core, VIB Nucleomics Core, IRC cell core facility and VIB Transgenic Core facilities for help with the experiments. We would like to thank all the people from IRC Animal House Facility. We also thank VIB TechWatch, the VIB Single Cell Accelerator program, and M. Guilliams and C. Scott for help in establishing the CITE-seq protocols. We thank Bruno De Geest and Alexander Lamoot (Faculty of Pharmaceutical Sciences, UGent) for their advice on LNP production. Author contributions V.B., S.J.T., B.N.L., and S.J. contributed to conceptualization of the study. V.B., S.M., E.C., L.V.H., S.J.T., S.R., S.A., J.M., E.V.D.V., F.F., K.D. and P.M. conducted experiments. V.B., S.M., and C.D.N. were involved in visualizing the data. V.B., C.D.N. and S.J. wrote the manuscript. V.B., S.M., E.C., C.D.N., L.M., J.V.D., G.V.I., W.S., Y.S. and P.M. provided software and analyzed the data. L.B., I.G.B. and W.L.G. provided key reagents. I.G.B. and W.L.G. provided essential advice for setting up all cholesterol related experiments. J.V.D. and G.V.I. were involved in instrument validation. S.J. supervised the project and provided funding for the project. Funding: This work was supported by an ERC Consolidator Grant (DCRIDDLE-819314), FWO Program Grants (G063018 and G050622N), FWO EOS (G0G7318N), GOA (LNP-DECODE-U1G01524) and FWO PhD Grant (1134321N, V.B., 11L5522N, S.M.). The authors declare no competing interests. Supplementary Information is available for this paper. Correspondence and requests for materials should be addressed to Sophie Janssens. References Grootjans, J., Kaser, A., Kaufman, R. J. & Blumberg, R. S. The unfolded protein response in immunity and inflammation. Nat. Rev. Immunol. 16 , 469–484 (2016). Janssens, S., Pulendran, B. & Lambrecht, B. N. Emerging functions of the unfolded protein response in immunity. Nat. Immunol. 15 , 910–919 (2014). Almanza, A. et al. Endoplasmic reticulum stress signalling - from basic mechanisms to clinical applications. FEBS J. 286 , 241–278 (2019). Hollien, J. & Weissman, J. S. Decay of endoplasmic reticulum-localized mRNAs during the unfolded protein response. Science 313 , 104–107 (2006). Hollien, J. et al. Regulated Ire1-dependent decay of messenger RNAs in mammalian cells. J. Cell Biol. 186 , 323–331 (2009). Ottens, F., Efstathiou, S. & Hoppe, T. Cutting through the stress: RNA decay pathways at the endoplasmic reticulum. Trends Cell Biol. S0962892423002362 (2023) doi:10.1016/j.tcb.2023.11.003. Maurel, M., Chevet, E., Tavernier, J. & Gerlo, S. Getting RIDD of RNA: IRE1 in cell fate regulation. Trends Biochem. Sci. 39 , 245–254 (2014). Cloots, E. et al. Activation of goblet-cell stress sensor IRE1β is controlled by the mucin chaperone AGR2. EMBO J. 43 , 695–718 (2024). Iwakoshi, N. N. et al. Plasma cell differentiation and the unfolded protein response intersect at the transcription factor XBP-1. Nat. Immunol. 4 , 321–329 (2003). Vetters, J. et al. Canonical IRE1 function needed to sustain vigorous natural killer cell proliferation during viral infection. iScience 26 , 108570 (2023). Iwakoshi, N. N., Pypaert, M. & Glimcher, L. H. The transcription factor XBP-1 is essential for the development and survival of dendritic cells. J. Exp. Med. 204 , 2267–2275 (2007). Osorio, F. et al. The unfolded-protein-response sensor IRE-1α regulates the function of CD8α+ dendritic cells. Nat. Immunol. 15 , 248–257 (2014). Tavernier, S. J. et al. Regulated IRE1-dependent mRNA decay sets the threshold for dendritic cell survival. Nat. Cell Biol. 19 , 698–710 (2017). Guttman, O. et al. Antigen-derived peptides engage the ER stress sensor IRE1α to curb dendritic cell cross-presentation. J. Cell Biol. 221 , e202111068 (2022). García-González, P., Fernández, D., Gutiérrez, D., Parra-Cordero, M. & Osorio, F. Human cDC1s display constitutive activation of the UPR sensor IRE1. Eur. J. Immunol. 52 , 1069–1076 (2022). Cloots, E. et al. Evolution and function of the epithelial cell-specific ER stress sensor IRE1β. Mucosal Immunol. 14 , 1235–1246 (2021). Bright, M. D., Itzhak, D. N., Wardell, C. P., Morgan, G. J. & Davies, F. E. Cleavage of BLOC1S1 mRNA by IRE1 Is Sequence Specific, Temporally Separate from XBP1 Splicing, and Dispensable for Cell Viability under Acute Endoplasmic Reticulum Stress. Mol. Cell. Biol. 35 , 2186–2202 (2015). Acosta-Alvear, D. et al. XBP1 controls diverse cell type- and condition-specific transcriptional regulatory networks. Mol. Cell 27 , 53–66 (2007). Ardouin, L. et al. Broad and Largely Concordant Molecular Changes Characterize Tolerogenic and Immunogenic Dendritic Cell Maturation in Thymus and Periphery. Immunity 45 , 305–318 (2016). Bosteels, V. et al. LXR signaling controls homeostatic dendritic cell maturation. Sci. Immunol. 8 , eadd3955 (2023). Cabeza-Cabrerizo, M., Cardoso, A., Minutti, C. M., Pereira da Costa, M. & Reis e Sousa, C. Dendritic Cells Revisited. Annu. Rev. Immunol. 39 , 131–166 (2021). Belabed, M. et al. AXL Limits the Mobilization of Cholesterol to Regulate Dendritic Cell Maturation and the Immunogenic Response to Cancer . http://biorxiv.org/lookup/doi/10.1101/2023.12.25.573303 (2023) doi:10.1101/2023.12.25.573303. Maier, B. et al. A conserved dendritic-cell regulatory program limits antitumour immunity. Nature 580 , 257–262 (2020). Iwawaki, T., Akai, R., Kohno, K. & Miura, M. A transgenic mouse model for monitoring endoplasmic reticulum stress. Nat. Med. 10 , 98–102 (2004). Liu, K. et al. Immune tolerance after delivery of dying cells to dendritic cells in situ. J. Exp. Med. 196 , 1091–1097 (2002). Cummings, R. J. et al. Different tissue phagocytes sample apoptotic cells to direct distinct homeostasis programs. Nature 539 , 565–569 (2016). Silva-Sanchez, A. et al. Activation of regulatory dendritic cells by Mertk coincides with a temporal wave of apoptosis in neonatal lungs. Sci. Immunol. 8 , eadc9081 (2023). Desch, A. N. et al. CD103+ pulmonary dendritic cells preferentially acquire and present apoptotic cell-associated antigen. J. Exp. Med. 208 , 1789–1797 (2011). Qiu, C.-H. et al. Novel subset of CD8{alpha}+ dendritic cells localized in the marginal zone is responsible for tolerance to cell-associated antigens. J. Immunol. Baltim. Md 1950 182 , 4127–4136 (2009). Subramanian, M. et al. An AXL/LRP-1/RANBP9 complex mediates DC efferocytosis and antigen cross-presentation in vivo. J. Clin. Invest. 124 , 1296–1308 (2014). Bedoui, S. et al. Cross-presentation of viral and self antigens by skin-derived CD103+ dendritic cells. Nat. Immunol. 10 , 488–495 (2009). Henri, S. et al. CD207+ CD103+ dermal dendritic cells cross-present keratinocyte-derived antigens irrespective of the presence of Langerhans cells. J. Exp. Med. 207 , 189–206 (2010). Iyoda, T. et al. The CD8+ dendritic cell subset selectively endocytoses dying cells in culture and in vivo. J. Exp. Med. 195 , 1289–1302 (2002). den Haan, J. M., Lehar, S. M. & Bevan, M. J. CD8(+) but not CD8(-) dendritic cells cross-prime cytotoxic T cells in vivo. J. Exp. Med. 192 , 1685–1696 (2000). Halbleib, K. et al. Activation of the Unfolded Protein Response by Lipid Bilayer Stress. Mol. Cell 67 , 673-684.e8 (2017). Volmer, R., van der Ploeg, K. & Ron, D. Membrane lipid saturation activates endoplasmic reticulum unfolded protein response transducers through their transmembrane domains. Proc. Natl. Acad. Sci. U. S. A. 110 , 4628–4633 (2013). Cho, H. et al. Intrinsic Structural Features of the Human IRE1α Transmembrane Domain Sense Membrane Lipid Saturation. Cell Rep. 27 , 307-320.e5 (2019). Feng, B. et al. The endoplasmic reticulum is the site of cholesterol-induced cytotoxicity in macrophages. Nat. Cell Biol. 5 , 781–792 (2003). Volmer, R. & Ron, D. Lipid-dependent regulation of the unfolded protein response. Curr. Opin. Cell Biol. 33 , 67–73 (2015). Kitai, Y. et al. Membrane lipid saturation activates IRE1α without inducing clustering. Genes Cells Devoted Mol. Cell. Mech. 18 , 798–809 (2013). Promlek, T. et al. Membrane aberrancy and unfolded proteins activate the endoplasmic reticulum stress sensor Ire1 in different ways. Mol. Biol. Cell 22 , 3520–3532 (2011). So, J.-S. et al. Silencing of lipid metabolism genes through IRE1α-mediated mRNA decay lowers plasma lipids in mice. Cell Metab. 16 , 487–499 (2012). Almanza, A. et al. Regulated IRE1α-dependent decay (RIDD)-mediated reprograming of lipid metabolism in cancer. Nat. Commun. 13 , 2493 (2022). Wang, J.-M. et al. IRE1α prevents hepatic steatosis by processing and promoting the degradation of select microRNAs. Sci. Signal. 11 , eaao4617 (2018). Tarling, E. J. & Edwards, P. A. ATP binding cassette transporter G1 (ABCG1) is an intracellular sterol transporter. Proc. Natl. Acad. Sci. U. S. A. 108 , 19719–19724 (2011). Rong, X. et al. LXRs regulate ER stress and inflammation through dynamic modulation of membrane phospholipid composition. Cell Metab. 18 , 685–697 (2013). Upton, J.-P. et al. IRE1α cleaves select microRNAs during ER stress to derepress translation of proapoptotic Caspase-2. Science 338 , 818–822 (2012). Lerner, A. G. et al. IRE1α induces thioredoxin-interacting protein to activate the NLRP3 inflammasome and promote programmed cell death under irremediable ER stress. Cell Metab. 16 , 250–264 (2012). Zhang, K. et al. The UPR Transducer IRE1 Promotes Breast Cancer Malignancy by Degrading Tumor Suppressor microRNAs. iScience 23 , 101503 (2020). Wang, Z. et al. MiR‑30e and miR‑92a are related to atherosclerosis by targeting ABCA1. Mol. Med. Rep. (2019) doi:10.3892/mmr.2019.9983. Luo, J., Yang, H. & Song, B.-L. Mechanisms and regulation of cholesterol homeostasis. Nat. Rev. Mol. Cell Biol. 21 , 225–245 (2020). Kirkling, M. E. et al. Notch Signaling Facilitates In Vitro Generation of Cross-Presenting Classical Dendritic Cells. Cell Rep. 23 , 3658-3672.e6 (2018). Medel, B. et al. The Unfolded Protein Response Sensor IRE1 Regulates Activation of In Vitro Differentiated Type 1 Conventional DCs with Viral Stimuli. Int. J. Mol. Sci. 24 , 10205 (2023). Gardner, B. M., Pincus, D., Gotthardt, K., Gallagher, C. M. & Walter, P. Endoplasmic reticulum stress sensing in the unfolded protein response. Cold Spring Harb. Perspect. Biol. 5 , a013169 (2013). Ho, N. et al. Stress sensor Ire1 deploys a divergent transcriptional program in response to lipid bilayer stress. J. Cell Biol. 219 , e201909165 (2020). Luo, J., Jiang, L.-Y., Yang, H. & Song, B.-L. Intracellular Cholesterol Transport by Sterol Transfer Proteins at Membrane Contact Sites. Trends Biochem. Sci. 44 , 273–292 (2019). Höglinger, D. et al. NPC1 regulates ER contacts with endocytic organelles to mediate cholesterol egress. Nat. Commun. 10 , 4276 (2019). Feng, B. et al. Niemann-Pick C heterozygosity confers resistance to lesional necrosis and macrophage apoptosis in murine atherosclerosis. Proc. Natl. Acad. Sci. U. S. A. 100 , 10423–10428 (2003). Wang, S. et al. IRE1α-XBP1s induces PDI expression to increase MTP activity for hepatic VLDL assembly and lipid homeostasis. Cell Metab. 16 , 473–486 (2012). Lee, A.-H., Scapa, E. F., Cohen, D. E. & Glimcher, L. H. Regulation of hepatic lipogenesis by the transcription factor XBP1. Science 320 , 1492–1496 (2008). Hamid, S. M. et al. Inositol-requiring enzyme-1 regulates phosphoinositide signaling lipids and macrophage growth. EMBO Rep. 21 , e51462 (2020). Yildirim, Z. et al. Intercepting IRE1 kinase-FMRP signaling prevents atherosclerosis progression. EMBO Mol. Med. 14 , e15344 (2022). Wang, J.-M. et al. IRE1α prevents hepatic steatosis by processing and promoting the degradation of select microRNAs. Sci. Signal. 11 , eaao4617 (2018). Ha, M. & Kim, V. N. Regulation of microRNA biogenesis. Nat. Rev. Mol. Cell Biol. 15 , 509–524 (2014). Di Conza, G. et al. Tumor-induced reshuffling of lipid composition on the endoplasmic reticulum membrane sustains macrophage survival and pro-tumorigenic activity. Nat. Immunol. 22 , 1403–1415 (2021). Iwawaki, T., Akai, R., Yamanaka, S. & Kohno, K. Function of IRE1 alpha in the placenta is essential for placental development and embryonic viability. Proc. Natl. Acad. Sci. U. S. A. 106 , 16657–16662 (2009). Iwawaki, T., Akai, R., Yamanaka, S. & Kohno, K. Function of IRE1 alpha in the placenta is essential for placental development and embryonic viability. Proc. Natl. Acad. Sci. U. S. A. 106 , 16657–16662 (2009). Emmaneel, A. et al. PeacoQC: Peak-based selection of high quality cytometry data. Cytom. Part J. Int. Soc. Anal. Cytol. 101 , 325–338 (2022). Rye, K.-A. Interaction of apolipoprotein A-II with recombinant HDL containing egg phosphatidylcholine, unesterified cholesterol and apolipoprotein A-I. Biochim. Biophys. Acta BBA - Lipids Lipid Metab. 1042 , 227–236 (1990). Tanaka, N. et al. Eicosapentaenoic Acid-Enriched High-Density Lipoproteins Exhibit Anti-Atherogenic Properties. Circ. J. 82 , 596–601 (2018). Edgar, R., Domrachev, M. & Lash, A. E. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 30 , 207–210 (2002). Additional Declarations There is NO Competing Interest. Supplementary Files SupplTable1summaryDEgenescDC2.xls Dataset 1 SupplTable2summaryDEgenescDC1s.xls Dataset 2 SupplTable3summaryGOtermsdiffexp.xlsx Dataset 3 SupplTable4CITEseqDEgenesincDC1subclusters.xlsx Dataset 4 SupplTable5summaryDEmiRNAslessStrict.xlsx Dataset 5 BosteelsSupplementaryinformation.docx Supplementary Methods and tables SupplTable10summaryownGOlists.xlsx Dataset 10 Cite Share Download PDF Status: Under Review Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4763670","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Biological Sciences - Article","associatedPublications":[],"authors":[{"id":330769624,"identity":"35e5b85b-11dd-444a-a00e-9f8ab2170c8d","order_by":0,"name":"Sophie Janssens","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABQklEQVRIie2RMUvDQBTHXzk4l7NdLxSar/BKIZP4Wa4UmqUFxw7SdrourXPF0S/g6HgQyBTMmiFDpJA5IoiCinfaiLnUXTC/4cK9y+/u/+4AGhr+JhQEAClnPfr5QVUWlP1/TRlUFfWL8pPhsrL5AcVdbcIsm8FR52q1Kx5u5/5FN8gIO0sB4+twV0DasxSM7nwUERCeRp5zGQVT2R4jYZgDJrmv8+UDW+ETjw+l7iWZUHIs1VQyBq0tBoubJPK4gqCM+h1sa5R3IG7i7x7f5Nyne0WfEj8ZZWEpenOtLIFgIrDbkkQYBQqjxGtqFFHvZcxFyElfu85GBn3JKKpC9+Ik1OMR5n07mL4x5/n8ZNTTwYoXOXfdNbnPxGsK7TjI+WyWuvYtAzMDH1VqX2/BTSSsCXsFTg+sdNSBYkNDQ8M/5ANBpHUpypzCsQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0003-1702-1636","institution":"VIB-UGent Center for Inflammation Research","correspondingAuthor":true,"prefix":"","firstName":"Sophie","middleName":"","lastName":"Janssens","suffix":""},{"id":330769625,"identity":"abe055c7-8129-4c50-8955-c94a910e9787","order_by":1,"name":"Victor Bosteels","email":"","orcid":"","institution":"VIB-UGent Center for Inflammation Research","correspondingAuthor":false,"prefix":"","firstName":"Victor","middleName":"","lastName":"Bosteels","suffix":""},{"id":330769626,"identity":"9a6c67a5-b355-4203-9555-a87fed70cd88","order_by":2,"name":"Sandra Marechal","email":"","orcid":"","institution":"VIB-UGent Center for Inflammation Research","correspondingAuthor":false,"prefix":"","firstName":"Sandra","middleName":"","lastName":"Marechal","suffix":""},{"id":330769627,"identity":"cb79039c-f558-43d6-aed6-6f6a9eb1b28c","order_by":3,"name":"Eva Cloots","email":"","orcid":"","institution":"VIB-UGent Center for Inflammation Research","correspondingAuthor":false,"prefix":"","firstName":"Eva","middleName":"","lastName":"Cloots","suffix":""},{"id":330769628,"identity":"c81c6304-d049-4619-bef6-3af2270685c3","order_by":4,"name":"Laurien Van Heddegem","email":"","orcid":"","institution":"VIB-UGent Center for Inflammation Research","correspondingAuthor":false,"prefix":"","firstName":"Laurien","middleName":"Van","lastName":"Heddegem","suffix":""},{"id":330769629,"identity":"3a1b9a8d-39d5-4480-8a1e-f9b489cb41c1","order_by":5,"name":"Simon Tavernier","email":"","orcid":"","institution":"Ghent University","correspondingAuthor":false,"prefix":"","firstName":"Simon","middleName":"","lastName":"Tavernier","suffix":""},{"id":330769630,"identity":"52927b81-f729-48c2-8b17-5b4c29bf1128","order_by":6,"name":"Sofie Rennen","email":"","orcid":"","institution":"VIB-UGent Center for Inflammation Research","correspondingAuthor":false,"prefix":"","firstName":"Sofie","middleName":"","lastName":"Rennen","suffix":""},{"id":330769631,"identity":"cb5efb0f-8e14-4082-8ff0-e3b70d8a4a4e","order_by":7,"name":"Clint De Nolf","email":"","orcid":"https://orcid.org/0000-0002-2033-1830","institution":"VIB-UGent Center for Inflammation Research","correspondingAuthor":false,"prefix":"","firstName":"Clint","middleName":"","lastName":"De Nolf","suffix":""},{"id":330769632,"identity":"cea3c763-9806-453e-b422-db97785e69ef","order_by":8,"name":"Seraja Amstelveen","email":"","orcid":"","institution":"VIB-UGent Center for Inflammation Research","correspondingAuthor":false,"prefix":"","firstName":"Seraja","middleName":"","lastName":"Amstelveen","suffix":""},{"id":330769633,"identity":"7d4dcca6-1df5-4577-9d3d-e4cb73fddf17","order_by":9,"name":"Jonathan Maelfait","email":"","orcid":"https://orcid.org/0000-0002-1476-0583","institution":"VIB-UGent IRC","correspondingAuthor":false,"prefix":"","firstName":"Jonathan","middleName":"","lastName":"Maelfait","suffix":""},{"id":330769634,"identity":"f719f197-657c-4fbd-af4d-8b122ecec988","order_by":10,"name":"Liesbet Martens","email":"","orcid":"https://orcid.org/0000-0001-9180-7456","institution":"Flanders Institute for Biotechnology","correspondingAuthor":false,"prefix":"","firstName":"Liesbet","middleName":"","lastName":"Martens","suffix":""},{"id":330769635,"identity":"a9ef8eca-7471-409d-8e16-177f7c22519f","order_by":11,"name":"Evelien Van De Velde","email":"","orcid":"","institution":"VIB-UGent Center for Inflammation Research","correspondingAuthor":false,"prefix":"","firstName":"Evelien","middleName":"Van","lastName":"De Velde","suffix":""},{"id":330769636,"identity":"e4445783-cb10-4238-b10a-efbb7beb88f0","order_by":12,"name":"Farzaneh Fayazpour","email":"","orcid":"","institution":"VIB-UGent Center for Inflammation Research","correspondingAuthor":false,"prefix":"","firstName":"Farzaneh","middleName":"","lastName":"Fayazpour","suffix":""},{"id":330769637,"identity":"edd31da7-ce56-4432-8ddc-6d28e524e9d5","order_by":13,"name":"Kim Deswarte","email":"","orcid":"https://orcid.org/0000-0002-9761-6973","institution":"Ghent University","correspondingAuthor":false,"prefix":"","firstName":"Kim","middleName":"","lastName":"Deswarte","suffix":""},{"id":330769638,"identity":"cf055718-7fa4-4f3d-9c38-557645961931","order_by":14,"name":"Wouter Saelens","email":"","orcid":"","institution":"VIB-UGent Center for Inflammation Research","correspondingAuthor":false,"prefix":"","firstName":"Wouter","middleName":"","lastName":"Saelens","suffix":""},{"id":330769639,"identity":"d2d9e09f-d24b-4408-af6e-14fc9f029729","order_by":15,"name":"Louis Boon","email":"","orcid":"","institution":"Polpharma Biologics","correspondingAuthor":false,"prefix":"","firstName":"Louis","middleName":"","lastName":"Boon","suffix":""},{"id":330769640,"identity":"94314757-116b-4361-a375-251b197710f2","order_by":16,"name":"Julie Van Duyse","email":"","orcid":"","institution":"VIB-UGent Center for Inflammation Research","correspondingAuthor":false,"prefix":"","firstName":"Julie","middleName":"Van","lastName":"Duyse","suffix":""},{"id":330769641,"identity":"88ef32e5-be6f-443a-8aea-95bbd92ee128","order_by":17,"name":"Gert Van Isterdael","email":"","orcid":"https://orcid.org/0000-0001-6626-1316","institution":"VIB-UGent","correspondingAuthor":false,"prefix":"","firstName":"Gert","middleName":"Van","lastName":"Isterdael","suffix":""},{"id":330769642,"identity":"848ba57f-8a98-44fd-993a-927dcddf6e1f","order_by":18,"name":"Isabelle Guillas","email":"","orcid":"","institution":"Sorbonne Université, INSERM","correspondingAuthor":false,"prefix":"","firstName":"Isabelle","middleName":"","lastName":"Guillas","suffix":""},{"id":330769643,"identity":"ab5bdaf8-be47-4ded-b160-e7012dc34ed5","order_by":19,"name":"Yvan Saeys","email":"","orcid":"","institution":"Ghent University","correspondingAuthor":false,"prefix":"","firstName":"Yvan","middleName":"","lastName":"Saeys","suffix":""},{"id":330769644,"identity":"bb2adda9-4368-4387-910b-0dd1f078561b","order_by":20,"name":"Bart Lambrecht","email":"","orcid":"","institution":"VIB Center for Inflammation Research","correspondingAuthor":false,"prefix":"","firstName":"Bart","middleName":"","lastName":"Lambrecht","suffix":""},{"id":330769645,"identity":"1d53b684-a76c-4905-85db-bd67a1e10fcd","order_by":21,"name":"Pieter Mestdagh","email":"","orcid":"https://orcid.org/0000-0001-7821-9684","institution":"Center for Medical Genetics, Ghent University","correspondingAuthor":false,"prefix":"","firstName":"Pieter","middleName":"","lastName":"Mestdagh","suffix":""},{"id":330769646,"identity":"53bbfeae-5002-4b09-a6bf-b7b59031b5aa","order_by":22,"name":"Wilfried Le Goff","email":"","orcid":"","institution":"Sorbonne Université, INSERM","correspondingAuthor":false,"prefix":"","firstName":"Wilfried","middleName":"Le","lastName":"Goff","suffix":""}],"badges":[],"createdAt":"2024-07-18 15:30:31","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4763670/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4763670/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":61862565,"identity":"15571b42-69b8-487e-a95f-c14e43dd23b1","added_by":"auto","created_at":"2024-08-06 11:19:17","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":249508,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLoss of XBP1/IRE1 affects gene expression in cDC1s, not cDC2s.\u003c/strong\u003e (\u003cstrong\u003ea-b\u003c/strong\u003e) The three genotypes used for RNA-seq. RT-qPCR analysis of \u003cem\u003eXbp1\u003c/em\u003e, \u003cem\u003eErn1\u003c/em\u003eand representative DE genes from sorted splenic cDC1s. RNA expression was normalized to housekeeping genes \u003cem\u003eActB\u003c/em\u003e and \u003cem\u003eYwhaz\u003c/em\u003e. The mean ± SEM is shown. Welch’s one-way ANOVA tests with Dunnett’s T3 multiple comparison test, with individual variances computed for each comparison. ∗p \u0026lt; 0.05; ∗∗p \u0026lt; 0.01; ∗∗∗p \u0026lt; 0.001. The data shown is one of two independent experiments. (\u003cstrong\u003ec\u003c/strong\u003e) Triwise plot visualizing the relative expression of genes in the three genotypes (left). The three axes represent the different mouse strains, with the ‘+’ and ‘-’ side indicating genes that are respectively upregulated or downregulated in this genotype. Genes that are not DE in any comparison (logFC\u0026lt;1) cluster in the grey center, genes that are not significantly DE are grey dots. A significant DE gene is plotted as a black dot with its position reflecting its relative expression in the three genotypes. The distance from the origin represents the magnitude of differential expression. The rose diagram (right) shows in which direction the DE genes are most enriched. (\u003cstrong\u003ed\u003c/strong\u003e) Heatmaps of DE canonical XBP1, RIDD and ISR (top 30) targets. The color scale indicates the scaled log2 normalized gene expression. (\u003cstrong\u003ee\u003c/strong\u003e) Triwise plots with canonical XBP1, RIDD or ISR targets shown in red, not (significantly) DE genes are pale red. The rose diagrams show the directionality of the DE gene enrichment.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4763670/v1/0d6228273f34ca8af8294712.png"},{"id":61862555,"identity":"edaba162-3829-449f-95a0-537d931bc05e","added_by":"auto","created_at":"2024-08-06 11:19:16","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":192171,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIRE1 is essential for homeostatic cDC1 maturation. \u003c/strong\u003e(\u003cstrong\u003ea\u003c/strong\u003e) Heatmaps (left), triwise plots (middle) and rose diagrams (right) of DE genes involved in common DC maturation (top 30) or homeostatic DC maturation. The color scale of the heatmap indicates the scaled log2 normalized gene expression. On the triwise plot, significant DE genes are shown in red, non-significant DE genes are in pale red. The rose diagrams show the directionality of DE gene enrichment. (\u003cstrong\u003eb\u003c/strong\u003e) Left: The number of splenic cDC1s and cDC2s from steady state XBP1(/IRE1)\u003csup\u003efl/fl\u003c/sup\u003e, XBP1∆DC and XBP1/IRE1∆DC mice. Right: The percentage of splenic CCR7\u003csup\u003e+\u003c/sup\u003e cDC1s and CCR7\u003csup\u003e+\u003c/sup\u003e cDC2s within cDC1s and cDC2s, respectively, in steady state XBP1(/IRE1)\u003csup\u003efl/fl\u003c/sup\u003e, XBP1∆DC and XBP1/IRE1∆DC mice. (\u003cstrong\u003ec\u003c/strong\u003e) The percentage of splenic CD86\u003csup\u003e+\u003c/sup\u003e cDC1s and CD86\u003csup\u003e+\u003c/sup\u003e cDC2s within cDC1s and cDC2s, respectively, in steady state XBP1(/IRE1)\u003csup\u003efl/fl\u003c/sup\u003e, XBP1∆DC and XBP1/IRE1∆DC mice. (\u003cstrong\u003ed\u003c/strong\u003e) The percentage of splenic cDC1 subsets within cDC1s in steady state XBP1(/IRE1)\u003csup\u003efl/fl \u003c/sup\u003e(n=7), XBP1∆DC (n=5) and XBP1/IRE1∆DC (n=7) mice. The x-axis is a schematic representation of the different cDC1 substates according to maturation as determined previously\u003csup\u003e20\u003c/sup\u003e. The gating strategy is shown in \u003cstrong\u003eExtended Data Fig. 6b\u003c/strong\u003e. (\u003cstrong\u003ee\u003c/strong\u003e) The percentage of splenic CCR7\u003csup\u003e+\u003c/sup\u003e cDC1s within the cDC1s of XBP1/IRE1\u003csup\u003efl/fl\u003c/sup\u003e and XBP1/IRE1∆DC after injection of ACs at indicated time points. Statistics are omitted from the kinetics (left). (\u003cstrong\u003ef\u003c/strong\u003e) The percentage of splenic CCR7\u003csup\u003e+\u003c/sup\u003e cDC1s within cDC1s of XBP1/IRE1\u003csup\u003efl/fl\u003c/sup\u003e and XBP1/IRE1∆DC 2h and 8h after injection of PBS, eLNPs (left) or pIC-LNPs (right). Two-way ANOVA and Tukey’s \u003cstrong\u003e(b-c, e-f)\u003c/strong\u003e or Dunnett’s \u003cstrong\u003e(d) \u003c/strong\u003emultiple comparisons test, with a single pooled variance. The mean ± SEM is shown in \u003cstrong\u003eb-f\u003c/strong\u003e. Representative of at least 2 independent experiments in \u003cstrong\u003eb-f\u003c/strong\u003e. ∗p \u0026lt; 0.05; ∗∗p \u0026lt; 0.01; ∗∗∗P \u0026lt; 0.001; ∗∗∗∗p \u0026lt; 0.0001; ns, not significant.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4763670/v1/7fb41c8bbc53a3172a1c539f.png"},{"id":61862553,"identity":"722e3251-50a3-4869-8e63-8a30d9fabaa0","added_by":"auto","created_at":"2024-08-06 11:19:16","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":75736,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIRE1 is triggered by apoptotic cell engulfment in cDC1s. \u003c/strong\u003e(\u003cstrong\u003ea-d\u003c/strong\u003e) The MFI of ERAI in splenic cDC1s and cDC2s (left) and cDC1 subsets (right) 2h after uptake of ACs (\u003cstrong\u003ea\u003c/strong\u003e), beads (\u003cstrong\u003ec\u003c/strong\u003e) or eLNPs (\u003cstrong\u003ed\u003c/strong\u003e), or in steady state Rac1\u003csup\u003efl/fl\u003c/sup\u003eRac2\u003csup\u003e+/+\u003c/sup\u003e and Rac1∆DCRac2\u003csup\u003e-/-\u003c/sup\u003e (\u003cstrong\u003eb\u003c/strong\u003e) mice. The MFI was corrected for background fluorescence from non-transgenic littermates. Two-way ANOVA and Sidak’s multiple comparisons test, with a single pooled variance. (\u003cstrong\u003ee\u003c/strong\u003e) The MFI of ERAI in CCR7\u003csup\u003e+\u003c/sup\u003e cDC1s after 2h engulfment (CTV\u003csup\u003e+\u003c/sup\u003e 2h, early mature) and 12h engulfment (CTV\u003csup\u003e+\u003c/sup\u003e 12h, late mature) compared to CTV\u003csup\u003e-\u003c/sup\u003e CCR7\u003csup\u003e+\u003c/sup\u003e cDC1s. The MFI was corrected for background fluorescence from non-transgenic littermates. One-way ANOVA and Sidak’s multiple comparisons test, with a single pooled variance. (\u003cstrong\u003ef-g\u003c/strong\u003e) The percentage of CTV\u003csup\u003e+\u003c/sup\u003e (ACs, F) and beads\u003csup\u003e+\u003c/sup\u003e (G) cDC1s and cDC2s of XBP1/IRE1\u003csup\u003efl/fl\u003c/sup\u003e and XBP1/IRE1∆DC 2h (empty circles) and 12h (filled circles) after injection. Two-way ANOVA with Geisser-Greenhouse correction and Tukey’s multiple comparisons test, with individual variances. The mean ± SEM is shown in \u003cstrong\u003ea\u003c/strong\u003e-\u003cstrong\u003eg\u003c/strong\u003e. Representative of at least 2 independent experiments in \u003cstrong\u003ea\u003c/strong\u003e-\u003cstrong\u003ef\u003c/strong\u003e. ∗p \u0026lt; 0.05; ∗∗p \u0026lt; 0.01; ∗∗∗p \u0026lt; 0.001; ∗∗∗∗p \u0026lt; 0.0001; ns, not significant.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4763670/v1/363862f6204dc7aef588bf90.png"},{"id":61862556,"identity":"8405a5c8-9916-4121-a74a-91e85c45de31","added_by":"auto","created_at":"2024-08-06 11:19:16","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":141475,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIRE1 controls cholesterol efflux in homeostatic mature cDC1s.\u003c/strong\u003e (\u003cstrong\u003ea\u003c/strong\u003e) Heatmap (left), triwise plot (middle) and rose diagram (right) of all DE genes playing a role in cholesterol metabolism. The color scale of the heatmap indicates the scaled log2 normalized gene expression. On the triwise plot, DE genes are shown in red, non-significant DE genes are shown in pale red. The rose diagrams show the directionality of DE gene enrichment. (\u003cstrong\u003eb\u003c/strong\u003e) The relative expression of \u003cem\u003eAbcg1\u003c/em\u003e, \u003cem\u003eApoe\u003c/em\u003e, \u003cem\u003eApol10b\u003c/em\u003e, \u003cem\u003eApol7c\u003c/em\u003e, \u003cem\u003eSqle\u003c/em\u003e and \u003cem\u003eLdlr\u003c/em\u003e in sorted splenic CCR7\u003csup\u003e-\u003c/sup\u003e and CCR7\u003csup\u003e+\u003c/sup\u003e cDC1s of XBP1(/IRE1)\u003csup\u003efl/fl\u003c/sup\u003e, XBP1∆DC and XBP1/IRE1∆DC mice relative to house keeping genes \u003cem\u003eGapdh\u003c/em\u003e and \u003cem\u003eYwhaz\u003c/em\u003e, as determined by RT-qPCR. (\u003cstrong\u003ec\u003c/strong\u003e) The normalized MFI of BODIPY 493/503 in cDC1 states of WT, XBP1∆DC and XBP1/IRE1∆DC mice. The x-axis is a schematic representation of the different cDC1 substates according to maturation as determined previously\u003csup\u003e20\u003c/sup\u003e. The gating strategy is shown in \u003cstrong\u003eExtended Data Fig. 6b\u003c/strong\u003e. (\u003cstrong\u003ed\u003c/strong\u003e) Total cholesterol levels from sorted splenic CCR7\u003csup\u003e-\u003c/sup\u003e and CCR7\u003csup\u003e+\u003c/sup\u003e cDC1s (left) and cDC2s (right) of XBP1(/IRE1)\u003csup\u003efl/fl\u003c/sup\u003e, XBP1∆DC (one outlier removed after Grubb’s outlier analysis) and XBP1/IRE1∆DC mice. Two-way ANOVA and Tukey’s multiple comparison test, with a single-pooled variance in b and d, or individual variances in c. The mean ± SEM is shown in b-d. b-c are representative of 2 independent experiments. d contains pooled data of independent experiments. ∗p \u0026lt; 0.05; ∗∗p \u0026lt; 0.01; ∗∗∗p \u0026lt; 0.001; ∗∗∗∗p \u0026lt; 0.0001; ns: not significant.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4763670/v1/bafa597bdcd5c874003e733e.png"},{"id":61862559,"identity":"b4c1461a-7764-4466-8183-e223fb9efff6","added_by":"auto","created_at":"2024-08-06 11:19:16","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":201521,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIRE1 controls cholesterol efflux genes in a RIDD/miRNA-dependent manner.\u003c/strong\u003e (\u003cstrong\u003ea\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eScheme explaining the hypothesis for the\u003cstrong\u003e \u003c/strong\u003ecrossing between Dicer and IRE1D mice to investigate whether miRNA\u003cstrong\u003e \u003c/strong\u003edegradation by IRE1 leads to the stabilization of \u003cem\u003eAbcg1\u003c/em\u003e and \u003cem\u003eApoe\u003c/em\u003e mRNAs.\u003cstrong\u003e \u003c/strong\u003eWe postulated that in WT cDC1s, activated IRE1 may degrade certain pre-miRNAs targeting \u003cem\u003eAbcg1\u003c/em\u003e or \u003cem\u003eApoe1\u003c/em\u003e. Because of their degradation, Dicer would no longer be able to cleave them to generate mature miRNAs, leading to increased stability of the miRNA target genes. In absence of IRE1, IRE1 target pre-miRNAs are no longer cleaved, allowing Dicer to mature them.\u0026nbsp; We reasoned that if this model was to be true, compound deficient cDC1s for both IRE1 and Dicer would similarly prevent the formation of mature miRNAs, thereby restoring expression of miRNA target gene expression. (\u003cstrong\u003eb\u003c/strong\u003e) The number of splenic cDC1s and cDC2s (left) and the percentage of splenic CCR7\u003csup\u003e+\u003c/sup\u003e cDC1s and cDC2s (right) in IRE1/Dicer\u003csup\u003efl/fl\u003c/sup\u003e, Dicer∆DC, IRE1∆DC and IRE1/Dicer∆DC mice at steady state. Two-way ANOVA with Tukey’s multiple comparison test, with a single pooled variance. (\u003cstrong\u003ec\u003c/strong\u003e) The relative expression of \u003cem\u003eDicer1\u003c/em\u003e, \u003cem\u003eAbcg1\u003c/em\u003e, \u003cem\u003eApoe\u003c/em\u003e, \u003cem\u003eApol7c\u003c/em\u003e and \u003cem\u003eApol10b\u003c/em\u003e in sorted splenic cDC1s of IRE1(/Dicer)\u003csup\u003efl/fl\u003c/sup\u003e, IRE1∆DC and IRE1/Dicer∆DC mice. The expression was normalized on housekeeping genes \u003cem\u003eRpl13a\u003c/em\u003e and \u003cem\u003eYwhaz\u003c/em\u003e. One-way ANOVA with Holm-Sidak’s multiple comparison test, using a single pooled variance. (\u003cstrong\u003ed\u003c/strong\u003e) Triwise plot of miRNA-seq data on sorted splenic cDC1s from XBP1(/IRE1)\u003csup\u003efl/fl\u003c/sup\u003e, XBP1∆DC and XBP1/IRE1∆DC mice. Significantly differentially expressed (DE) miRNAs in the XBP1(/IRE1)\u003csup\u003efl/fl\u003c/sup\u003e versus XBP1/IRE1∆DC comparison are indicated in red. DE miRNAs upregulated in XBP1/IRE1∆DC cDC1s compared to WT are depicted with their names. (\u003cstrong\u003ee\u003c/strong\u003e) The relative expression of miRNAs by RT-qPCR in splenic CCR7\u003csup\u003e-\u003c/sup\u003e and CCR7\u003csup\u003e+\u003c/sup\u003e cDC1s that were found upregulated in the XBP1/IRE1∆DC cDC1s in the miRNA-seq. The expression was normalized on miR-423-3p and miR-191-5p, which were not DE in the miRNA-seq experiment but adequately expressed. Two-way ANOVA with Sidak’s multiple comparison test, using a single pooled variance. (\u003cstrong\u003ef\u003c/strong\u003e) Degradation of XBP1, miR-92-a1 and a negative control (miR-30b) upon incubation with recombinant IRE1. Degradation and fragmentation of the RNA was visualized by separation on TBE-Urea gel. XBP1 degradation products are not visualized on the gel (too small). The mean ± SEM is shown in b-c and e. Representative of at least two independent experiments in b-c and e-f. ∗p \u0026lt; 0.05; ∗∗p \u0026lt; 0.01; ∗∗∗p \u0026lt; 0.001; ∗∗∗∗p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4763670/v1/50bc705db067ca103ba3325c.png"},{"id":61862560,"identity":"96e90428-771b-4c78-8164-bd97a120b1db","added_by":"auto","created_at":"2024-08-06 11:19:16","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":86583,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIRE1-dependent cell death in Flt3 Notch cDC1s is rescued by rHDL treatment. \u003c/strong\u003e(\u003cstrong\u003ea\u003c/strong\u003e) The MFI of ERAI in splenic and Flt3 Notch (Day9 of culturing) cDC1s and cDC2s. (\u003cstrong\u003eb\u003c/strong\u003e) The MFI of CD11c in Flt3 Notch XBP1(/IRE1)\u003csup\u003efl/fl\u003c/sup\u003e, XBP1∆DC and XBP1/IRE1∆DC cDC1s and cDC2s. Two-way ANOVA and Tukey’s multiple comparison test, with a single-pooled variance. (\u003cstrong\u003ec\u003c/strong\u003e) ER-morphology of Flt3/Notch XBP1(/IRE1)\u003csup\u003efl/fl\u003c/sup\u003e, XBP1∆DC and XBP1/IRE1∆DC cDC1s by confocal microscopy. The nucleus and the ER are stained with DAPI (blue) and anti-KDEL staining (green), respectively. The scale bar represents 1 µm. (\u003cstrong\u003ed\u003c/strong\u003e) The relative expression of \u003cem\u003eXbp1\u003c/em\u003e, \u003cem\u003eIre1\u003c/em\u003e, \u003cem\u003eAbcg1\u003c/em\u003e, \u003cem\u003eApoe\u003c/em\u003e, \u003cem\u003eApol10b\u003c/em\u003e, \u003cem\u003eApol7c\u003c/em\u003e, \u003cem\u003eSqle\u003c/em\u003e and \u003cem\u003eLdlr\u003c/em\u003e in sorted Flt3 Notch cDC1s from XBP1/IRE1\u003csup\u003efl/fl\u003c/sup\u003e and XBP1/IRE1∆DC bone-marrow relative to house keeping genes \u003cem\u003eGapdh\u003c/em\u003e and \u003cem\u003eYwhaz\u003c/em\u003e, as determined by RT-qPCR. Unpaired t-test. (\u003cstrong\u003ee\u003c/strong\u003e) Total cholesterol levels from sorted Flt3 Notch XBP1/IRE1\u003csup\u003efl/fl\u003c/sup\u003e and XBP1/IRE1∆DC cDC1s. Mann-Whitney test.\u0026nbsp; (\u003cstrong\u003ef\u003c/strong\u003e) Left: Scheme showing experimental set-up. Right: Representative FACS contour plots of Flt3 Notch XBP1/IRE1∆DC cDC1s at 11 days of culturing, 2 days after PBS (control) or rHDL (50 µg/ml) treatment. The graph depicts the percentage of live cDC1s among total cDC1s in Flt3 Notch cultures at 9 days of culturing or 11 days of culturing after 2-day PBS (control) or rHDL (50 µg/ml) treatment. Two-way ANOVA and Tukey’s multiple comparison test, with a single-pooled variance. The mean ± SEM is shown in a-b and d-f. Representative of at least 2 independent experiments in a-b and f. c shows one representative image per genotype. ∗p \u0026lt; 0.05; ∗∗p \u0026lt; 0.01; ∗∗∗p \u0026lt; 0.001; ∗∗∗∗p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4763670/v1/5ad06f4f269661cbf45da2d1.png"},{"id":89084450,"identity":"c12a0049-2a4e-4c68-9454-5d6d1c79c322","added_by":"auto","created_at":"2025-08-14 13:50:13","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3179254,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4763670/v1/642c57fa-c7f3-4acd-aebe-b858d69aabc4.pdf"},{"id":61863025,"identity":"00b2760d-3c09-48c0-9c37-79ca91158bd1","added_by":"auto","created_at":"2024-08-06 11:27:16","extension":"xls","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":22016,"visible":true,"origin":"","legend":"\u003cp\u003eDataset 1\u003c/p\u003e","description":"","filename":"SupplTable1summaryDEgenescDC2.xls","url":"https://assets-eu.researchsquare.com/files/rs-4763670/v1/0fdf570d173a7a5612c6a447.xls"},{"id":61862564,"identity":"8192d86c-19fe-434f-9b43-1a0dd9b4c75d","added_by":"auto","created_at":"2024-08-06 11:19:16","extension":"xls","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":197120,"visible":true,"origin":"","legend":"\u003cp\u003eDataset 2\u003c/p\u003e","description":"","filename":"SupplTable2summaryDEgenescDC1s.xls","url":"https://assets-eu.researchsquare.com/files/rs-4763670/v1/9c91af7e7a15c59b80289c53.xls"},{"id":61862558,"identity":"0b9514eb-0d91-4d11-8347-84cf25b4eb83","added_by":"auto","created_at":"2024-08-06 11:19:16","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":183075,"visible":true,"origin":"","legend":"\u003cp\u003eDataset 3\u003c/p\u003e","description":"","filename":"SupplTable3summaryGOtermsdiffexp.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4763670/v1/7d76515581a34ab51812da96.xlsx"},{"id":61862557,"identity":"4ed89fa0-2099-4888-ac56-fa66de2c2de4","added_by":"auto","created_at":"2024-08-06 11:19:16","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":426814,"visible":true,"origin":"","legend":"\u003cp\u003eDataset 4\u003c/p\u003e","description":"","filename":"SupplTable4CITEseqDEgenesincDC1subclusters.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4763670/v1/2ff6e3f60d62eb9eca57613f.xlsx"},{"id":61862562,"identity":"e5014cab-268a-4104-818f-89cf31cb4aae","added_by":"auto","created_at":"2024-08-06 11:19:16","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":25554,"visible":true,"origin":"","legend":"\u003cp\u003eDataset 5\u003c/p\u003e","description":"","filename":"SupplTable5summaryDEmiRNAslessStrict.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4763670/v1/1ece261c55a2226436c6fc7b.xlsx"},{"id":61863026,"identity":"49d04f1f-7ce9-4516-92a7-9c6e8ece767b","added_by":"auto","created_at":"2024-08-06 11:27:16","extension":"docx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":55379,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Methods and tables\u003c/p\u003e","description":"","filename":"BosteelsSupplementaryinformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-4763670/v1/4c4381ec147ec133fc3062cc.docx"},{"id":61862561,"identity":"c619eaf3-a6b8-41ed-950f-39e02feebb0e","added_by":"auto","created_at":"2024-08-06 11:19:16","extension":"xlsx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":139638,"visible":true,"origin":"","legend":"\u003cp\u003eDataset 10\u003c/p\u003e","description":"","filename":"SupplTable10summaryownGOlists.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4763670/v1/274ab6a684f4f23ba71fddab.xlsx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"The unfolded protein sensor IRE1a is essential for homeostatic dendritic cell maturation","fulltext":[{"header":"One sentence summary","content":"\u003cp\u003eIRE1 controls homeostatic cDC1 maturation by coordinating cholesterol homeostasis upon apoptotic cell engulfment.\u003c/p\u003e"},{"header":"Main","content":"\u003cp\u003eInositol Requiring Enzyme 1 (IRE1) is an endonuclease embedded in the ER membrane that together with PKR-like endoplasmic reticulum kinase (PERK) and Activating Transcription Factor 6 (ATF6), coordinates the unfolded protein response (UPR)\u003csup\u003e1–3\u003c/sup\u003e. The UPR is an adaptive response that is typically activated upon accumulation of unfolded proteins in the ER. IRE1 represents the most conserved branch of the UPR and splices X-box binding protein 1 (\u003cem\u003eXbp1\u003c/em\u003e) mRNA to generate the transcription factor XBP1s. XBP1s in turn helps to restore protein homeostasis by inducing the expression of chaperones, redox enzymes and ER-associated degradation (ERAD) components. In addition, IRE1 endonuclease activity targets mRNAs and miRNAs for degradation through a poorly understood process termed regulated IRE1 dependent decay (RIDD)\u003csup\u003e4–7\u003c/sup\u003e. \u003cem\u003eIn vivo\u003c/em\u003e, IRE1 is typically activated in secretory cells such as goblet cells\u003csup\u003e8\u003c/sup\u003e or plasma cells\u003csup\u003e9\u003c/sup\u003e, or in immune cells that are actively proliferating during a viral infection\u003csup\u003e10\u003c/sup\u003e, underscoring IRE1’s canonical role in protein folding. On the contrary, in type 1 conventional dendritic cells (cDC1s), IRE1 is active in absence of prototypical ER stress and without the induction of typical XBP1s target genes\u003csup\u003e11–15\u003c/sup\u003e. Why and how IRE1 is specifically activated in cDC1s but not in the highly related cDC2 subset remains enigmatic.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLoss of XBP1/IRE1 affects gene expression in cDC1s, not cDC2s\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo gain insights into the function of IRE1 in cDC1s, we performed bulk RNA sequencing (RNA-seq) in different genotypes of the XBP1/IRE1 axis. Loss of XBP1 induces IRE1 hyperactivation and strong activation of RIDD-associated mRNA degradation in cDC1s, not in the closely related cDC2 subset\u003csup\u003e12,13\u003c/sup\u003e. This complicates the interpretation of RNA-seq data, since any gene downregulated in Xbp1\u003csup\u003efl/fl\u003c/sup\u003e \u003cem\u003eItgax\u003c/em\u003e-cre (called XBP1∆DC) cDC1s could either be transcriptionally regulated by XBP1s or targeted for degradation through RIDD\u003csup\u003e12\u003c/sup\u003e. To dissect the functions of XBP1 and IRE1 separately, we compared cDC1s sorted from the spleens of XBP1(/IRE1)\u003csup\u003efl/fl\u003c/sup\u003e (WT), XBP1∆DC and a XBP1/IRE1∆DC mouse strains (\u003cstrong\u003eFig. 1a\u003c/strong\u003e)\u003cstrong\u003e.\u003c/strong\u003e IRE1 can be found as two different paralogues, IRE1a\u0026nbsp;and IRE1b. IRE1a\u0026nbsp;is ubiquitously expressed, while IRE1b\u0026nbsp;expression is limited to epithelial cells lining the mucosal tracts\u003csup\u003e16\u003c/sup\u003e. When referring to IRE1 in this study, we refer to IRE1a, encoded by the gene \u003cem\u003eErn1\u003c/em\u003e.XBP1∆DC cDC1s have lost \u003cem\u003eXbp1\u003c/em\u003e mRNA expression and show high RIDD activity, as reflected by downregulation of the prototypic RIDD target gene \u003cem\u003eBloc1s\u003c/em\u003e\u003csup\u003e17\u003c/sup\u003e\u003cstrong\u003e(Fig. 1b)\u003c/strong\u003e. XBP1/IRE1∆DC cDC1s do not express \u003cem\u003eXbp1\u003c/em\u003e nor \u003cem\u003eErn1\u003c/em\u003e, hence lost RIDD activity, as confirmed by restoration of \u003cem\u003eBloc1s1\u003c/em\u003e expression (\u003cstrong\u003eFig. 1b\u003c/strong\u003e). The two major splenic conventional DC subsets, cDC1s and cDC2s, were sorted (gating strategy \u003cstrong\u003eExtended Data\u003c/strong\u003e \u003cstrong\u003eFig. 1\u003c/strong\u003e) and processed for bulk RNA-seq analysis. In cDC2s, very few differentially expressed (DE) genes could be identified, revealing that in steady state the XBP1/IRE1 pathway does not play a major role in cDC2s (\u003cstrong\u003eSupplementary\u003c/strong\u003e \u003cstrong\u003eTable 1\u003c/strong\u003e). On the contrary, in cDC1s many DE genes were uncovered in all 3 pairwise comparisons (\u003cstrong\u003eFig. 1c and Supplementary\u003c/strong\u003e \u003cstrong\u003eTable 2\u003c/strong\u003e), which was validated by RT-qPCR (\u003cstrong\u003eExtended Data\u003c/strong\u003e \u003cstrong\u003eFig. 2\u003c/strong\u003e). Overall, three major directionalities of DE genes could be distinguished, with representative genes indicated on \u003cstrong\u003eFig. 1c\u003c/strong\u003e and validated by RT-qPCR in \u003cstrong\u003eFig. 1b\u003c/strong\u003e. A first group of genes (indicated in yellow on the rose plot, \u003cstrong\u003eFig. 1c\u003c/strong\u003e) represents genes that were specifically downregulated in XBP1∆DC cDC1s and comprises classical RIDD targets such as \u003cem\u003eBloc1s1\u003c/em\u003e, \u003cem\u003eTapbp\u003c/em\u003e or \u003cem\u003eStim1\u003c/em\u003e in addition to established XBP1 target genes (\u003cstrong\u003eFig. 1d-e, Extended Data\u003c/strong\u003e \u003cstrong\u003eFig. 2, Extended Data\u003c/strong\u003e \u003cstrong\u003eFig. 3a-b)\u003c/strong\u003e. Loss of XBP1 in cDC1s does not lead to a major loss in XBP1 target gene expression as only a few XBP1 target genes were retrieved as differentially expressed genes (DEGs), all with low fold inductions (e.g. \u003cem\u003eSec61a1\u003c/em\u003e, \u003cem\u003eTxndc11\u003c/em\u003e, \u003cem\u003eSec24d\u003c/em\u003e). Of note, several genes previously annotated as XBP1 transcriptional target genes\u003csup\u003e18\u003c/sup\u003e appeared regulated by RIDD rather than by XBP1 based on their restored expression in XBP1/IRE1∆DC cDC1s (\u003cstrong\u003eFig. 1d, Extended Data\u003c/strong\u003e \u003cstrong\u003eFig. 3b\u003c/strong\u003e). A second group of genes (indicated in green and blue on the rose plot, \u003cstrong\u003eFig. 1c\u003c/strong\u003e) is highly upregulated in XBP1∆cDC1s and XBP1/IRE1∆cDC1s and comprises genes that belong to the integrated stress response (ISR) (\u003cstrong\u003eFig. 1d-e, Extended Data\u003c/strong\u003e \u003cstrong\u003eFig. 2, 3d, 4\u003c/strong\u003e), confirming earlier data\u003csup\u003e13\u003c/sup\u003e. Finally,the pink group (\u003cstrong\u003eFig. 1c\u003c/strong\u003e) represents genes that were downregulated in absence of XBP1/IRE1. Based on their directionality, they appeared more affected by the loss of IRE1 than by the loss of XBP1s transcriptional activity (\u003cstrong\u003eFig. 1b, c\u003c/strong\u003e). To probe the function of the DE genes in this group, we assessed whether particular gene ontology (GO) terms were enriched in this direction. This revealed GO immunological terms such as “negative regulation of inflammation” and “tolerance induction” associated with the pink group of genes (angle 5-6 \u003cstrong\u003eExtended Data Fig. 5a, Supplementary Table 3\u003c/strong\u003e), comprising well-established DC maturation genes such as \u003cem\u003eTmem176a\u003c/em\u003e, \u003cem\u003eFsnc1\u003c/em\u003e or \u003cem\u003eCcr7\u003c/em\u003e\u003csup\u003e19,20\u003c/sup\u003e \u003cstrong\u003e(Extended Data Fig. 3e)\u003c/strong\u003e. None of these genes were known as IRE1 or XBP1s target genes before. In addition, ingenuity pathway analysis (IPA) highlighted ER associated (GO) terms such as “unfolded protein response”, “superpathway of cholesterol biosynthesis” or “tRNA charging” in the comparison XBP1∆DC vs WT while the comparisons XBP1/IRE1∆DC vs WT, and XBP1∆ vs XBP1/IRE1∆DC additionally retrieved DC specific categories such as “Th1 and Th2 activation pathway”, “dendritic cell maturation”or “graft-versus-host-disease signaling”\u003cstrong\u003e\u0026nbsp;(Extended Data Fig. 5b)\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOverall, the bulk RNA-seq analysis revealed\u0026nbsp;that the absence of the IRE1/XBP1 signaling branch does not affect gene expression in cDC2s, in contrast to cDC1s. In line with our earlier observations\u003csup\u003e12,13\u003c/sup\u003e, the high basal activity of IRE1 in cDC1s was not reflected by strong expression of canonical XBP1 target genes. On the contrary, a large group of DC specific genes appeared downregulated in absence of IRE1 rather than XBP1 and were associated with DC maturation. While we could not rule out the possibility that these genes might be indirectly regulated rather than being direct targets of IRE1 endonuclease activity, it suggested that in cDC1s, IRE1 might hold functions beyond its traditional role in protein folding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIRE1 is essential for homeostatic cDC1 maturation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDEG analysis revealed that genes belonging to the homeostatic and common DC maturation program\u003csup\u003e19\u003c/sup\u003e showed decreased expression levels in XBP1/IRE1 deficient cDC1s (\u003cstrong\u003eFig. 2a, Extended Data Fig. 3e, 4\u003c/strong\u003e), which was validated by RT-qPCR (\u003cstrong\u003eExtended Data\u003c/strong\u003e \u003cstrong\u003eFig. 2\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eTo assess whether the differences in expression of DC maturation genes were reflected by differences in DC maturation, we immunophenotyped the DC compartment in the different genotypes. In line with our previous findings\u003csup\u003e12,13\u003c/sup\u003e, the total number of splenic cDC1s and cDC2s was not altered in XBP1∆DC or XBP1/IRE1∆DC mice (\u003cstrong\u003eFig. 2b\u003c/strong\u003e). However, the percentage of mature CCR7\u003csup\u003e+\u003c/sup\u003e cDC1s was strongly affected, particularly in XBP1/IRE1∆DC mice \u003cstrong\u003e(Fig. 2b)\u003c/strong\u003e, while CCR7\u003csup\u003e+\u003c/sup\u003e cDC2s were not affected. To exclude the possibility that the difference in mature cDC1s was due to downregulation of the marker gene \u003cem\u003eCcr7\u003c/em\u003e, we assessed the percentage of CD86\u003csup\u003e+\u003c/sup\u003e cDC1s, as \u003cem\u003eCd86\u003c/em\u003e was not affected in the RNA-seq analysis (\u003cstrong\u003eFig. 2a\u003c/strong\u003e) which confirmed the specific decrease in the mature cDC1 population (\u003cstrong\u003eFig. 2c\u003c/strong\u003e). Furthermore, we noticed that the surface expression of CCR7 appeared unaffected in XBP1∆DC and XBP1/IRE1∆DC cDC1s, even though \u003cem\u003eCcr7\u003c/em\u003e came out as a DE gene \u003cstrong\u003e(Extended Data\u003c/strong\u003e \u003cstrong\u003eFig. 6a)\u003c/strong\u003e. This indicated that \u003cem\u003eCcr7\u003c/em\u003e might not be directly regulated by IRE1, but that the loss of IRE1 in cDC1s is associated with a block in maturation, which is reflected by a general decrease in maturation genes in a bulk RNA-seq dataset. Recently, our lab extensively mapped homeostatic DC maturation pathways in the spleen through CITE-Seq analysis and lineage tracing experiments\u003csup\u003e20\u003c/sup\u003e. This led to the identification of markers that could be used by flow cytometry to distinguish different maturation stages of cDC1s\u003csup\u003e20\u003c/sup\u003e (\u003cstrong\u003eExtended Data Fig. 6b\u003c/strong\u003e). We used this gating strategy to assess at which point loss of the XBP1/IRE1 signaling branch affected the DC maturation program and found significant loss of the mature CCR7\u003csup\u003e+\u003c/sup\u003e cDC1s and the late immature subset (identified as CD62L\u003csup\u003e-\u003c/sup\u003eCD103\u003csup\u003e+\u003c/sup\u003eESAM\u003csup\u003e+\u003c/sup\u003eCCR7\u003csup\u003e-\u003c/sup\u003e). On the other hand, the early immature cDC1 subset (CD62L\u003csup\u003e+\u003c/sup\u003eCD103\u003csup\u003e-\u003c/sup\u003eESAM\u003csup\u003e-\u003c/sup\u003eCCR7\u003csup\u003e-\u003c/sup\u003e)was increased, suggesting that loss of IRE1 led to a reduction of mature cDC1s and an accumulation of the early immature cells (\u003cstrong\u003eFig. 2d)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eSignals driving homeostatic DC maturation in steady state conditions have long remained enigmatic\u003csup\u003e21\u003c/sup\u003e. Recently, several labs uncovered an essential role for apoptotic cell (AC) engulfment and cholesterol metabolic pathways at the heart of cDC1 maturation\u003csup\u003e20,22,23\u003c/sup\u003e. We previously noted that injection of exogenous apoptotic thymocytes boosted engulfment in splenic cDC1s and triggered their homeostatic maturation with a peak observed at 12h post- intravenous injection\u003csup\u003e20\u003c/sup\u003e (\u003cstrong\u003eFig. 2e)\u003c/strong\u003e. In line with the observed defects in the mature cDC1 compartment, injection of ACs in XBP1/IRE1∆DC mice did not lead to a similar increase in cDC1 maturation (\u003cstrong\u003eFig. 2e\u003c/strong\u003e). Also, injection of empty non-adjuvanted lipid nanoparticles (eLNPs)\u003csup\u003e20\u003c/sup\u003e, comprising 40% cholesterol (\u003cstrong\u003eFig. 2f\u003c/strong\u003e left panel), only slightly increased cDC1 maturation in absence of XBP1/IRE1. On the contrary, injection with LNPs coupled to poly(I:C), a potent TLR3 ligand, did induce full cDC1 maturation in XBP1/IRE1∆DC mice, showing that the immunogenic maturation program did not depend on the presence of the IRE1 signaling branch (\u003cstrong\u003eFig. 2f\u0026nbsp;\u003c/strong\u003eright panel).\u003c/p\u003e\n\u003cp\u003eIn summary, these data highlight a function for the ER stress sensor IRE1 in the homeostatic maturation process of cDC1s, not cDC2s. Kinetics experiments further revealed that the process of cDC1 maturation induced by injection of ACs or cholesterol rich eLNPs was strongly impaired in absence of IRE1, while TLR ligand-induced cDC1 maturation appeared largely unaffected.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIRE1 is triggered by apoptotic cell engulfment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSeveral labs meanwhile noted that IRE1 shows a higher basal activity in cDC1s compared to cDC2s\u003csup\u003e11–15\u003c/sup\u003e, still the mechanism explaining this subset specific activation of IRE1 has remained enigmatic. A recent study proposed that antigen-derived peptides can engage IRE1 in a TAP1-dependent manner by binding the IRE1 lumenal domain upon their import in the ER\u003csup\u003e14\u003c/sup\u003e. We tested this hypothesis \u003cem\u003ein vivo\u003c/em\u003e by monitoring the IRE1 activity in TAP1-deficient cDC1s, by crossing the well-established IRE1 reporter line ERAI\u003csup\u003e12,24\u003c/sup\u003e on TAP1-deficient mice. Unexpectedly, absence of TAP1 did not result in any difference in ERAI activity, suggesting that \u003cem\u003ein vivo\u003c/em\u003e TAP1-dependent import of peptides into the ER does not contribute to the cDC1 specific steady state activity of IRE1 (\u003cstrong\u003eExtended Data\u003c/strong\u003e \u003cstrong\u003eFig. 6c\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eWe previously noted that AC engulfment in cDC1s is reflected by changes in endogenous cholesterol levels: cholesterol levels first rise due to the uptake of apoptotic cargo followed by a steep decline once cDC1s start to mature and migrate to the white pulp of the spleen\u003csup\u003e20\u003c/sup\u003e. In steady state conditions, cDC2s do not engulf ACs\u003csup\u003e20,25–34\u003c/sup\u003e and therefore do not show these drastic changes in cholesterol levels\u003csup\u003e20\u003c/sup\u003e. Intrigued by recent data showing IRE1 activation by accumulation of aberrant lipids such as cholesterol at the ER membrane\u003csup\u003e35–37\u003c/sup\u003e, we tested the premise that the selective activation of IRE1 in cDC1s could be explained by their unique capacity to engulf ACs \u003cem\u003ein vivo\u003c/em\u003e. A strict correlation could be observed between IRE1 activity, as monitored by ERAI reporter activity\u003csup\u003e12,13,24\u003c/sup\u003e, and intracellular cholesterol content as measured by BODIPY 493/503, which stains all neutral lipids including cholesterol esters (\u003cstrong\u003eExtended Data\u003c/strong\u003e \u003cstrong\u003eFig. 6d\u003c/strong\u003e). IRE1 activity increases from the early immature to the late immature state and then declines as soon as cells gain CCR7 expression (\u003cstrong\u003eExtended Data\u003c/strong\u003e \u003cstrong\u003eFig. 6d\u003c/strong\u003e). Injection of exogenous CTV-labeled ACs led to an increase in IRE1 activity specifically in CTV\u003csup\u003e+\u003c/sup\u003e cDC1s 2h post injection (p.i.), but not in cDC2s (\u003cstrong\u003eFig. 3a\u003c/strong\u003e). More detailed examination of the different maturation stages revealed an increase in ERAI signal in all CTV\u003csup\u003e+\u003c/sup\u003e subsets, which was least prominent in the late immature cDC1s, that already have a high basal IRE1 activity due to engulfment of endogenous (CTV\u003csup\u003e-\u003c/sup\u003e) ACs\u003csup\u003e20\u003c/sup\u003e (\u003cstrong\u003eFig. 3a\u003c/strong\u003e). We recently generated a Rac1∆DC Rac2\u003csup\u003e-/-\u003c/sup\u003e mouse line in which cDC1s are deficient in the engulfment of ACs and therefore have lower levels of neutral lipids and cholesterol esters\u003csup\u003e20\u003c/sup\u003e. We crossed the ERAI reporter to this line and observed that blocking engulfment causes a strong decrease in IRE1 activity in cDC1s, whereas IRE1 activity in cDC2s remains low (\u003cstrong\u003eFig. 3b\u003c/strong\u003e). To assess whether the increase in IRE1 activity was due to the engulfment process itself or due to the influx of lipids, we injected inert beads and eLNPs, respectively. Engulfment of inert beads did not induce IRE1 activity while eLNPs did, following a similar pattern as observed upon AC engulfment (\u003cstrong\u003eFig. 3c-d\u003c/strong\u003e). Of note, the difference in IRE1 activity between CTV\u003csup\u003e+\u003c/sup\u003e or LNP\u003csup\u003e+\u003c/sup\u003e and CTV\u003csup\u003e-\u003c/sup\u003e or LNP\u003csup\u003e-\u003c/sup\u003e cDC1s was most prominent in the CCR7\u003csup\u003e+\u003c/sup\u003e stage \u003cstrong\u003e(Fig. 3a, d)\u003c/strong\u003e. This can be explained by the fact that CTV\u003csup\u003e+\u003c/sup\u003e CCR7\u003csup\u003e+\u003c/sup\u003e cDC1s are still in the early mature state, as reflected by their intermediate expression level of CCR7 (blue dots in\u0026nbsp;\u003cstrong\u003eExtended Data\u003c/strong\u003e \u003cstrong\u003eFig. 6e\u003c/strong\u003e), compared to CTV\u003csup\u003e-\u003c/sup\u003e CCR7\u003csup\u003e+\u003c/sup\u003e cDC1s which consist mainly of late mature cDC1s.\u0026nbsp;From early to late mature cDC1s, IRE1 activity progressively declines \u003cstrong\u003e(\u003c/strong\u003e\u003cstrong\u003eExtended Data\u003c/strong\u003e \u003cstrong\u003eFig. 6c)\u003c/strong\u003e, to reach basal levels 12h post-injection of ACs (\u003cstrong\u003eFig. 3e\u003c/strong\u003e). Altogether, these data establish that uptake of ACs and more specifically influx of lipids triggers IRE1 endonuclease activity in cDC1s.\u003c/p\u003e\n\u003cp\u003eFurthermore, the engulfment capacity of XBP1/IRE1 deficient cDC1s appeared reduced, especially at 12 hours post-injection \u003cstrong\u003e(Fig. 3f)\u003c/strong\u003e. Since the engulfment defect appeared less pronounced at early timepoints, the reduction in the CTV\u003csup\u003e+\u003c/sup\u003e cDC1 population at later timepoints could also be explained by a specific survival deficit of CTV\u003csup\u003e+\u003c/sup\u003e mature cDC1s over time in XBP1/IRE1∆DC mice (\u003cstrong\u003eFig. 3f\u003c/strong\u003e). In contrast, engulfment of inert latex beads in cDC1s was not hampered by deletion of XBP1/IRE1 neither at the 2 or 12 hours time point (\u003cstrong\u003eFig. 3g\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eIn summary, these data reveal that lipids derived from ACs are the major trigger for IRE1 activity in steady state cDC1s rather than the import of peptides into the ER. This explains the selective activation of IRE1 in cDC1s\u003csup\u003e11–13\u003c/sup\u003e and is in line with earlier studies showing IRE1 activation by aberrant lipids such as accumulation of cholesterol at the ER membrane\u003csup\u003e35–41\u003c/sup\u003e. Deficiency of XBP1/IRE1 in cDC1s leads to a specific loss of cDC1s that engulfed ACs, potentially explaining why homeostatically matured cDC1s are reduced in XBP1/IRE1∆DC mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIRE1 controls cholesterol efflux in homeostatic mature cDC1s\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEarlier studies showed a role for IRE1-dependent RIDD in regulating lipid metabolism\u003csup\u003e42–44\u003c/sup\u003e. Our bulk RNA-seq data in cDC1s confirmed this and showed a specific deficit in cholesterol biosynthesis genes like the transcription factor \u003cem\u003eSrebf2\u003c/em\u003e, or key enzymes in the mevalonate pathway, such as \u003cem\u003eSqle, Cyp51\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Hsd17b17\u003c/em\u003e upon XBP1-deficiency (\u003cstrong\u003eFig. 4a, Extended Data\u003c/strong\u003e \u003cstrong\u003eFig. 2, Extended Data\u003c/strong\u003e \u003cstrong\u003eFig. 3c\u003c/strong\u003e). In IRE1/XBP1 deficient cDC1s, the cholesterol efflux gene \u003cem\u003eAbcg1\u003c/em\u003e and the apolipoproteins \u003cem\u003eApol7c\u003c/em\u003e and \u003cem\u003eApol10b\u003c/em\u003e, genes that we previously noted to be induced specifically in homeostatic mature cDC1s\u003csup\u003e20\u003c/sup\u003e, were downregulated. \u0026nbsp;On the other hand, genes related to cholesterol esterification like \u003cem\u003eSoat2\u0026nbsp;\u003c/em\u003eor genes associated with lipotoxicity such as \u003cem\u003eChop\u003c/em\u003e and \u003cem\u003eTrib3\u003c/em\u003e were upregulated in IRE1/XBP1 deficient cDC1s (\u003cstrong\u003eFig. 4a,\u003c/strong\u003e \u003cstrong\u003eExtended Data\u003c/strong\u003e \u003cstrong\u003eFig. 2, Extended Data Fig. 3c)\u003c/strong\u003e. Since the loss of IRE1 and XBP1 leads to a strong reduction in the number of homeostatic mature cDC1s, we decided to verify whether these genes were affected at single cell level in absence of IRE1 and performed cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq). CITE-Seq was performed on sorted CD64\u003csup\u003e-\u003c/sup\u003e CD11c\u003csup\u003e+\u003c/sup\u003e MHCII\u003csup\u003e+\u003c/sup\u003e XCR1\u003csup\u003e+\u003c/sup\u003e CD172a\u003csup\u003e-\u003c/sup\u003e cDC1s (65% of total), CD64\u003csup\u003e-\u003c/sup\u003e CD11c\u003csup\u003e+\u003c/sup\u003e MHCII\u003csup\u003e+\u003c/sup\u003e XCR1\u003csup\u003e-\u003c/sup\u003e CD172a\u003csup\u003e+\u003c/sup\u003e cDC2s (10% of total), CD64\u003csup\u003e-\u003c/sup\u003e CD11c\u003csup\u003e+\u003c/sup\u003e MHCII\u003csup\u003e-/Lo\u003c/sup\u003e CD135\u003csup\u003e+\u003c/sup\u003e CD172a\u003csup\u003edim\u003c/sup\u003e pre-DCs (15% of total) and live cells (10% of total) from the spleen of WT (XBP1/IRE1\u003csup\u003efl/fl\u003c/sup\u003e) and XBP1/IRE1∆DC mice. Unsupervised clustering and UMAP dimensionality reduction yielded several clusters for cDC1s that were annotated based on expression of data-driven marker genes and led to the identification of pre-cDC1s, proliferating cDC1s, early immature cDC1s, late immature cDC1s, early mature cDC1s, Cxcl9+ cDC1s and late mature cDC1s (\u003cstrong\u003eExtended Data\u003c/strong\u003e \u003cstrong\u003eFig. 7a\u003c/strong\u003e). We recently identified these clusters as consecutive steps in cDC1 maturation, except for the Cxcl9\u003csup\u003e+\u003c/sup\u003e cluster which was previously included in the early mature cDC1 cluster\u003csup\u003e20\u003c/sup\u003e. Comparing the relative abundances of each subcluster of cDC1s confirmed the reduction of mature cDC1s in XBP1/IRE1∆DC mice (\u003cstrong\u003eExtended Data\u003c/strong\u003e \u003cstrong\u003eFig. 7b\u003c/strong\u003e). DE genes (both up and down) could be identified in each cDC1 subcluster, with only a few in the pre-cDC1s and most in the late immature and mature subsets (\u003cstrong\u003eSupplementary\u003c/strong\u003e \u003cstrong\u003eTable\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e4\u003c/strong\u003e). Previously identified DE genes with a high logFC (\u0026gt;2) linked to DC maturation (like \u003cem\u003eCcr7\u003c/em\u003e, \u003cem\u003eFscn1\u003c/em\u003e, \u003cem\u003eTmem176a\u003c/em\u003e, \u003cem\u003eTmem176b\u003c/em\u003e, \u003cem\u003eSlco5a1\u003c/em\u003e, \u003cem\u003eNudt17\u003c/em\u003e) were not differentially expressed anymore in the late mature cDC1s in the CITE-seq analysis, indicating that they were differentially expressed due to a loss of the CCR7\u003csup\u003e+\u003c/sup\u003e cDC1 subset in the bulk RNA-seq rather than being directly regulated by IRE1. However, we could still identify DE genes related to cholesterol metabolism and apolipoproteins (\u003cem\u003eApol7c, Apoe\u003c/em\u003e, \u003cem\u003eApol10b\u003c/em\u003e and\u003cem\u003e\u0026nbsp;Abcg1\u003c/em\u003e) (\u003cstrong\u003eSupplementary Table 4,\u003c/strong\u003e \u003cstrong\u003eExtended Data\u003c/strong\u003e \u003cstrong\u003eFig. 7c\u003c/strong\u003e), a few remaining DC maturation genes (\u003cem\u003eIl4i1\u003c/em\u003e, \u003cem\u003eMical3\u003c/em\u003e, \u003cem\u003eH2-M2\u003c/em\u003e, etc.) and \u003cem\u003eDnase1l3\u003c/em\u003e, which is related to the degradation of self-DNA. The upregulated genes mainly contained genes related to the ISR pathway (\u003cem\u003eAtf4, Ddit3, Cars, Yars\u003c/em\u003e, …) confirming the findings of the bulk RNA-seq (\u003cstrong\u003eSupplementary\u003c/strong\u003e \u003cstrong\u003eTable 4\u003c/strong\u003e). One of the top upregulated genes was \u003cem\u003eCox6a2\u003c/em\u003e, a subunit of the mitochondrial complex IV of the oxidative phophorylation pathway, which was also one of the few upregulated genes in XBP1/IRE1 deficient cDC2s (\u003cstrong\u003eSupplementary\u003c/strong\u003e \u003cstrong\u003eTable 1\u003c/strong\u003e). Together, the CITEseq data confirmed the specific loss of the CCR7\u003csup\u003e+\u003c/sup\u003e mature cDC1 subset and revealed genes important for cholesterol efflux, such as \u003cem\u003eApoe\u003c/em\u003e and \u003cem\u003eAbcg1\u003c/em\u003e and apolipoproteins \u003cem\u003eApol10b\u003c/em\u003e and \u003cem\u003eApol7c\u003c/em\u003e as potential IRE1 target genes.\u003c/p\u003e\n\u003cp\u003eWe previously showed that during cDC1 homeostatic maturation, cholesterol efflux is activated to restore cholesterol levels after AC engulfment in an LXR-dependent manner\u003csup\u003e20\u003c/sup\u003e. Based on the gene expression signature obtained in the XBP1/IRE1 CITE-seq data and the activation of IRE1 by ACs and LNPs, we decided to assess the role of the IRE1 branch in regulating cholesterol efflux during cDC1 maturation. RT-qPCR analysis confirmed the decrease in expression of \u003cem\u003eAbcg1\u003c/em\u003e, \u003cem\u003eApoe\u003c/em\u003e, \u003cem\u003eApol10b\u003c/em\u003e and \u003cem\u003eApol7c\u003c/em\u003e most prominently in XBP1/IRE1∆DC cDC1s (\u003cstrong\u003eFig. 4b\u003c/strong\u003e). This was reflected by a small increase in BODIPY 493/503 levels \u003cstrong\u003e(Fig. 4c)\u003c/strong\u003e, which can be used to monitor the amount of neutral lipids amongst others cholesterol esters. To assess specifically the cholesterol content in the cell, we used an enzymatic assay that detects both free and esterified cholesterol and confirmed the increase in cholesterol levels in mature XBP1/IRE1∆DC cDC1s, while we did not detect any difference in immature cDC1s or in cDC2s (\u003cstrong\u003eFig. 4d\u003c/strong\u003e). We previously noted that late during homeostatic cDC1 maturation, likely as a compensatory response to ABCG1-mediated shuttling of cholesterol from the ER\u003csup\u003e45\u003c/sup\u003e, SREBP2-dependent gene transcription becomes reactivated\u003csup\u003e20\u003c/sup\u003e. We observed that SREBP2-target genes \u003cem\u003eLdlr\u003c/em\u003e and \u003cem\u003eSqle\u003c/em\u003e were less induced in XBP1/IRE1∆DC cDC1s, potentially due to the loss of ABCG1 expression and therefore a potential defect in cholesterol export from the ER (\u003cstrong\u003eFig. 4b\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAbcg1\u003c/em\u003e and \u003cem\u003eApoe\u003c/em\u003e are known target genes of the LXR signaling pathway and we previously established a role for LXRß in mediating cholesterol efflux upon AC engulfment in cDC1s\u003csup\u003e20\u003c/sup\u003e. Furthermore, LXRs have been shown to mitigate ER stress by upregulating \u003cem\u003eLpcat3\u003c/em\u003e, an enzyme that favors the incorporation of polyunsaturated fatty acids into phospholipid\u003csup\u003e46\u003c/sup\u003e. Hence, we were keen to understand if the IRE1 and LXR signaling pathways operated independently from each other or impacted each other \u003cstrong\u003e(Extended Data Fig. 8a)\u003c/strong\u003e. We reasoned that if activation of the LXR signaling pathway was upstream of IRE1 (scenario 1), this would be reflected by a loss of IRE1 reporter activity in LXRa/LXRß∆DC mice, hence we crossed ERAI mice onto LXRa/LXRß∆DC mice to assess this. Neither in total cDC1s or cDC2s, neither in any of the previously identified cDC1s states, IRE1 activity was affected by loss of LXRa/LXRß, indicating that activation of IRE1 occurs independently from LXR signaling (\u003cstrong\u003eExtended Data Fig. 8b\u003c/strong\u003e). Due to the lack of specific LXRß antibodies or reporter assays \u003cem\u003ein vivo\u003c/em\u003e, we addressed scenario 2, whether IRE1 would be needed for triggering LXRa/LXRß activation, in an indirect way. We measured the expression of interferon stimulated genes (ISGs) in XBP1/IRE1∆DC cDC1s as we had previously shown that they were induced in LXRa/LXRß deficient cDC1s\u003csup\u003e20\u003c/sup\u003e. Loss of XBP1/IRE1 in cDC1s did not result in increased expression of ISGs, suggesting that the LXRa/LXRß pathway was still active in IRE1 deficient cDC1s (\u003cstrong\u003eExtended data Fig. 8c).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn conclusion, in the absence of IRE1 and XBP1, the efflux of cholesterol levels after AC engulfment in cDC1s is not properly controlled, leading to enhanced cholesterol levels particularly at the mature state. This indicates that IRE1 plays a crucial role in regulating cholesterol metabolism in maturing cDC1s, likely in an LXR-independent manner (\u003cstrong\u003eExtended Data Fig. 8a\u003c/strong\u003e scenario 3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIRE1 controls cholesterol efflux genes in a RIDD/miRNA-dependent manner\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCholesterol efflux genes were downregulated, not stabilized in absence of IRE1 endonuclease activity. This suggested that they were not directly targeted by IRE1-dependent RIDD activity, but that they might be targets of miRNAs that would be regulated by IRE1 (\u003cstrong\u003eFig. 5a, WT\u003c/strong\u003e). IRE1 dependent RIDD activity has been previously linked to the degradation of miRNAs, especially in conditions of prolonged ER stress\u003csup\u003e44,47–49\u003c/sup\u003e. To test the hypothesis that IRE1-dependent regulation of cholesterol efflux genes, and hence DC maturation, was controlled by the degradation of miRNAs, we generated IRE1/Dicer deficient conditional knockout mice (IRE1/Dicer∆DC). We postulated that in absence of IRE1, miRNA cleavage is prevented, leading to degradation of cholesterol efflux mRNAs (\u003cstrong\u003eFig. 5a, IRE1∆DC\u003c/strong\u003e). In DCs deficient for both IRE1 and Dicer, pre-miRNAs might no longer mature, leading to a restoration of downstream cholesterol efflux genes and cDC1 maturation (\u003cstrong\u003eFig. 5a, IRE1/Dicer∆DC\u003c/strong\u003e). In line with this hypothesis, the absence of Dicer on top of IRE1 led to a restoration of homeostatic mature cDC1s \u003cstrong\u003e(Fig. 5b)\u003c/strong\u003e. Similarly, we noted a complete restoration of the expression levels of \u003cem\u003eAbcg1\u003c/em\u003e, and a partial restoration of \u003cem\u003eApoe\u003c/em\u003e and \u003cem\u003eApol10b\u003c/em\u003e, while the levels of \u003cem\u003eApol7c\u003c/em\u003e remained unaffected in the absence of \u003cem\u003eDicer\u003c/em\u003e expression\u003cstrong\u003e\u0026nbsp;(Fig. 5c)\u003c/strong\u003e. To address whether IRE1 regulates the expression of miRNAs in steady state conditions in cDC1s, we performed small RNA-seq on sorted splenic cDC1s derived from WT, XBP1∆DC and XBP1/IRE1∆DC mice and\u0026nbsp;highlighted in red all significantly DE miRNAs between XBP1/IRE1∆DC and WT cDC1s on a Triwise plot \u003cstrong\u003e(Fig. 5d, Supplementary Table 5)\u003c/strong\u003e. Four DE miRNAs were identified that were specifically upregulated in absence of IRE1, hence in absence of RIDD activity (\u003cstrong\u003eFig. 5d\u003c/strong\u003e), which were all validated by RT-qPCR (\u003cstrong\u003eFig. 5e\u003c/strong\u003e). Interestingly, miR-92a has been previously linked to regulating cholesterol efflux in macrophages by targeting \u003cem\u003eAbca1\u003c/em\u003e\u003csup\u003e50\u003c/sup\u003e. Inspection of the sequence of miR-92a revealed a potential IRE1 cleavage site UUGCAC that was present in the stem, rather than the stemloop \u003cstrong\u003e(Extended Fig. 9)\u003c/strong\u003e. In none of the other DE miRNAs a potential IRE1 cleavage site could be found (data not shown). To address whether IRE1 could cleave miR-92a, an \u003cem\u003ein vitro\u003c/em\u003e cleavage assay was set up with human recombinant IRE1 cytosolic endonuclease domain incubated with RNA oligonucleotides encoding \u003cem\u003eXbp1\u003c/em\u003e stemloop, miR-92-a-1 or miR-30b, the latter being one of the most abundantly expressed miRNAs in cDC1s (data not shown). Both the Xbp1 stemloop and miR-92a-1 were cleaved by IRE1, while miR-30b remained unaffected (\u003cstrong\u003eFig. 5f\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eAltogether, these data indicate that in homeostatic conditions IRE1 can cleave miR-92a-1 through a RIDD-dependent mechanism in cDC1s. Loss of miRNAs by removal of Dicer on top of IRE1 deficiency leads to restoration of \u003cem\u003eAbcg1\u003c/em\u003e expression levels and restores the mature homeostatic cDC1 population.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHomeostatic mature cDC1s can be restored by enforcing cholesterol efflux\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWhen analyzing the cholesterol metabolic gene signatures in absence of XBP1/IRE1 signaling, we noted that the upregulation of \u003cem\u003eSoat2,\u003c/em\u003e encoding the cholesterol esterifying enzyme acetyl-CoA acetyltransferase\u003csup\u003e51\u003c/sup\u003e and the induction of \u003cem\u003eTrib3\u003c/em\u003e and \u003cem\u003eDdit3\u003c/em\u003e, potentially reflected signs of lipotoxicity (\u003cstrong\u003eFig. 4a, Extended Data Fig. 2c\u003c/strong\u003e). To test the hypothesis that the loss of homeostatic mature cDC1s in absence of IRE1 was caused by lipotoxicity, we aimed to restore cholesterol levels by injecting reconstituted high-density lipoprotein (rHDL) into IRE1/XBP1 deficient mice. However, it did not manage to reach the limited amounts of cDC1s in the spleen. Therefore, we established an \u003cem\u003ein vitro\u003c/em\u003e system for cDC1s by cultivating bone marrow (BM) cells in presence of FLT3L and on a feeder layer of OP9 fibroblasts expressing the Notch ligand DLL1 (Flt3 Notch cDC1s)\u003csup\u003e52,53\u003c/sup\u003e. This protocol yielded cDC1s with IRE1 activity levels that were comparable to what we noticed in the spleen \u003cstrong\u003e(Fig. 6a)\u003c/strong\u003e. Similar to what we had observed \u003cem\u003ein vivo\u003c/em\u003e, loss of XBP1 leads to a reduction in CD11c expression, due to activation of RIDD, which is restored by concomitant loss of IRE1\u003csup\u003e13\u003c/sup\u003e (\u003cstrong\u003eFig. 6b\u003c/strong\u003e). When analyzing the cDC1s by microscopy, we observed the same aberrant ER structures, as we described before in sorted XBP1∆DC and XBP1/IRE1∆DC cDC1s \u003cstrong\u003e(Fig. 6c)\u003c/strong\u003e\u003csup\u003e12\u003c/sup\u003e. Also \u003cem\u003ein vitro\u003c/em\u003e, the absence of XBP1/IRE1 led to a defect in cholesterol efflux gene expression \u003cstrong\u003e(Fig. 6d)\u003c/strong\u003e, which was reflected by an increase in total cholesterol levels\u003cstrong\u003e\u0026nbsp;(Fig. 6e)\u003c/strong\u003e. The effect of XBP1/IRE1 deficiency on cDC1 survival in Flt3 Notch DC cultures becomes prominent from day11 of seeding the BM cells on the OP9 feeder layer onwards, while at day9 the survival of WT versus XBP1/IRE1∆DC cDC1s is still similar \u003cstrong\u003e(Fig. 6f)\u003c/strong\u003e. Treatment of XBP1/IRE1∆DC Flt3 Notch cDC1s on day9 for 2 days with rHDL to enforce cholesterol efflux led to a complete restoration of their survival at day11 \u003cstrong\u003e(Fig. 6f)\u003c/strong\u003e, supporting the hypothesis that homeostatic mature IRE1-deficient cDC1s die due to accumulation of cholesterol in absence of IRE1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLoss of IRE1 in cDC1s leads to hampered cross-priming\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe speculated that the loss of homeostatic mature cDC1s in XBP1/IRE1∆DC mice will impact the cross-priming of dead-cell derived antigens. Previous studies from our lab showed that loss of XBP1, but not loss of IRE1 in DCs, leads to decreased cross-presentation in an \u003cem\u003eex vivo\u003c/em\u003e co-culture assay\u003csup\u003e12\u003c/sup\u003e. At the time, we assumed that this was due to activation of canonical RIDD in XBP1-deficient cDC1s which led to degradation of \u003cem\u003eTapbp\u003c/em\u003e and \u003cem\u003eErgic3\u003c/em\u003e. In XBP1/IRE1∆cDC1s \u003cem\u003eTapbp\u003c/em\u003e and \u003cem\u003eErgic3\u003c/em\u003e mRNA expression was restored, leading to the restoration in cross-presentation\u003csup\u003e12\u003c/sup\u003e. However, in this type of \u003cem\u003eex vivo\u003c/em\u003e co-culture assays, DCs and T cells are brought in close proximity bypassing any potential deficits in processes like cDC1 migration to the T cell area in the dLN. To take this into account, we assessed the presentation of dead-cell derived antigens by XBP1/IRE1∆DC cDC1s \u003cem\u003ein vivo\u003c/em\u003e. We adoptively transferred CTV-labeled CD45.1.2 OT-I cells in CD45.2 acceptor WT and XBP1/IRE1∆DC mice. One day later, we injected apoptotic thymocytes from Act-mOVA mice or wild-type mice as a control. Three days later, we sacrificed the mice and analyzed the proliferation of OT-I cells in the spleen (\u003cstrong\u003eExtended Data\u003c/strong\u003e \u003cstrong\u003eFig. 10a\u003c/strong\u003e). As expected, injection of mice with WT apoptotic thymocytes, not containing any OVA, did not result in proliferation of OT-I cells, and the percentage and number of OT-I cells remained low. Injection of OVA-containing apoptotic thymocytes led to increased percentage, number and CTV-dilution of OT-I cells. XBP1/IRE1∆DC mice showed a reduced percentage and number of OT-I cells after injection with OVA-ACs compared to WT littermates (\u003cstrong\u003eExtended Data\u003c/strong\u003e \u003cstrong\u003eFig. 10b\u003c/strong\u003e). Furthermore, the proliferation index, a measure for CTV-dilution, was lower in the XBP1/IRE1∆DC mice compared to WT littermates (\u003cstrong\u003eExtended Data\u003c/strong\u003e \u003cstrong\u003eFig. 10c\u003c/strong\u003e). These data therefore indicate that \u003cem\u003ein vivo\u003c/em\u003e the loss of mature cDC1s in XBP1/IRE1∆DC does affect their capability to prime naïve antigen-specific T cells.\u003c/p\u003e\n\u003cp\u003eIn summary, our data establish IRE1 as a sensor of cholesterol influx in cDC1s during AC engulfment. IRE1 regulates cholesterol efflux from cDC1s by regulating the stability of the cholesterol efflux transporter \u003cem\u003eAbcg1\u003c/em\u003e through RIDD-mediated miRNA-92a degradation, while LXRß drives \u003cem\u003eAbcg1\u003c/em\u003e expression. In absence of IRE1, cholesterol might accumulate at the ER, potentially explaining the aberrant ER aggregates. This causes lipotoxicity, leading to a loss of cDC1s that have recently engulfed and matured in XBP1/IRE1∆DC mice and results in defective cross-presentation of dead-cell derived antigens \u003cstrong\u003e(Extended\u003c/strong\u003e \u003cstrong\u003eFig. 10d\u003c/strong\u003e). On the contrary, neither pIC-triggered immunogenic cDC1 maturation nor homeostatic cDC2 maturation depend on IRE1 signaling. These data therefore confirm the previously observed link between AC engulfment, cholesterol metabolism and homeostatic cDC1 maturation and establish a central role for IRE1 in this process.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eHere we uncovered an unexpected role for the UPR sensor IRE1 in the homeostatic maturation of cDC1s. We have previously noted that the activity of this endonuclease is high in cDC1s in steady state and appears regulated in a tissue dependent manner\u003csup\u003e12,13\u003c/sup\u003e. By generating mice in which cDC1s are deficient in the engulfment of ACs, we now found that activation of IRE1 in cDC1s is driven by their capacity to engulf ACs. Traditionally, IRE1 activation has been linked to the accumulation of unfolded proteins\u003csup\u003e54\u003c/sup\u003e and a recent study proposed that IRE1 in cDC1s is activated by the import of peptides, resembling unfolded proteins, in the ER through TAP1\u003csup\u003e14\u003c/sup\u003e. However, we found that deletion of TAP1 does not affect the IRE1 activity in splenic cDC1s. Also lipids, such as cholesterol or saturated fatty acids, inducing so-called lipid bilayer stress, can trigger IRE1 both in yeast and in mammals\u003csup\u003e35\u0026ndash;38,41,55\u003c/sup\u003e. The pattern of IRE1 activity in cDC1s closely reflects their cholesterol content and, next to ACs, empty LNPs, consisting only of lipids (amongst others 40% cholesterol), can induce IRE1 activation in cDC1s. How cholesterol reaches the ER remains at present unclear, but recent data suggest an important role for endosomal/ER contact sites\u003csup\u003e56,57\u003c/sup\u003e. Hence, our data indicate that the increased influx of cholesterol during the uptake of ACs or LNPs is sensed at the ER membrane and leads to the activation of IRE1. This explains the subset specific activity of IRE1 in cDC1s, which hold a unique capacity to engulf apoptotic cells in steady state\u003csup\u003e20,25\u0026ndash;34\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThese data put the ER in a central position in sensing AC engulfment, consistent with its established role in monitoring intracellular cholesterol levels\u003csup\u003e51\u003c/sup\u003e. We propose that IRE1 redirects cellular metabolism, which is needed to adapt cellular homeostasis to the large intracellular influx of metabolites and lipids from engulfed cells. Accordingly, we found an increase in cholesterol levels in IRE1 deficient cDC1s, specifically in the mature subset. We noticed earlier that loss of IRE1 and XBP1 leads to an aberrant ER morphology\u003csup\u003e12\u003c/sup\u003e and speculate that accumulation of (free) cholesterol at the ER might contribute to this phenotype. In macrophages, accumulation of cholesterol at the ER has been established as a key factor driving lipotoxicity and cell death\u003csup\u003e38,58\u003c/sup\u003e. Similarly, we noticed that XBP1/IRE1 deficient cDC1s die both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e. Treatment of IRE1-deficient DCs with reconstituted HDL, enforcing cholesterol efflux, rescues cDC1 survival. These data highlight the role for IRE1 in regulating cholesterol metabolism in cDC1s, confirming earlier findings in hepatocytes and macrophages\u003csup\u003e42,59\u0026ndash;63\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThe loss of mature cDC1s and increase in cholesterol levels was particularly prominent in XBP1/IRED cDC1s, which was in line with the fact that most DC specific genes were affected in and IRE1- rather than a XBP1-dependent manner. So far, IRE1-endonuclease dependent RIDD activity has been observed mostly in (artificial) conditions of XBP1 deficiency or in conditions of high dose drug-induced ER stress, which both induce hyperactivation of IRE1\u003csup\u003e4,5,7\u003c/sup\u003e. In XBP1-deficient hepatocytes, IRE1-dependent RIDD leads to degradation of the triglyceride synthesizing enzyme \u003cem\u003eDgat2\u003c/em\u003e, which is fully restored upon concomitant deletion of IRE1\u003csup\u003e42\u003c/sup\u003e. While this process appears conserved in XBP1-deficient DCs\u003csup\u003e12\u003c/sup\u003e \u003csup\u003e(and this study)\u003c/sup\u003e, the role of RIDD in physiological conditions has remained unclear. Along these lines, the pathways that are activated downstream of IRE1 in WT steady state conditions are more relevant. In these conditions, at least in cDC1s, IRE1-dependent endonuclease activity appears to target miRNAs rather than mRNAs. These data are in line with earlier data from the hepatocyte field, where IRE1 has been shown to play a crucial role in preventing hepatic steatosis by controlling the decay of a select group of miRNAs that target PPARa and SIRT1, master regulators of fatty acid oxidation and triglyceride lipolysis\u003csup\u003e63\u003c/sup\u003e. Small RNA-seq in cDC1s revealed that lipid-induced activation of IRE1 in cDC1s leads to the degradation of miR-92a-1 and the stabilization of the cholesterol efflux gene \u003cem\u003eAbcg1\u003c/em\u003e. Previously, our lab found that uptake of apoptotic cells by cDC1s induces activation of LXRb and its target genes \u003cem\u003eAbcg1\u003c/em\u003e and \u003cem\u003eApoe1\u003c/em\u003e. Our new data suggest that IRE1 acts in parallel of LXRb to ensure transcript stability of \u003cem\u003eAbcg1\u003c/em\u003e by degrading miRNAs. Loss of IRE1 leads to an increase in miR-92a-1 and a decrease in \u003cem\u003eAbcg1\u003c/em\u003e expression, which is restored in absence of Dicer, the RNase that produces mature miRNA\u003csup\u003e64\u003c/sup\u003e. In macrophages, it has been shown that triggering of LXR signaling would mitigate IRE1 activation by promoting the incorporation of polyunsaturated fatty acids in membranes, thereby increasing membrane fluidity\u003csup\u003e46,65\u003c/sup\u003e, and hence decreasing activation of the IRE1/XBP1 axis. In cDC1s, the activation of IRE1 appears to occur independently of LXR signaling in response to apoptotic cell engulfment, and both pathways are needed to control cholesterol. Why DCs need this two-step regulation of cholesterol efflux pathways efflux during homeostatic maturation remains speculative at this point.\u003c/p\u003e\n\u003cp\u003eIn summary, we describe an unexpected role for the UPR sensor IRE1 in homeostatic cDC1 maturation. IRE1 is triggered by apoptotic cell engulfment in cDC1s and coordinates downstream metabolic processes, amongst others cholesterol efflux, needed to process apoptotic cargo. IRE1 deficiency leads to a block in homeostatic cDC1 maturation, impeding dead cell derived antigen presentation.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003ch2\u003eAnimal models\u003c/h2\u003e\n\u003cp\u003eXbp1\u003csup\u003efl/fl\u003c/sup\u003e (B6.129s6/SvEvTac-XBP-1\u003csup\u003etm2Glm\u003c/sup\u003e)\u003csup\u003e60\u003c/sup\u003e, Xbp1\u003csup\u003efl/fl\u003c/sup\u003e × Ern1a\u003csup\u003efl/fl\u003c/sup\u003e (also called IRE1\u003csup\u003efl/fl\u003c/sup\u003e)(B6;129S4-Ern1\u003csup\u003etm2.1Tiw\u003c/sup\u003e)\u003csup\u003e66\u003c/sup\u003e, Rac1\u003csup\u003efl/fl\u003c/sup\u003e (Rac1\u003csup\u003etm1Djk\u003c/sup\u003e) (gift from Prof. Brakebusch, University of Copenhagen, Biotech Research \u0026amp; Innovation Centre, Denmark) x Rac2\u003csup\u003e-/-\u003c/sup\u003e (B6.129S6-Rac2\u003csup\u003etm1Mddw\u003c/sup\u003e/J) (gift from Prof. Tybulewicz, The Francis Crick Institute, United Kingdom), Ern1\u003csup\u003efl/fl\u003c/sup\u003e x Dicer\u003csup\u003efl/fl\u003c/sup\u003e (B6.Cg-Dicer\u003csup\u003e1tm1Bdh\u003c/sup\u003e/J) \u0026nbsp;and LXRa\u003csup\u003efl/fl\u003c/sup\u003e x LXRb\u003csup\u003efl/fl\u003c/sup\u003e (gift from Prof. Baron, Université Clermont Auvergne, France) were crossed to \u003cem\u003eItgax\u003c/em\u003e-cre (Tg\u003csup\u003eItgax−cre1-1Reiz\u003c/sup\u003e, CD11c-Cre) to generate DC-specific knock-outs (XBP1∆DC, XBP1/IRE1∆DC, Rac1∆DCRac2\u003csup\u003e-/-\u003c/sup\u003e, Dicer∆DC, IRE1/Dicer∆DC and LXRa/LXRb∆DC mice). Xbp1\u003csup\u003efl/fl\u003c/sup\u003e and Xbp1\u003csup\u003efl/fl\u003c/sup\u003e × Ern1\u003csup\u003efl/fl\u003c/sup\u003e mice were also crossed to \u003cem\u003eXcr1\u003c/em\u003e-Cre (B6.XCR1\u003csup\u003etm3/mtfp CIPHE\u003c/sup\u003e) mice (gift from B. Malissen, CIML, France) to generate cDC1-specific knock-outs. ERAI (B6.TG\u003csup\u003epCAX-F-XBP-1DBD-Venus\u003c/sup\u003e/J)\u003csup\u003e24\u003c/sup\u003e mice were used to measure IRE1 activity. TAP1\u003csup\u003e-/-\u003c/sup\u003e (B6;129S2-Tap1\u003csup\u003etm1Arp\u003c/sup\u003e/J, The Jackson Laboratory, USA), Rac1∆DCRac2\u003csup\u003e-/-\u003c/sup\u003e and LXRaLXRb∆DC mice were crossed with ERAI mice. ActmOVA mice (C57BL/6-Tg\u003csup\u003e(CAG-OVAL)916Jen\u003c/sup\u003e/J) were bought from The Jackson Laboratory (USA). OT-I mice (C57BL/6-Tg\u003csup\u003e(TcraTcrb)1100Mjb\u003c/sup\u003e/Crl) were bought from Charles River (France) and bred to CD45.1 (B6.SJL-Ptprc\u003csup\u003ea\u003c/sup\u003ePepc\u003csup\u003eb\u003c/sup\u003e/BoyJ) mice, offspring were used for experiments (CD45.1.2 OT-I\u003csup\u003eTg/+\u003c/sup\u003e).\u003c/p\u003e\n\u003cp\u003eAll mice were bred at Ghent University (Belgium) in specific pathogen-free conditions. The Ern1\u003csup\u003efl/fl\u003c/sup\u003e allele does not lead to a full deletion of the IRE1 gene, but to a truncated version in which the endonuclease domain is removed\u003csup\u003e67\u003c/sup\u003e. However, the remaining IRE1 fragment is hardly detectable, so it does represent a full knockout \u0026nbsp;allele\u003csup\u003e13\u003c/sup\u003e. XBP1/IRE1∆DC were generated by backcrossing IRE1∆DC mice onto XBP1∆DC mice for more than 15 generations to obtain equal genetic background.\u003c/p\u003e\n\u003cp\u003eLitters with mice of both sexes at 6 to 14 weeks of age were used for experiments, except donor mice for thymocytes were between 3 to 6 weeks of age. \u0026nbsp;All animal experiments were performed in accordance with institutional guidelines for animal care of the VIB site Ghent–Ghent University Faculty of Sciences.\u003c/p\u003e\n\u003ch2\u003eBone-marrow derived Flt3 Notch DCs\u003c/h2\u003e\n\u003cp\u003eBone marrow (BM) was isolated from tibia and femur of XBP1(/IRE1)\u003csup\u003efl/fl\u003c/sup\u003e, XBP1∆DC and XBP1/IRE1∆DC mice. Red blood cells were removed by osmotic lysis. Flt3 Notch DCs were generated as described by Kirkling \u003cem\u003eet al\u003c/em\u003e \u003csup\u003e52\u003c/sup\u003e. \u0026nbsp;In brief, BM cells were differentiated in tissue culture medium (TCM: RPMI-1640 medium (Thermo Fisher Scientific) containing 10% fetal calf serum (FCS, Gibco), 1.1 mg/ml β-Mercaptoethanol (Sigma-Aldrich), 2 mM L-alanyl-L-glutamine dipeptide (Thermo Fisher Scientific) and 56 μg/ml Gentamicin (Thermo Fisher Scientific)) supplemented with 250 ng/ml Flt3L (PSF, VIB Protein Core). Cells were cultured at 1x10\u003csup\u003e6\u003c/sup\u003e cells/ml in 24-well (2ml) or 6-well (8ml) plates at 37°C and 5% CO\u003csub\u003e2\u003c/sub\u003e for 3 days. OP9-DLL1 cells (gift from Prof. Tom Taghon, UGent) were cultured in OP9 culture medium (MEMα medium (Thermo Fisher Scientific) containing 20% FCS (Bodinco), 2 mM L-alanyl-L-glutamine dipeptide (Thermo Fisher Scientific) and 56 μg/ml Gentamicin (Thermo Fisher Scientific)). On day 3 of differentiation, half of the volume (i.e., 1 ml or 4 ml, depending on the plate) of BM cells in TCM was transferred to a single well containing a monolayer of OP9 cells in 1 ml (24-well) or 4 ml (6-well) fresh OP9 medium supplemented with 250 ng/ml Flt3L. On day 8 of differentiation, half of the medium was refreshed. Cultures were harvested on day 9 and day 11. The cells were mechanically dislodged from the plates and further processed for flow cytometry or cell sorting.\u003c/p\u003e\n\u003cp\u003eTo drive cholesterol efflux, rHDL (see further) was added on day 9 at a concentration of 50 µg/ml and cultures were harvested 2 days later. PBS was used as a control.\u003c/p\u003e\n\u003ch2\u003eEngulfment Assay\u003c/h2\u003e\n\u003cp\u003eFor AC engulfment experiments, 50 million thymocytes were resuspended in 10 ml RPMI 1640\u003c/p\u003e\n\u003cp\u003e(Thermo Fisher Scientific; 21875-059) supplemented with 10% fetal calf serum (FCS; Bodinco), containing 10 μM dexamethasone (Sigma-Aldrich; D2915), and incubated at 37 °C in a humified atmosphere with 5% CO\u003csub\u003e2\u003c/sub\u003e for 3.5h. Next, to allow tracking of the ACs, the cells were labeled with Cell Proliferation Dye eFluor450 (CTV; Thermo Fisher Scientific; 65-0842-90) according to manufacturer’s protocol. 30-50 million ACs were i.v. injected. At different time points (30min, 2h, 6h and 12h) post-injection, the mice were sacrificed and uptake of CTV-labeled ACs in the spleen was assessed by flow cytometry.\u003c/p\u003e\n\u003cp\u003eTo investigate the uptake of beads, mice were i.v. injected with 100 μl 5x diluted 0.5 μm red fluorescent FluoSpheres (580/605) (Thermo Fisher Scientific, F8812). 2h and 12h post-injection, the mice were sacrificed, and the uptake of beads was assessed by flow cytometry. To investigate the uptake of LNPs, mice were i.v. injected with 100 μl Cy5-labeled empty LNPs (eLNPs) or poly(I:C)-coupled LNPs (pIC-LNPs) (homemade; see below). 2h or 8h after injection, the mice were sacrificed and the uptake of LNPs was assessed by flow cytometry.\u003c/p\u003e\n\u003ch2\u003eLNP formulation\u003c/h2\u003e\n\u003cp\u003eAqueous solutions of pIC(Invivogen, tlrl-picw) were made by adding 750 μl of a pIC stock solution (1 mg/ml) to 9.25ml 5 mM acetate buffer (pH 4) for pIC-LNPs. For eLNPs, aqueous solutions contained 10 ml5 mM acetate buffer (pH 4). Ethanol solutions (5 ml) consisted of an ionizable lipid (ALC-0315; BroadPharm; BP-25498), 1,2-dimyristoyl-rac-glycero-3-methoxypoly (ethylene glycol)(DMG-PEG; PEG length, 2 kDa) (Avanti lipids; 880151P-1g), cholesterol (Sigma-Aldrich;C8667), dioleoylphosphatidylethanolamine (DOPE; Avanti lipids; 850725P-25mg) andDOPE-Cy5 (Avanti lipids; 810335C-1mg) (\u003cstrong\u003eSupplementary Table 6\u003c/strong\u003e for LNP composition). LNPs were fabricated by solvent displacement. Hereto, anethanolic solution containing all lipids was added to an aqueous solution containing pIC (orblank) under vigorous mixing on a vortex mixer. To remove ethanol, the formed LNPsuspensions were dialysed overnight against phosphate buffered saline (PBS) using Slide-ALyzer(r) dialysis cassettes (cut-off 3.5 kDa) (Thermo Fisher Scientific; 66107). Subsequently,the dialysed LNP suspensions were concentrated 10X using Amicon Ultra 10K Centrifugal Filters (Millipore; UFC910024).\u003c/p\u003e\n\u003ch2\u003eTissue Sampling and Processing.\u003c/h2\u003e\n\u003cp\u003eMice were euthanized by cervical dislocation or CO\u003csub\u003e2\u003c/sub\u003e. To analyze DCs by flow cytometry, spleens were minced and digested in RPMI 1640 (Thermo Fisher Scientific; 21875-059) supplemented with recombinant DNase I (10 U/ml; Roche; 04 536 282 001) and Liberase TM (0.02 mg/ml; Roche; 05 401 127 001) at 37°C for 30min. To isolate OT-I cells and analyze T cells by flow cytometry, spleens and mesenteric lymph nodes were smashed on a 70 µm filter (Falcon) to obtain single cell suspensions.\u003c/p\u003e\n\u003cp\u003eTo dissect the thymus from mice, the mice were euthanized by CO\u003csub\u003e2\u003c/sub\u003e. Thymocytes were obtained by smashing the tissue on a 70 μm filter (Falcon).\u003c/p\u003e\n\u003cp\u003eIn all cases, red blood cells were removed by osmotic lysis. The live cells were counted prior to antibody staining, by staining a sample with DAPI (Thermo Fisher Scientific; D3571) or acridine orange/propidium iodide (Logos Biosystems; LB F23001) and counting with the BD FACSVerse (BD Bioscience) or LUNA-FX7 (Logos Biosystems), respectively.\u003c/p\u003e\n\u003ch2\u003eFlow Cytometry and Cell Sorting\u003c/h2\u003e\n\u003cp\u003e4 million live cells were stained with fluorescent, and biotin labeled antibodies for staining of surface and intracellular markers. A first staining mixture consisted of Fc block (Polpharma Biologics) to avoid nonspecific binding, CD64-BV711 (X54-5/7.1; BioLegend; 139311) and CCR7-biotin (4B12; BioLegend; 13-1971-85) and was incubated at 4°C for 45min. A second staining step contained all other antibodies against surface markers and was performed at 4°C for 30min. Viable cells were discriminated by Fixable Viability Dye eFluor 506 (Thermo Fisher Scientific; 65-0866-18) or eFluor 780 (Thermo Fisher Scientific; 65-0865-14). Biotinylated antibodies were conjugated to PE-CF594 or AF647 Streptavidin (BD Bioscience; 562284 and Thermo Fisher Scientific; S32357, respectively). In some experiments, cells were stained with BODIPY 493/503 (500 ng/ml; Thermo Fisher Scientific; D3922). The BODIPY 493/503 MFI was corrected by subtracting background fluorescence and normalized on the MFI of B cells, to minimize technical variance caused by the separate staining of different samples. Acquisition and analysis of labeled cell suspensions was performed with BD LSR Fortessa FACSymphony A5 and A3 (BD Biosciences) cytometer equipped with FACSDiva software (BD Bioscience; v8.0.2). Single stained UltraComp eBeads (Thermo Fisher Scientific; 01-2222-42) and cells were prepared to adjust photomultiplier tube voltages to make sure the signal was within detection limits, to reduce fluorescence spill-over and to calculate the compensation matrix. A list of antibodies is provided in \u003cstrong\u003eSupplementary\u003c/strong\u003e \u003cstrong\u003eTable 7\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eCell sorting was performed on FACS ARIAII, ARIAIII and FACSymphony S6 sorter (BD Biosciences). To sort different cDC1 maturation subsets, the total single-cell suspension was enriched prior to staining and cell sorting by depletion of CD3e\u003csup\u003e+\u003c/sup\u003e, CD19\u003csup\u003e+\u003c/sup\u003e, Ly6G\u003csup\u003e+\u003c/sup\u003e, NK1.1\u003csup\u003e+\u003c/sup\u003e, TER119\u003csup\u003e+\u003c/sup\u003e and CD64\u003csup\u003e+\u003c/sup\u003e cells using biotin-labeled monoclonal antibodies and MagniSort Streptavidin Negative Selection Beads (Thermo Fisher Scientific; MSNB-6002-74). Flt3/Notch DCs were sorted without prior enrichment.\u003c/p\u003e\n\u003cp\u003eFlow cytometry data was preprocessed by the PeacoQC algorithm\u003csup\u003e68\u003c/sup\u003e (code available at https://github.com/saeyslab/PeacoQC). Flow data was analyzed with FlowJo10 software (FlowJo, BD).\u003c/p\u003e\n\u003ch2\u003eMicroscopy\u003c/h2\u003e\n\u003cp\u003eFlt3 Notch XBP1(/IRE1)\u003csup\u003efl/fl\u003c/sup\u003e, XBP1∆DC and XBP1/IRE1∆DC were FACS purified and adhered to a fibronectin (Merck, F1141-1mg)-coated ibidi chamber for 2h. The cells were fixed in 4% PFA, permeabilized with 0.5% Triton X-100 (Merck, 10789704001) and blocked with 1% BSA and normal donkey serum. The cells were stained with primary mouse IgG2a anti-KDEL (Enzo Life Sciences, ADI-SPA-827-D, 1/500) overnight. After extensive washing, the cells were stained with secondary donkey anti-mouse IgG (Invivogen, A21202) conjugated to AF488. After extensive washing, the nucleus of the cells was stained with DAPI (Invitrogen, D3571). The cells were visualized on a Zeiss LSM880 FastAiryScan microscope.\u003c/p\u003e\n\u003ch2\u003eCross-priming assay\u003c/h2\u003e\n\u003cp\u003eOT-I cells were isolated from the spleen and mesenteric LNs of CD45.1.2 OT-I mice and CTV-labeled according to manufacturer’s protocol (Thermo Fisher Scientific; 65-0842-90). Then the cells were FACS-purified on live cells, CD11c\u003csup\u003e-\u003c/sup\u003e, MHCII\u003csup\u003e-\u003c/sup\u003e, CD19\u003csup\u003e-\u003c/sup\u003e, CD4\u003csup\u003e-\u003c/sup\u003e, CD8a\u003csup\u003e+\u003c/sup\u003e and CD62L\u003csup\u003e+\u003c/sup\u003e. Three million cells were adoptively transferred in acceptor mice by i.v. injection. One day later, the acceptor mice were injected with either 20 million apoptotic thymocytes derived from ActmOVA mice or from wild-type mice as negative control. Three days later, the acceptor mice were sacrificed and the spleen was analyzed by flow cytometry.\u003c/p\u003e\n\u003ch2\u003eCholesterol Quantification Assay\u003c/h2\u003e\n\u003cp\u003eDistinct DC maturation subsets were sorted in FCS-containing buffer. After sorting, the DCs were washed with PBS and frozen as dry cell pellet at -150°C. Lipid isolation and Cholesterol quantification was performed with the Cholesterol/Cholesteryl Ester Quantitation Kit (Abnova; KA0829) according to manufacturer’s instructions, except that the standard was diluted to range from 12.5 ng/well to 200 ng/well. The extract from at least 30,000 cells was used for the analysis. Total cholesterol (free and esterified) was measured. Fluorescence was measured with the FLUOstar omega (BMG Labtech).\u003c/p\u003e\n\u003ch2\u003eIn vitro miRNA degradation assay\u003c/h2\u003e\n\u003cp\u003eTo assay degradation of miRNAs, 50 nM recombinant human IRE1 kinase/RNAse domain (468-977, SignalChem) was incubated with 1000 nM XBP1 stem loop (CUGAGUCCGCAGCACUCAG, IDT), hsa-miR-92a-1 (CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGUAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG, IDT Ultramer) or hsa-miR-30b (ACCAAGUUUCAGUUCAUGUAAACAUCCUACACUCAGCUGUAAUACAUGGAUUGGCUGGGAGGUGGAUGUUUACUUCAGCUGACUU-GGA, IDT Ultramer) for indicated times at 37°C in reaction buffer (20mM HEPES pH7, 50mM NaCl, 1mM DTT, 2mM ATP).\u003c/p\u003e\n\u003cp\u003eAfter incubation, samples were boiled after adding an equal volume 2x RNA Loading Dye (NEB) and fragments were separated on 15% TBE-Urea Gels (Novex™, ThermoFisher). Fragments were visualized by incubating gels in SybrGold (Invitrogen) and images were acquired using GelDoc XR+ (Bio-Rad).\u003c/p\u003e\n\u003ch2\u003ePreparation of reconstituted HDL\u003c/h2\u003e\n\u003cp\u003e\u003cem\u003eIsolation of human ApoA-I\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eHuman ApoA-I was isolated from human plasma and purified by fast protein liquid chromatography (FPLC). Total HDL was isolated by sequential ultracentrifugation. The first ultracentrifugation step in Beckman 70 Ti rotor at 45,000 rpm for 24 hours at 15°C at a density of 1.063 g/ml allowed to remove all apo B-containing lipoproteins. Then total HDL was recovered after the second ultracentrifugation step at a density of 1.21 g/ml under the same conditions. Total HDL were extensively dialyzed against ammonium buffer (5 mM, pH 7.4) and lyophilized, resuspended, and delipidated completely with methanol/ether (1:4) at -20°C. Precipitated proteins were dried under speed vacuum and ApoA-I was purified by ion-exchange chromatography. After protein solubilization in buffer A (20 mM Tris/6 M urea, pH 8.5) at a concentration \u0026gt; 12mg/ml, ApoA-I was loaded on XK26-40 chromatography column and separated at a flow rate of 3 ml/min in Tris-urea buffer by biologic DuoFlow systems (BioRad, France). The purity of individual ApoA-I-containing fractions detected at 280 nm was assessed on 20% denaturing acrylamide gel revealed with Coomassie blue. Pure fractions were pooled and dialyzed against ammonium buffer (20 mM, pH 7.4) and lyophilized.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePreparation of reconstituted HDL\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eReconstituted HDL (rHDL) particles were prepared by sodium cholate dialysis as previously described\u003csup\u003e69\u003c/sup\u003e. Briefly, human ApoA-I was mixed with L-α phosphatidylcholine (Soy-PC) without or with either L-α phosphatidylethanolamine (Soy-PE; Avanti Polar Lipids, AL, USA), PE at a molar ratio of 1:90 (ApoA-I: Soy-PC). The required amounts of phospholipids in chloroform were mixed and dried under nitrogen gas. To form micelles, sodium cholate (30 mg/ml) was added to the dried lipids at a molar ratio of 1:1 (sodium cholate: phospholipid) in Tris-buffered saline (TBS, pH 7.4) and vortexed every 15 minutes at 4C° until the solution became clear. Then ApoA-I was added to the mixture and incubated for 2h at 4°C. Finally, rHDL particles were dialyzed against TBS for 5 days and against PBS for 3 days and stored at -80°C. All the rHDL concentrations were based on their ApoA-I content, which was measured using Indiko™ Plus clinical chemistry analyzer (Thermo Scientific, US) according to the manufacturer’s instructions. Quality control of rHDL and ApoA-I was performed using non-denaturing TBE 4–20% gradient polyacrylamide gel electrophoresis and staining with Coomassie Brilliant Blue\u003csup\u003e70\u003c/sup\u003e.\u003c/p\u003e\n\u003ch2\u003emRNA Isolation and RT-qPCR\u003c/h2\u003e\n\u003cp\u003eTotal or CCR7\u003csup\u003e-\u003c/sup\u003e and CCR7\u003csup\u003e+\u003c/sup\u003e cDC1s and cDC2s (5,000 – 50,000 cells) were sorted directly into RLT Plus buffer (Qiagen; 74034) supplemented with ß-mercaptoethanol (1/100) and stored at -80 °C until further processing. RNA was obtained using the RNeasy Plus Micro Kit (Qiagen; 74034) according to manufacturer’s protocol.\u003c/p\u003e\n\u003cp\u003eFor RT-qPCR, complementary DNA was amplified using the Ovation PicoSL WTA System V2 kit (NuGEN; 2210-24), according to manufacturer’s protocol. Pollutants were removed using the MinElute PCR purification kit (Qiagen; 28204), according to manufacturer’s protocol, prior to SYBR Green-based (Bioline; BIO-98020) RT-qPCR (Lightcycler 480, Roche). mRNA expression was analyzed using qbase+ software version 3.2 (Biogazelle). GeNorm was used to select stable housekeeping genes. A list of primer sequences is provided in \u003cstrong\u003eSupplementary\u003c/strong\u003e \u003cstrong\u003eTable 8\u003c/strong\u003e.\u003c/p\u003e\n\u003ch2\u003emiRNA isolation and RT-qPCR\u003c/h2\u003e\n\u003cp\u003eTotal or CCR7\u003csup\u003e-\u003c/sup\u003e and CCR7\u003csup\u003e+\u003c/sup\u003e cDC1s and cDC2s (5,000 – 50,000 cells) were sorted directly into Qiazol buffer (Qiagen; 217084) and stored at -80 °C until further processing. miRNA was obtained using the miRNeasy Micro Kit (Qiagen; 217084) according to manufacturer’s protocol.\u003c/p\u003e\n\u003cp\u003eFor RT-qPCR of miRNA, cDNA was generated using the miRCURY LNA RT Kit (Qiagen; 339340), according to manufacturer’s protocol. RT-qPCR reactions were performed using the miRCURY LNA SYBR Green PCR Kit (Qiagen, 339346) and miRCURY LNA miRNA primers (Qiagen) were used. RT-qPCR reactions were performed on a LightCycler 480 (Roche). miRNA expression was analyzed using qbase+ software version 3.2 (Biogazelle). A list of primers is provided in \u003cstrong\u003eSupplementary Table 9.\u003c/strong\u003e\u003c/p\u003e\n\u003ch2\u003eQuantification and statistical analysis\u003c/h2\u003e\n\u003cp\u003eStatistical analyses and data representations were performed using Prism (GraphPad, La Jolla, CA). Data are presented as mean ± standard error of the mean (SEM) as specified in the legend of the figures. In all experiments, distinct samples were measured. However, the expression of different RNAs by RT-qPCR was measured on the same samples. The data distribution and variance characteristics were considered for statistical testing. In case of comparing more than two populations, ordinary one-way (one independent variable) or two-way (two independent variables) ANOVA with correction for multiple testing was used for the statistical analysis. The exact statistical test is mentioned in the legend of the figures. Statistical significance was defined as p \u0026lt; 0.05. Asterisks in graph represent the p-value unless mentioned otherwise. Number of biological replicates is indicated as dots in the figure or as ‘n’ in the legend. The researcher was not blinded.\u003c/p\u003e\n\u003cp\u003eDifferential expression in the bulk RNA-seq and small RNA-seq was analyzed by edgeR v3.28.0, using an adjusted p-value set at 0.05 and logFC at 1 to determine significant DE genes and miRNAs. A separate DE analysis was also performed with less strict cut-offs to determine a broader list of affected miRNAs (adjusted p-value \u0026lt; 0.15 and absolute logFC \u0026gt; 0.5).\u003c/p\u003e\n\u003cp\u003eDifferential expression analysis to determine the cluster markers in the CITE-seq analysis was performed using the Wilcoxon Rank Sum test through the Seurat functions FindAllMarkers and FindMarkers. P-value adjustment was accomplished with Bonferroni correction. RNA and ADT markers for the annotated clusters were determined with these cutoffs: min.pct = 0.10, logfc.threshold = 0.25 and return.thresh (adj. P-value) = 0.01. Only positive markers were evaluated. An extra \"score\" column was calculated to rank the importance of the genes as markers. It was calculated with this function: \"pct.1/(pct.2+0.01)*avg_logFC\". The markers are ordered according to this score. Differential State analysis to determine the differential markers for each cDC1 subpopulation between DKO and WT was performed using DESeq2 within muscat. P-value adjustment was performed using Benjamini-Hochberg correction at a local level (per cluster). Significant differentially expressed (DE) genes were determined by using these cut-offs: p_adj.loc \u0026lt; 0.05 and |logFC| \u0026gt; 0.4.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll raw sequencing data enclosed in this publication has been deposited in NCBI\u0026rsquo;s Gene Expression Omnibus\u003csup\u003e71\u003c/sup\u003e and is accessible through GEO Series accession number GSE270655 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE270655). All single-cell datasets provided in this manuscript can be accessed via our online tool: https://www.single-cell.be/Spleen_cDC1_Homeostatic_Maturation_in_Ire1_Xbp1_DKO.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCode availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe code used for analyzing the various sequencing data is deposited in a GitHub repository at https://github.com/JanssensLab/Spleen_cDC1_Homeostatic_Maturation_in_Ire1_Xbp1_DKO. An archive of the GitHub repository can be downloaded from Zenodo: https://doi.org/10.5281/zenodo.11263498.\u003c/p\u003e\n\u003cp\u003eAcknowledgements\u003c/p\u003e\n\u003cp\u003eWe thank the VIB Flow Core, VIB Single Cell core, VIB BioImaging core, VIB Nucleomics Core, IRC cell core facility and VIB Transgenic Core facilities for help with the experiments. We would like to thank all the people from IRC Animal House Facility. We also thank VIB TechWatch, the VIB Single Cell Accelerator program, and M. Guilliams and C. Scott for help in establishing the CITE-seq protocols. We thank Bruno De Geest and Alexander Lamoot (Faculty of Pharmaceutical Sciences, UGent) for their advice on LNP production.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eV.B., S.J.T., B.N.L., and S.J. contributed to conceptualization of the study. V.B., S.M., E.C., L.V.H., S.J.T., S.R., S.A., J.M., E.V.D.V., F.F., K.D. and P.M. conducted experiments. V.B., S.M., and C.D.N. were involved in visualizing the data. V.B., C.D.N. and S.J. wrote the manuscript. V.B., S.M., E.C., C.D.N., L.M., J.V.D., G.V.I., W.S., Y.S. and P.M. provided software and analyzed the data. L.B., I.G.B. and W.L.G. provided key reagents. I.G.B. and W.L.G. provided essential advice for setting up all cholesterol related experiments. J.V.D. and G.V.I. were involved in instrument validation. S.J. supervised the project and provided funding for the project.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by an ERC Consolidator Grant (DCRIDDLE-819314), FWO Program Grants (G063018 and G050622N), FWO EOS (G0G7318N), GOA (LNP-DECODE-U1G01524) and FWO PhD Grant (1134321N, V.B., 11L5522N, S.M.).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe authors declare no competing interests.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary Information is available for this paper.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorrespondence and requests for materials should be addressed to Sophie Janssens.\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eGrootjans, J., Kaser, A., Kaufman, R. J. \u0026amp; Blumberg, R. S. The unfolded protein response in immunity and inflammation. \u003cem\u003eNat. Rev. Immunol.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 469\u0026ndash;484 (2016).\u003c/li\u003e\n \u003cli\u003eJanssens, S., Pulendran, B. \u0026amp; Lambrecht, B. N. Emerging functions of the unfolded protein response in immunity. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 910\u0026ndash;919 (2014).\u003c/li\u003e\n \u003cli\u003eAlmanza, A. \u003cem\u003eet al.\u003c/em\u003e Endoplasmic reticulum stress signalling - from basic mechanisms to clinical applications. \u003cem\u003eFEBS J.\u003c/em\u003e \u003cstrong\u003e286\u003c/strong\u003e, 241\u0026ndash;278 (2019).\u003c/li\u003e\n \u003cli\u003eHollien, J. \u0026amp; Weissman, J. S. Decay of endoplasmic reticulum-localized mRNAs during the unfolded protein response. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e313\u003c/strong\u003e, 104\u0026ndash;107 (2006).\u003c/li\u003e\n \u003cli\u003eHollien, J. \u003cem\u003eet al.\u003c/em\u003e Regulated Ire1-dependent decay of messenger RNAs in mammalian cells. \u003cem\u003eJ. Cell Biol.\u003c/em\u003e \u003cstrong\u003e186\u003c/strong\u003e, 323\u0026ndash;331 (2009).\u003c/li\u003e\n \u003cli\u003eOttens, F., Efstathiou, S. \u0026amp; Hoppe, T. Cutting through the stress: RNA decay pathways at the endoplasmic reticulum. \u003cem\u003eTrends Cell Biol.\u003c/em\u003e S0962892423002362 (2023) doi:10.1016/j.tcb.2023.11.003.\u003c/li\u003e\n \u003cli\u003eMaurel, M., Chevet, E., Tavernier, J. \u0026amp; Gerlo, S. Getting RIDD of RNA: IRE1 in cell fate regulation. \u003cem\u003eTrends Biochem. Sci.\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e, 245\u0026ndash;254 (2014).\u003c/li\u003e\n \u003cli\u003eCloots, E. \u003cem\u003eet al.\u003c/em\u003e Activation of goblet-cell stress sensor IRE1\u0026beta; is controlled by the mucin chaperone AGR2. \u003cem\u003eEMBO J.\u003c/em\u003e \u003cstrong\u003e43\u003c/strong\u003e, 695\u0026ndash;718 (2024).\u003c/li\u003e\n \u003cli\u003eIwakoshi, N. N. \u003cem\u003eet al.\u003c/em\u003e Plasma cell differentiation and the unfolded protein response intersect at the transcription factor XBP-1. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 321\u0026ndash;329 (2003).\u003c/li\u003e\n \u003cli\u003eVetters, J. \u003cem\u003eet al.\u003c/em\u003e Canonical IRE1 function needed to sustain vigorous natural killer cell proliferation during viral infection. \u003cem\u003eiScience\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e, 108570 (2023).\u003c/li\u003e\n \u003cli\u003eIwakoshi, N. N., Pypaert, M. \u0026amp; Glimcher, L. H. The transcription factor XBP-1 is essential for the development and survival of dendritic cells. \u003cem\u003eJ. Exp. Med.\u003c/em\u003e \u003cstrong\u003e204\u003c/strong\u003e, 2267\u0026ndash;2275 (2007).\u003c/li\u003e\n \u003cli\u003eOsorio, F. \u003cem\u003eet al.\u003c/em\u003e The unfolded-protein-response sensor IRE-1\u0026alpha; regulates the function of CD8\u0026alpha;+ dendritic cells. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 248\u0026ndash;257 (2014).\u003c/li\u003e\n \u003cli\u003eTavernier, S. J. \u003cem\u003eet al.\u003c/em\u003e Regulated IRE1-dependent mRNA decay sets the threshold for dendritic cell survival. \u003cem\u003eNat. Cell Biol.\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 698\u0026ndash;710 (2017).\u003c/li\u003e\n \u003cli\u003eGuttman, O. \u003cem\u003eet al.\u003c/em\u003e Antigen-derived peptides engage the ER stress sensor IRE1\u0026alpha; to curb dendritic cell cross-presentation. \u003cem\u003eJ. Cell Biol.\u003c/em\u003e \u003cstrong\u003e221\u003c/strong\u003e, e202111068 (2022).\u003c/li\u003e\n \u003cli\u003eGarc\u0026iacute;a-Gonz\u0026aacute;lez, P., Fern\u0026aacute;ndez, D., Guti\u0026eacute;rrez, D., Parra-Cordero, M. \u0026amp; Osorio, F. Human cDC1s display constitutive activation of the UPR sensor IRE1. \u003cem\u003eEur. J. Immunol.\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e, 1069\u0026ndash;1076 (2022).\u003c/li\u003e\n \u003cli\u003eCloots, E. \u003cem\u003eet al.\u003c/em\u003e Evolution and function of the epithelial cell-specific ER stress sensor IRE1\u0026beta;. \u003cem\u003eMucosal Immunol.\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 1235\u0026ndash;1246 (2021).\u003c/li\u003e\n \u003cli\u003eBright, M. D., Itzhak, D. N., Wardell, C. P., Morgan, G. J. \u0026amp; Davies, F. E. Cleavage of BLOC1S1 mRNA by IRE1 Is Sequence Specific, Temporally Separate from XBP1 Splicing, and Dispensable for Cell Viability under Acute Endoplasmic Reticulum Stress. \u003cem\u003eMol. Cell. Biol.\u003c/em\u003e \u003cstrong\u003e35\u003c/strong\u003e, 2186\u0026ndash;2202 (2015).\u003c/li\u003e\n \u003cli\u003eAcosta-Alvear, D. \u003cem\u003eet al.\u003c/em\u003e XBP1 controls diverse cell type- and condition-specific transcriptional regulatory networks. \u003cem\u003eMol. Cell\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 53\u0026ndash;66 (2007).\u003c/li\u003e\n \u003cli\u003eArdouin, L. \u003cem\u003eet al.\u003c/em\u003e Broad and Largely Concordant Molecular Changes Characterize Tolerogenic and Immunogenic Dendritic Cell Maturation in Thymus and Periphery. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e45\u003c/strong\u003e, 305\u0026ndash;318 (2016).\u003c/li\u003e\n \u003cli\u003eBosteels, V. \u003cem\u003eet al.\u003c/em\u003e LXR signaling controls homeostatic dendritic cell maturation. \u003cem\u003eSci. Immunol.\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, eadd3955 (2023).\u003c/li\u003e\n \u003cli\u003eCabeza-Cabrerizo, M., Cardoso, A., Minutti, C. M., Pereira da Costa, M. \u0026amp; Reis e Sousa, C. Dendritic Cells Revisited. \u003cem\u003eAnnu. Rev. Immunol.\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e, 131\u0026ndash;166 (2021).\u003c/li\u003e\n \u003cli\u003eBelabed, M. \u003cem\u003eet al.\u003c/em\u003e \u003cem\u003eAXL Limits the Mobilization of Cholesterol to Regulate Dendritic Cell Maturation and the Immunogenic Response to Cancer\u003c/em\u003e. http://biorxiv.org/lookup/doi/10.1101/2023.12.25.573303 (2023) doi:10.1101/2023.12.25.573303.\u003c/li\u003e\n \u003cli\u003eMaier, B. \u003cem\u003eet al.\u003c/em\u003e A conserved dendritic-cell regulatory program limits antitumour immunity. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e580\u003c/strong\u003e, 257\u0026ndash;262 (2020).\u003c/li\u003e\n \u003cli\u003eIwawaki, T., Akai, R., Kohno, K. \u0026amp; Miura, M. A transgenic mouse model for monitoring endoplasmic reticulum stress. \u003cem\u003eNat. Med.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 98\u0026ndash;102 (2004).\u003c/li\u003e\n \u003cli\u003eLiu, K. \u003cem\u003eet al.\u003c/em\u003e Immune tolerance after delivery of dying cells to dendritic cells in situ. \u003cem\u003eJ. Exp. Med.\u003c/em\u003e \u003cstrong\u003e196\u003c/strong\u003e, 1091\u0026ndash;1097 (2002).\u003c/li\u003e\n \u003cli\u003eCummings, R. J. \u003cem\u003eet al.\u003c/em\u003e Different tissue phagocytes sample apoptotic cells to direct distinct homeostasis programs. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e539\u003c/strong\u003e, 565\u0026ndash;569 (2016).\u003c/li\u003e\n \u003cli\u003eSilva-Sanchez, A. \u003cem\u003eet al.\u003c/em\u003e Activation of regulatory dendritic cells by Mertk coincides with a temporal wave of apoptosis in neonatal lungs. \u003cem\u003eSci. Immunol.\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, eadc9081 (2023).\u003c/li\u003e\n \u003cli\u003eDesch, A. N. \u003cem\u003eet al.\u003c/em\u003e CD103+ pulmonary dendritic cells preferentially acquire and present apoptotic cell-associated antigen. \u003cem\u003eJ. Exp. Med.\u003c/em\u003e \u003cstrong\u003e208\u003c/strong\u003e, 1789\u0026ndash;1797 (2011).\u003c/li\u003e\n \u003cli\u003eQiu, C.-H. \u003cem\u003eet al.\u003c/em\u003e Novel subset of CD8{alpha}+ dendritic cells localized in the marginal zone is responsible for tolerance to cell-associated antigens. \u003cem\u003eJ. Immunol. Baltim. Md 1950\u003c/em\u003e \u003cstrong\u003e182\u003c/strong\u003e, 4127\u0026ndash;4136 (2009).\u003c/li\u003e\n \u003cli\u003eSubramanian, M. \u003cem\u003eet al.\u003c/em\u003e An AXL/LRP-1/RANBP9 complex mediates DC efferocytosis and antigen cross-presentation in vivo. \u003cem\u003eJ. Clin. Invest.\u003c/em\u003e \u003cstrong\u003e124\u003c/strong\u003e, 1296\u0026ndash;1308 (2014).\u003c/li\u003e\n \u003cli\u003eBedoui, S. \u003cem\u003eet al.\u003c/em\u003e Cross-presentation of viral and self antigens by skin-derived CD103+ dendritic cells. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 488\u0026ndash;495 (2009).\u003c/li\u003e\n \u003cli\u003eHenri, S. \u003cem\u003eet al.\u003c/em\u003e CD207+ CD103+ dermal dendritic cells cross-present keratinocyte-derived antigens irrespective of the presence of Langerhans cells. \u003cem\u003eJ. Exp. Med.\u003c/em\u003e \u003cstrong\u003e207\u003c/strong\u003e, 189\u0026ndash;206 (2010).\u003c/li\u003e\n \u003cli\u003eIyoda, T. \u003cem\u003eet al.\u003c/em\u003e The CD8+ dendritic cell subset selectively endocytoses dying cells in culture and in vivo. \u003cem\u003eJ. Exp. Med.\u003c/em\u003e \u003cstrong\u003e195\u003c/strong\u003e, 1289\u0026ndash;1302 (2002).\u003c/li\u003e\n \u003cli\u003eden Haan, J. M., Lehar, S. M. \u0026amp; Bevan, M. J. CD8(+) but not CD8(-) dendritic cells cross-prime cytotoxic T cells in vivo. \u003cem\u003eJ. Exp. Med.\u003c/em\u003e \u003cstrong\u003e192\u003c/strong\u003e, 1685\u0026ndash;1696 (2000).\u003c/li\u003e\n \u003cli\u003eHalbleib, K. \u003cem\u003eet al.\u003c/em\u003e Activation of the Unfolded Protein Response by Lipid Bilayer Stress. \u003cem\u003eMol. Cell\u003c/em\u003e \u003cstrong\u003e67\u003c/strong\u003e, 673-684.e8 (2017).\u003c/li\u003e\n \u003cli\u003eVolmer, R., van der Ploeg, K. \u0026amp; Ron, D. Membrane lipid saturation activates endoplasmic reticulum unfolded protein response transducers through their transmembrane domains. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e \u003cstrong\u003e110\u003c/strong\u003e, 4628\u0026ndash;4633 (2013).\u003c/li\u003e\n \u003cli\u003eCho, H. \u003cem\u003eet al.\u003c/em\u003e Intrinsic Structural Features of the Human IRE1\u0026alpha; Transmembrane Domain Sense Membrane Lipid Saturation. \u003cem\u003eCell Rep.\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 307-320.e5 (2019).\u003c/li\u003e\n \u003cli\u003eFeng, B. \u003cem\u003eet al.\u003c/em\u003e The endoplasmic reticulum is the site of cholesterol-induced cytotoxicity in macrophages. \u003cem\u003eNat. Cell Biol.\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 781\u0026ndash;792 (2003).\u003c/li\u003e\n \u003cli\u003eVolmer, R. \u0026amp; Ron, D. Lipid-dependent regulation of the unfolded protein response. \u003cem\u003eCurr. Opin. Cell Biol.\u003c/em\u003e \u003cstrong\u003e33\u003c/strong\u003e, 67\u0026ndash;73 (2015).\u003c/li\u003e\n \u003cli\u003eKitai, Y. \u003cem\u003eet al.\u003c/em\u003e Membrane lipid saturation activates IRE1\u0026alpha; without inducing clustering. \u003cem\u003eGenes Cells Devoted Mol. Cell. Mech.\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, 798\u0026ndash;809 (2013).\u003c/li\u003e\n \u003cli\u003ePromlek, T. \u003cem\u003eet al.\u003c/em\u003e Membrane aberrancy and unfolded proteins activate the endoplasmic reticulum stress sensor Ire1 in different ways. \u003cem\u003eMol. Biol. Cell\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 3520\u0026ndash;3532 (2011).\u003c/li\u003e\n \u003cli\u003eSo, J.-S. \u003cem\u003eet al.\u003c/em\u003e Silencing of lipid metabolism genes through IRE1\u0026alpha;-mediated mRNA decay lowers plasma lipids in mice. \u003cem\u003eCell Metab.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 487\u0026ndash;499 (2012).\u003c/li\u003e\n \u003cli\u003eAlmanza, A. \u003cem\u003eet al.\u003c/em\u003e Regulated IRE1\u0026alpha;-dependent decay (RIDD)-mediated reprograming of lipid metabolism in cancer. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 2493 (2022).\u003c/li\u003e\n \u003cli\u003eWang, J.-M. \u003cem\u003eet al.\u003c/em\u003e IRE1\u0026alpha; prevents hepatic steatosis by processing and promoting the degradation of select microRNAs. \u003cem\u003eSci. Signal.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, eaao4617 (2018).\u003c/li\u003e\n \u003cli\u003eTarling, E. J. \u0026amp; Edwards, P. A. ATP binding cassette transporter G1 (ABCG1) is an intracellular sterol transporter. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e \u003cstrong\u003e108\u003c/strong\u003e, 19719\u0026ndash;19724 (2011).\u003c/li\u003e\n \u003cli\u003eRong, X. \u003cem\u003eet al.\u003c/em\u003e LXRs regulate ER stress and inflammation through dynamic modulation of membrane phospholipid composition. \u003cem\u003eCell Metab.\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, 685\u0026ndash;697 (2013).\u003c/li\u003e\n \u003cli\u003eUpton, J.-P. \u003cem\u003eet al.\u003c/em\u003e IRE1\u0026alpha; cleaves select microRNAs during ER stress to derepress translation of proapoptotic Caspase-2. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e338\u003c/strong\u003e, 818\u0026ndash;822 (2012).\u003c/li\u003e\n \u003cli\u003eLerner, A. G. \u003cem\u003eet al.\u003c/em\u003e IRE1\u0026alpha; induces thioredoxin-interacting protein to activate the NLRP3 inflammasome and promote programmed cell death under irremediable ER stress. \u003cem\u003eCell Metab.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 250\u0026ndash;264 (2012).\u003c/li\u003e\n \u003cli\u003eZhang, K. \u003cem\u003eet al.\u003c/em\u003e The UPR Transducer IRE1 Promotes Breast Cancer Malignancy by Degrading Tumor Suppressor microRNAs. \u003cem\u003eiScience\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 101503 (2020).\u003c/li\u003e\n \u003cli\u003eWang, Z. \u003cem\u003eet al.\u003c/em\u003e MiR‑30e and miR‑92a are related to atherosclerosis by targeting ABCA1. \u003cem\u003eMol. Med. Rep.\u003c/em\u003e (2019) doi:10.3892/mmr.2019.9983.\u003c/li\u003e\n \u003cli\u003eLuo, J., Yang, H. \u0026amp; Song, B.-L. Mechanisms and regulation of cholesterol homeostasis. \u003cem\u003eNat. Rev. Mol. Cell Biol.\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 225\u0026ndash;245 (2020).\u003c/li\u003e\n \u003cli\u003eKirkling, M. E. \u003cem\u003eet al.\u003c/em\u003e Notch Signaling Facilitates In Vitro Generation of Cross-Presenting Classical Dendritic Cells. \u003cem\u003eCell Rep.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 3658-3672.e6 (2018).\u003c/li\u003e\n \u003cli\u003eMedel, B. \u003cem\u003eet al.\u003c/em\u003e The Unfolded Protein Response Sensor IRE1 Regulates Activation of In Vitro Differentiated Type 1 Conventional DCs with Viral Stimuli. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 10205 (2023).\u003c/li\u003e\n \u003cli\u003eGardner, B. M., Pincus, D., Gotthardt, K., Gallagher, C. M. \u0026amp; Walter, P. Endoplasmic reticulum stress sensing in the unfolded protein response. \u003cem\u003eCold Spring Harb. Perspect. Biol.\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, a013169 (2013).\u003c/li\u003e\n \u003cli\u003eHo, N. \u003cem\u003eet al.\u003c/em\u003e Stress sensor Ire1 deploys a divergent transcriptional program in response to lipid bilayer stress. \u003cem\u003eJ. Cell Biol.\u003c/em\u003e \u003cstrong\u003e219\u003c/strong\u003e, e201909165 (2020).\u003c/li\u003e\n \u003cli\u003eLuo, J., Jiang, L.-Y., Yang, H. \u0026amp; Song, B.-L. Intracellular Cholesterol Transport by Sterol Transfer Proteins at Membrane Contact Sites. \u003cem\u003eTrends Biochem. Sci.\u003c/em\u003e \u003cstrong\u003e44\u003c/strong\u003e, 273\u0026ndash;292 (2019).\u003c/li\u003e\n \u003cli\u003eH\u0026ouml;glinger, D. \u003cem\u003eet al.\u003c/em\u003e NPC1 regulates ER contacts with endocytic organelles to mediate cholesterol egress. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 4276 (2019).\u003c/li\u003e\n \u003cli\u003eFeng, B. \u003cem\u003eet al.\u003c/em\u003e Niemann-Pick C heterozygosity confers resistance to lesional necrosis and macrophage apoptosis in murine atherosclerosis. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e \u003cstrong\u003e100\u003c/strong\u003e, 10423\u0026ndash;10428 (2003).\u003c/li\u003e\n \u003cli\u003eWang, S. \u003cem\u003eet al.\u003c/em\u003e IRE1\u0026alpha;-XBP1s induces PDI expression to increase MTP activity for hepatic VLDL assembly and lipid homeostasis. \u003cem\u003eCell Metab.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 473\u0026ndash;486 (2012).\u003c/li\u003e\n \u003cli\u003eLee, A.-H., Scapa, E. F., Cohen, D. E. \u0026amp; Glimcher, L. H. Regulation of hepatic lipogenesis by the transcription factor XBP1. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e320\u003c/strong\u003e, 1492\u0026ndash;1496 (2008).\u003c/li\u003e\n \u003cli\u003eHamid, S. M. \u003cem\u003eet al.\u003c/em\u003e Inositol-requiring enzyme-1 regulates phosphoinositide signaling lipids and macrophage growth. \u003cem\u003eEMBO Rep.\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, e51462 (2020).\u003c/li\u003e\n \u003cli\u003eYildirim, Z. \u003cem\u003eet al.\u003c/em\u003e Intercepting IRE1 kinase-FMRP signaling prevents atherosclerosis progression. \u003cem\u003eEMBO Mol. Med.\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, e15344 (2022).\u003c/li\u003e\n \u003cli\u003eWang, J.-M. \u003cem\u003eet al.\u003c/em\u003e IRE1\u0026alpha; prevents hepatic steatosis by processing and promoting the degradation of select microRNAs. \u003cem\u003eSci. Signal.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, eaao4617 (2018).\u003c/li\u003e\n \u003cli\u003eHa, M. \u0026amp; Kim, V. N. Regulation of microRNA biogenesis. \u003cem\u003eNat. Rev. Mol. Cell Biol.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 509\u0026ndash;524 (2014).\u003c/li\u003e\n \u003cli\u003eDi Conza, G. \u003cem\u003eet al.\u003c/em\u003e Tumor-induced reshuffling of lipid composition on the endoplasmic reticulum membrane sustains macrophage survival and pro-tumorigenic activity. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 1403\u0026ndash;1415 (2021).\u003c/li\u003e\n \u003cli\u003eIwawaki, T., Akai, R., Yamanaka, S. \u0026amp; Kohno, K. Function of IRE1 alpha in the placenta is essential for placental development and embryonic viability. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e \u003cstrong\u003e106\u003c/strong\u003e, 16657\u0026ndash;16662 (2009).\u003c/li\u003e\n \u003cli\u003eIwawaki, T., Akai, R., Yamanaka, S. \u0026amp; Kohno, K. Function of IRE1 alpha in the placenta is essential for placental development and embryonic viability. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e \u003cstrong\u003e106\u003c/strong\u003e, 16657\u0026ndash;16662 (2009).\u003c/li\u003e\n \u003cli\u003eEmmaneel, A. \u003cem\u003eet al.\u003c/em\u003e PeacoQC: Peak-based selection of high quality cytometry data. \u003cem\u003eCytom. Part J. Int. Soc. Anal. Cytol.\u003c/em\u003e \u003cstrong\u003e101\u003c/strong\u003e, 325\u0026ndash;338 (2022).\u003c/li\u003e\n \u003cli\u003eRye, K.-A. Interaction of apolipoprotein A-II with recombinant HDL containing egg phosphatidylcholine, unesterified cholesterol and apolipoprotein A-I. \u003cem\u003eBiochim. Biophys. Acta BBA - Lipids Lipid Metab.\u003c/em\u003e \u003cstrong\u003e1042\u003c/strong\u003e, 227\u0026ndash;236 (1990).\u003c/li\u003e\n \u003cli\u003eTanaka, N. \u003cem\u003eet al.\u003c/em\u003e Eicosapentaenoic Acid-Enriched High-Density Lipoproteins Exhibit Anti-Atherogenic Properties. \u003cem\u003eCirc. J.\u003c/em\u003e \u003cstrong\u003e82\u003c/strong\u003e, 596\u0026ndash;601 (2018).\u003c/li\u003e\n \u003cli\u003eEdgar, R., Domrachev, M. \u0026amp; Lash, A. E. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 207\u0026ndash;210 (2002).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4763670/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4763670/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe continuous engulfment of apoptotic cells initiates a homeostatic maturation program in conventional type I dendritic cells (cDC1s), hallmarked by the activation of the transcription factor LXRb, which mediates cholesterol efflux and dampens interferon stimulated gene expression. cDC1s are characterized by a high basal activation of the unfolded protein response (UPR) sensor IRE1, without concomitant induction of a proper UPR gene signature, a finding that has puzzled the field. Here we show that in absence of IRE1, the homeostatic maturation of cDC1s is blocked, while homeostatic maturation of cDC2s remains unaffected. IRE1 activation is strictly dependent on apoptotic cell engulfment and cholesterol influx, explaining its cDC1 subset specific activity. Stimulation of IRE1 endonuclease activity in cDC1s leads to a Regulated IRE1 Dependent Decay (RIDD) response, targeting miRNAs rather than mRNAs. This causes the degradation of miRNA-92a, which targets the cholesterol efflux transporter \u003cem\u003eAbcg1\u003c/em\u003e. Loss of IRE1 leads to defects in cholesterol efflux in mature cDC1s and concomitant cell death, while cDC2s do not show any defects. Blocking miRNA synthesis or enforcing cholesterol efflux by treatment with reconstituted high-density lipoproteins rescues cDC1s from cell death. These data highlight the central role of IRE1 as a sensor of cholesterol influx in the ER, extending IRE1’s function beyond its canonical role in protein folding. Furthermore, they underscore the tight control of cholesterol metabolism during cDC1 maturation, uncovering a second pathway to coordinate cholesterol efflux that acts in parallel to LXRb.\u003c/p\u003e","manuscriptTitle":"The unfolded protein sensor IRE1a is essential for homeostatic dendritic cell maturation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-06 11:19:11","doi":"10.21203/rs.3.rs-4763670/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"nature-communications","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"NCOMMS","sideBox":"Learn more about [Nature Communications](http://www.nature.com/ncomms/)","snPcode":"","submissionUrl":"https://mts-ncomms.nature.com/","title":"Nature Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature Communications","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"f767fbe9-43a8-4804-8d94-de9af9dc08b0","owner":[],"postedDate":"August 6th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":35016633,"name":"Biological sciences/Immunology/Innate immune cells/Dendritic cells/Conventional dendritic cells"},{"id":35016634,"name":"Biological sciences/Cell biology/Protein folding/Endoplasmic reticulum"}],"tags":[],"updatedAt":"2026-01-21T23:20:25+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-06 11:19:11","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4763670","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4763670","identity":"rs-4763670","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}