Semaglutide reduces cardiomyocyte damage caused by high-fat through HSDL2

preprint OA: closed
Full text JSON View at publisher
Full text 115,695 characters · extracted from preprint-html · click to expand
Semaglutide reduces cardiomyocyte damage caused by high-fat through HSDL2 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Semaglutide reduces cardiomyocyte damage caused by high-fat through HSDL2 Lin Yang, Xiaoyu Pan, Zhenyu Pan, Haina Gao, Jiangli Ban, Shuchun Chen This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5269858/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background The expression of inflammation and oxidative stress caused by obesity is high, which has a certain degree of damage to myocardial cells. is a glucagon-like peptide-1 receptor agonist, which has a hypoglycemic and weight loss effect. Similarly, hydroxysteroid dehydrogenase-like protein 2 (HSDL2) can also regulate lipid metabolism. However, it is not clear whether smegroupide reduces obesity-related cardiomyocyte damage through HSDL2. In this study, the oxidative stress index of the serum of mouse cardiomyocytes and obese mice in a high-fat environment and the expression of HSDL2 were detected to reveal the mechanism of obesity-induced cardiomyocyte injury and the effect of semaglutide in reducing cardiomyocyte injury regulated by HSDL2. Methods In this study, animal models of mice in the obesity group and the micetigrupide intervention group, the cardiomyocyte model of palmitic acid cultured mice in ordinary and knockout HSDL2, and the cell model of the miceglupeptide intervention were established. The levels of inflammatory and oxidative stress indicators such as tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), reactive oxygen (ROS) and malondialdehyde (MDA) in mouse serum and mouse cardiomyocytes were also detected. Then, the expression of HSDL2 of normal mouse cardiomyocytes cultured with high fat culture and mouse cardiomyocytes that knocked HSDL2, as well as the oxidative stress and autophagy levels of cells, were measured, and the effect of semaglutide regulation by HSDL2 on cardiomyocyte damage caused by high fat was evaluated. Conclusion Obesity increased the oxidative stress level of mouse cardiomyocytes and mouse serum, while semaglutide can reduce the increased oxidative stress level caused by obesity. At the same time, semaglutide also significantly reduced the weight of obese mice. The myocardial tissue and myocardial cells of mice in the obese group showed an upward expression of HSDL2, but after the intervention of semaglutide. After knocking out HSDL2, the level of ROS and autophagy of mouse cardiomyocytes decreased significantly. Semaglutide may reduce cardiomyocyte damage caused by high fat by regulating the expression of HSDL2. These findings are expected to reveal the new molecular mechanism of semaglutide to regulate obesity-related cardiomyocyte injury through HSDL2, providing a new target for clinical treatment. Obesity inflammation oxidative stress semaglutide HSDL2 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Obesity is a chronic multifactorial disease in which the accumulation of multiple fats can have a negative impact on human health. With the development of the global economy, the incidence of obesity continues to rise among people around the world, and there is no sign of a significant decline. Obesity is directly involved in the occurrence and development of metabolic diseases, cardiomyopathy, ischemic coronary heart disease, peripheral artery disease, heart failure and arterial hypertension, affecting global morbidity and mortality. Therefore, obesity is a disease syndrome that deserves our continued attention. Obesity causes a variety of hemodynamic changes, which may lead to changes in heart morphology, ventricular function and vascular endotheter cells, leading to various cardiovascular diseases such as heart hypertrophy, heart failure and atherosmosis. 1, 2 Abnormal metabolism in the body caused by obesity plays a key role in cardiovascular disease. Studies have shown that feeding a high-fat diet (HFD) can lead to obesity in mice, accompanied by impaired endothelial-dependent vasostolic function and arterial wall thickness. 3 In addition, lipid metabolism disorders caused by obesity greatly increase the level of oxidative stress, which can damage a variety of target organs, mainly affecting the function of cardiovascular cells and triggering a series of pathological changes. At the same time, the increase in oxidative stress will also increase the product of lipid peroxide, resulting in myocardial cell damage. 4 However, the mechanism of myocardial injury caused by obesity still needs to be further explored. Insulin-like peptide-1 receptor agonist (GLP-1RA) enhances insulin secretion by activating the GLP-1 receptor and reduces blood sugar. Semaglutide is a long-acting glucagon-like peptide-1 receptor agonist and has the effect of reducing sugar and weight loss. In a clinical trial, we observed a significantly lower risk of heart disease in patients with type 2 diabetes treated with smegrin, and a significant improvement in the prognosis of heart disease. However, most studies on GLP-1R agonists focus on the mechanism of atherosclerosis induced by diabetes. There are few studies on the protective effect of early myocardial injury caused by obesity, and the molecular mechanism of drugs and new target effects is lacking. Obesity and diabetes have common pathogenic mechanisms, which can lead to cardiac lesions. Hydroxysteroid dehydrogenase-like protein 2 (HSDL2) is a member of the short-chain dehydrogenase/reductase (SDR) family, 5, 6 expressed in fat, myocardium and other tissues. And it can catalyze the oxidation and reduction of various substrates, such as steroids, sugars, vitamin A and fatty acids. 7 A large number of studies have shown that HSDL2 is a key factor in the regulation of fatty acids in lipid metabolism, and it also participates in cholesterol synthesis. 8–10 Shang et al observed that long-chain non-coding RNA LNMICC can promote lymph node metastasis in cervical cancer by reprogramming fatty acid metabolism, which also proves that HSDL2 is a key factor for fatty acids to regulate lipid metabolism. 11 In recent years, it has been found that abnormal lipid metabolism can accelerate cardiomyopathy. 12 HSDL2 can participate in the synthesis of cholesterol by binding the coenzyme NADPH. The study found that when HSDL2 is overexpressed in the body, the cholesterol synthesis in the cell is significantly accelerated, and the total cholesterol in the body is significantly increased. 9 At the same time, our previous study of cardiovascular protein expression in mice based on proteomics-fat diet showed that Hsd17b4, Hsdl2 and Acadvl are proteins mainly involved in lipid metabolism, and Hsd17b4, Hsdl2 and Acadvl, as co-differentiated expression proteins of the heart and aorta (Co-DEP), may become new targets for the diagnosis and treatment of obese cardiovascular diseases. Therefore, we assume that Hsd17b4 and Hsdl2 are involved in regulating lipid metabolism and oxidative stress, because they are all related to catalase activity, and peroxidase bodies are essential in maintaining cell redox normal state. 13 In addition, HSDL2 expresses disorders in a variety of cancers and is associated with tumor progression. 14, 15 HSDL2 is positioned at the peroxisome, which also affects tumor progression by regulating lipid metabolism. 7, 8 Iron death is a type of iron-dependent cell death characterized by increased lipid peroxidation; this type of cell death is different from necrosis, apoptosis and autophagy. 16 Iron death plays a potential role in nerve formation, cancer and organ dysfunction. 17, 18 Research shows that HSDL2 is related to the occurrence and development of iron death. 19 However, so far, it is not clear whether the abnormality of HSDL2 is related to myocardial damage caused by obesity. In summary, we screened the heart and aortic Co-DEP based on proteomics results. Then carry out functional analysis of the key proteins. 13 Therefore, HSDL2 was selected to further explore the molecular mechanism of the protective effect of Semaglutide on myocardial injury in obese mice and potential new clinical therapeutic targets for obesity-related cardiomyopathy. To further verify this mechanism, we have established a high-fat myocardial cell model to observe changes in myocardial cell damage. Protein immunosprinting technology and polymerase chain reaction technology were used to observe changes in myocardial cell proteins and mRNA in high-fat mice before and after Smegrupide intervention and before and after HSDL2 knockout. The molecular mechanism of Smegrutide's protective effect on myocardial cell damage caused by high fat by regulating HSDL2 was explored. 2. Methods 2.1 Animals and Experimental Design In this study, 24 6-week-old male C57BL/6 mice were obtained from Hebei Shengwu Technology Co., Ltd. The company holds a license (certificate number: SYXK) (June 20150004) for the sale and distribution of experimental animals. These mice were then placed in the Experimental Animal Center of Hebei Provincial People's Hospital, where they were raised under standard laboratory conditions. These conditions include a temperature of 22 ± 2°C, a humidity of 55 ± 10%, a 12-hour light-dark cycle, and free drinking water. These standardized conditions ensure that mice have a suitable environment during the study. After a one-week domestication period, the mice were randomly divided into the normal feed group (NC), the high-fat feed group (HF) and the high-fat feed plus meglutide group (Sema). It should be noted that all experimental procedures are approved by the Animal Ethics Committee of Hebei Provincial General Hospital and carried out in accordance with the Regulations on the Management of Experimental Animals in Hebei Province. The NCD group feeds normal daily food with a fat content of 4%, a protein content of 20% and a carbohydrate content of 20% (D1035, Beijing Huafukang Biotechnology Co., Ltd., China), with a total energy of 34.8 kcal/100 g. The high-fat group feeds high-fat feed with a fat content of 60%, a protein content of 20% and a carbohydrate content of 20% (H10060, Beijing Huafukang Biotechnology Co., Ltd., China), with a total energy of 524 kcal/100 g. The smeglu peptide group followed a similar high-fat diet for 14 weeks, and then injected subcutaneously with a daily dose of 30 nmol/kg/day (Novo Nordisk, Bagsvaerd, Denmark). The maximum dose of smeglupeptide is selected according to previously published mouse studies. After 8 weeks of treatment, glucose tolerance test and weight and serum measurement were carried out. The mouse fasted for 12 hours before euthanasia. After the experiment, 1% sodium pentobarbital (60 mg/kg) was injected into the peritoneal cavity of the mouse. Blood samples were collected from the posterior orbital sinus and placed in a sterile tube containing 1mm ethylenediaminetetraacetic acid (EDTA). Then euthanate the mice. Collect the heart tissue of mice, weigh it, stain it with Sumujing and Yihong or freeze it with liquid nitrogen, and store it at -80°C for further analysis. 2.2 Weight assessment During the whole experiment, the weight of the mice was measured weekly. These measurements can provide valuable data for assessing the physiological and metabolic effects of drug interventions on mice. 2.3 Enzyme linked immunosorbent assay (ELISA) Elabscience Mouse insulin ELISA Kit was used to determine the plasma insulin (INS) level of mice. The kit was made by Wuhan Elarite Biological Department. Produced by Technology Co., Ltd. This kit is specially designed to measure insulin levels in mouse plasma samples. Nanjing Jiancheng's commercial kit is used to detect low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), serum total cholesterol (TC), triglycerides (TG), inflammatory cytokines (IL-1β), tumor necrosis factor α (TNF-α), propylene aldehyde ( MDA) and superoxide dismutase (SOD) levels. All measurements are detected using VERSAmax, a fully automatic ELISA reader made in the United States. Use Graphpad Prism software to analyze the data obtained from the ELISA reader. 2.4 IHC The paraffin slices (thickness of 3µm) of mice with fixed formalin were dewaxed and rehydrated. 3% hydrogen peroxide solution blocks endogenous peroxidase activity. The slide and anti-HSDL2 (1:200) anti-incubation overnight, and then incubate immunoglobulin G (IgG) coupled with horseradish peroxidase (HRP) for 50 minutes at room temperature. The slicing is made of freshly prepared DAB color rendering liquid. The color rendering time is controlled under the microscope, and the positive is brownish yellow. Sugnylin 3min re-infects the nucleus. The slice is placed under a white light microscope (Nikon Instrument Co., Ltd., China) for interpretation of the results. 2.5 cell culture Mouse cardiomyocytes (HL-1) are cultured in DMEM medium (Gibco, USA, 22400089), adding 10% fetal bovine serum (Gibco, USA, 16140071) and 1% double antibiotics (100µg/mL penicillin and 100 U/mL streptomycin). Cells hatch at 37°C in a humidifying incubator with 5% CO2. 2.6 Study subgroups High-fat cell additives (sodium palmitate concentration is 6mmol/L) and complete medium at a ratio of 1:30, and finally palmitic acid (PA) 0.25mmol/L. The cell suspension is inoculated into the 6-hole plate, and the prepared palmitine solution is added after the cell is attached to the wall. It is cultured at 37°C for 24 hours to build a high-fat cardiomyocyte model. In the same way, the prepared smegroupide (concentration of 100nmol/L) will intervene in the high-fat cardiomyocyte model for 24 hours for the following experiments. 2.7 HSDL2 transfection siHSDL2 (HSDL2 knocks low RNA) is processed by GenePharma (Shanghai, China). Try to transfect the cell line with the Lipofectamine 3000 of Genechem (Shanghai, China). HSDL2 small interference RNA (siRNA) (si-HSDL2) and siRNA (siRNA control) were obtained from GenePharma. SiRNA is transfected with Lipofectamine 3000 to HL-1 cells according to the experimental instructions. After transfection, the transfection efficiency is verified by western blotting 24 hours, and the transfection stable cells are used for the next experiment. Transfection sequence, siRNA-HSDL2 forward: GGGAGGACCUGGUAUCGAATT, reverse: UUCGAUACCAGGUCCUCCCTT. The cells were divided into palmitic acid (PA) group, palmitate plus semaglutide group (Sema) group, knockout HSDL2 plus palmitate group (Si-HSDL2) group and normal control (NC) group. 2.8 Western blotting Protein extraction uses cell cracking buffer (Biosharp, China, BL509A) with phase inhibitor (Biosharp, China, BL507A). Protein concentration was measured using bicinchoninic acid protein assay kit (Servicebio, China, G2026). The protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoretic (SDS-PAGE) method and transferred to a polyvinylidene (PVDF) membrane (Immobilon-P, USA). Sealed with 5% skim milk powder. After the closure, use appropriately diluted rabbit-derived HSDL2 (Proteintech, USA), P62 (Servicebio, China), LC3 (Servicebio, China) and Rat-derived Gapdh (ABclonal, USA) to infer overnight at 4℃, and inocate with The film was obtained by exposure of Amersham Imager 600 ultra-sensitive multifunction imager (General Electric, American). 2.9 Quantitative reverse transcription PCR (qRT-PCR) Total RNA is extracted with TRIzol reagent. The isolated RNA is reversed into complementary DNA (cDNA) with SweScript All-in-one RT SuperMix for qPCR (Servicebio, China, G3337). Adopt SuperReal PreMix Plus (SYBR Green) (TIANGEN, China, FP205) in StepOnePlus real-time fluorescent quantitative PCR system (Applied Biosystem, Quantification on USA, Cat#4376600). The results are calculated using the 2-ΔΔCT method. The primers used in qRT-PCR are shown in Table 1 . Table 1 Sequences of primers used for qPCR. Genes Forward (5'→3') Reverse (5'→3') HSDL2 ATTCTCAATCTCAGCCCACC TCCCAGCATATCCATAGCAG β-actin GTGACGTTGACATCCGTAAAGA GTAACAGTCCGCCTAGAAGCAC 2.10 Cell viability detection Cell activity was evaluated by CCCK-8 determination (Biosharp, China, BS350A). Cells are inoculated on 96 orifice plates (1 × 103 cells per hole) and cultured for 24 hours incubators containing 10% fetal bovine serum incubators of 37°C and 5% CO2. After the cell was attached to the wall, the Palmitic Acid (PA) group intervened with 20% PA for 24 hours, the semaglutide group intervened with 20% for 24 hours, and then 200nmmol/L. The cell is then hatched with the CCK-8 solution for 2 hours. The absorption at 450nm is measured by Synergy HT multi-mode microporous plate (BioTek, USA). 2.11 IF In order to detect the expression of HSDL2, cells were inoculated into confocal dishes and cultured for 24 hours at 37°C and 5% CO2 with an RPMI 1640 medium containing 10% bovine serum. After knocking out HSDL2, the Si group intervened with 20% palmitic acid for 24 hours, the PA group with 20% PA intervention for 24 hours, the semaglutide group with 20% intervention for 24 hours, and 200nmmol/L semaglutide intervention for 24 hours. Cells are fixed with 4% polyformaldehyde, transparent, and closed by 1% bovine Serum Protein (BSA). The sample is incubated overnight with an anti-HSDL2 (1:500), and then the fluorescent rabbit-resistant IgG combined with 486 is incubated at room temperature for 1.5 hours. The nucleus was stained with hoechst and imaged under a laser confocal microscope (observer Z1, Zeisss, Germany). 2.12 Enzyme-linked immunosorbent assay The corresponding ELISA kit (Esebio, Shanghai, China) was used to detect interleukin (IL)-6 and tumor necrosis factor (TNF)-α levels in mice. Each group of cell supernatant was added to the pores and reacted with the detected antibody labeled by horseradish peroxidase (HRP), and inocchered at 37℃ for 60 min. Remove the liquid and clean the orifice plate. Add color developer A and color developer B, 37℃ to avoid light and inhale for 10min, and add 50µL of reaction termination solution per hole to determine the absorbance (OD) value of each hole at 450nm. 2.13 Measurement of ROS production Use fluorescent probe dichlorodihydrofluorofluoroin diacetate (DCFH-DA, Zomanbio, China) to detect the ROS level. According to the manufacturer's instructions, add 10µM DCFHDA to each group after processing. Cell incubation for 30min, washing with DMEM 3 times, and laser confocal (BD Biosciences, USA) to detect the fluorescence intensity. 2.14 Assessment of MDA In order to detect the level of propylene aldehyde, the treated cells are mixed and incubated with 300µL of MDA working solution containing thiobarbituric acid (TBA) for 60 minutes, and then centrifuge to remove the supernatant, using Gene5 multifunctional enzyme labeler (Gene, USA) analyze. 2.15 Cell apoptosis assay According to the reagent manufacturer's plan, Annexin V-FITC/propyl iodide (PI) cell apoptosis test kit (Elabscience (China)) is used for apoptosis detection according to the instructions. BD Biosciences (USA) was used to detect apoptosis and analyze at least 10,000 cells in the gated area. The results are expressed as a percentage of the total number of cells. 2.16 Statistical processing The average comparison of the two sets of data is tested by Student's t. Single-factor variance analysis is used to compare the data mean of three or more groups. P < 0.05 is defined as a statistically significant difference between groups. All statistical analysis uses Graphpad 8.0 software for statistical analysis. 3. Results 3.1 Changes in weight in three groups of mice At first, the weight of the three groups of mice was not different. However, after a 14-week high-fat diet, the weight of HF mice increased significantly compared with that in the NC group (Fig. 1 , P < 0.01), indicating that the obesity model was successfully established. After the semaglutide drug intervention of 8W, the weight of the Sema group decreased significantly compared with the HF group (Fig. 1 , P 0.05). It illustrates the weight changes of mice after high-fat diet and smegroupide treatment. Figure 1 describes a line chart of weight changes in three groups of mice. 3.2 Changes in blood sugar and blood lipids in three groups of mice TC, HDL-C, LDL-C, FBG and OGTT of three groups of mice were determined to evaluate the changes in blood lipids and blood sugar and the regulation of glycolipid disorders by smeglupeptide in obese mice. The serum TC, HDL-C, LDL-C and FBG levels of the mice in the HF group were significantly higher than those of the mice in the NC group (Fig. 2 , P < 0.01), and the average blood lipids and FBG water in the Sema group decreased significantly (Fig. 2 , P < 0.01). The OGTT level of the HF group was also significantly higher than that of other groups (Fig. 2 , P 0.05). At the same time, the insulin level of obese mice was higher than that of the smeglutide treatment group and the normal group (Fig. 2 , P < 0.01). Compared with the HF group, the insulin level of the Sema group decreased more significantly than that of the NC group. (Fig. 2 , P < 0.01). 3.3 The effect of smeglupeptide on the level of inflammation and oxidative stress caused by obesity The levels of TNF-α, MDA, IL-1β, T-SOD and adenosine in myocardial tissue of obese mice were significantly higher than those of normal mice (Fig. 3 , P < 0.05), indicating that obesity can aggravate inflammation and oxidative stress of myocardial tissue. After treatment with smeglu peptide, the levels of TNF-α, IL-6, MDA, ROS, IL-1β, T-SOD and adenosine in myocardial tissue decreased, indicating that smeglu peptide can improve the inflammation and oxidative stress levels of myocardial tissue caused by obesity to a certain extent (Fig. 3 , P < 0.05). 3.4 Effect of HSDL2 on myocardial cells in obese mice After transfection of HSDL2-siRNA, the morphology of mouse cardiomyocytes changed, and the transfected cells became wider than the NC group(Fig. 8 ). After transfection HSDL2-siRNA, Wb expression of HSDL2 showed a corresponding trend, HSDL2 expression increased in PA group, and PCR and IF results were consistent with Wb results (Fig. 5 , P < 0.05). PA-induced high-fat environment increases ROS in myocardial cells, and HSDL2 knockout reduces the level of oxidative stress caused by PA (Fig. 5 , P < 0.05). In addition, PA will increase the autovoy of cardiomyocyte, while knockout HSDL2 can relieve cell autochy at a certain level (Fig. 5 , P < 0.05). 3.5 Statistical processing The myocardial cells in PA group showed obvious fat vacuoles and slow cell proliferation, while those in Sema group were reduced(Fig. 8 ).The levels of TNF-α, IL-6, MDA and ROS in the Sema group decreased significantly, and the difference was statistically significant (Fig. 4 , P < 0.05). Sema can also increase cell activity and reduce apoptosis affected by PA (Fig. 6 , P < 0.001). At the same time, the results of Wb and IF tests in the Sema group also showed that Sema can reduce cell autophagy caused by PA (Fig. 5 , P < 0.05). For HSDL2, compared with the PA group, Sema reduces the protein expression of HSDL2 in cardiomyocytes, and the PCR results are consistent (Fig. 7 ,P < 0.05). In addition, the immunohistochemistometry of mouse myocardial tissue to detect the expression of HSDL2 in the Sema group and PA group was consistent with the Wb expression (Fig. 7 , P < 0.05). 4. Discussion In recent years, with the improvement of people's living standards, the number of obesity has increased, and the damage of obesity-related target organs, such as the heart, islet and kidney function, has posed a considerable threat to people's health. 20 According to many clinical and basic experiments, obesity damages the human body through a significant increase in lipid glucose levels, leading to metabolic disorders. 21 Research shows that in the model of obese mice caused by a high-fat diet, obesity increases the levels of TG, TC, LDL-C and fasting blood glucose in the blood. Elevated blood lipids and blood sugar levels, coupled with inflammatory states caused by obesity, will accelerate lipid oxidation, leading to atherosclerosis and cardiac function impairment. 22 At the same time, the increase in LDL-C and the decrease in HDL-C caused by obesity are related to oxidative stress, which will lead to a large amount of lipid oxidation, which further significantly increases the lipid peroxidation product. 23 The activation of a variety of oxidoreductases and the reduction of the activity of cellular antioxidant enzymes (including Cu-Zn SOD, hydroperoxidase and GPx) can induce an increase in lipid peroxide and reactive oxygen (ROS), thus damaging cells and tissues. 24, 25 In addition, obesity also leads to a significant increase in TNF-α and IL-6 levels in serum and cardiac tissue, indicating the presence of inflammation in the body. The increase in cardiac tissue ROS caused by obesity may lead to the production of toxic MDA. Increased lipid synthesis, inflammation and oxidative stress all contribute to lipid peroxidation to produce excessive MDA. MDA levels in cardiac tissue are related to mitochondrial activity, cell membrane damage and peroxidation damage. Changes in lipid and oxidative stress indicators can affect myocardial cell metabolism, thus affecting the progression of obesity-associated cardiomyopathy. 26, 27 In the early stage of obesity, cardiomyocyte hypertrophy and ventricular wall thickening can still produce sufficient compensatory function, but the occurrence of compensation loss will lead to irreversible serious cardiac function damage. 28, 29 In our previous studies, cardiac ultrasound in obese mice showed that the ventricular wall was thickened and the ventricular volume decreased, indicating centritropic hypertrophy. 30 In this study, we established a mouse model of the HF group and the Sema group, and also established a cell model of the PA group and the Sema group to better study the mechanism of myocardial damage caused by obesity and whether smeglutide can reduce the damage caused by high fat. The weight of the mice in the HF group increased compared with that of the mice in the Sema group, and the blood lipid levels such as TC, TG and LDL-C increased. The levels of TNF-α, IL-6, ROS and MDA in the serum of mice in the HF group also increased significantly. The expression results of the same PA group cell oxidative stress level are similar to those of the HF group. In addition, the morphology of the myocardial cells in the PA group has changed compared with that of the NC group. The cells in the PA group showed lipidrop formation and cell atrophy under a 20-fold electron microscope. At the same time, cell fragments formed by large-scale cell death can be seen. Using cck8 to measure cell vitality, the cell vitality of the PA group also decreased significantly. Cell autophagy and apoptosis of the PA group also increased significantly. This means that obesity increases the level of lipids and oxidative stress in the body, resulting in an increase in the production of lipid peroxide products, which leads to myocardial damage and myocardial disease. HSDL2 is located on the human chromosome 9Q32, with a length of 92kd on the chromosome, with 11 exonons and 418 amino acids. HSDL2 belongs to the SDR family, which is a group of proteins that catalyze the oxidation and reduction of a variety of substrates, including steroid hormones, oxysterols, BASs, prostaglandins, vitamins a, fatty acids, amino acids, sugars, etc. 31 HSDL2 includes n-end SDR domain and c-end SCP2 domain. These two structural characteristics are involved in the redox reaction of nicotinamide adenine dinucleotide (oxidation form) (NAD)/NAD phosphate (NADP)-dependent and the binding of sterols and other lipids. 32, 33 HSDL2 can bind NADP/H, sterol derivatives and fatty acids, which is related to HSDL2's highly conservative NADP/H binding site and SCP2 domain, which is a structure that binds sterols and other lipids to promote its intermembraneal transport. 34, 35 In past studies, it has only been proposed that HSDL2 affects lipid metabolism, and the relationship between HSDL2 and high-lipid myocardium has not been further studied. This study found that in the immunohistochemistry of mouse myocardium, there were significantly more brown and yellow particles in the Sema group, that is, HSDL2 was highly expressed in the HF group, and the expression in the Sema group was reduced. At the same time, the Wb, PCR and IF results of the PA group of mouse cardiomyocytes and Sema group were consistent with this. That is, high fat does improve the expression of HSDL2 in the myocardium, and smegropeptide can reduce this expression. We performed HSDL2 knockout to determine whether HSDL2 is one of the mechanisms for high fat to cause changes in myocardial function. After knockout of HSDL2, according to the autophagy of IF and ROS results, the expression inhibition of HSDL2 improves the autophagy and oxidative stress levels of high-fat-induced cardiomyocytes. According to the above findings, HSDL2 seems to be one of the mechanisms of myocardial injury. Smeglutide is a sugar-lowering drug belonging to GLP-1R. A large number of tests have proved that it has a hypoglycemic and weight-reducing effect. 36 In recent years, the weight loss effect of smegropeptide has been widely studied clinically. This drug can reduce basic weight by 20–30% with few side effects. 37, 38 At the same time, smegroupide has also been shown to reduce the risk of cardiovascular events in patients with type 2 diabetes and have a cardiac protective effect on patients who are overweight or obese but have no diabetes. 39, 40 According to our previous research, Smegrutin can reduce the negative effects of obesity on the heart and change the expression of many proteins involved in Lipid metabolism in heart tissue. 30 This study found that smeglutide can reduce the weight and blood lipid levels of mice in the HF group, and at the same time reduce the level of oxidative stress indicators such as lipids, TNF-α, IL-6, ROS and MDA in serum and myocardial cells of mice in the HF group and PA group. Although smeglutide cannot change the cell morphology caused by the PA group, microscopic observation found that a wide range of cell death stopped. When measuring cell activity, it was found that the cell activity of the Sema group was higher than that of the PA group. At the same time, the cell autophagy level and apoptosis level of the Sema group decreased significantly compared with the PA group. The results show that smeglutide may reduce the state of myocardial inflammatory injury caused by high fat and restore myocardial vitality. By looking for the expression of HSDL2 in high-fat myocardium above, it was found that smeglutide significantly reduced the expression of HSDL2 in high-fat myocardium. According to the above findings, HSDL2 may be one of the mechanisms that cause myocardial injury, and smeglutide seems to protect the myocardium by regulating the expression of HSDL2. 5. Conclusions Our study shows that obesity can lead to oxidative stress, inflammatory reactions and cell autosage, apoptosis in cardiomyocyte cells. Expression inhibition of HSDL2 can reduce the levels of autophage and oxidative stress in myocardial cells. Semaglutide can reduce cell damage caused by obesity while also reducing the high level of HSDL2 expression caused by obesity. It provides new ideas for GLP-1 receptor agonists as a target therapy for regulating the treatment and prognosis of myocardial injury caused by obesity, and also provides a new potential target for clinical control of obesity-related myocardial injury. Declarations Ethics approval All experimental procedures and animal management procedures were approved by the Ethics Committee of Hebei General Hospital (Approval Number: 2023-32; Date of approval: Jun 14, 2023). Funding This study was supported by the Hebei Province Natural Science Foundation (H2022307026). The funding bodies played no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript. Authorship contribution statement Lin Yang: Conceptualization, Investigation, Formal analysis, Project administration, Writing – original draft. Xiaoyu Pan: Conceptualization, Project administration, Writing – review & editing, Funding acquisition. Zhenyu Pan: Resources, Investigation. Haina Gao: Investigation. Jiangli Ban: Resources. Shuchun Chen: Conceptualization, Funding acquisition, Supervision, Project administration, Writing – review & editing. Data availability Data available on request from the authors. Conflicts of interest None of the authors have a conflicts of interest References Pan, X.; Chen, S.; Chen, X.; Ren, Q.; Yue, L.; Niu, S.; Li, Z.; Zhu, R.; Chen, X.; Jia, Z.; Zhen, R.; Ban, J., Effect of high-fat diet and empagliflozin on cardiac proteins in mice. Nutr Metab (Lond) 2022, 19 (1), 69. Rosengren, A., Obesity and cardiovascular health: the size of the problem. Eur Heart J 2021, 42 (34), 3404-3406. Ma, L.; Ma, S.; He, H.; Yang, D.; Chen, X.; Luo, Z.; Liu, D.; Zhu, Z., Perivascular fat-mediated vascular dysfunction and remodeling through the AMPK/mTOR pathway in high-fat diet-induced obese rats. Hypertens Res 2010, 33 (5), 446-53. Ionică, L. N.; Gaiță, L.; Bînă, A. M.; Soșdean, R.; Lighezan, R.; Sima, A.; Malița, D.; Crețu, O. M.; Burlacu, O.; Muntean, D. M.; Sturza, A., Metformin alleviates monoamine oxidase-related vascular oxidative stress and endothelial dysfunction in rats with diet-induced obesity. Mol Cell Biochem 2021, 476 (11), 4019-4029. Kowalik, D.; Haller, F.; Adamski, J.; Moeller, G., In search for function of two human orphan SDR enzymes: hydroxysteroid dehydrogenase like 2 (HSDL2) and short-chain dehydrogenase/reductase-orphan (SDR-O). J Steroid Biochem Mol Biol 2009, 117 (4-5), 117-24. Dai, J.; Xie, Y.; Wu, Q.; Wang, L.; Yin, G.; Ye, X.; Zeng, L.; Xu, J.; Ji, C.; Gu, S.; Huang, Q.; Zhao, R. C.; Mao, Y., Molecular cloning and characterization of a novel human hydroxysteroid dehydrogenase-like 2 (HSDL2) cDNA from fetal brain. Biochem Genet 2003, 41 (5-6), 165-74. Yang, Y.; Han, A.; Wang, X.; Yin, X.; Cui, M.; Lin, Z., Lipid metabolism regulator human hydroxysteroid dehydrogenase-like 2 (HSDL2) modulates cervical cancer cell proliferation and metastasis. J Cell Mol Med 2021, 25 (10), 4846-4859. Han, A.; Xu, R.; Liu, Y.; Yin, X.; Lin, Z.; Yang, W., HSDL2 Acts as a Promoter in Pancreatic Cancer by Regulating Cell Proliferation and Lipid Metabolism. Onco Targets Ther 2021, 14 , 435-444. Cheng, Z.; Li, Y.; Sui, C.; Sun, X.; Xie, Y., Synthesis, purification and crystallographic studies of the C-terminal sterol carrier protein type 2 (SCP-2) domain of human hydroxysteroid dehydrogenase-like protein 2. Acta Crystallogr F Struct Biol Commun 2015, 71 (Pt 7), 901-5. Gronemeyer, T.; Wiese, S.; Ofman, R.; Bunse, C.; Pawlas, M.; Hayen, H.; Eisenacher, M.; Stephan, C.; Meyer, H. E.; Waterham, H. R.; Erdmann, R.; Wanders, R. J.; Warscheid, B., The proteome of human liver peroxisomes: identification of five new peroxisomal constituents by a label-free quantitative proteomics survey. PLoS One 2013, 8 (2), e57395. Shang, C.; Wang, W.; Liao, Y.; Chen, Y.; Liu, T.; Du, Q.; Huang, J.; Liang, Y.; Liu, J.; Zhao, Y.; Guo, L.; Hu, Z.; Yao, S., LNMICC Promotes Nodal Metastasis of Cervical Cancer by Reprogramming Fatty Acid Metabolism. Cancer Res 2018, 78 (4), 877-890. Kim, M. S.; Kim, W. J.; Khera, A. V.; Kim, J. Y.; Yon, D. K.; Lee, S. W.; Shin, J. I.; Won, H. H., Association between adiposity and cardiovascular outcomes: an umbrella review and meta-analysis of observational and Mendelian randomization studies. Eur Heart J 2021, 42 (34), 3388-3403. Pan, X.; Zhang, X.; Ban, J.; Yue, L.; Ren, L.; Chen, S., Effects of High-Fat Diet on Cardiovascular Protein Expression in Mice Based on Proteomics. Diabetes Metab Syndr Obes 2023, 16 , 873-882. Zhang, D. Y.; Liu, Z.; Lu, Z.; Sun, W. L.; Ma, X.; Zhang, P.; Wu, B. Q.; Cui, P. Y., Lentivirus-mediated overexpression of HSDL2 suppresses cell proliferation and induces apoptosis in cholangiocarcinoma. Onco Targets Ther 2018, 11 , 7133-7142. Sun, Q.; Zhang, Y.; Su, J.; Li, T.; Jiang, Y., Role of Hydroxysteroid Dehydrogenase-Like 2 (HSDL2) in Human Ovarian Cancer. Med Sci Monit 2018, 24 , 3997-4008. Dixon, S. J.; Lemberg, K. M.; Lamprecht, M. R.; Skouta, R.; Zaitsev, E. M.; Gleason, C. E.; Patel, D. N.; Bauer, A. J.; Cantley, A. M.; Yang, W. S.; Morrison, B., 3rd; Stockwell, B. R., Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell 2012, 149 (5), 1060-72. Stockwell, B. R.; Friedmann Angeli, J. P.; Bayir, H.; Bush, A. I.; Conrad, M.; Dixon, S. J.; Fulda, S.; Gascón, S.; Hatzios, S. K.; Kagan, V. E.; Noel, K.; Jiang, X.; Linkermann, A.; Murphy, M. E.; Overholtzer, M.; Oyagi, A.; Pagnussat, G. C.; Park, J.; Ran, Q.; Rosenfeld, C. S.; Salnikow, K.; Tang, D.; Torti, F. M.; Torti, S. V.; Toyokuni, S.; Woerpel, K. A.; Zhang, D. D., Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. Cell 2017, 171 (2), 273-285. Tang, D.; Chen, X.; Kang, R.; Kroemer, G., Ferroptosis: molecular mechanisms and health implications. Cell Res 2021, 31 (2), 107-125. Ma, S.; Ma, Y.; Qi, F.; Lei, J.; Chen, F.; Sun, W.; Wang, D.; Zhou, S.; Liu, Z.; Lu, Z.; Zhang, D., HSDL2 knockdown promotes the progression of cholangiocarcinoma by inhibiting ferroptosis through the P53/SLC7A11 axis. World J Surg Oncol 2023, 21 (1), 293. Bunbupha, S.; Apaijit, K.; Maneesai, P.; Prasarttong, P.; Pakdeechote, P., Nobiletin ameliorates high-fat diet-induced vascular and renal changes by reducing inflammation with modulating AdipoR1 and TGF-β1 expression in rats. Life Sci 2020, 260 , 118398. O'Neil, P. M.; Birkenfeld, A. L.; McGowan, B.; Mosenzon, O.; Pedersen, S. D.; Wharton, S.; Carson, C. G.; Jepsen, C. H.; Kabisch, M.; Wilding, J. P. H., Efficacy and safety of semaglutide compared with liraglutide and placebo for weight loss in patients with obesity: a randomised, double-blind, placebo and active controlled, dose-ranging, phase 2 trial. Lancet 2018, 392 (10148), 637-649. Piché, M. E.; Tchernof, A.; Després, J. P., Obesity Phenotypes, Diabetes, and Cardiovascular Diseases. Circ Res 2020, 126 (11), 1477-1500. Cafe, S. L.; Nixon, B.; Dun, M. D.; Roman, S. D.; Bernstein, I. R.; Bromfield, E. G., Oxidative Stress Dysregulates Protein Homeostasis Within the Male Germ Line. Antioxid Redox Signal 2020, 32 (8), 487-503. Rani, V.; Deep, G.; Singh, R. K.; Palle, K.; Yadav, U. C., Oxidative stress and metabolic disorders: Pathogenesis and therapeutic strategies. Life Sci 2016, 148 , 183-93. Holvoet, P.; Kritchevsky, S. B.; Tracy, R. P.; Mertens, A.; Rubin, S. M.; Butler, J.; Goodpaster, B.; Harris, T. B., The metabolic syndrome, circulating oxidized LDL, and risk of myocardial infarction in well-functioning elderly people in the health, aging, and body composition cohort. Diabetes 2004, 53 (4), 1068-73. Kolijn, D.; Pabel, S.; Tian, Y.; Lódi, M.; Herwig, M.; Carrizzo, A.; Zhazykbayeva, S.; Kovács, Á.; Fülöp, G.; Falcão-Pires, I.; Reusch, P. H.; Linthout, S. V.; Papp, Z.; van Heerebeek, L.; Vecchione, C.; Maier, L. S.; Ciccarelli, M.; Tschöpe, C.; Mügge, A.; Bagi, Z.; Sossalla, S.; Hamdani, N., Empagliflozin improves endothelial and cardiomyocyte function in human heart failure with preserved ejection fraction via reduced pro-inflammatory-oxidative pathways and protein kinase Gα oxidation. Cardiovasc Res 2021, 117 (2), 495-507. Watanabe, K.; Nagao, M.; Toh, R.; Irino, Y.; Shinohara, M.; Iino, T.; Yoshikawa, S.; Tanaka, H.; Satomi-Kobayashi, S.; Ishida, T.; Hirata, K. I., Critical role of glutamine metabolism in cardiomyocytes under oxidative stress. Biochem Biophys Res Commun 2021, 534 , 687-693. Alpert, M. A.; Omran, J.; Bostick, B. P., Effects of Obesity on Cardiovascular Hemodynamics, Cardiac Morphology, and Ventricular Function. Curr Obes Rep 2016, 5 (4), 424-434. Harada, T.; Obokata, M., Obesity-Related Heart Failure with Preserved Ejection Fraction: Pathophysiology, Diagnosis, and Potential Therapies. Heart Fail Clin 2020, 16 (3), 357-368. Pan, X.; Yue, L.; Ban, J.; Ren, L.; Chen, S., Effects of Semaglutide on Cardiac Protein Expression and Cardiac Function of Obese Mice. J Inflamm Res 2022, 15 , 6409-6425. Kavanagh, K. L.; Jörnvall, H.; Persson, B.; Oppermann, U., Medium- and short-chain dehydrogenase/reductase gene and protein families : the SDR superfamily: functional and structural diversity within a family of metabolic and regulatory enzymes. Cell Mol Life Sci 2008, 65 (24), 3895-906. Persson, B.; Kallberg, Y.; Bray, J. E.; Bruford, E.; Dellaporta, S. L.; Favia, A. D.; Duarte, R. G.; Jörnvall, H.; Kavanagh, K. L.; Kedishvili, N.; Kisiela, M.; Maser, E.; Mindnich, R.; Orchard, S.; Penning, T. M.; Thornton, J. M.; Adamski, J.; Oppermann, U., The SDR (short-chain dehydrogenase/reductase and related enzymes) nomenclature initiative. Chem Biol Interact 2009, 178 (1-3), 94-8. Chiapparino, A.; Maeda, K.; Turei, D.; Saez-Rodriguez, J.; Gavin, A. C., The orchestra of lipid-transfer proteins at the crossroads between metabolism and signaling. Prog Lipid Res 2016, 61 , 30-9. Bhatia, C.; Oerum, S.; Bray, J.; Kavanagh, K. L.; Shafqat, N.; Yue, W.; Oppermann, U., Towards a systematic analysis of human short-chain dehydrogenases/reductases (SDR): Ligand identification and structure-activity relationships. Chem Biol Interact 2015, 234 , 114-25. Burgardt, N. I.; Gianotti, A. R.; Ferreyra, R. G.; Ermácora, M. R., A structural appraisal of sterol carrier protein 2. Biochim Biophys Acta Proteins Proteom 2017, 1865 (5), 565-577. Ryan, D. H.; Lingvay, I.; Colhoun, H. M.; Deanfield, J.; Emerson, S. S.; Kahn, S. E.; Kushner, R. F.; Marso, S.; Plutzky, J.; Brown-Frandsen, K.; Gronning, M. O. L.; Hovingh, G. K.; Holst, A. G.; Ravn, H.; Lincoff, A. M., Semaglutide Effects on Cardiovascular Outcomes in People With Overweight or Obesity (SELECT) rationale and design. Am Heart J 2020, 229 , 61-69. Aroda, V. R.; Ahmann, A.; Cariou, B.; Chow, F.; Davies, M. J.; Jódar, E.; Mehta, R.; Woo, V.; Lingvay, I., Comparative efficacy, safety, and cardiovascular outcomes with once-weekly subcutaneous semaglutide in the treatment of type 2 diabetes: Insights from the SUSTAIN 1-7 trials. Diabetes Metab 2019, 45 (5), 409-418. Thethi, T. K.; Pratley, R.; Meier, J. J., Efficacy, safety and cardiovascular outcomes of once-daily oral semaglutide in patients with type 2 diabetes: The PIONEER programme. Diabetes Obes Metab 2020, 22 (8), 1263-1277. Husain, M.; Birkenfeld, A. L.; Donsmark, M.; Dungan, K.; Eliaschewitz, F. G.; Franco, D. R.; Jeppesen, O. K.; Lingvay, I.; Mosenzon, O.; Pedersen, S. D.; Tack, C. J.; Thomsen, M.; Vilsbøll, T.; Warren, M. L.; Bain, S. C., Oral Semaglutide and Cardiovascular Outcomes in Patients with Type 2 Diabetes. N Engl J Med 2019, 381 (9), 841-851. Bain, S. C.; Mosenzon, O.; Arechavaleta, R.; Bogdański, P.; Comlekci, A.; Consoli, A.; Deerochanawong, C.; Dungan, K.; Faingold, M. C.; Farkouh, M. E.; Franco, D. R.; Gram, J.; Guja, C.; Joshi, P.; Malek, R.; Merino-Torres, J. F.; Nauck, M. A.; Pedersen, S. D.; Sheu, W. H.; Silver, R. J.; Tack, C. J.; Tandon, N.; Jeppesen, O. K.; Strange, M.; Thomsen, M.; Husain, M., Cardiovascular safety of oral semaglutide in patients with type 2 diabetes: Rationale, design and patient baseline characteristics for the PIONEER 6 trial. Diabetes Obes Metab 2019, 21 (3), 499-508. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5269858","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":366721149,"identity":"7a46784c-4bf1-4b48-8897-9ea318108775","order_by":0,"name":"Lin Yang","email":"","orcid":"","institution":"Hebei North University","correspondingAuthor":false,"prefix":"","firstName":"Lin","middleName":"","lastName":"Yang","suffix":""},{"id":366721150,"identity":"c5d11ddd-6355-491d-b13b-d72a390e120c","order_by":1,"name":"Xiaoyu Pan","email":"","orcid":"","institution":"Hebei General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xiaoyu","middleName":"","lastName":"Pan","suffix":""},{"id":366721152,"identity":"136d40ba-981f-4a1e-b121-d7ecd66fe272","order_by":2,"name":"Zhenyu Pan","email":"","orcid":"","institution":"Shandong Medical College","correspondingAuthor":false,"prefix":"","firstName":"Zhenyu","middleName":"","lastName":"Pan","suffix":""},{"id":366721154,"identity":"0113f343-7720-40ca-8aa8-bc825cd8c0ad","order_by":3,"name":"Haina Gao","email":"","orcid":"","institution":"The Second Hospital of Shijiazhuang","correspondingAuthor":false,"prefix":"","firstName":"Haina","middleName":"","lastName":"Gao","suffix":""},{"id":366721156,"identity":"f89f85a0-60b2-4f0e-87b5-99957ff71c5b","order_by":4,"name":"Jiangli Ban","email":"","orcid":"","institution":"The Second Hospital of Shijiazhuang","correspondingAuthor":false,"prefix":"","firstName":"Jiangli","middleName":"","lastName":"Ban","suffix":""},{"id":366721160,"identity":"f6cde4a3-65db-4225-b97f-ddf2b585e967","order_by":5,"name":"Shuchun Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIiWNgGAWjYDACCSBmbGBg4GdmbDD4YGBjR7wWyfbmhsIZBWnJxGsxOHO84TPPh0MgNn7AP7v52MOfOw7LM9xIbNxsY3CAmYH98NENeC25cyzdmPfMYcPGGYnNxjkGd/gYeNLSbuDTYiCRYybN2HY4gVkisQ2o5RkzgwSPGQEt+d8kfwK1sEkktv+2MDjM2EBYSw6bBC9QCw/PwQZjBmK0SNxIM5PmbUs3nMHe2GDYY5CWzEbIL/wzkp8BHWYtb3+Y/YHBjz82dvzsh4/h1YIJ2EhTPgpGwSgYBaMAGwAAOUFLrMSOzbQAAAAASUVORK5CYII=","orcid":"","institution":"Hebei General Hospital","correspondingAuthor":true,"prefix":"","firstName":"Shuchun","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2024-10-15 15:08:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5269858/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5269858/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":66953647,"identity":"c3d796ee-6f87-4659-b740-05886e3e1695","added_by":"auto","created_at":"2024-10-18 10:44:47","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":130434,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe weight changes in the HF group and the NC group.\u003c/strong\u003e****P\u0026lt;0.001(A)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe effect of semaglutide on mouse weight.\u003c/strong\u003e****P\u0026lt;0.001,NC vs HF。\u003csup\u003e####\u003c/sup\u003e P\u0026lt;0.001, HF vs Sema(B) ns P\u0026gt;0.05\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5269858/v1/07ad806a79c61c977559639a.png"},{"id":66953645,"identity":"b987bbae-098b-448e-a81f-07eddb751999","added_by":"auto","created_at":"2024-10-18 10:44:47","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":119669,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe Effect of Semaglutide on Blood Lipid and Glucose Levels in Mice. \u003c/strong\u003e****P\u0026lt;0.001,*** P\u0026lt;0.01,** P\u0026lt;0.05,ns \u0026nbsp;P\u0026gt;0.05\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5269858/v1/ac0abfe3091d89fd5367a73a.png"},{"id":66953651,"identity":"39ff3918-0718-4554-9fd3-92fd19a1765b","added_by":"auto","created_at":"2024-10-18 10:44:48","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":78099,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of obesity and semaglutide on myocardial inflammation and oxidative stress levels in mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A)TNF-α (B)MDA (C)IL-1β (D)T-SOD\u003c/p\u003e\n\u003cp\u003e(E)Adenosine \u0026nbsp;****P\u0026lt;0.001,*** P\u0026lt;0.01,** P\u0026lt;0.05,* P\u0026lt;0.05,ns \u0026nbsp;P\u0026gt;0.05\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5269858/v1/3acadf3ba34c00a788cbb515.png"},{"id":66953646,"identity":"a476a3fa-7dc4-45da-9e6e-b88a4d641b62","added_by":"auto","created_at":"2024-10-18 10:44:47","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":428388,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of semaglutide on cardiomyocyte function in mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A)TNF-α (B)IL-6 (C)MDA\u003c/p\u003e\n\u003cp\u003e(D)ROS ****P\u0026lt;0.001,*** P\u0026lt;0.01,** P\u0026lt;0.05,* P\u0026lt;0.05,ns \u0026nbsp;P\u0026gt;0.05\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5269858/v1/0e1a78faa012e7d45a4ebcdb.png"},{"id":66953652,"identity":"52646955-0357-43b8-9a71-6b9cd3a14944","added_by":"auto","created_at":"2024-10-18 10:44:48","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":898031,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of HSDL2 on cardiomyocyte function in mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) HSDL2 protein expression bands\u003c/p\u003e\n\u003cp\u003e(B) Relative HSDL2 protein expression\u003c/p\u003e\n\u003cp\u003e(C) Relative LC3 protein expression\u003c/p\u003e\n\u003cp\u003e(D) Relative P62 protein expression\u003c/p\u003e\n\u003cp\u003e(E) mean fiuorescence intensity of HSDL2\u003c/p\u003e\n\u003cp\u003e(F) mean fiuorescence intensity of P62\u003c/p\u003e\n\u003cp\u003e(G) HSDL2 fiuorescence intensity bands\u003c/p\u003e\n\u003cp\u003e(H) P62 fiuorescence intensity bands\u003c/p\u003e\n\u003cp\u003e****P\u0026lt;0.001,*** P\u0026lt;0.01,** P\u0026lt;0.05,* P\u0026lt;0.05,ns \u0026nbsp;P\u0026gt;0.05\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5269858/v1/4d84c9b4f460fe4210a87dda.png"},{"id":66953850,"identity":"0a7491c1-5f30-4a90-9976-b849cccb89b9","added_by":"auto","created_at":"2024-10-18 10:52:47","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":158179,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSemaglutide reduces apoptosis and increases cell viability in mouse cardiomyocytes induced by high-fat diet\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Cardiomyocyte viability assay\u003c/p\u003e\n\u003cp\u003e(B) Cardiomyocyte apoptosis rate\u003c/p\u003e\n\u003cp\u003e(C) Flow cytometry\u003c/p\u003e\n\u003cp\u003e****P\u0026lt;0.001, ns \u0026nbsp;P\u0026gt;0.05\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-5269858/v1/603a2cbd8d7383cee98908c9.png"},{"id":66953653,"identity":"5d011c67-c889-4c78-bc65-692b12d206a6","added_by":"auto","created_at":"2024-10-18 10:44:48","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":239180,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of semaglutide on cardiomyocyte function in mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) HSDL2 IOD ration expression bands\u003c/p\u003e\n\u003cp\u003e(B) Relative mRNA expression of HSDL2\u003c/p\u003e\n\u003cp\u003e****P\u0026lt;0.001,*** P\u0026lt;0.01,** P\u0026lt;0.05, ns \u0026nbsp;P\u0026gt;0.05\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-5269858/v1/885f2154208038f01350a74c.png"},{"id":66953649,"identity":"d5a7d6a9-8ab0-4841-8318-51ca5f37c9eb","added_by":"auto","created_at":"2024-10-18 10:44:47","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":977507,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eChanges in cell morphology\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)Cells were treated with PA for 24h\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B)Cells were treated with semaglutide for 24h\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C)Si-HSDL2 cell\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D)NC cell\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-5269858/v1/f959ec1b6ead5bfa33af2436.png"},{"id":68092538,"identity":"c4f496c2-6a7b-4c52-8533-504469948ed5","added_by":"auto","created_at":"2024-11-02 19:01:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4437299,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5269858/v1/a9819378-5c9a-4a0c-ae8d-95df93901cd0.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Semaglutide reduces cardiomyocyte damage caused by high-fat through HSDL2","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eObesity is a chronic multifactorial disease in which the accumulation of multiple fats can have a negative impact on human health. With the development of the global economy, the incidence of obesity continues to rise among people around the world, and there is no sign of a significant decline. Obesity is directly involved in the occurrence and development of metabolic diseases, cardiomyopathy, ischemic coronary heart disease, peripheral artery disease, heart failure and arterial hypertension, affecting global morbidity and mortality. Therefore, obesity is a disease syndrome that deserves our continued attention.\u003c/p\u003e \u003cp\u003eObesity causes a variety of hemodynamic changes, which may lead to changes in heart morphology, ventricular function and vascular endotheter cells, leading to various cardiovascular diseases such as heart hypertrophy, heart failure and atherosmosis.\u003csup\u003e1, 2\u003c/sup\u003e Abnormal metabolism in the body caused by obesity plays a key role in cardiovascular disease. Studies have shown that feeding a high-fat diet (HFD) can lead to obesity in mice, accompanied by impaired endothelial-dependent vasostolic function and arterial wall thickness.\u003csup\u003e3\u003c/sup\u003e In addition, lipid metabolism disorders caused by obesity greatly increase the level of oxidative stress, which can damage a variety of target organs, mainly affecting the function of cardiovascular cells and triggering a series of pathological changes. At the same time, the increase in oxidative stress will also increase the product of lipid peroxide, resulting in myocardial cell damage.\u003csup\u003e4\u003c/sup\u003e However, the mechanism of myocardial injury caused by obesity still needs to be further explored.\u003c/p\u003e \u003cp\u003eInsulin-like peptide-1 receptor agonist (GLP-1RA) enhances insulin secretion by activating the GLP-1 receptor and reduces blood sugar. Semaglutide is a long-acting glucagon-like peptide-1 receptor agonist and has the effect of reducing sugar and weight loss. In a clinical trial, we observed a significantly lower risk of heart disease in patients with type 2 diabetes treated with smegrin, and a significant improvement in the prognosis of heart disease. However, most studies on GLP-1R agonists focus on the mechanism of atherosclerosis induced by diabetes. There are few studies on the protective effect of early myocardial injury caused by obesity, and the molecular mechanism of drugs and new target effects is lacking. Obesity and diabetes have common pathogenic mechanisms, which can lead to cardiac lesions. Hydroxysteroid dehydrogenase-like protein 2 (HSDL2) is a member of the short-chain dehydrogenase/reductase (SDR) family, \u003csup\u003e5, 6\u003c/sup\u003e expressed in fat, myocardium and other tissues. And it can catalyze the oxidation and reduction of various substrates, such as steroids, sugars, vitamin A and fatty acids.\u003csup\u003e7\u003c/sup\u003e A large number of studies have shown that HSDL2 is a key factor in the regulation of fatty acids in lipid metabolism, and it also participates in cholesterol synthesis.\u003csup\u003e8\u0026ndash;10\u003c/sup\u003e Shang et al observed that long-chain non-coding RNA LNMICC can promote lymph node metastasis in cervical cancer by reprogramming fatty acid metabolism, which also proves that HSDL2 is a key factor for fatty acids to regulate lipid metabolism.\u003csup\u003e11\u003c/sup\u003e In recent years, it has been found that abnormal lipid metabolism can accelerate cardiomyopathy.\u003csup\u003e12\u003c/sup\u003e HSDL2 can participate in the synthesis of cholesterol by binding the coenzyme NADPH. The study found that when HSDL2 is overexpressed in the body, the cholesterol synthesis in the cell is significantly accelerated, and the total cholesterol in the body is significantly increased.\u003csup\u003e9\u003c/sup\u003e At the same time, our previous study of cardiovascular protein expression in mice based on proteomics-fat diet showed that Hsd17b4, Hsdl2 and Acadvl are proteins mainly involved in lipid metabolism, and Hsd17b4, Hsdl2 and Acadvl, as co-differentiated expression proteins of the heart and aorta (Co-DEP), may become new targets for the diagnosis and treatment of obese cardiovascular diseases. Therefore, we assume that Hsd17b4 and Hsdl2 are involved in regulating lipid metabolism and oxidative stress, because they are all related to catalase activity, and peroxidase bodies are essential in maintaining cell redox normal state.\u003csup\u003e13\u003c/sup\u003e In addition, HSDL2 expresses disorders in a variety of cancers and is associated with tumor progression.\u003csup\u003e14, 15\u003c/sup\u003e HSDL2 is positioned at the peroxisome, which also affects tumor progression by regulating lipid metabolism.\u003csup\u003e7, 8\u003c/sup\u003e Iron death is a type of iron-dependent cell death characterized by increased lipid peroxidation; this type of cell death is different from necrosis, apoptosis and autophagy.\u003csup\u003e16\u003c/sup\u003e Iron death plays a potential role in nerve formation, cancer and organ dysfunction.\u003csup\u003e17, 18\u003c/sup\u003e Research shows that HSDL2 is related to the occurrence and development of iron death.\u003csup\u003e19\u003c/sup\u003e However, so far, it is not clear whether the abnormality of HSDL2 is related to myocardial damage caused by obesity.\u003c/p\u003e \u003cp\u003eIn summary, we screened the heart and aortic Co-DEP based on proteomics results. Then carry out functional analysis of the key proteins.\u003csup\u003e13\u003c/sup\u003e Therefore, HSDL2 was selected to further explore the molecular mechanism of the protective effect of Semaglutide on myocardial injury in obese mice and potential new clinical therapeutic targets for obesity-related cardiomyopathy. To further verify this mechanism, we have established a high-fat myocardial cell model to observe changes in myocardial cell damage. Protein immunosprinting technology and polymerase chain reaction technology were used to observe changes in myocardial cell proteins and mRNA in high-fat mice before and after Smegrupide intervention and before and after HSDL2 knockout. The molecular mechanism of Smegrutide's protective effect on myocardial cell damage caused by high fat by regulating HSDL2 was explored.\u003c/p\u003e"},{"header":"2. Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Animals and Experimental Design\u003c/h2\u003e \u003cp\u003eIn this study, 24 6-week-old male C57BL/6 mice were obtained from Hebei Shengwu Technology Co., Ltd. The company holds a license (certificate number: SYXK) (June 20150004) for the sale and distribution of experimental animals. These mice were then placed in the Experimental Animal Center of Hebei Provincial People's Hospital, where they were raised under standard laboratory conditions. These conditions include a temperature of 22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, a humidity of 55\u0026thinsp;\u0026plusmn;\u0026thinsp;10%, a 12-hour light-dark cycle, and free drinking water. These standardized conditions ensure that mice have a suitable environment during the study.\u003c/p\u003e \u003cp\u003eAfter a one-week domestication period, the mice were randomly divided into the normal feed group (NC), the high-fat feed group (HF) and the high-fat feed plus meglutide group (Sema). It should be noted that all experimental procedures are approved by the Animal Ethics Committee of Hebei Provincial General Hospital and carried out in accordance with the Regulations on the Management of Experimental Animals in Hebei Province. The NCD group feeds normal daily food with a fat content of 4%, a protein content of 20% and a carbohydrate content of 20% (D1035, Beijing Huafukang Biotechnology Co., Ltd., China), with a total energy of 34.8 kcal/100 g. The high-fat group feeds high-fat feed with a fat content of 60%, a protein content of 20% and a carbohydrate content of 20% (H10060, Beijing Huafukang Biotechnology Co., Ltd., China), with a total energy of 524 kcal/100 g. The smeglu peptide group followed a similar high-fat diet for 14 weeks, and then injected subcutaneously with a daily dose of 30 nmol/kg/day (Novo Nordisk, Bagsvaerd, Denmark). The maximum dose of smeglupeptide is selected according to previously published mouse studies. After 8 weeks of treatment, glucose tolerance test and weight and serum measurement were carried out. The mouse fasted for 12 hours before euthanasia. After the experiment, 1% sodium pentobarbital (60 mg/kg) was injected into the peritoneal cavity of the mouse. Blood samples were collected from the posterior orbital sinus and placed in a sterile tube containing 1mm ethylenediaminetetraacetic acid (EDTA). Then euthanate the mice. Collect the heart tissue of mice, weigh it, stain it with Sumujing and Yihong or freeze it with liquid nitrogen, and store it at -80\u0026deg;C for further analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Weight assessment\u003c/h2\u003e \u003cp\u003eDuring the whole experiment, the weight of the mice was measured weekly. These measurements can provide valuable data for assessing the physiological and metabolic effects of drug interventions on mice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Enzyme linked immunosorbent assay (ELISA)\u003c/h2\u003e \u003cp\u003eElabscience Mouse insulin ELISA Kit was used to determine the plasma insulin (INS) level of mice. The kit was made by Wuhan Elarite Biological Department. Produced by Technology Co., Ltd. This kit is specially designed to measure insulin levels in mouse plasma samples.\u003c/p\u003e \u003cp\u003eNanjing Jiancheng's commercial kit is used to detect low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), serum total cholesterol (TC), triglycerides (TG), inflammatory cytokines (IL-1β), tumor necrosis factor α (TNF-α), propylene aldehyde ( MDA) and superoxide dismutase (SOD) levels. All measurements are detected using VERSAmax, a fully automatic ELISA reader made in the United States. Use Graphpad Prism software to analyze the data obtained from the ELISA reader.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 IHC\u003c/h2\u003e \u003cp\u003eThe paraffin slices (thickness of 3\u0026micro;m) of mice with fixed formalin were dewaxed and rehydrated. 3% hydrogen peroxide solution blocks endogenous peroxidase activity. The slide and anti-HSDL2 (1:200) anti-incubation overnight, and then incubate immunoglobulin G (IgG) coupled with horseradish peroxidase (HRP) for 50 minutes at room temperature. The slicing is made of freshly prepared DAB color rendering liquid. The color rendering time is controlled under the microscope, and the positive is brownish yellow. Sugnylin 3min re-infects the nucleus. The slice is placed under a white light microscope (Nikon Instrument Co., Ltd., China) for interpretation of the results.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 cell culture\u003c/h2\u003e \u003cp\u003eMouse cardiomyocytes (HL-1) are cultured in DMEM medium (Gibco, USA, 22400089), adding 10% fetal bovine serum (Gibco, USA, 16140071) and 1% double antibiotics (100\u0026micro;g/mL penicillin and 100 U/mL streptomycin). Cells hatch at 37\u0026deg;C in a humidifying incubator with 5% CO2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Study subgroups\u003c/h2\u003e \u003cp\u003eHigh-fat cell additives (sodium palmitate concentration is 6mmol/L) and complete medium at a ratio of 1:30, and finally palmitic acid (PA) 0.25mmol/L. The cell suspension is inoculated into the 6-hole plate, and the prepared palmitine solution is added after the cell is attached to the wall. It is cultured at 37\u0026deg;C for 24 hours to build a high-fat cardiomyocyte model. In the same way, the prepared smegroupide (concentration of 100nmol/L) will intervene in the high-fat cardiomyocyte model for 24 hours for the following experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 HSDL2 transfection\u003c/h2\u003e \u003cp\u003esiHSDL2 (HSDL2 knocks low RNA) is processed by GenePharma (Shanghai, China). Try to transfect the cell line with the Lipofectamine 3000 of Genechem (Shanghai, China). HSDL2 small interference RNA (siRNA) (si-HSDL2) and siRNA (siRNA control) were obtained from GenePharma.\u003c/p\u003e \u003cp\u003eSiRNA is transfected with Lipofectamine 3000 to HL-1 cells according to the experimental instructions. After transfection, the transfection efficiency is verified by western blotting 24 hours, and the transfection stable cells are used for the next experiment. Transfection sequence, siRNA-HSDL2 forward: GGGAGGACCUGGUAUCGAATT, reverse: UUCGAUACCAGGUCCUCCCTT.\u003c/p\u003e \u003cp\u003eThe cells were divided into palmitic acid (PA) group, palmitate plus semaglutide group (Sema) group, knockout HSDL2 plus palmitate group (Si-HSDL2) group and normal control (NC) group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Western blotting\u003c/h2\u003e \u003cp\u003eProtein extraction uses cell cracking buffer (Biosharp, China, BL509A) with phase inhibitor (Biosharp, China, BL507A). Protein concentration was measured using bicinchoninic acid protein assay kit (Servicebio, China, G2026). The protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoretic (SDS-PAGE) method and transferred to a polyvinylidene (PVDF) membrane (Immobilon-P, USA). Sealed with 5% skim milk powder. After the closure, use appropriately diluted rabbit-derived HSDL2 (Proteintech, USA), P62 (Servicebio, China), LC3 (Servicebio, China) and Rat-derived Gapdh (ABclonal, USA) to infer overnight at 4℃, and inocate with The film was obtained by exposure of Amersham Imager 600 ultra-sensitive multifunction imager (General Electric, American).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Quantitative reverse transcription PCR (qRT-PCR)\u003c/h2\u003e \u003cp\u003eTotal RNA is extracted with TRIzol reagent. The isolated RNA is reversed into complementary DNA (cDNA) with SweScript All-in-one RT SuperMix for qPCR (Servicebio, China, G3337). Adopt SuperReal PreMix Plus (SYBR Green) (TIANGEN, China, FP205) in StepOnePlus real-time fluorescent quantitative PCR system (Applied Biosystem, Quantification on USA, Cat#4376600). The results are calculated using the 2-ΔΔCT method. The primers used in qRT-PCR are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequences of primers used for qPCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward (5'\u0026rarr;3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse (5'\u0026rarr;3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHSDL2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATTCTCAATCTCAGCCCACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCCAGCATATCCATAGCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGACGTTGACATCCGTAAAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTAACAGTCCGCCTAGAAGCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Cell viability detection\u003c/h2\u003e \u003cp\u003eCell activity was evaluated by CCCK-8 determination (Biosharp, China, BS350A). Cells are inoculated on 96 orifice plates (1 \u0026times; 103 cells per hole) and cultured for 24 hours incubators containing 10% fetal bovine serum incubators of 37\u0026deg;C and 5% CO2. After the cell was attached to the wall, the Palmitic Acid (PA) group intervened with 20% PA for 24 hours, the semaglutide group intervened with 20% for 24 hours, and then 200nmmol/L. The cell is then hatched with the CCK-8 solution for 2 hours. The absorption at 450nm is measured by Synergy HT multi-mode microporous plate (BioTek, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 IF\u003c/h2\u003e \u003cp\u003eIn order to detect the expression of HSDL2, cells were inoculated into confocal dishes and cultured for 24 hours at 37\u0026deg;C and 5% CO2 with an RPMI 1640 medium containing 10% bovine serum. After knocking out HSDL2, the Si group intervened with 20% palmitic acid for 24 hours, the PA group with 20% PA intervention for 24 hours, the semaglutide group with 20% intervention for 24 hours, and 200nmmol/L semaglutide intervention for 24 hours. Cells are fixed with 4% polyformaldehyde, transparent, and closed by 1% bovine Serum Protein (BSA). The sample is incubated overnight with an anti-HSDL2 (1:500), and then the fluorescent rabbit-resistant IgG combined with 486 is incubated at room temperature for 1.5 hours. The nucleus was stained with hoechst and imaged under a laser confocal microscope (observer Z1, Zeisss, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Enzyme-linked immunosorbent assay\u003c/h2\u003e \u003cp\u003eThe corresponding ELISA kit (Esebio, Shanghai, China) was used to detect interleukin (IL)-6 and tumor necrosis factor (TNF)-α levels in mice. Each group of cell supernatant was added to the pores and reacted with the detected antibody labeled by horseradish peroxidase (HRP), and inocchered at 37℃ for 60 min. Remove the liquid and clean the orifice plate. Add color developer A and color developer B, 37℃ to avoid light and inhale for 10min, and add 50\u0026micro;L of reaction termination solution per hole to determine the absorbance (OD) value of each hole at 450nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13 Measurement of ROS production\u003c/h2\u003e \u003cp\u003eUse fluorescent probe dichlorodihydrofluorofluoroin diacetate (DCFH-DA, Zomanbio, China) to detect the ROS level. According to the manufacturer's instructions, add 10\u0026micro;M DCFHDA to each group after processing. Cell incubation for 30min, washing with DMEM 3 times, and laser confocal (BD Biosciences, USA) to detect the fluorescence intensity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.14 Assessment of MDA\u003c/h2\u003e \u003cp\u003eIn order to detect the level of propylene aldehyde, the treated cells are mixed and incubated with 300\u0026micro;L of MDA working solution containing thiobarbituric acid (TBA) for 60 minutes, and then centrifuge to remove the supernatant, using Gene5 multifunctional enzyme labeler (Gene, USA) analyze.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.15 Cell apoptosis assay\u003c/h2\u003e \u003cp\u003eAccording to the reagent manufacturer's plan, Annexin V-FITC/propyl iodide (PI) cell apoptosis test kit (Elabscience (China)) is used for apoptosis detection according to the instructions. BD Biosciences (USA) was used to detect apoptosis and analyze at least 10,000 cells in the gated area. The results are expressed as a percentage of the total number of cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e2.16 Statistical processing\u003c/h2\u003e \u003cp\u003eThe average comparison of the two sets of data is tested by Student's t. Single-factor variance analysis is used to compare the data mean of three or more groups. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 is defined as a statistically significant difference between groups. All statistical analysis uses Graphpad 8.0 software for statistical analysis.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Changes in weight in three groups of mice\u003c/h2\u003e \u003cp\u003eAt first, the weight of the three groups of mice was not different. However, after a 14-week high-fat diet, the weight of HF mice increased significantly compared with that in the NC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating that the obesity model was successfully established. After the semaglutide drug intervention of 8W, the weight of the Sema group decreased significantly compared with the HF group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). From the 18th week, the weight of the Sema and NC groups was basically the same (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). It illustrates the weight changes of mice after high-fat diet and smegroupide treatment. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e describes a line chart of weight changes in three groups of mice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Changes in blood sugar and blood lipids in three groups of mice\u003c/h2\u003e \u003cp\u003eTC, HDL-C, LDL-C, FBG and OGTT of three groups of mice were determined to evaluate the changes in blood lipids and blood sugar and the regulation of glycolipid disorders by smeglupeptide in obese mice. The serum TC, HDL-C, LDL-C and FBG levels of the mice in the HF group were significantly higher than those of the mice in the NC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and the average blood lipids and FBG water in the Sema group decreased significantly (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The OGTT level of the HF group was also significantly higher than that of other groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The OGTT of the Sema group increased at 15 minutes and 30 minutes earlier than that of the NC group. After that, the level of the two groups is basically the same (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). At the same time, the insulin level of obese mice was higher than that of the smeglutide treatment group and the normal group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Compared with the HF group, the insulin level of the Sema group decreased more significantly than that of the NC group. (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.3 The effect of smeglupeptide on the level of inflammation and oxidative stress caused by obesity\u003c/h2\u003e \u003cp\u003eThe levels of TNF-α, MDA, IL-1β, T-SOD and adenosine in myocardial tissue of obese mice were significantly higher than those of normal mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), indicating that obesity can aggravate inflammation and oxidative stress of myocardial tissue. After treatment with smeglu peptide, the levels of TNF-α, IL-6, MDA, ROS, IL-1β, T-SOD and adenosine in myocardial tissue decreased, indicating that smeglu peptide can improve the inflammation and oxidative stress levels of myocardial tissue caused by obesity to a certain extent (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Effect of HSDL2 on myocardial cells in obese mice\u003c/h2\u003e \u003cp\u003eAfter transfection of HSDL2-siRNA, the morphology of mouse cardiomyocytes changed, and the transfected cells became wider than the NC group(Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). After transfection HSDL2-siRNA, Wb expression of HSDL2 showed a corresponding trend, HSDL2 expression increased in PA group, and PCR and IF results were consistent with Wb results (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). PA-induced high-fat environment increases ROS in myocardial cells, and HSDL2 knockout reduces the level of oxidative stress caused by PA (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In addition, PA will increase the autovoy of cardiomyocyte, while knockout HSDL2 can relieve cell autochy at a certain level (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Statistical processing\u003c/h2\u003e \u003cp\u003eThe myocardial cells in PA group showed obvious fat vacuoles and slow cell proliferation, while those in Sema group were reduced(Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).The levels of TNF-α, IL-6, MDA and ROS in the Sema group decreased significantly, and the difference was statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Sema can also increase cell activity and reduce apoptosis affected by PA (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). At the same time, the results of Wb and IF tests in the Sema group also showed that Sema can reduce cell autophagy caused by PA (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). For HSDL2, compared with the PA group, Sema reduces the protein expression of HSDL2 in cardiomyocytes, and the PCR results are consistent (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e,P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In addition, the immunohistochemistometry of mouse myocardial tissue to detect the expression of HSDL2 in the Sema group and PA group was consistent with the Wb expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn recent years, with the improvement of people's living standards, the number of obesity has increased, and the damage of obesity-related target organs, such as the heart, islet and kidney function, has posed a considerable threat to people's health.\u003csup\u003e20\u003c/sup\u003e According to many clinical and basic experiments, obesity damages the human body through a significant increase in lipid glucose levels, leading to metabolic disorders.\u003csup\u003e21\u003c/sup\u003e Research shows that in the model of obese mice caused by a high-fat diet, obesity increases the levels of TG, TC, LDL-C and fasting blood glucose in the blood. Elevated blood lipids and blood sugar levels, coupled with inflammatory states caused by obesity, will accelerate lipid oxidation, leading to atherosclerosis and cardiac function impairment.\u003csup\u003e22\u003c/sup\u003e At the same time, the increase in LDL-C and the decrease in HDL-C caused by obesity are related to oxidative stress, which will lead to a large amount of lipid oxidation, which further significantly increases the lipid peroxidation product.\u003csup\u003e23\u003c/sup\u003e The activation of a variety of oxidoreductases and the reduction of the activity of cellular antioxidant enzymes (including Cu-Zn SOD, hydroperoxidase and GPx) can induce an increase in lipid peroxide and reactive oxygen (ROS), thus damaging cells and tissues.\u003csup\u003e24, 25\u003c/sup\u003e In addition, obesity also leads to a significant increase in TNF-α and IL-6 levels in serum and cardiac tissue, indicating the presence of inflammation in the body. The increase in cardiac tissue ROS caused by obesity may lead to the production of toxic MDA. Increased lipid synthesis, inflammation and oxidative stress all contribute to lipid peroxidation to produce excessive MDA. MDA levels in cardiac tissue are related to mitochondrial activity, cell membrane damage and peroxidation damage. Changes in lipid and oxidative stress indicators can affect myocardial cell metabolism, thus affecting the progression of obesity-associated cardiomyopathy.\u003csup\u003e26, 27\u003c/sup\u003e In the early stage of obesity, cardiomyocyte hypertrophy and ventricular wall thickening can still produce sufficient compensatory function, but the occurrence of compensation loss will lead to irreversible serious cardiac function damage.\u003csup\u003e28, 29\u003c/sup\u003e In our previous studies, cardiac ultrasound in obese mice showed that the ventricular wall was thickened and the ventricular volume decreased, indicating centritropic hypertrophy.\u003csup\u003e30\u003c/sup\u003e In this study, we established a mouse model of the HF group and the Sema group, and also established a cell model of the PA group and the Sema group to better study the mechanism of myocardial damage caused by obesity and whether smeglutide can reduce the damage caused by high fat. The weight of the mice in the HF group increased compared with that of the mice in the Sema group, and the blood lipid levels such as TC, TG and LDL-C increased. The levels of TNF-α, IL-6, ROS and MDA in the serum of mice in the HF group also increased significantly. The expression results of the same PA group cell oxidative stress level are similar to those of the HF group. In addition, the morphology of the myocardial cells in the PA group has changed compared with that of the NC group. The cells in the PA group showed lipidrop formation and cell atrophy under a 20-fold electron microscope. At the same time, cell fragments formed by large-scale cell death can be seen. Using cck8 to measure cell vitality, the cell vitality of the PA group also decreased significantly. Cell autophagy and apoptosis of the PA group also increased significantly. This means that obesity increases the level of lipids and oxidative stress in the body, resulting in an increase in the production of lipid peroxide products, which leads to myocardial damage and myocardial disease.\u003c/p\u003e \u003cp\u003eHSDL2 is located on the human chromosome 9Q32, with a length of 92kd on the chromosome, with 11 exonons and 418 amino acids. HSDL2 belongs to the SDR family, which is a group of proteins that catalyze the oxidation and reduction of a variety of substrates, including steroid hormones, oxysterols, BASs, prostaglandins, vitamins a, fatty acids, amino acids, sugars, etc.\u003csup\u003e31\u003c/sup\u003e HSDL2 includes n-end SDR domain and c-end SCP2 domain. These two structural characteristics are involved in the redox reaction of nicotinamide adenine dinucleotide (oxidation form) (NAD)/NAD phosphate (NADP)-dependent and the binding of sterols and other lipids.\u003csup\u003e32, 33\u003c/sup\u003e HSDL2 can bind NADP/H, sterol derivatives and fatty acids, which is related to HSDL2's highly conservative NADP/H binding site and SCP2 domain, which is a structure that binds sterols and other lipids to promote its intermembraneal transport.\u003csup\u003e34, 35\u003c/sup\u003e In past studies, it has only been proposed that HSDL2 affects lipid metabolism, and the relationship between HSDL2 and high-lipid myocardium has not been further studied. This study found that in the immunohistochemistry of mouse myocardium, there were significantly more brown and yellow particles in the Sema group, that is, HSDL2 was highly expressed in the HF group, and the expression in the Sema group was reduced. At the same time, the Wb, PCR and IF results of the PA group of mouse cardiomyocytes and Sema group were consistent with this. That is, high fat does improve the expression of HSDL2 in the myocardium, and smegropeptide can reduce this expression. We performed HSDL2 knockout to determine whether HSDL2 is one of the mechanisms for high fat to cause changes in myocardial function. After knockout of HSDL2, according to the autophagy of IF and ROS results, the expression inhibition of HSDL2 improves the autophagy and oxidative stress levels of high-fat-induced cardiomyocytes. According to the above findings, HSDL2 seems to be one of the mechanisms of myocardial injury.\u003c/p\u003e \u003cp\u003eSmeglutide is a sugar-lowering drug belonging to GLP-1R. A large number of tests have proved that it has a hypoglycemic and weight-reducing effect.\u003csup\u003e36\u003c/sup\u003e In recent years, the weight loss effect of smegropeptide has been widely studied clinically. This drug can reduce basic weight by 20\u0026ndash;30% with few side effects.\u003csup\u003e37, 38\u003c/sup\u003e At the same time, smegroupide has also been shown to reduce the risk of cardiovascular events in patients with type 2 diabetes and have a cardiac protective effect on patients who are overweight or obese but have no diabetes.\u003csup\u003e39, 40\u003c/sup\u003e According to our previous research, Smegrutin can reduce the negative effects of obesity on the heart and change the expression of many proteins involved in Lipid metabolism in heart tissue.\u003csup\u003e30\u003c/sup\u003e This study found that smeglutide can reduce the weight and blood lipid levels of mice in the HF group, and at the same time reduce the level of oxidative stress indicators such as lipids, TNF-α, IL-6, ROS and MDA in serum and myocardial cells of mice in the HF group and PA group. Although smeglutide cannot change the cell morphology caused by the PA group, microscopic observation found that a wide range of cell death stopped. When measuring cell activity, it was found that the cell activity of the Sema group was higher than that of the PA group. At the same time, the cell autophagy level and apoptosis level of the Sema group decreased significantly compared with the PA group. The results show that smeglutide may reduce the state of myocardial inflammatory injury caused by high fat and restore myocardial vitality. By looking for the expression of HSDL2 in high-fat myocardium above, it was found that smeglutide significantly reduced the expression of HSDL2 in high-fat myocardium. According to the above findings, HSDL2 may be one of the mechanisms that cause myocardial injury, and smeglutide seems to protect the myocardium by regulating the expression of HSDL2.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eOur study shows that obesity can lead to oxidative stress, inflammatory reactions and cell autosage, apoptosis in cardiomyocyte cells. Expression inhibition of HSDL2 can reduce the levels of autophage and oxidative stress in myocardial cells. Semaglutide can reduce cell damage caused by obesity while also reducing the high level of HSDL2 expression caused by obesity. It provides new ideas for GLP-1 receptor agonists as a target therapy for regulating the treatment and prognosis of myocardial injury caused by obesity, and also provides a new potential target for clinical control of obesity-related myocardial injury.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experimental procedures and animal management procedures were approved by the Ethics Committee of Hebei General Hospital (Approval Number: 2023-32; Date of approval: Jun 14, 2023).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Hebei Province Natural Science Foundation (H2022307026). The funding bodies played no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthorship contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLin Yang:\u003c/strong\u003e\u0026nbsp; Conceptualization, Investigation, Formal analysis, Project administration, Writing \u0026ndash; original draft.\u003cstrong\u003e\u0026nbsp;Xiaoyu Pan:\u0026nbsp;\u003c/strong\u003eConceptualization, Project administration, Writing \u0026ndash; review \u0026amp; editing, Funding acquisition. \u003cstrong\u003eZhenyu Pan:\u003c/strong\u003e Resources, Investigation. \u003cstrong\u003eHaina Gao:\u003c/strong\u003e Investigation. \u003cstrong\u003eJiangli Ban:\u003c/strong\u003e Resources. \u003cstrong\u003eShuchun Chen:\u003c/strong\u003e Conceptualization, Funding acquisition, Supervision, Project administration, Writing \u0026ndash; review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData available on request from the authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone of the authors have a conflicts of interest\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003ePan, X.; Chen, S.; Chen, X.; Ren, Q.; Yue, L.; Niu, S.; Li, Z.; Zhu, R.; Chen, X.; Jia, Z.; Zhen, R.; Ban, J., Effect of high-fat diet and empagliflozin on cardiac proteins in mice. \u003cem\u003eNutr Metab (Lond) \u003c/em\u003e\u003cstrong\u003e2022,\u003c/strong\u003e \u003cem\u003e19\u003c/em\u003e (1), 69.\u003c/li\u003e\n\u003cli\u003eRosengren, A., Obesity and cardiovascular health: the size of the problem. \u003cem\u003eEur Heart J \u003c/em\u003e\u003cstrong\u003e2021,\u003c/strong\u003e \u003cem\u003e42\u003c/em\u003e (34), 3404-3406.\u003c/li\u003e\n\u003cli\u003eMa, L.; Ma, S.; He, H.; Yang, D.; Chen, X.; Luo, Z.; Liu, D.; Zhu, Z., Perivascular fat-mediated vascular dysfunction and remodeling through the AMPK/mTOR pathway in high-fat diet-induced obese rats. \u003cem\u003eHypertens Res \u003c/em\u003e\u003cstrong\u003e2010,\u003c/strong\u003e \u003cem\u003e33\u003c/em\u003e (5), 446-53.\u003c/li\u003e\n\u003cli\u003eIonică, L. N.; Gaiță, L.; B\u0026icirc;nă, A. M.; Soșdean, R.; Lighezan, R.; Sima, A.; Malița, D.; Crețu, O. M.; Burlacu, O.; Muntean, D. M.; Sturza, A., Metformin alleviates monoamine oxidase-related vascular oxidative stress and endothelial dysfunction in rats with diet-induced obesity. \u003cem\u003eMol Cell Biochem \u003c/em\u003e\u003cstrong\u003e2021,\u003c/strong\u003e \u003cem\u003e476\u003c/em\u003e (11), 4019-4029.\u003c/li\u003e\n\u003cli\u003eKowalik, D.; Haller, F.; Adamski, J.; Moeller, G., In search for function of two human orphan SDR enzymes: hydroxysteroid dehydrogenase like 2 (HSDL2) and short-chain dehydrogenase/reductase-orphan (SDR-O). \u003cem\u003eJ Steroid Biochem Mol Biol \u003c/em\u003e\u003cstrong\u003e2009,\u003c/strong\u003e \u003cem\u003e117\u003c/em\u003e (4-5), 117-24.\u003c/li\u003e\n\u003cli\u003eDai, J.; Xie, Y.; Wu, Q.; Wang, L.; Yin, G.; Ye, X.; Zeng, L.; Xu, J.; Ji, C.; Gu, S.; Huang, Q.; Zhao, R. C.; Mao, Y., Molecular cloning and characterization of a novel human hydroxysteroid dehydrogenase-like 2 (HSDL2) cDNA from fetal brain. \u003cem\u003eBiochem Genet \u003c/em\u003e\u003cstrong\u003e2003,\u003c/strong\u003e \u003cem\u003e41\u003c/em\u003e (5-6), 165-74.\u003c/li\u003e\n\u003cli\u003eYang, Y.; Han, A.; Wang, X.; Yin, X.; Cui, M.; Lin, Z., Lipid metabolism regulator human hydroxysteroid dehydrogenase-like 2 (HSDL2) modulates cervical cancer cell proliferation and metastasis. \u003cem\u003eJ Cell Mol Med \u003c/em\u003e\u003cstrong\u003e2021,\u003c/strong\u003e \u003cem\u003e25\u003c/em\u003e (10), 4846-4859.\u003c/li\u003e\n\u003cli\u003eHan, A.; Xu, R.; Liu, Y.; Yin, X.; Lin, Z.; Yang, W., HSDL2 Acts as a Promoter in Pancreatic Cancer by Regulating Cell Proliferation and Lipid Metabolism. \u003cem\u003eOnco Targets Ther \u003c/em\u003e\u003cstrong\u003e2021,\u003c/strong\u003e \u003cem\u003e14\u003c/em\u003e, 435-444.\u003c/li\u003e\n\u003cli\u003eCheng, Z.; Li, Y.; Sui, C.; Sun, X.; Xie, Y., Synthesis, purification and crystallographic studies of the C-terminal sterol carrier protein type 2 (SCP-2) domain of human hydroxysteroid dehydrogenase-like protein 2. \u003cem\u003eActa Crystallogr F Struct Biol Commun \u003c/em\u003e\u003cstrong\u003e2015,\u003c/strong\u003e \u003cem\u003e71\u003c/em\u003e (Pt 7), 901-5.\u003c/li\u003e\n\u003cli\u003eGronemeyer, T.; Wiese, S.; Ofman, R.; Bunse, C.; Pawlas, M.; Hayen, H.; Eisenacher, M.; Stephan, C.; Meyer, H. E.; Waterham, H. R.; Erdmann, R.; Wanders, R. J.; Warscheid, B., The proteome of human liver peroxisomes: identification of five new peroxisomal constituents by a label-free quantitative proteomics survey. \u003cem\u003ePLoS One \u003c/em\u003e\u003cstrong\u003e2013,\u003c/strong\u003e \u003cem\u003e8\u003c/em\u003e (2), e57395.\u003c/li\u003e\n\u003cli\u003eShang, C.; Wang, W.; Liao, Y.; Chen, Y.; Liu, T.; Du, Q.; Huang, J.; Liang, Y.; Liu, J.; Zhao, Y.; Guo, L.; Hu, Z.; Yao, S., LNMICC Promotes Nodal Metastasis of Cervical Cancer by Reprogramming Fatty Acid Metabolism. \u003cem\u003eCancer Res \u003c/em\u003e\u003cstrong\u003e2018,\u003c/strong\u003e \u003cem\u003e78\u003c/em\u003e (4), 877-890.\u003c/li\u003e\n\u003cli\u003eKim, M. S.; Kim, W. J.; Khera, A. V.; Kim, J. Y.; Yon, D. K.; Lee, S. W.; Shin, J. I.; Won, H. H., Association between adiposity and cardiovascular outcomes: an umbrella review and meta-analysis of observational and Mendelian randomization studies. \u003cem\u003eEur Heart J \u003c/em\u003e\u003cstrong\u003e2021,\u003c/strong\u003e \u003cem\u003e42\u003c/em\u003e (34), 3388-3403.\u003c/li\u003e\n\u003cli\u003ePan, X.; Zhang, X.; Ban, J.; Yue, L.; Ren, L.; Chen, S., Effects of High-Fat Diet on Cardiovascular Protein Expression in Mice Based on Proteomics. \u003cem\u003eDiabetes Metab Syndr Obes \u003c/em\u003e\u003cstrong\u003e2023,\u003c/strong\u003e \u003cem\u003e16\u003c/em\u003e, 873-882.\u003c/li\u003e\n\u003cli\u003eZhang, D. Y.; Liu, Z.; Lu, Z.; Sun, W. L.; Ma, X.; Zhang, P.; Wu, B. Q.; Cui, P. Y., Lentivirus-mediated overexpression of HSDL2 suppresses cell proliferation and induces apoptosis in cholangiocarcinoma. \u003cem\u003eOnco Targets Ther \u003c/em\u003e\u003cstrong\u003e2018,\u003c/strong\u003e \u003cem\u003e11\u003c/em\u003e, 7133-7142.\u003c/li\u003e\n\u003cli\u003eSun, Q.; Zhang, Y.; Su, J.; Li, T.; Jiang, Y., Role of Hydroxysteroid Dehydrogenase-Like 2 (HSDL2) in Human Ovarian Cancer. \u003cem\u003eMed Sci Monit \u003c/em\u003e\u003cstrong\u003e2018,\u003c/strong\u003e \u003cem\u003e24\u003c/em\u003e, 3997-4008.\u003c/li\u003e\n\u003cli\u003eDixon, S. J.; Lemberg, K. M.; Lamprecht, M. R.; Skouta, R.; Zaitsev, E. M.; Gleason, C. E.; Patel, D. N.; Bauer, A. J.; Cantley, A. M.; Yang, W. S.; Morrison, B., 3rd; Stockwell, B. R., Ferroptosis: an iron-dependent form of nonapoptotic cell death. \u003cem\u003eCell \u003c/em\u003e\u003cstrong\u003e2012,\u003c/strong\u003e \u003cem\u003e149\u003c/em\u003e (5), 1060-72.\u003c/li\u003e\n\u003cli\u003eStockwell, B. R.; Friedmann Angeli, J. P.; Bayir, H.; Bush, A. I.; Conrad, M.; Dixon, S. J.; Fulda, S.; Gasc\u0026oacute;n, S.; Hatzios, S. K.; Kagan, V. E.; Noel, K.; Jiang, X.; Linkermann, A.; Murphy, M. E.; Overholtzer, M.; Oyagi, A.; Pagnussat, G. C.; Park, J.; Ran, Q.; Rosenfeld, C. S.; Salnikow, K.; Tang, D.; Torti, F. M.; Torti, S. V.; Toyokuni, S.; Woerpel, K. A.; Zhang, D. D., Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. \u003cem\u003eCell \u003c/em\u003e\u003cstrong\u003e2017,\u003c/strong\u003e \u003cem\u003e171\u003c/em\u003e (2), 273-285.\u003c/li\u003e\n\u003cli\u003eTang, D.; Chen, X.; Kang, R.; Kroemer, G., Ferroptosis: molecular mechanisms and health implications. \u003cem\u003eCell Res \u003c/em\u003e\u003cstrong\u003e2021,\u003c/strong\u003e \u003cem\u003e31\u003c/em\u003e (2), 107-125.\u003c/li\u003e\n\u003cli\u003eMa, S.; Ma, Y.; Qi, F.; Lei, J.; Chen, F.; Sun, W.; Wang, D.; Zhou, S.; Liu, Z.; Lu, Z.; Zhang, D., HSDL2 knockdown promotes the progression of cholangiocarcinoma by inhibiting ferroptosis through the P53/SLC7A11 axis. \u003cem\u003eWorld J Surg Oncol \u003c/em\u003e\u003cstrong\u003e2023,\u003c/strong\u003e \u003cem\u003e21\u003c/em\u003e (1), 293.\u003c/li\u003e\n\u003cli\u003eBunbupha, S.; Apaijit, K.; Maneesai, P.; Prasarttong, P.; Pakdeechote, P., Nobiletin ameliorates high-fat diet-induced vascular and renal changes by reducing inflammation with modulating AdipoR1 and TGF-\u0026beta;1 expression in rats. \u003cem\u003eLife Sci \u003c/em\u003e\u003cstrong\u003e2020,\u003c/strong\u003e \u003cem\u003e260\u003c/em\u003e, 118398.\u003c/li\u003e\n\u003cli\u003eO\u0026apos;Neil, P. M.; Birkenfeld, A. L.; McGowan, B.; Mosenzon, O.; Pedersen, S. D.; Wharton, S.; Carson, C. G.; Jepsen, C. H.; Kabisch, M.; Wilding, J. P. H., Efficacy and safety of semaglutide compared with liraglutide and placebo for weight loss in patients with obesity: a randomised, double-blind, placebo and active controlled, dose-ranging, phase 2 trial. \u003cem\u003eLancet \u003c/em\u003e\u003cstrong\u003e2018,\u003c/strong\u003e \u003cem\u003e392\u003c/em\u003e (10148), 637-649.\u003c/li\u003e\n\u003cli\u003ePich\u0026eacute;, M. E.; Tchernof, A.; Despr\u0026eacute;s, J. P., Obesity Phenotypes, Diabetes, and Cardiovascular Diseases. \u003cem\u003eCirc Res \u003c/em\u003e\u003cstrong\u003e2020,\u003c/strong\u003e \u003cem\u003e126\u003c/em\u003e (11), 1477-1500.\u003c/li\u003e\n\u003cli\u003eCafe, S. L.; Nixon, B.; Dun, M. D.; Roman, S. D.; Bernstein, I. R.; Bromfield, E. G., Oxidative Stress Dysregulates Protein Homeostasis Within the Male Germ Line. \u003cem\u003eAntioxid Redox Signal \u003c/em\u003e\u003cstrong\u003e2020,\u003c/strong\u003e \u003cem\u003e32\u003c/em\u003e (8), 487-503.\u003c/li\u003e\n\u003cli\u003eRani, V.; Deep, G.; Singh, R. K.; Palle, K.; Yadav, U. C., Oxidative stress and metabolic disorders: Pathogenesis and therapeutic strategies. \u003cem\u003eLife Sci \u003c/em\u003e\u003cstrong\u003e2016,\u003c/strong\u003e \u003cem\u003e148\u003c/em\u003e, 183-93.\u003c/li\u003e\n\u003cli\u003eHolvoet, P.; Kritchevsky, S. B.; Tracy, R. P.; Mertens, A.; Rubin, S. M.; Butler, J.; Goodpaster, B.; Harris, T. B., The metabolic syndrome, circulating oxidized LDL, and risk of myocardial infarction in well-functioning elderly people in the health, aging, and body composition cohort. \u003cem\u003eDiabetes \u003c/em\u003e\u003cstrong\u003e2004,\u003c/strong\u003e \u003cem\u003e53\u003c/em\u003e (4), 1068-73.\u003c/li\u003e\n\u003cli\u003eKolijn, D.; Pabel, S.; Tian, Y.; L\u0026oacute;di, M.; Herwig, M.; Carrizzo, A.; Zhazykbayeva, S.; Kov\u0026aacute;cs, \u0026Aacute;.; F\u0026uuml;l\u0026ouml;p, G.; Falc\u0026atilde;o-Pires, I.; Reusch, P. H.; Linthout, S. V.; Papp, Z.; van Heerebeek, L.; Vecchione, C.; Maier, L. S.; Ciccarelli, M.; Tsch\u0026ouml;pe, C.; M\u0026uuml;gge, A.; Bagi, Z.; Sossalla, S.; Hamdani, N., Empagliflozin improves endothelial and cardiomyocyte function in human heart failure with preserved ejection fraction via reduced pro-inflammatory-oxidative pathways and protein kinase G\u0026alpha; oxidation. \u003cem\u003eCardiovasc Res \u003c/em\u003e\u003cstrong\u003e2021,\u003c/strong\u003e \u003cem\u003e117\u003c/em\u003e (2), 495-507.\u003c/li\u003e\n\u003cli\u003eWatanabe, K.; Nagao, M.; Toh, R.; Irino, Y.; Shinohara, M.; Iino, T.; Yoshikawa, S.; Tanaka, H.; Satomi-Kobayashi, S.; Ishida, T.; Hirata, K. I., Critical role of glutamine metabolism in cardiomyocytes under oxidative stress. \u003cem\u003eBiochem Biophys Res Commun \u003c/em\u003e\u003cstrong\u003e2021,\u003c/strong\u003e \u003cem\u003e534\u003c/em\u003e, 687-693.\u003c/li\u003e\n\u003cli\u003eAlpert, M. A.; Omran, J.; Bostick, B. P., Effects of Obesity on Cardiovascular Hemodynamics, Cardiac Morphology, and Ventricular Function. \u003cem\u003eCurr Obes Rep \u003c/em\u003e\u003cstrong\u003e2016,\u003c/strong\u003e \u003cem\u003e5\u003c/em\u003e (4), 424-434.\u003c/li\u003e\n\u003cli\u003eHarada, T.; Obokata, M., Obesity-Related Heart Failure with Preserved Ejection Fraction: Pathophysiology, Diagnosis, and Potential Therapies. \u003cem\u003eHeart Fail Clin \u003c/em\u003e\u003cstrong\u003e2020,\u003c/strong\u003e \u003cem\u003e16\u003c/em\u003e (3), 357-368.\u003c/li\u003e\n\u003cli\u003ePan, X.; Yue, L.; Ban, J.; Ren, L.; Chen, S., Effects of Semaglutide on Cardiac Protein Expression and Cardiac Function of Obese Mice. \u003cem\u003eJ Inflamm Res \u003c/em\u003e\u003cstrong\u003e2022,\u003c/strong\u003e \u003cem\u003e15\u003c/em\u003e, 6409-6425.\u003c/li\u003e\n\u003cli\u003eKavanagh, K. L.; J\u0026ouml;rnvall, H.; Persson, B.; Oppermann, U., Medium- and short-chain dehydrogenase/reductase gene and protein families : the SDR superfamily: functional and structural diversity within a family of metabolic and regulatory enzymes. \u003cem\u003eCell Mol Life Sci \u003c/em\u003e\u003cstrong\u003e2008,\u003c/strong\u003e \u003cem\u003e65\u003c/em\u003e (24), 3895-906.\u003c/li\u003e\n\u003cli\u003ePersson, B.; Kallberg, Y.; Bray, J. E.; Bruford, E.; Dellaporta, S. L.; Favia, A. D.; Duarte, R. G.; J\u0026ouml;rnvall, H.; Kavanagh, K. L.; Kedishvili, N.; Kisiela, M.; Maser, E.; Mindnich, R.; Orchard, S.; Penning, T. M.; Thornton, J. M.; Adamski, J.; Oppermann, U., The SDR (short-chain dehydrogenase/reductase and related enzymes) nomenclature initiative. \u003cem\u003eChem Biol Interact \u003c/em\u003e\u003cstrong\u003e2009,\u003c/strong\u003e \u003cem\u003e178\u003c/em\u003e (1-3), 94-8.\u003c/li\u003e\n\u003cli\u003eChiapparino, A.; Maeda, K.; Turei, D.; Saez-Rodriguez, J.; Gavin, A. C., The orchestra of lipid-transfer proteins at the crossroads between metabolism and signaling. \u003cem\u003eProg Lipid Res \u003c/em\u003e\u003cstrong\u003e2016,\u003c/strong\u003e \u003cem\u003e61\u003c/em\u003e, 30-9.\u003c/li\u003e\n\u003cli\u003eBhatia, C.; Oerum, S.; Bray, J.; Kavanagh, K. L.; Shafqat, N.; Yue, W.; Oppermann, U., Towards a systematic analysis of human short-chain dehydrogenases/reductases (SDR): Ligand identification and structure-activity relationships. \u003cem\u003eChem Biol Interact \u003c/em\u003e\u003cstrong\u003e2015,\u003c/strong\u003e \u003cem\u003e234\u003c/em\u003e, 114-25.\u003c/li\u003e\n\u003cli\u003eBurgardt, N. I.; Gianotti, A. R.; Ferreyra, R. G.; Erm\u0026aacute;cora, M. R., A structural appraisal of sterol carrier protein 2. \u003cem\u003eBiochim Biophys Acta Proteins Proteom \u003c/em\u003e\u003cstrong\u003e2017,\u003c/strong\u003e \u003cem\u003e1865\u003c/em\u003e (5), 565-577.\u003c/li\u003e\n\u003cli\u003eRyan, D. H.; Lingvay, I.; Colhoun, H. M.; Deanfield, J.; Emerson, S. S.; Kahn, S. E.; Kushner, R. F.; Marso, S.; Plutzky, J.; Brown-Frandsen, K.; Gronning, M. O. L.; Hovingh, G. K.; Holst, A. G.; Ravn, H.; Lincoff, A. M., Semaglutide Effects on Cardiovascular Outcomes in People With Overweight or Obesity (SELECT) rationale and design. \u003cem\u003eAm Heart J \u003c/em\u003e\u003cstrong\u003e2020,\u003c/strong\u003e \u003cem\u003e229\u003c/em\u003e, 61-69.\u003c/li\u003e\n\u003cli\u003eAroda, V. R.; Ahmann, A.; Cariou, B.; Chow, F.; Davies, M. J.; J\u0026oacute;dar, E.; Mehta, R.; Woo, V.; Lingvay, I., Comparative efficacy, safety, and cardiovascular outcomes with once-weekly subcutaneous semaglutide in the treatment of type 2 diabetes: Insights from the SUSTAIN 1-7 trials. \u003cem\u003eDiabetes Metab \u003c/em\u003e\u003cstrong\u003e2019,\u003c/strong\u003e \u003cem\u003e45\u003c/em\u003e (5), 409-418.\u003c/li\u003e\n\u003cli\u003eThethi, T. K.; Pratley, R.; Meier, J. J., Efficacy, safety and cardiovascular outcomes of once-daily oral semaglutide in patients with type 2 diabetes: The PIONEER programme. \u003cem\u003eDiabetes Obes Metab \u003c/em\u003e\u003cstrong\u003e2020,\u003c/strong\u003e \u003cem\u003e22\u003c/em\u003e (8), 1263-1277.\u003c/li\u003e\n\u003cli\u003eHusain, M.; Birkenfeld, A. L.; Donsmark, M.; Dungan, K.; Eliaschewitz, F. G.; Franco, D. R.; Jeppesen, O. K.; Lingvay, I.; Mosenzon, O.; Pedersen, S. D.; Tack, C. J.; Thomsen, M.; Vilsb\u0026oslash;ll, T.; Warren, M. L.; Bain, S. C., Oral Semaglutide and Cardiovascular Outcomes in Patients with Type 2 Diabetes. \u003cem\u003eN Engl J Med \u003c/em\u003e\u003cstrong\u003e2019,\u003c/strong\u003e \u003cem\u003e381\u003c/em\u003e (9), 841-851.\u003c/li\u003e\n\u003cli\u003eBain, S. C.; Mosenzon, O.; Arechavaleta, R.; Bogdański, P.; Comlekci, A.; Consoli, A.; Deerochanawong, C.; Dungan, K.; Faingold, M. C.; Farkouh, M. E.; Franco, D. R.; Gram, J.; Guja, C.; Joshi, P.; Malek, R.; Merino-Torres, J. F.; Nauck, M. A.; Pedersen, S. D.; Sheu, W. H.; Silver, R. J.; Tack, C. J.; Tandon, N.; Jeppesen, O. K.; Strange, M.; Thomsen, M.; Husain, M., Cardiovascular safety of oral semaglutide in patients with type 2 diabetes: Rationale, design and patient baseline characteristics for the PIONEER 6 trial. \u003cem\u003eDiabetes Obes Metab \u003c/em\u003e\u003cstrong\u003e2019,\u003c/strong\u003e \u003cem\u003e21\u003c/em\u003e (3), 499-508.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Obesity, inflammation, oxidative stress, semaglutide, HSDL2","lastPublishedDoi":"10.21203/rs.3.rs-5269858/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5269858/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eThe expression of inflammation and oxidative stress caused by obesity is high, which has a certain degree of damage to myocardial cells. is a glucagon-like peptide-1 receptor agonist, which has a hypoglycemic and weight loss effect. Similarly, hydroxysteroid dehydrogenase-like protein 2 (HSDL2) can also regulate lipid metabolism. However, it is not clear whether smegroupide reduces obesity-related cardiomyocyte damage through HSDL2. In this study, the oxidative stress index of the serum of mouse cardiomyocytes and obese mice in a high-fat environment and the expression of HSDL2 were detected to reveal the mechanism of obesity-induced cardiomyocyte injury and the effect of semaglutide in reducing cardiomyocyte injury regulated by HSDL2.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eIn this study, animal models of mice in the obesity group and the micetigrupide intervention group, the cardiomyocyte model of palmitic acid cultured mice in ordinary and knockout HSDL2, and the cell model of the miceglupeptide intervention were established. The levels of inflammatory and oxidative stress indicators such as tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), reactive oxygen (ROS) and malondialdehyde (MDA) in mouse serum and mouse cardiomyocytes were also detected. Then, the expression of HSDL2 of normal mouse cardiomyocytes cultured with high fat culture and mouse cardiomyocytes that knocked HSDL2, as well as the oxidative stress and autophagy levels of cells, were measured, and the effect of semaglutide regulation by HSDL2 on cardiomyocyte damage caused by high fat was evaluated.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eObesity increased the oxidative stress level of mouse cardiomyocytes and mouse serum, while semaglutide can reduce the increased oxidative stress level caused by obesity. At the same time, semaglutide also significantly reduced the weight of obese mice. The myocardial tissue and myocardial cells of mice in the obese group showed an upward expression of HSDL2, but after the intervention of semaglutide. After knocking out HSDL2, the level of ROS and autophagy of mouse cardiomyocytes decreased significantly. Semaglutide may reduce cardiomyocyte damage caused by high fat by regulating the expression of HSDL2. These findings are expected to reveal the new molecular mechanism of semaglutide to regulate obesity-related cardiomyocyte injury through HSDL2, providing a new target for clinical treatment.\u003c/p\u003e","manuscriptTitle":"Semaglutide reduces cardiomyocyte damage caused by high-fat through HSDL2","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-18 10:44:42","doi":"10.21203/rs.3.rs-5269858/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"aa53ebc0-0e5a-4ef3-a3c5-de383075c5a6","owner":[],"postedDate":"October 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-11-08T06:08:36+00:00","versionOfRecord":[],"versionCreatedAt":"2024-10-18 10:44:42","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5269858","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5269858","identity":"rs-5269858","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00